Antisense oligonucleotide

Antisense oligonucleotides targeting duplications in the UBE3A pre-mRNA transcript effectively reduce its levels in cells, addressing the overexpression associated with Dup15q syndrome and potentially alleviating related symptoms.

WO2025132962A2PCT designated stage expired Publication Date: 2025-06-26F HOFFMANN LA ROCHE & CO AG +1
View PDF 18 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2024/087664
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-21
Filing Date
2024-12-19
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

There is a need for therapeutics that can effectively reduce the overexpression of the UBE3A pre-mRNA transcript, which is associated with Dup15q syndrome, a genetic disorder causing autism spectrum disorder, intellectual disability, and epilepsy.

Method used

The use of antisense oligonucleotides that are 8 to 40 nucleotides in length and comprise a contiguous nucleotide sequence complementary to a region of the UBE3A pre-mRNA transcript, specifically targeting duplications within the transcript to reduce its levels in target cells.

Benefits of technology

These antisense oligonucleotides are surprisingly effective in reducing the level of the UBE3A pre-mRNA transcript by at least 40% to 80% in cells, potentially alleviating symptoms associated with Dup15q syndrome such as seizures, hypotonia, and motor delays.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000019_0001
    Figure IMGF000019_0001
  • Figure IMGF000028_0001
    Figure IMGF000028_0001
  • Figure IMGF000029_0001
    Figure IMGF000029_0001
Patent Text Reader

Abstract

The present invention relates to an antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of at least 8 nucleotides in length which is complementary to a region of a UBE3A pre-mRNA transcript, wherein the UBE3A pre-mRNA transcript comprises a duplication of at least 8 nucleotides and the contiguous nucleotide sequence is complementary to at least 8 nucleotides in each duplication.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] ANTISENSE OLIGONUCLEOTIDE

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to antisense oligonucleotides which target the UBE3A pre-mRNA transcript, and their use in methods for reducing the level of UBE3A pre-mRNA transcript in a target cell. Such antisense oligonucleotides may be used in the treatment of diseases associated with increased levels of UBE3A pre-mRNA transcripts, in particular Dup15q syndrome.

[0004] BACKGROUND TO THE INVENTION

[0005] One of the most common genetic causes of autism spectrum disorder (ASD) is the duplication of chromosome 15q11.2-q13.1 (Dup15q syndrome). Dup15q syndrome is characterized by hypotonia, motor delays, intellectual disability (ID), ASD, and epilepsy including infantile spasm.

[0006] Dup15q syndrome is caused by partial duplication of the proximal long arm of chromosome 15. These duplications most commonly occur in one of two forms, isodicentric chromosome 15 (idic(15)) and interstitial 15q duplication. Patients with a isodicentric chromosome 15q are typically more severely affected than those with an interstitial duplication. Genes in the 15q11.2-13.1 region that are thought to play crucial roles in the etiology of Dup15q syndrome include TP10A, CYFIP1 , MAGEL2, NECDIN, SNRPN, snoRNAs, the cluster of genes encoding GABAA receptor subunits and UBE3A.

[0007] UBE3A is an imprinted gene maternally expressed in brain and biallelically expressed in other tissues. UBE3A encodes the E3 ligase E6-associated protein (E6AP), a ubiquitin-protein ligase that is involved in targeting proteins for degradation and plays an important role in synapse function. Alternative splicing of UBE3A results in three transcript variants encoding three isoforms with different N-termini. Deficient expression or function of the maternal UBE3A gene results in Angelman syndrome. However, it is thought that increased protein expression as a result of increased copy number of UBE3A may be linked to severity of the disease phenotype in Dup15q syndrome.

[0008] There is thus a need for therapeutics to knockdown overexpression of UBE3A, and which may be useful in the treatment of seizures, hypotonia, motor delays, ID and ASD in subjects affected by Dup15q syndrome.

[0009] SUMMARY OF THE INVENTION

[0010] The present invention relates to antisense oligonucleotides targeting the UBE3A pre-mRNA transcript that are surprisingly effective at reducing the level of the UBE3A pre-mRNA transcript in a cell. In particular, the inventors have determined that the effect can be increased using antisense oligonucleotides that target duplications in the pre-mRNA transcript.

[0011] The present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of at least 8 nucleotides in length which is complementary to a region of a LIBE3A pre-mRNA transcript, wherein the LIBE3A pre-mRNA transcript comprises a duplication of at least 8 nucleotides and the contiguous nucleotide sequence is complementary to at least 8 nucleotides in each duplication.

[0012] In some embodiments, the LIBE3A pre-mRNA transcript comprises a duplication of at least one nucleobase sequence selected from SEQ ID NO 211 , SEQ ID NO 212, SEQ ID NO 213, SEQ ID NO 214, SEQ ID NO 215, SEQ ID NO 216, and SEQ ID NO 217.

[0013] Preferably, the LIBE3A pre-mRNA transcript comprises a duplication of at least one nucleobase sequence selected from SEQ ID NO 214, SEQ ID NO 215 and SEQ ID NO 216.

[0014] The LIBE3A pre-mRNA transcript may comprise a duplication of the nucleobase sequence of SEQ ID NO 211. The LIBE3A pre-mRNA transcript may comprise a duplication of the nucleobase sequence of SEQ ID NO 212. The LIBE3A pre-mRNA transcript may comprise a duplication of the nucleobase sequence of SEQ ID NO 213. The LIBE3A pre-mRNA transcript may comprise a duplication of the nucleobase sequence of SEQ ID NO 214. The LIBE3A pre- mRNA transcript may comprise a duplication of the nucleobase sequence of SEQ ID NO 215. The LIBE3A pre-mRNA transcript may comprise a duplication of the nucleobase sequence of SEQ ID NO 216. The LIBE3A pre-mRNA transcript may comprise a duplication of the nucleobase sequence of SEQ ID NO 217.

[0015] In some embodiments, the LIBE3A pre-mRNA transcript comprises the nucleobase sequence of SEQ ID NO 218. In some embodiments, the LIBE3A pre-mRNA transcript comprises the nucleobase sequence of SEQ ID NO 219. In some embodiments, the LIBE3A pre-mRNA transcript comprises the nucleobase sequence of SEQ ID NO 220. In some embodiments, the LIBE3A pre-mRNA transcript comprises the nucleobase sequence of SEQ ID NO 221.

[0016] In some embodiments, the contiguous nucleotide sequence is complementary to a nucleobase sequence selected from SEQ ID NO 99, SEQ ID NO 108 or SEQ ID NO 110, or at least 8 nucleotides thereof. In some embodiments, the contiguous nucleotide sequence is complementary to the nucleobase sequence of SEQ ID NO 99. In some embodiments, the contiguous nucleotide sequence is complementary to the nucleobase sequence of SEQ ID NO 108. In some embodiments, the contiguous nucleotide sequence is complementary to the nucleobase sequence of SEQ ID NO 110. The contiguous nucleotide sequence may comprise the nucleobase sequence of SEQ ID NO 189, SEQ ID NO 198, or SEQ ID NO 200, or at least 8 nucleotides thereof. The contiguous nucleotide sequence may comprise the nucleobase sequence of SEQ ID NO 189. The contiguous nucleotide sequence may comprise the nucleobase sequence of SEQ ID NO 198. The contiguous nucleotide sequence may comprise the nucleobase sequence of SEQ ID NO 200.

[0017] The invention also provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of at least 8 nucleotides in length which is complementary to a region of a LIBE3A pre-mRNA transcript, wherein the region of the LIBE3A pre-mRNA transcript comprises a nucleobase sequence selected from SEQ ID NO 1 to SEQ ID NO 30, or a fragment thereof.

[0018] In some embodiments, the region of the LIBE3A pre-mRNA transcript comprises a nucleobase sequence selected from SEQ ID NO 26 and SEQ ID NO 27, or a fragment thereof.

[0019] The fragment may be 8 to 40 nucleotides in length, such as 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0020] In some embodiments, the contiguous nucleotide sequence is complementary to a nucleobase sequence selected from SEQ ID NO 31 to SEQ ID NO 120, or at least 8 nucleotides thereof. The contiguous nucleotide sequence may be at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a nucleobase sequence selected from SEQ ID NO 31 to SEQ ID NO 120. The contiguous nucleotide sequence may be fully complementary to a nucleobase sequence selected from SEQ ID NO 31 to SEQ ID NO 120.

[0021] The contiguous nucleotide sequence may comprise the nucleobase sequence of any one of SEQ ID NOs 121 to 210, or at least s nucleotides thereof. Preferably, the contiguous nucleotide sequence comprises the nucleobase sequence of any one of SEQ ID NOs 121 to 210.

[0022] In some embodiments, the contiguous nucleotide sequence is complementary to a nucleobase sequence selected from SEQ ID NO 99, SEQ ID NO 108 or SEQ ID NO 110, or at least 8 nucleotides thereof. In some embodiments, the contiguous nucleotide sequence is complementary to the nucleobase sequence of SEQ ID NO 99. In some embodiments, the contiguous nucleotide sequence is complementary to the nucleobase sequence of SEQ ID NO 108. In some embodiments, the contiguous nucleotide sequence is complementary to the nucleobase sequence of SEQ ID NO 110.

[0023] The contiguous nucleotide sequence may comprise the nucleobase sequence of SEQ ID NO 189, SEQ ID NO 198 or SEQ ID NO 200, or at least 8 nucleotides thereof. The contiguous nucleotide sequence may comprise the nucleobase sequence of SEQ ID NO 189. The contiguous nucleotide sequence may comprise the nucleobase sequence of SEQ ID NO 198. The contiguous nucleotide sequence may comprise the nucleobase sequence of SEQ ID NO 200.

[0024] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide according to the invention is 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0025] In some embodiments, the antisense oligonucleotide according to the invention comprises one or more modified nucleosides.

[0026] The one or more modified nucleoside may be selected from 2'-O-methoxyethyl-RNA (2’-MOE) and LNA nucleosides.

[0027] The antisense oligonucleotide may comprise any number of LNAs at the 5’ end and / or any number of LNAs at the 3’ end.

[0028] The antisense oligonucleotide may comprise one or more 2'-MOE nucleosides. The antisense oligonucleotide may comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32, 33, 34, 35, 36, 37, 38, 39 or 40 2'-MOE nucleosides.

[0029] In some embodiments, the antisense oligonucleotide is a gapmer.

[0030] In some embodiments, the antisense oligonucleotide comprises the oligonucleotide of SEQ ID NO 290, SEQ ID NO 299 or SEQ ID NO 301.

[0031] The invention also provides an antisense oligonucleotide wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of at least 8 nucleotides in length which is complementary to a region of a LIBE3A pre-mRNA transcript, wherein the contiguous nucleotide sequence comprises the nucleobase sequence of any one of SEQ ID NOs 312 to 365, or at least 8 nucleotides thereof. Preferably, the antisense oligonucleotide comprises the oligonucleotide of any one of SEQ ID NOs 366 to 419.

[0032] The antisense oligonucleotide according to the invention may be capable of recruiting RNase H1. Preferably, the antisense oligonucleotide is capable of recruiting RNase H1 to two sites on the LIBE3A pre-mRNA transcript.

[0033] The antisense oligonucleotide according to the invention may reduce the level of the LIBE3A pre-mRNA transcript by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99% in a cell, compared to a control that has not been exposed to the antisense oligonucleotide. Preferably, the antisense oligonucleotide reduces the level of the LIBE3A pre-mRNA transcript by at least 40% to 80%, such as 50% to 70%, in a cell, compared to a control that has not been exposed to the antisense oligonucleotide.

[0034] The antisense oligonucleotide according to the invention may reduce the level of expression of E3 ligase E6-associated protein (E6AP) by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99% in a cell, compared to a control that has not been exposed to the antisense oligonucleotide. Preferably, the antisense oligonucleotide according to the invention reduces the level of expression of E6AP by at least 40% to 80%, such as 50% to 70%, in a cell, compared to a control that has not been exposed to the antisense oligonucleotide.

[0035] The invention provides a pharmaceutical composition comprising the antisense oligonucleotide according to the invention, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0036] The invention provides an in vivo or in vitro method for reducing the level of LIBE3A pre-mRNA transcript in a target cell, the method comprising exposing said cell to an effective amount of an antisense oligonucleotide or a pharmaceutical composition according to the invention.

[0037] The cell may be a human cell or a mammalian cell.

[0038] In some embodiments, the level of LIBE3A pre-mRNA transcript may be decreased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99%, compared to a control cell that has not been exposed to the antisense oligonucleotide. Preferably, the level of LIBE3A pre-mRNA transcript is decreased by at least 40% to 80%, such as 50% to 70%, compared to a control cell that has not been exposed to the antisense oligonucleotide.

[0039] In some embodiments, the expression of E6AP is decreased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99%, compared to a control cell that has not been exposed to the antisense oligonucleotide. Preferably, the expression of E6AP is decreased by at least 40% to 80%, such as 50% to 70%, compared to a control cell that has not been exposed to the antisense oligonucleotide.

[0040] The invention also provides a method of treating or preventing a disease comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide or a pharmaceutical composition according to the invention to a subject suffering from or susceptible to the disease.

[0041] The invention provides an antisense oligonucleotide or pharmaceutical composition according to the invention for use in the treatment of a disease. The invention provides for the use of the antisense oligonucleotide or pharmaceutical composition according to the invention for the preparation of a medicament for the treatment of a disease.

[0042] Suitably, the disease is associated with increased levels of LIBE3A pre-mRNA transcript.

[0043] For example, the disease may be selected from hypotonia, motor delays, intellectual disability (ID), and autism spectrum disorder (ASD). Preferably, the disease is Dup15q syndrome.

[0044] DESCRIPTION OF THE FIGURES

[0045] Figure 1 - Exemplary LNA nucleosides.

[0046] Figure 2 - IC50 of selected antisense oligonucleotides. A549 cells were treated with ASO concentrations ranging from 50 pM to 0.1 pM (2 fold dilutions).

[0047] Figure 3 - Schematic of neuronal induction and maturation for Dup15q-iN glutamatergic neurons. NGN2 expression via Doxycycline (Dox) for 6 days with subsequent differentiation in maturation media. Gaps indicate media changes.

[0048] Figure 4 - Dose response curve showing compound concentration and UBE3A KD in Dup15q- iN glutamatergic neurons. Percentage remaining UBE3A mRNA calculation is based on gene counts of a sequenced BRB-seq library. The IC50 for the SEQ ID 301 , SEQ ID 290 and SEQ ID 299, was calculated to be 37.2 nM, 21.5 nM and 26.2 nM, respectively.

[0049] DETAILED DESCRIPTION OF THE INVENTION

[0050] OLIGONUCLEOTIDE

[0051] The term “oligonucleotide” as used herein is defined, as is generally understood by the skilled person, as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers.

[0052] Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides.

[0053] The oligonucleotide of the invention is man-made, and is chemically synthesized, and is typically purified or isolated. The oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides.

[0054] Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides and nucleosides. In nature, nucleotides, such as DNA and RNA nucleotides, comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is / are absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as “units” or “monomers”.

[0055] ANTISENSE OLIGONUCLEOTIDES

[0056] The term “antisense oligonucleotide” as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid.

[0057] The antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs or shRNAs.

[0058] The antisense oligonucleotides of the present invention may be single stranded. The term single stranded is generally understood by the skilled person in the art. Especially it is understood that single stranded oligonucleotides of the present invention can form hairpins or intermolecular duplex structures (duplex between two molecules of the same oligonucleotide), as long as the degree of intra or inter self complementarity is less than 50% across of the full length of the oligonucleotide.

[0059] In some embodiments, the antisense oligonucleotide according to the invention comprises an oligonucleotide selected from the group consisting of SEQ ID NO 222, SEQ ID NO 223, SEQ ID NO 224, SEQ ID NO 225, SEQ ID NO 226, SEQ ID NO 227, SEQ ID NO 228, SEQ ID NO 229, SEQ ID NO 230, SEQ ID NO 231 , SEQ ID NO 232, SEQ ID NO 233, SEQ ID NO 234, SEQ ID NO 235, SEQ ID NO 236, SEQ ID NO 237, SEQ ID NO 238, SEQ ID NO 239, SEQ ID NO 240, SEQ ID NO 241 , SEQ ID NO 242, SEQ ID NO 243, SEQ ID NO 244, SEQ ID NO 245, SEQ ID NO 246, SEQ ID NO 247, SEQ ID NO 248, SEQ ID NO 249, SEQ ID NO 250, SEQ ID NO 251 , SEQ ID NO 252, SEQ ID NO 253, SEQ ID NO 254, SEQ ID NO 255, SEQ ID NO 256, SEQ ID NO 257, SEQ ID NO 258, SEQ ID NO 259, SEQ ID NO 260, SEQ ID NO 261 , SEQ ID NO 262, SEQ ID NO 263, SEQ ID NO 264, SEQ ID NO 265, SEQ ID NO 266, SEQ ID NO 267, SEQ ID NO 268, SEQ ID NO 269, SEQ ID NO 270, SEQ ID NO 271 , SEQ ID NO 272, SEQ ID NO 273, SEQ ID NO 274, SEQ ID NO 275, SEQ ID NO 276, SEQ ID NO 277, SEQ ID NO 278, SEQ ID NO 279, SEQ ID NO 280, SEQ ID NO 281 , SEQ ID NO 282, SEQ ID NO 283, SEQ ID NO 284, SEQ ID NO 285, SEQ ID NO 286, SEQ ID NO 287, SEQ ID NO 288, SEQ ID NO 289, SEQ ID NO 290, SEQ ID NO 291 , SEQ ID NO 292, SEQ ID NO 293, SEQ ID NO 294, SEQ ID NO 295, SEQ ID NO 296, SEQ ID NO 297, SEQ ID NO 298, SEQ ID NO 299, SEQ ID NO 300, SEQ ID NO 301 , SEQ ID NO 290, SEQ ID NO 302, SEQ ID NO 301 , SEQ ID NO 303, SEQ ID NO 304, SEQ ID NO 305, SEQ ID NO 306, SEQ ID NO 307, SEQ ID NO 308, SEQ ID NO 309, SEQ ID NO 310, or SEQ ID NO 311. Preferably, the antisense oligonucleotide according to the invention comprises the oligonucleotide of SEQ ID NO 290, SEQ ID NO 299 or SEQ ID NO 301.

[0060] In some embodiments, the antisense oligonucleotide according to the invention comprises an oligonucleotide selected from the group consisting of SEQ ID NO 366, SEQ ID NO 367, SEQ ID NO 368, SEQ ID NO 369, SEQ ID NO 370, SEQ ID NO 371 , SEQ ID NO 372, SEQ ID NO 373, SEQ ID NO 374, SEQ ID NO 375, SEQ ID NO 376, SEQ ID NO 377, SEQ ID NO 378, SEQ ID NO 379, SEQ ID NO 380, SEQ ID NO 381 , SEQ ID NO 382, SEQ ID NO 383, SEQ ID NO 384, SEQ ID NO 385, SEQ ID NO 386, SEQ ID NO 387, SEQ ID NO 388, SEQ ID NO 389, SEQ ID NO 390, SEQ ID NO 391 , SEQ ID NO 392, SEQ ID NO 393, SEQ ID NO 394, SEQ ID NO 395, SEQ ID NO 396, SEQ ID NO 397, SEQ ID NO 398, SEQ ID NO 399, SEQ ID NO 400, SEQ ID NO 401 , SEQ ID NO 402, SEQ ID NO 403, SEQ ID NO 404, SEQ ID NO 405, SEQ ID NO 406, SEQ ID NO 407, SEQ ID NO 408, SEQ ID NO 409, SEQ ID NO 410, SEQ ID NO 411 , SEQ ID NO 412, SEQ ID NO 413, SEQ ID NO 414, SEQ ID NO 415, SEQ ID NO 416, SEQ ID NO 417, SEQ ID NO 418, or SEQ ID NO 419.CONTIGUOUS NUCLEOTIDE SEQUENCE

[0061] The term “contiguous nucleotide sequence” refers to the region of the antisense oligonucleotide which is complementary to a target nucleic acid, which may be or may comprise an oligonucleotide motif sequence.

[0062] In some embodiments, all the nucleotides of the antisense oligonucleotide constitute the contiguous nucleotide sequence. In some embodiments, the oligonucleotide comprises the contiguous nucleotide sequence and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid.

[0063] In some embodiments, the antisense oligonucleotide according to the invention comprises a contiguous nucleotide sequence comprising a nucleobase sequence selected from the group consisting of SEQ ID NO: 121 , SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131 , SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141 , SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151 , SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161 , SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171 , SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181 , SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 186, SEQ ID NO: 187, SEQ ID NO: 188, SEQ ID NO: 189, SEQ ID NO: 190, SEQ ID NO: 191 , SEQ ID NO: 192, SEQ ID NO: 193, SEQ ID NO: 194, SEQ ID NO: 195, SEQ ID NO: 196, SEQ ID NO: 197, SEQ ID NO: 198, SEQ ID NO: 199, SEQ ID NO: 200, SEQ ID NO: 201 , SEQ ID NO: 202, SEQ ID NO: 203, SEQ ID NO: 204, SEQ ID NO: 205, SEQ ID NO: 206, SEQ ID NO: 207, SEQ ID NO: 208, SEQ ID NO: 209, and SEQ ID NO: 210, or at least 8 nucleotides thereof.

[0064] In some embodiments, the antisense oligonucleotide according to the invention comprises a contiguous nucleotide sequence comprising a nucleobase sequence selected from the group consisting of SEQ ID NO: 121 , SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131 , SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141 , SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151 , SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161 , SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171 , SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181 , SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 186, SEQ ID NO: 187, SEQ ID NO: 188, SEQ ID NO: 189, SEQ ID NO: 190, SEQ ID NO: 191 , SEQ ID NO: 192, SEQ ID NO: 193, SEQ ID NO: 194, SEQ ID NO: 195, SEQ ID NO: 196, SEQ ID NO: 197, SEQ ID NO: 198, SEQ ID NO: 199, SEQ ID NO: 200, SEQ ID NO: 201 , SEQ ID NO: 202, SEQ ID NO: 203, SEQ ID NO: 204, SEQ ID NO: 205, SEQ ID NO: 206, SEQ ID NO: 207, SEQ ID NO: 208, SEQ ID NO: 209, and SEQ ID NO: 210.

[0065] In some embodiments, the antisense oligonucleotide according to the invention comprises a contiguous nucleotide sequence comprising the nucleobase sequence of SEQ ID NO: 189, or at least 8 nucleotides thereof.

[0066] In some embodiments, the antisense oligonucleotide according to the invention comprises a contiguous nucleotide sequence comprising the nucleobase sequence of SEQ ID NO: 198, or at least 8 nucleotides thereof. In some embodiments, the antisense oligonucleotide according to the invention comprises a contiguous nucleotide sequence comprising the nucleobase sequence of SEQ ID NO: 200, or at least 8 nucleotides thereof.

[0067] In some embodiments, the antisense oligonucleotide according to the invention comprises a contiguous nucleotide sequence comprising the nucleobase sequence of SEQ ID NO: 189.

[0068] In some embodiments, the antisense oligonucleotide according to the invention comprises a contiguous nucleotide sequence comprising the nucleobase sequence of SEQ ID NO: 198.

[0069] In some embodiments, the antisense oligonucleotide according to the invention comprises a contiguous nucleotide sequence comprising the nucleobase sequence of SEQ ID NO: 200.

[0070] In some embodiments, the antisense oligonucleotide according to the invention comprises a contiguous nucleotide sequence comprising a nucleobase sequence selected from the group consisting of SEQ ID NO: 312, SEQ ID NO: 313, SEQ ID NO: 314, SEQ ID NO: 315, SEQ ID NO: 316, SEQ ID NO: 317, SEQ ID NO: 318, SEQ ID NO: 319, SEQ ID NO: 320, SEQ ID NO: 321 , SEQ ID NO: 322, SEQ ID NO: 323, SEQ ID NO: 324, SEQ ID NO: 325, SEQ ID NO: 326, SEQ ID NO: 327, SEQ ID NO: 328, SEQ ID NO: 329, SEQ ID NO: 330, SEQ ID NO: 331 , SEQ ID NO: 332, SEQ ID NO: 333, SEQ ID NO: 334, SEQ ID NO: 335, SEQ ID NO: 336, SEQ ID NO: 337, SEQ ID NO: 338, SEQ ID NO: 339, SEQ ID NO: 340, SEQ ID NO: 341 , SEQ ID NO: 342, SEQ ID NO: 343, SEQ ID NO: 344, SEQ ID NO: 345, SEQ ID NO: 346, SEQ ID NO: 347, SEQ ID NO: 348, SEQ ID NO: 349, SEQ ID NO: 350, SEQ ID NO: 351 , SEQ ID NO: 352, SEQ ID NO: 353, SEQ ID NO: 354, SEQ ID NO: 355, SEQ ID NO: 356, SEQ ID NO: 357, SEQ ID NO: 358, SEQ ID NO: 359, SEQ ID NO: 360, SEQ ID NO: 361 , SEQ ID NO: 362, SEQ ID NO: 363, SEQ ID NO: 364, or SEQ ID NO: 365, or at least 8 nucleotides thereof.

[0071] TARGET SEQUENCE

[0072] The term “target sequence” as used herein refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the oligonucleotide molecule of the invention. In some embodiments, the target sequence consists of a region on the target nucleic acid which is complementary to the contiguous nucleotide sequence of the oligonucleotide of the invention (i.e. a sub-sequence).

[0073] The oligonucleotide of the invention comprises a contiguous nucleotide sequence which is complementary to or hybridizes to a region on the target nucleic acid, such as a target sequence described herein. The target nucleic sequence to which the oligonucleotide is complementary to or hybridizes to generally comprises a stretch of contiguous nucleobases of at least 8 nucleotides. The contiguous nucleotide sequence is between 10 to 50 nucleotides, such as 12-30, such as 13 to 25, such as 14 to 20, such as 15 to 18 contiguous nucleotides.

[0074] In some embodiments, the target sequence is a region of a LIBE3A pre-mRNA transcript, wherein the region of the LIBE3A pre-mRNA transcript comprises a nucleobase sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30, or a fragment thereof.

[0075] In some embodiments, the antisense oligonucleotide according to the invention comprises a contiguous nucleotide sequence that is complementary to a region of a LIBE3A pre-mRNA transcript, wherein the region of the LIBE3A pre-mRNA transcript comprises a nucleobase sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9,

[0076] SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID

[0077] NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20,

[0078] SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID

[0079] NO: 26 SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30, or a fragment thereof.

[0080] In some embodiments, the antisense oligonucleotide according to the invention comprises a contiguous nucleotide sequence that is complementary to a region of a LIBE3A pre-mRNA transcript, wherein the region of the LIBE3A pre-mRNA transcript comprises a nucleobase sequence selected from SEQ ID NO 26 and SEQ ID NO 27, or a fragment thereof.

[0081] The fragment may be 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length. Preferably, the fragment is 18, 19, or 20 nucleotides in length.

[0082] In some embodiments, the target sequence is a nucleobase sequence selected from the group consisting of SEQ ID NO: 31 , SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51 , SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61 , SEQ ID NO: 62, SEQ ID

[0083] NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68,

[0084] SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 , SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID

[0085] NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79,

[0086] SEQ ID NO: 80, SEQ ID NO: 81 , SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID

[0087] NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90,

[0088] SEQ ID NO: 91 , SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID

[0089] NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101 , SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 99, SEQ ID NO: 111 , SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, and SEQ ID NO: 120, or at least 8 nucleotides thereof.

[0090] In some embodiments, the antisense oligonucleotide according to the invention comprises a contiguous nucleotide sequence that is complementary to a nucleobase sequence selected from the group consisting of SEQ ID NO: 31 , SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID

[0091] NO: 51 , SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56,

[0092] SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61 , SEQ ID

[0093] NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67,

[0094] SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 , SEQ ID NO: 72, SEQ ID

[0095] NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78,

[0096] SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81 , SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID

[0097] NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89,

[0098] SEQ ID NO: 90, SEQ ID NO: 91 , SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID

[0099] NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101 , SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 99, SEQ ID NO: 111 , SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, and SEQ ID NO: 120, or at least 8 nucleotides thereof.

[0100] In some embodiments, the contiguous nucleotide sequence is 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a nucleobase sequence selected from SEQ ID NO: 31 to SEQ ID NO: 120. In some embodiments, the contiguous nucleotide sequence is fully complementary to a nucleobase sequence selected from SEQ ID NO: 31 to SEQ ID NO: 120.

[0101] In some embodiments, the contiguous nucleotide sequence is complementary to a nucleobase sequence selected from SEQ ID NO 99, SEQ ID NO 108 or SEQ ID NO 110, or at least 8 nucleotides thereof.

[0102] In some embodiments, the contiguous nucleotide sequence is complementary to the nucleobase sequence of SEQ ID NO 99.

[0103] In some embodiments, the contiguous nucleotide sequence is complementary to the nucleobase sequence of SEQ ID NO 108.

[0104] In some embodiments, the contiguous nucleotide sequence is complementary to the nucleobase sequence of SEQ ID NO 110.

[0105] UBE3A PRE-MRNA TRANSCRIPT

[0106] The LIBE3A gene, located within the human chromosomal region 15q11-13, encodes E6AP ubiquitin-protein ligase (E6AP).

[0107] Ensembl entry number ENSG00000114062.22 provides an example human LIBE3A gene sequence (SEQ ID NO: 420).

[0108] The term “pre-mRNA” may be used interchangeably with “precursor mRNA” or “primary transcript mRNA”. It refers to a single-stranded ribonucleic acid (RNA) product synthesized by transcription of genomic DNA, prior to its processing to generate mRNA. Pre-mRNA may contain both intronic and exonic regions.

[0109] DUPLICATION

[0110] The invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of at least 8 nucleotides in length which is complementary to a region of a UBE3A pre-mRNA transcript, wherein the UBE3A pre-mRNA transcript comprises a duplication of at least 8 nucleotides and the contiguous nucleotide sequence is complementary to at least 8 nucleotides in each duplication.

[0111] By “duplication” is meant a contiguous sequence of at least 8 nucleotides that is present at least twice in a region of the UBE3A pre-mRNA transcript. The terms “micro-duplication” and “duplication” may be used interchangeably.

[0112] In some embodiments, the duplication is 8-40 nucleotides in length, such as 12-30, such as 13 to 25, such as 14 to 20, such as 15 to 18 nucleotides in length. The duplication may be at least 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.

[0113] Each duplication may be separated by any number of nucleotides or adjacent to one another. In some embodiments, the duplication may be separated by 0-200 nucleotides, such as 50- 150, such as 60-120, such as 70-100 nucleotides. In some embodiments, the duplications are separated by 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides.

[0114] In some embodiments, the LIBE3A pre-mRNA transcript comprises a duplication of the nucleobase sequence of at least one of SEQ ID NO 211 , SEQ ID NO 212, SEQ ID NO 213, SEQ ID NO 214, SEQ ID NO 215, SEQ ID NO 216, and SEQ ID NO 217.

[0115] TCTGTCTCGGCTCACTGCAA (Micro-duplication 1a / 1 b; SEQ ID NO: 211)

[0116] AAATATGTAAATATTTACATATTT (Micro-duplication 2; SEQ ID NO: 212)

[0117] GATACAGTATCCATCCATGT (Micro-duplication 3; SEQ ID NO: 213)

[0118] GTAGGTGTAAAATTGAATTTTTAAGAATATTCTTGA (Micro-duplication 4a; SEQ ID NO: 214)

[0119] TAACAGAGAATTGTGAAATTGT (Micro-duplication 4b; SEQ ID NO: 215)

[0120] TGTATATGGCCTTTTCATAGCTTAATATTGGCT (Micro-duplication 4c; SEQ ID NO: 216)

[0121] CTGGGCTCATGCAATCTTCTTAC (Micro-duplication 5; SEQ ID NO: 217)

[0122] Preferably, the LIBE3A pre-mRNA transcript comprises a duplication of the nucleobase sequence of at least one of SEQ ID NO 214, SEQ ID NO 215 and SEQ ID NO 216.

[0123] In some embodiments, the LIBE3A pre-mRNA transcript comprises the nucleobase sequence of at least one of SEQ ID NO 218, SEQ ID NO 219, SEQ ID NO 220 and SEQ ID NO 221.

[0124] AAATATGTAAATATTTACATATTTACAAATATGCAAATATTTACATATTTACAAATATGTAA ATATTTACATATTTACAAATATGTAAATATTTACATATTT (SEQ ID NO: 218; microduplication 2 shown in underline)

[0125] GATACAGTATCCATCCATGTACTAGATACAGTATCCATCCATGT (SEQ ID NO: 219; microduplication 3 shown in underline)

[0126] TG TA TA TGGCC TTTTCA TAGCTTAA TA 77GGC7GTAACAG AG A ATTGTGA A ATTGTAAGA AGTAGTTTTCTTTGTAGGTGTAAAATTGAATTTTTAAGAATATTCTTGACAGTTTTA TG TA T A TGGCCTTTTCA TAGCTTAA TA 77GGC7ATAACAGAG AATTGTGAAATTGTTAAGAAGJA GGTGTAAAATTGAATTTTTAAGAATATTCTTGA (SEQ ID NO: 220; micro-duplication 4a shown in underline, micro-duplication 4b shown in bold; micro-duplication 4c shown in italics) CTGGGCTCATGCAATCTTCTTACCTCAGTCCTCTGAGTATCTGGGCTCATGCAATCTTCT TAG (SEQ ID NO: 221 ; micro-duplication 5 shown in underline)

[0127] NUCLEOBASE

[0128] The term nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization.

[0129] In the context of the present invention the term nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but which are functional during nucleic acid hybridization. In this context “nucleobase” refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al., 2012, Accounts of Chemical Research, 45, 2055-2065 and Bergstrom, 2009, Curr. Protoc. Nucleic Acid Chem., 37, 1.4.1-1.4.32.

[0130] In some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo- cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2’thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine.

[0131] The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or II, wherein each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine. Optionally, for LNA gapmers, 5-methyl cytosine LNA nucleosides may be used. 5-methyl cytosine may be denoted as E .

[0132] Reference to the “sequence” of a given SEQ ID NO refers to the nucleobase sequence, i.e. it does not include the chemistry of a that particular SEQ ID NO. Reference to an “oligonucleotide”, “compound” or “molecule” of a given SEQ ID NO includes the chemistry (e.g. modified nucleotides and linkages) of that particular SEQ ID NO.

[0133] MODIFIED OLIGONUCLEOTIDE

[0134] The term modified oligonucleotide or modified nucleic acid molecule describes an oligonucleotide or nucleic acid molecule comprising one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term “chimeric” is a term that has been used in the literature to describe oligonucleotides or nucleic acid molecules with modified nucleosides, in particular gapmer oligonucleotides.

[0135] The term “modified nucleoside” or “nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety.

[0136] Advantageously, one or more of the modified nucleosides of the nucleic acid molecules of the invention may comprise a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term “nucleoside analogue” or modified “units” or modified “monomers”. Nucleosides with an unmodified DNA or RNA sugar moiety are termed DNA or RNA nucleosides herein. Nucleosides with modifications in the base region of the DNA or RNA nucleoside are still generally termed DNA or RNA if they allow Watson Crick base pairing. Exemplary modified nucleosides include LNA, 2’-O-MOE, 2’oMe and morpholino nucleoside analogues.

[0137] A high affinity modified nucleoside is a modified nucleoside which, when incorporated into an oligonucleotide, enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (Tm). A high affinity modified nucleoside of the present invention preferably results in an increase in melting temperature between +0.5 to +12°C, more preferably between +1.5 to +10°C and most preferably between +3 to +8°C per modified nucleoside. Numerous high affinity modified nucleosides are known in the art and include for example, many 2’ substituted nucleosides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann, Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 203-213).

[0138] SUGAR MODIFICATIONS

[0139] The antisense oligonucleotides according to the invention may comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.

[0140] Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0141] Such modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradicle bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the 02 and 03 carbons (e.g. UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO 2011 / 017521) or tricyclic nucleic acids (WO 2013 / 154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids.

[0142] Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2'-OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2', 3', 4' or 5' positions.

[0143] In some embodiments, the one or more modified nucleoside is selected from 2'-O- methoxyethyl-RNA (2’-MOE) and LNA nucleosides.

[0144] In some embodiments, the antisense oligonucleotide comprises any number of LNAs at the 5’ end and / or any number of LNAs at the 3’ end. The antisense oligonucleotide may comprise at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 LNAs at the 5’ end. The antisense oligonucleotide may comprise at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 LNAs at the 3’ end.

[0145] The antisense oligonucleotide may comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32, 33, 34, 35, 36, 37, 38, 39 or 40 2'-MOE nucleosides. The antisense oligonucleotide may comprise at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 2'-MOE nucleosides at the 5’ end. The antisense oligonucleotide may comprise at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 2'-MOE nucleosides at the 3’ end.

[0146] 2' SUGAR MODIFIED NUCLEOSIDES

[0147] A 2' sugar modified nucleoside is a nucleoside which has a substituent other than H or -OH at the 2' position (2' substituted nucleoside) or comprises a 2' linked biradicle capable of forming a bridge between the 2' carbon and a second carbon in the ribose ring, such as LNA (2'- 4' biradicle bridged) nucleosides.

[0148] Indeed, much focus has been spent on developing 2' sugar substituted nucleosides, and numerous 2' substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, the 2' modified sugar may provide enhanced binding affinity and / or increased nuclease resistance to the oligonucleotide. Examples of 2' substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA (2'oMe). 2'-alkoxy- RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-Fluoro-RNA, and 2'-F-ANA nucleoside. For further examples, please see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development 2000, 3(2), 203-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are illustrations of some 2' substituted modified nucleosides.

[0149] LOCKED NUCLEIC ACID NUCLEOSIDES (LNA NUCLEOSIDE)

[0150] A “LNA nucleoside” is a 2'- modified nucleoside which comprises a biradical linking the C2' and C4' of the ribose sugar ring of said nucleoside (also referred to as a “2' - 4' bridge”), which restricts or locks the conformation of the ribose ring.

[0151] These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature. The locking of the conformation of the ribose is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide for a complementary RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complement duplex.

[0152] Non limiting, exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181 , WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071 , WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401 , WO 2009 / 067647, WO 2008 / 150729, Morita et a!., Bioorganic & Med.Chem. Lett., 12, 73-76, Seth et al., J. Org. Chem., 2010, Vol 75(5) pp. 1569-81 , Mitsuoka et al., Nucleic Acids Research, 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry, 2016, 59, 9645-9667.

[0153] Further non limiting, exemplary LNA nucleosides are disclosed in Figure 1.

[0154] Particular LNA nucleosides are beta-D-oxy-LNA, 6’-methyl-beta-D-oxy LNA such as (S)-6’- methyl-beta-D-oxy-LNA (ScET) and ENA.

[0155] A particularly advantageous LNA is beta-D-oxy-LNA. COMPLEMENTARITY

[0156] The term “complementarity” describes the capacity for Watson-Crick base-pairing of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G) - cytosine (C) and adenine (A) - thymine (T) / uracil (II).

[0157] It will be understood that oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non-modified and modified nucleobases (see for example Hirao et al., 2012, Accounts of Chemical Research, 45, 2055 and Bergstrom, 2009, Curr. Protoc. Nucleic Acid Chem., 37, 1.4.1).

[0158] The term “% complementary” as used herein, refers to the proportion of nucleotides (in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which across the contiguous nucleotide sequence, are complementary to a reference sequence (e.g. a target sequence or sequence motif). The percentage of complementarity is thus calculated by counting the number of aligned nucleobases that are complementary (from Watson Crick base pairs) between the two sequences (when aligned with the target sequence 5’-3’ and the oligonucleotide sequence from 3’-5’), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase / nucleotide which does not align (form a base pair) is termed a mismatch. Insertions and deletions are not allowed in the calculation of % complementarity of a contiguous nucleotide sequence.

[0159] It will be understood that in determining complementarity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5’-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).

[0160] IDENTITY

[0161] The term “identity” as used herein, refers to the proportion of nucleotides (expressed in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which at a given position, are identical to (i.e. in their ability to form Watson Crick base pairs with the complementary nucleoside) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid).

[0162] The percentage of identity is thus calculated by counting the number of aligned nucleobases that are identical (a Match) between two sequences (in the contiguous nucleotide sequence of the compound of the invention and in the reference sequence), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. Therefore, Percentage of Identity = (Matches x 100) / Length of aligned region (e.g. the contiguous nucleotide sequence). Preferably, insertions and deletions are not allowed in the calculation of the percentage of identity of a contiguous nucleotide sequence. It will be understood that in determining identity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5- methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).

[0163] It is therefore to be understood that there is a relationship between identity and complementarity such that contiguous nucleotide sequences within the nucleic acid molecule of the invention that are complementary to a target sequence also share a percentage of identity with said complementary sequence.

[0164] HYBRIDIZATION

[0165] The terms “hybridizing” or “hybridizes” as used herein are to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (Tm) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions Tmis not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy AG° is a more accurate representation of binding affinity and is related to the dissociation constant (Kd) of the reaction by AG°=-RTIn(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low AG° of the reaction between an oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. AG° is the energy associated with a reaction where aqueous concentrations are 1 M, the pH is 7, and the temperature is 37°C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions AG° is less than zero. AG° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for AG° measurements. AG° can also be estimated numerically by using the nearest neighbour model as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405.

[0166] In some embodiments the degree or strength of hybridization is measured by the standard state Gibbs free energy AG°. The oligonucleotides may hybridize to a target nucleic acid with estimated AG° values below the range of -10 kcal, such as below -15 kcal, such as below -20 kcal and such as below -25 kcal. In some embodiments the oligonucleotides hybridize to a target nucleic acid with an estimated AG° value of -10 to -60 kcal, such as -12 to -40, such as from -15 to -30 kcal, or-16 to -27 kcal such as -18 to -25 kcal.

[0167] METHOD

[0168] The invention provides an in vivo or in vitro method for reducing the level of LIBE3A pre-mRNA transcript in a target cell, the method comprising exposing said cell to an effective amount of an antisense oligonucleotide or a pharmaceutical composition according to the invention.

[0169] The cell may be a human cell or a mammalian cell. Preferably, the cell is a neuron.

[0170] In some embodiments, the level of LIBE3A pre-mRNA transcript in a cell exposed to an antisense oligonucleotide according to the present invention is decreased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99%, compared to a control cell that has not been exposed to the antisense oligonucleotide.

[0171] Preferably, the level of LIBE3A pre-mRNA transcript is decreased by at least 40% to 80%, such as 50% to 70%, compared to a control cell that has not been exposed to the antisense oligonucleotide.

[0172] The term “modulation of expression” as used herein is to be understood as an overall term for a nucleic acid molecules ability to alter the amount of a target when compared to the amount of the target before administration of the nucleic acid molecule. Alternatively, modulation of expression may be determined by reference to a control experiment. It is generally understood that the control is an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting or nucleic acid molecule (mock). It may however also be an individual treated with the standard of care.

[0173] One type of modulation is a nucleic acid molecule’s, such as an antisense oligonucleotide’s, ability to inhibit, down-regulate, reduce, remove, stop, prevent, lessen, lower, avoid or terminate expression of a target, e.g. by degradation of mRNA or blockage of transcription.

[0174] In some embodiments, the expression of E6AP in a cell exposed to an antisense oligonucleotide according to the present invention is decreased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99%, compared to a control cell that has not been exposed to the antisense oligonucleotide.

[0175] Preferably, the expression of E6AP is decreased by at least 40% to 80%, such as 50% to 70%, compared to a control cell that has not been exposed to the antisense oligonucleotide. It is preferable that the level of LIBE3A pre-RNA transcript and / or expression of E6AP in a cell is not reduced by 100%, compared to a control cell that has not been exposed to the antisense oligonucleotide.

[0176] NUCLEASE MEDIATED DEGRADATION

[0177] Nuclease mediated degradation refers to an oligonucleotide capable of mediating degradation of a complementary nucleotide sequence when forming a duplex with such a sequence.

[0178] In some embodiments, the oligonucleotide may function via nuclease mediated degradation of the target nucleic acid, where the oligonucleotides of the invention are capable of recruiting a nuclease, particularly and endonuclease, preferably endoribonuclease (RNase), such as RNase H. Examples of oligonucleotide designs which operate via nuclease mediated mechanisms are oligonucleotides which typically comprise a region of at least 5 or 6 consecutive DNA nucleosides and are flanked on one side or both sides by affinity enhancing nucleosides, for example gapmers, headmers and tailmers.

[0179] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule. WO01 / 23613 provides in vitro methods for determining RNaseH activity, which may be used to determine the ability to recruit RNaseH. Typically an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol / l / min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91 - 95 of WO01 / 23613 (hereby incorporated by reference). For use in determining RHase H activity, recombinant human RNase H1 is available from Lubio Science GmbH, Lucerne, Switzerland

[0180] In some embodiments, the antisense oligonucleotide according to the invention is capable of recruiting RNase H1 to the target sequence (i.e. the UBE3A pre-mRNA transcript).

[0181] In some embodiments, the antisense oligonucleotide according to the invention is capable of recruiting RNase H1 to two or more sites on the UBE3A pre-mRNA transcript.

[0182] GAPMER

[0183] The antisense oligonucleotide of the invention, or contiguous nucleotide sequence thereof may be a gapmer. The antisense gapmers are commonly used to inhibit a target nucleic acid via RNase H mediated degradation. A gapmer oligonucleotide comprises at least three distinct structural regions a 5’-flank, a gap and a 3’-flank, F-G-F’ in the ‘5 -> 3’ orientation. The “gap” region (G) comprises a stretch of contiguous DNA nucleotides which enable the oligonucleotide to recruit RNase H. The gap region is flanked by a 5’ flanking region (F) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides, and by a 3’ flanking region (F’) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides. The one or more sugar modified nucleosides in region F and F’ enhance the affinity of the oligonucleotide for the target nucleic acid ( / .e. are affinity enhancing sugar modified nucleosides). In some embodiments, the one or more sugar modified nucleosides in region F and F’ are 2’ sugar modified nucleosides, such as high affinity 2’ sugar modifications, such as independently selected from LNA and 2’-MOE.

[0184] In a gapmer design, the 5’ and 3’ most nucleosides of the gap region are DNA nucleosides, and are positioned adjacent to a sugar modified nucleoside of the 5’ (F) or 3’ (F’) region respectively. The flanks may further defined by having at least one sugar modified nucleoside at the end most distant from the gap region, i.e. at the 5’ end of the 5’ flank and at the 3’ end of the 3’ flank.

[0185] Regions F-G-F’ form a contiguous nucleotide sequence.

[0186] Region G (gap region) of the gapmer is a region of nucleosides which enables the oligonucleotide to recruit RNaseH, such as human RNase H1 , typically DNA nucleosides. RNaseH is a cellular enzyme which recognizes the duplex between DNA and RNA, and enzymatically cleaves the RNA molecule. Suitably gapmers may have a gap region (G) of at least 5 or 6 contiguous DNA nucleosides, such as 5 - 16 contiguous DNA nucleosides, such as 6 - 15 contiguous DNA nucleosides, such as 7-14 contiguous DNA nucleosides, such as 8

[0187] - 12 contiguous DNA nucleotides, such as 8 - 12 contiguous DNA nucleotides in length. The gap region G may, in some embodiments consist of 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 or 16 contiguous DNA nucleosides. Cytosine (C) DNA in the gap region may in some instances be methylated, such residues are either annotated as 5-methyl-cytosine (meC or with an e instead of a c). Methylation of Cytosine DNA in the gap is advantageous if eg dinucleotides are present in the gap to reduce potential toxicity, the modification is not expected to have significant impact on efficacy of the oligonucleotides.

[0188] Whilst traditional gapmers have a DNA gap region, there are numerous examples of modified nucleosides which allow for RNaseH recruitment when they are used within the gap region. Modified nucleosides which have been reported as being capable of recruiting RNaseH when included within a gap region include, for example, alpha-L-LNA, C4’ alkylated DNA (as described in PCT / EP2009 / 050349 and Vester et a / ., Bioorg. Med. Chem. Lett. 18 (2008) 2296

[0189] - 2300, both incorporated herein by reference), arabinose derived nucleosides like ANA and 2'F-ANA (Mangos et al. 2003 J. AM. CHEM. SOC. 125, 654-661), UNA (unlocked nucleic acid) (as described in Fluter ed al., Mol. Biosyst., 2009, 10, 1039 incorporated herein by reference). UNA is unlocked nucleic acid, typically where the bond between C2 and C3 of the ribose has been removed, forming an unlocked “sugar” residue. The modified nucleosides used in such gapmers may be nucleosides which adopt a 2’ endo (DNA like) structure when introduced into the gap region, i.e. modifications which allow for RNaseH recruitment). In some embodiments the DNA Gap region (G) described herein may optionally contain 1 to 3 sugar modified nucleosides which adopt a 2’ endo (DNA like) structure when introduced into the gap region.

[0190] Region F is positioned immediately adjacent to the 5’ DNA nucleoside of region G. The 3’ most nucleoside of region F is a sugar modified nucleoside, such as a high affinity sugar modified nucleoside, for example a 2’ substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside.

[0191] Region F’ is positioned immediately adjacent to the 3’ DNA nucleoside of region G. The 5’ most nucleoside of region F’ is a sugar modified nucleoside, such as a high affinity sugar modified nucleoside, for example a 2’ substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside.

[0192] An LNA gapmer is a gapmer wherein either one or both of region F and F’ comprises or consists of LNA nucleosides. A beta-D-oxy gapmer is a gapmer wherein either one or both of region F and F’ comprises or consists of beta-D-oxy LNA nucleosides.

[0193] A MOE gapmers is a gapmer wherein regions F and F’ consist of MOE nucleosides. In some embodiments the MOE gapmer is of design [MOE]i-s-[Region G]-[MOE] 1.8, such as [MOE]^- [Region G]s-i6-[MOE] 2-7, such as [MOE]3-6-[Region G]-[MOE] 3-6, wherein region G is as defined in the Gapmer definition. MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) have been widely used in the art.

[0194] PHARMACEUTICAL COMPOSITION

[0195] The invention provides a pharmaceutical composition comprising the antisense oligonucleotide according to the invention, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0196] For example, the salt may comprise a metal cation, such as a sodium salt or a potassium salt.

[0197] The solution may be a phosphate buffered saline solution, such as a sterile phosphate buffered saline solution. METHOD OF TREATMENT

[0198] The invention provides a method of treating or preventing a disease comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide or pharmaceutical composition according to the invention to a subject suffering from or susceptible to the disease.

[0199] The invention provides an antisense oligonucleotide or pharmaceutical composition according to the invention for use in the treatment of a disease.

[0200] The invention provides for use of the antisense oligonucleotide or pharmaceutical composition according to the invention for the preparation of a medicament for the treatment of a disease.

[0201] The terms “treatment”, “treating”, “treats” or the like are used herein generally mean obtaining a desired pharmacological and / or physiological effect. This effect is therapeutic in terms of partially or completely curing a disease and / or adverse effect attributed to the disease. The term “treatment” as used herein covers any treatment of a disease in a subject and includes: (a) inhibiting the disease, i.e. arresting its development; or (b) ameliorating (i.e. relieving) the disease, i.e. causing regression of the disease. Thus, a compound that ameliorates and / or inhibits an infection is a compound that treats an invention. Preferably, the term “treatment” as used herein relates to medical intervention of an already manifested disorder, like the treatment of an already defined and manifested infection.

[0202] Herein the term “preventing”, “prevention” or “prevents” relates to a prophylactic treatment, i.e. to a measure or procedure the purpose of which is to prevent, rather than to cure a disease. Prevention means that a desired pharmacological and / or physiological effect is obtained that is prophylactic in terms of completely or partially preventing a disease or symptom thereof.

[0203] For the purposes of the present invention the “subject” (or “patient”) may be a vertebrate. In context of the present invention, the term “subject” includes both humans and other animals, particularly mammals, and other organisms. Thus, the herein provided means and methods are applicable to both human therapy and veterinary applications. Accordingly, herein the subject may be an animal such as a mouse, rat, hamster, rabbit, guinea pig, ferret, cat, dog, chicken, sheep, bovine species, horse, camel, or primate. Preferably, the subject is a mammal. More preferably the subject is human.

[0204] Suitably, the disease is associated with increased levels of LIBE3A pre-mRNA transcript. Preferably, the disease is Dup15q syndrome.

[0205] The antisense oligonucleotide according to the invention may be used in a method of treating or preventing a disease or symptom associated with Dup15q syndrome. For example, the disease and / or symptom may be hypotonia, motor delays, intellectual disability (ID), and / or autism spectrum disorder (ASD).

[0206] HELM NOTATION

[0207] Antisense oligonucleotides of the invention are depicted herein using Hierarchical Editing Language for Macromolecules (HELM) notation.

[0208] HELM is a notation format designed to depict the structure of macromolecules. Full details of HELM notation may be found at www.pistoiaalliance.org / helm-tools / , in Zhang et al., 2012, J. Chem. Inf. Model., 52, 2796-2806 (which initially described HELM notation) and in Milton et al., 2017, J. Chem Inf. Model., 57, 1233-1239 (which describes HELM version 2.0).

[0209] Briefly, a macromolecule is depicted as a “HELM string”, which is divided into sections. The first section lists the molecules comprised in the macromolecule. The second section lists the connections between molecules within the macromolecule. One or more dollar sign $ marks the end of a section of a HELM string.

[0210] Each molecule listed in the first section of a HELM string is given an identifier (e.g. “RNA1” for a nucleic acid) and the structure of the molecule is defined by notation in braces { } immediately following the identifier. The HELM notations used to define the structure of each molecule in braces { } in the first section of HELM strings for the compounds and conjugates of the present invention are as follows:

[0211] [dR] is a DNA nucleoside

[0212] [LR] is a beta-D-oxy-LNA nucleoside

[0213] [MOE](G) is a 2'-O-(2-methoxy) ethyl RNA guanine nucleoside

[0214] [MOE](U) is a 2'-O-(2-methoxy) ethyl RNA uracil nucleoside

[0215] [MOE](A) is a 2'-O-(2-methoxy) ethyl RNA adenine nucleoside

[0216] [M0E]([5meC]) is a 2'-O-(2-methoxy) ethyl RNA 5-methyl cytosine nucleoside

[0217] MOE](T) is a 2'-O-(2-methoxy) ethyl thymine nucleoside

[0218] [sP] is a phosphorothioate backbone

[0219] EXAMPLES

[0220] Example 1

[0221] Materials and Methods

[0222] ASOs were designed against homo sapiens UBE3A gene (ENSG00000114062.22). A mixture of LNA / DNA and MOE / DNA gapmers were designed and 1151 ASOs designed and synthesized in house (Roche Innovation Center Copenhagen). Potency of the ASOs were screened in A549 cells by non-assisted uptake (gymnosis) in two concentrations (5 and 25 pM). Briefly, 5000 cells were seeded per well in 96 well plates, and the following day ASOs were added to obtain a final concentration of 5 and 25 pM, respectively. Cells were incubated for 3 days at 37°C at 5% CO2. After 3 days of incubation, media was removed and cells lysed in the lysis buffer used in the RNeasy 96 system from Qiagen to purify total RNA. Denatured total RNA was used as input for qPCR using the probe based assays (IDT) against UBE3A (Hs.PT.58.20460880) and HPRT1 Hs.PT.58v.45621572 with a FAM and HEX fluorophores, respectively. Percent remaining UBE3A RNA after ASO treatment was calculated based on the UBE3A RNA in PBS treated cells (Table 1). To estimate the IC-50 value of selected ASOs, A549 cells were treated with 8 final ASO concentrations of ranging from 50 pM to 0.1 pM (2 fold dilutions). To obtain the estimated IC- 50 value (Table 2), the data was plotted in GraphPad Prism (Figure 2A-L).

[0223] Results

[0224] Upon non-assisted uptake we were able to identify a large number of ASOs that were able recruit RNase H to reduce the amount of UBE3A RNA to less than 0.5% at 25 pM (Figure 2A- L), and an estimated IC-50 value of 0.7 pM for the best performing ASO (Table 2).

[0225] Table 1. Antisense oligonucleotide sequences

[0226] Table 2. IC-50 value of selected ASOs

[0227] Example 2

[0228] Materials and Methods

[0229] Dup15q NGN2 Lines for screening ASOs

[0230] Stable Cell line generation for NGN2 Dup15q iPSCs

[0231] For this study, the isogenic set of Dup15 induced pluripotent stem cells (iPSCs) published by Elamin etal. were used to generate inducible Neurogenin2 (NGN2) glutamatergic neurons (iN) (Elamin et al., 2023, Stem Cell Reports, 18(4): 884-898; based on GM07992 at Coriell). Stable iN-iPSC lines were generated by inserting a Doxycycline (Dox)-inducible NGN2 construct into the AAVS1 locus on chromosome 19 using CRISPR / Cas9 technology. The nucleofection was performed using the Lonza 4D-Nucleofector system. Neomycin resistance was used for clonal selection (Geneticin™, 0.125 mg / ml, #10131027, Gibco) and positive clones were identified through PCR screening (primers targeting the resistance markers and homology arms). Successful neuronal conversion was further validated by Dox application (2 pg / ml; cat. no. D9891-1G, Sigma), and clones showing rapid and homogeneous changes, from iPSC to neuronal morphology, were selected. The final iN-iPSC lines for Dup15q have been characterised using short tandem repeat (STR) profiling (Microsynth, PowerPlex® 16 HS System (Promega)), have been tested for the expression of pluripotency markers (e.g. OCT4, SOX2 via fluorescence-activated cell sorting), the absence of mycoplasma (MycoAlert™ Mycoplasma detection kit, Lonza; Cat. No. LT07-318) and the absence of copy number variations (CNV) using iCS-digicalTM PSC test (stemgenomics). iPSC line expansion and maintenance was conducted in mTeSR™ Plus media (STEMCELL Technologies, # 100-0276) on human recombinant laminin 521 (12.5pg / ml, BioLamina #LN521-05, dil. in PBS+ / + (#14040091 , Gibco)). Rock inhibitor (Rl, 10 pM, cat. no. HB2297-10MG, HelloBio) was added to the media during cell detachment and initial plating for up to 18h. Accutase (Innovative Cell Technologies #AT-104) has been used for cell detachment and STEM-Cellbanker (ZENOAQ, #11890) has been used for cryopreservation.

[0232] Neuronal Induction and Differentiation of NGN2 Lines

[0233] For neuronal induction, iN-iPSCs were seeded at a density of 25,000 cells / cm2in mTeSR™ Plus media 2 days prior to induction. On DO the media was changed to pre-induction media (short N2-media) consisting of DMEM / F12 (cat. no. 11320-074, Gibco) supplemented with N2 Supplement (cat. no. 17502048, Thermo Fisher) and Doxycycline (2 pg / ml; cat. no. D9891- 1G, Sigma). N2-media was exchanged after 2 days and on the following day the cells were detached and banked as D3 induced neurons. For the final differentiation in the appropriate format, Day 3 iN neurons were defrosted and plated on dPGA / Laminin coated plates (dPGA: 50 pg / ml in PBS- / -, DENDRO TEK# DND400.50-10; 3x washes in PBS- / - (#14190094, Gibco); Laminin: 5 pg / ml in PBS- / -, Roche, #11243217001). Approximately 200,000 cells / cm2were seeded in NGB- induction media (Neurobasal Media, #21103049, Gibco; GlutaMax, # 35050- 38, Gibco; B27 (without Vit. A), #12587010, Gibco) supplemented with BDNF (10 ng / ml, # 450- 02, peprotech), Dox and Rl. Full media changes were performed on the following days: D4 (NGB- with BDNF, Dox, DAPT (10 pM #D5942-5MG, Sigma)), D5 (NGB- with BDNF, Dox, DAPT, AraC (5 pM, # C1768, Sigma), D6 (NGB- with BDNF & Laminin (2.5 pg / ml)). From D6 onwards half media changes were carried out 2x a week using NGB+ maturation media (Neurobasal Plus & B27 Plus, # A3653401 , Gibco; GlutaMax) with BDNF and Laminin. Care was taken to add new media dropwise to the wells to avoid disturbing the cells. An overview of the neuronal induction protocol can be found in Figure 3.

[0234] ASO treatment and IC50 analysis

[0235] ASO treatment was performed on day 14 of neuronal induction, and cells were harvested for RNA and RNA analysis one week later (day 21). NGN2 Dup15q neurons were treated with ASOs (in triplicates) for a final concentration of 1 uM, 200 nM, 40 nM, 8 nM, 1.6 nM and 0.32 nM at the day of treatment. Media change was carried out as described above and on day 21 , cells were harvested in MagNA Pure 96 External Lysis Buffer (Roche). For RNA isolation, the MagNA Pure 96 System including DNase I treatment was used. Isolated RNA was used as template for BRB-seq library prep (Alithea Genomics) using approximately 10 ng of total RNA as input. The BRB-seq libraries were sequenced on the NovaSeq 6000 System (Illumina) to a sequencing depth of 8-10 million reds per sample. The output was analysed with the Alithea Genomics pipeline and the count matrix was generated from 1 million unique reads per sample.

[0236] Results

[0237] To investigate the potency of gapmers in neurons with unassisted uptake, ASOs targeting the repeat region / duplication no 4 (SEQ ID NO: 220) were investigated in NGN2 Dup15q iPSCs with an extra copy of the chr.15q arm containing the UBE3A gene. The IC50 was estimated using a 5 fold dilution (6 steps) of the SEQ ID NO: 301 , SEQ ID NO: 290, SEQ ID NO: 299 and a non-targeting gapmer as control (used to set the input LIBE3A RNA to 100%). The concentration of ASOs ranged from 1 uM to 0.32 nM and NGN2 Dup15q neurons were treated for 8 days with a single dose. The transcriptomic profile and herein the percent remaining LIBE3A mRNA was estimated after RNA purification, and BRB-Seq. The IC50 value was estimated to be 37.2 nM, 21.5 nM and 26.2 nM, for the 3 gapmer’s targeting UBE3A pre- mRNA, SEQ ID NO: 301 , SEQ ID NO: 290, SEQ ID NO: 299, respectively (Figure 4). The data shows that targeting the duplicated region with ASOs can be very effective, with IC50 values from 20 to 40 nM.

[0238] NUMBERED EMBODIMENTS

[0239] 1. An antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of at least s nucleotides in length which is complementary to a region of a UBE3A pre-mRNA transcript, wherein the UBE3A pre-mRNA transcript comprises a duplication of at least 8 nucleotides and the contiguous nucleotide sequence is complementary to at least 8 nucleotides in each duplication.

[0240] 2. An antisense oligonucleotide according to embodiment 1 , wherein the UBE3A pre- mRNA transcript comprises a duplication of at least one nucleobase sequence selected from SEQ ID NO 211 , SEQ ID NO 212, SEQ ID NO 213, SEQ ID NO 214, SEQ ID NO 215, SEQ ID NO 216, and SEQ ID NO 217.

[0241] 3. An antisense oligonucleotide according to embodiment 2, wherein the UBE3A pre- mRNA transcript comprises a duplication of at least one nucleobase sequence selected from SEQ ID NO 214, SEQ ID NO 215 and SEQ ID NO 216.

[0242] 4. An antisense oligonucleotide according to embodiment 2 or embodiment 3, wherein the UBE3A pre-mRNA transcript comprises a duplication of the nucleobase sequence of SEQ ID NO 211.

[0243] 5. An antisense oligonucleotide according to any of embodiments 2 to 4, wherein the UBE3A pre-mRNA transcript comprises a duplication of the nucleobase sequence of SEQ ID NO 212.

[0244] 6. An antisense oligonucleotide according to any of embodiments 2 to 5, wherein the UBE3A pre-mRNA transcript comprises a duplication of the nucleobase sequence of SEQ ID NO 213.

[0245] 7. An antisense oligonucleotide according to any of embodiments 2 to 6, wherein the UBE3A pre-mRNA transcript comprises a duplication of the nucleobase sequence of SEQ ID NO 214.

[0246] 8. An antisense oligonucleotide according to any of embodiments 2 to 7, wherein the UBE3A pre-mRNA transcript comprises a duplication of the nucleobase sequence of SEQ ID NO 215.

[0247] 9. An antisense oligonucleotide according to any of embodiments 2 to 8, wherein the UBE3A pre-mRNA transcript comprises a duplication of the nucleobase sequence of SEQ ID NO 216. 10. An antisense oligonucleotide according to any of embodiments 2 to 9, wherein the LIBE3A pre-mRNA transcript comprises a duplication of the nucleobase sequence of SEQ ID NO 217.

[0248] 11. An antisense oligonucleotide according to any of embodiments 2 to 10, wherein the LIBE3A pre-mRNA transcript comprises the nucleobase sequence of SEQ ID NO 218.

[0249] 12. An antisense oligonucleotide according to any of embodiments 2 to 11 , wherein the LIBE3A pre-mRNA transcript comprises the nucleobase sequence of SEQ ID NO 219.

[0250] 13. An antisense oligonucleotide according to any of embodiments 2 to 12, wherein the LIBE3A pre-mRNA transcript comprises the nucleobase sequence of SEQ ID NO 220.

[0251] 14. An antisense oligonucleotide according to any of embodiments 2 to 13, wherein the LIBE3A pre-mRNA transcript comprises the nucleobase sequence of SEQ ID NO 221.

[0252] 15. An antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of at least s nucleotides in length which is complementary to a region of a LIBE3A pre-mRNA transcript, wherein the region of the LIBE3A pre-mRNA transcript comprises a nucleobase sequence selected from SEQ ID NO 1 to SEQ ID NO 30, or a fragment thereof.

[0253] 16. An antisense oligonucleotide according to embodiment 15, wherein the region of the LIBE3A pre-mRNA transcript comprises a nucleobase sequence selected from SEQ ID NO 26 and SEQ ID NO 27, or a fragment thereof.

[0254] 17. An antisense oligonucleotide according to embodiment 15 or embodiment 16, wherein the fragment is 8 to 40 nucleotides in length.

[0255] 18. An antisense oligonucleotide according to embodiment 17, wherein the fragment is 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0256] 19. An antisense oligonucleotide according to any of embodiments 15 to 18, wherein the contiguous nucleotide sequence is complementary to a nucleobase sequence selected from SEQ ID NO 31 to SEQ ID NO 120, or at least 8 nucleotides thereof.

[0257] 20. An antisense oligonucleotide according to embodiment 19, wherein the contiguous nucleotide sequence is at least 75% complementary to a nucleobase sequence selected from SEQ ID NO 31 to SEQ ID NO 120. 21. An antisense oligonucleotide according to embodiment 20, wherein the contiguous nucleotide sequence is fully complementary to a nucleobase sequence selected from SEQ ID NO 31 to SEQ ID NO 120.

[0258] 22. An antisense oligonucleotide according to any of embodiments 15 to 21 , wherein the contiguous nucleotide sequence comprises the nucleobase sequence of any one of SEQ ID NOs 121 to 210, or at least 8 nucleotides thereof.

[0259] 23. An antisense oligonucleotide according to embodiment 22, wherein the contiguous nucleotide sequence comprises the nucleobase sequence of any one of SEQ ID NOs 121 to 210.

[0260] 24. An antisense oligonucleotide according to any of embodiments 1 to 23, wherein the contiguous nucleotide sequence is complementary to a nucleobase sequence selected from SEQ I D NO 99, SEQ I D NO 108 or SEQ I D NO 110, or at least 8 nucleotides thereof.

[0261] 25. An antisense oligonucleotide according to embodiment 24, wherein the contiguous nucleotide sequence is complementary to the nucleobase sequence of SEQ ID NO 99.

[0262] 26. An antisense oligonucleotide according to embodiment 24, wherein the contiguous nucleotide sequence is complementary to the nucleobase sequence of SEQ ID NO 108.

[0263] 27. An antisense oligonucleotide according to embodiment 24, wherein the contiguous nucleotide sequence is complementary to the nucleobase sequence of SEQ ID NO 110.

[0264] 28. An antisense oligonucleotide according to any of embodiments 1 to 27, wherein the contiguous nucleotide sequence comprises the nucleobase sequence of SEQ ID NO 189, SEQ ID NO 198 or SEQ ID NO 200, or at least 8 nucleotides thereof.

[0265] 29. An antisense oligonucleotide according to embodiment 28, wherein the contiguous nucleotide sequence comprises the nucleobase sequence of SEQ ID NO 189.

[0266] 30. An antisense oligonucleotide according to embodiment 28, wherein the contiguous nucleotide sequence comprises the nucleobase sequence of SEQ ID NO 198.

[0267] 31. An antisense oligonucleotide according to embodiment 28, wherein the contiguous nucleotide sequence comprises the nucleobase sequence of SEQ ID NO 200.

[0268] 32. An antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of at least s nucleotides in length which is complementary to a region of a LIBE3A pre-mRNA transcript, wherein the contiguous nucleotide sequence comprises the nucleobase sequence of any one of SEQ ID NOs 312 to 365, or at least 8 nucleotides thereof. 33. An antisense oligonucleotide according to any of embodiments 1 to 32, wherein the contiguous nucleotide sequence is 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0269] 34. An antisense oligonucleotide according to any of embodiments 1 to 33, comprising one or more modified nucleosides.

[0270] 35. An antisense oligonucleotide according to embodiment 34, wherein the one or more modified nucleoside is selected from 2'-O-methoxyethyl-RNA (2’-MOE) and LNA nucleosides.

[0271] 36. An antisense oligonucleotide according to embodiment 34 or embodiment 35, wherein the antisense oligonucleotide comprises any number of LNAs at the 5’ end.

[0272] 37. An antisense oligonucleotide according to any of embodiments 34 to 36, wherein the antisense oligonucleotide comprises any number of LNAs at the 3’ end.

[0273] 38. An antisense oligonucleotide according to any of embodiments 34 to 37, wherein the antisense oligonucleotide comprises one or more 2'-MOE nucleosides.

[0274] 39. An antisense oligonucleotide according to embodiment 38, wherein the antisense oligonucleotide comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32, 33, 34, 35, 36, 37, 38, 39 or 402'-MOE nucleosides.

[0275] 40. An antisense oligonucleotide according to any of embodiments 34 to 39, wherein the antisense oligonucleotide is a gapmer.

[0276] 41. An antisense oligonucleotide according to embodiment 40, wherein the antisense oligonucleotide comprises the oligonucleotide of SEQ ID NO 290, SEQ ID NO 299 or SEQ ID NO 301.

[0277] 42. An antisense oligonucleotide according to embodiment 40, wherein the antisense oligonucleotide comprises the oligonucleotide of any one of SEQ ID NOs 366 to 419.

[0278] 43. An antisense oligonucleotide according to any of embodiments 1 to 42, wherein the antisense oligonucleotide is capable of recruiting RNase H1.

[0279] 44. An antisense oligonucleotide according to embodiment 43, wherein the antisense oligonucleotide is capable of recruiting RNase H1 to two sites on the LIBE3A pre-mRNA transcript.

[0280] 45. An antisense oligonucleotide according to any of embodiments 1 to 44, wherein the antisense oligonucleotide is capable of reducing the level of the LIBE3A pre-mRNA transcript by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99% in a cell, compared to a control that has not been exposed to the antisense oligonucleotide. 46. An antisense oligonucleotide according to embodiment 45, wherein the antisense oligonucleotide is capable of reducing the level of the LIBE3A pre-mRNA transcript by at least 40% to 80%, such as 50% to 70%, in a cell, compared to a control that has not been exposed to the antisense oligonucleotide.

[0281] 47. An antisense oligonucleotide according to any of embodiments 1 to 46, wherein the antisense oligonucleotide is capable of reducing the level of expression of E3 ligase Eeassociated protein (E6AP) by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99% in a cell, compared to a control that has not been exposed to the antisense oligonucleotide.

[0282] 48. An antisense oligonucleotide according to embodiment 47, wherein the antisense oligonucleotide is capable of reducing the level of expression of E6AP by at least 40% to 80%, such as 50% to 70%, in a cell, compared to a control that has not been exposed to the antisense oligonucleotide.

[0283] 49. A pharmaceutical composition comprising the antisense oligonucleotide according to any of embodiments 1 to 48, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0284] 50. An in vivo or in vitro method for reducing the level of LIBE3A pre-mRNA transcript in a target cell, the method comprising exposing said cell to an effective amount of an antisense oligonucleotide of any of embodiments 1 to 48 or a pharmaceutical composition of embodiment 49.

[0285] 51 . The method of embodiment 50, wherein the cell is either a human cell or a mammalian cell.

[0286] 52. The method of embodiment 50 or embodiment 51 , wherein the level of LIBE3A pre- mRNA transcript is decreased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99%, compared to a control cell that has not been exposed to the antisense oligonucleotide.

[0287] 53. The method of embodiment 52, wherein the level of LIBE3A pre-mRNA transcript is decreased by at least 40% to 80%, such as 50% to 70%, compared to a control cell that has not been exposed to the antisense oligonucleotide.

[0288] 54. The method of any of embodiments 50 to 53, wherein the expression of E6AP is decreased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99%, compared to a control cell that has not been exposed to the antisense oligonucleotide. 55. The method of embodiment 54, wherein the expression of E6AP is decreased by at least 40% to 80%, such as 50% to 70%, compared to a control cell that has not been exposed to the antisense oligonucleotide.

[0289] 56. A method of treating or preventing a disease comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide of any of embodiments 1 to 48 or a pharmaceutical composition of embodiment 49 to a subject suffering from or susceptible to the disease.

[0290] 57. The antisense oligonucleotide according to any of embodiments 1 to 48, or the pharmaceutical composition according to embodiment 49 for use in the treatment of a disease.

[0291] 58. Use of the antisense oligonucleotide according to any of embodiments 1 to 48, or the pharmaceutical composition according to embodiment 49 for the preparation of a medicament for the treatment of a disease.

[0292] 59. The method of embodiment 56, the antisense oligonucleotide or pharmaceutical composition for use according to embodiment 57, or the use according to embodiment 58, wherein the disease is associated with increased levels of UBE3A pre-mRNA transcript.

[0293] 60. The method of embodiment 56, the antisense oligonucleotide or pharmaceutical composition for use according to embodiment 57, or the use according to embodiment 58, wherein the disease is selected from hypotonia, motor delays, intellectual disability (ID), and autism spectrum disorder (ASD).

[0294] 61. The method of embodiment 56, the antisense oligonucleotide or pharmaceutical composition for use according to embodiment 57, or the use according to embodiment 58, wherein the disease is Dup15q syndrome.

Claims

CLAIMS1. An antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of at least s nucleotides in length which is complementary to a region of a UBE3A pre-mRNA transcript, wherein the UBE3A pre-mRNA transcript comprises a duplication of at least 8 nucleotides and the contiguous nucleotide sequence is complementary to at least 8 nucleotides in each duplication.

2. An antisense oligonucleotide according to claim 1 , wherein the UBE3A pre-mRNA transcript comprises at least one of:(a) a duplication of at least one nucleobase sequence selected from SEQ ID NO 211 , SEQ ID NO 212, SEQ ID NO 213, SEQ ID NO 214, SEQ ID NO 215, SEQ ID NO 216, and SEQ ID NO 217; preferably wherein the UBE3A pre-mRNA transcript comprises a duplication of at least one nucleobase sequence selected from SEQ ID NO 214, SEQ ID NO 215 and SEQ ID NO 216; and(b) one or more nucleobase sequence selected from SEQ ID NO 218, SEQ ID NO 219, SEQ ID NO 220 and SEQ ID NO 221.

3. An antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of at least s nucleotides in length which is complementary to a region of a UBE3A pre-mRNA transcript, wherein the region of the UBE3A pre-mRNA transcript comprises a nucleobase sequence selected from SEQ ID NO 1 to SEQ ID NO 30, or a fragment thereof; preferably wherein the region of the UBE3A pre-mRNA transcript comprises a nucleobase sequence selected from SEQ ID NO 26 and SEQ ID NO 27, or a fragment thereof.

4. An antisense oligonucleotide according to claim 3, wherein the fragment is 8 to 40 nucleotides in length; preferably wherein the fragment is 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

5. An antisense oligonucleotide according to claim 3 or claim 4, wherein the contiguous nucleotide sequence is complementary to a nucleobase sequence selected from SEQ ID NO 31 to SEQ ID NO 120, or at least 8 nucleotides thereof;preferably wherein the contiguous nucleotide sequence is at least 75% complementary to a nucleobase sequence selected from SEQ ID NO 31 to SEQ ID NO 120; further preferably wherein the contiguous nucleotide sequence is fully complementary to a nucleobase sequence selected from SEQ ID NO 31 to SEQ ID NO 120.

6. An antisense oligonucleotide according to any of claims 3 to 5, wherein the contiguous nucleotide sequence comprises the nucleobase sequence of any one of SEQ ID NOs 121 to 210, or at least 8 nucleotides thereof; preferably wherein the contiguous nucleotide sequence comprises the nucleobase sequence of any one of SEQ ID NOs 121 to 210.

7. An antisense oligonucleotide according to any of claims 1 to 6, wherein the contiguous nucleotide sequence:(a) is complementary to a nucleobase sequence selected from SEQ ID NO 99, SEQ ID NO 108 or SEQ ID NO 110, or at least 8 nucleotides thereof; preferably wherein the contiguous nucleotide sequence is complementary to the nucleobase sequence of SEQ ID NO 99, SEQ ID NO 108 or SEQ ID NO 110; and / or(b) comprises the nucleobase sequence of SEQ ID NO 189, SEQ ID NO 198 or SEQ ID NO 200, or at least 8 nucleotides thereof; preferably wherein the contiguous nucleotide sequence comprises the nucleobase sequence of SEQ I D NO 189, SEQ I D NO 198 or SEQ I D NO 200.

8. An antisense oligonucleotide, wherein the antisense oligonucleotide is 8 to 40 nucleotides in length and comprises a contiguous nucleotide sequence of at least s nucleotides in length which is complementary to a region of a LIBE3A pre-mRNA transcript, wherein the contiguous nucleotide sequence comprises the nucleobase sequence of any one of SEQ ID NOs 312 to 365, or at least 8 nucleotides thereof.

9. An antisense oligonucleotide according to any of claims 1 to 8, wherein the contiguous nucleotide sequence is 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

10. An antisense oligonucleotide according to any of claims 1 to 9, comprising one or more modified nucleosides;preferably wherein the one or more modified nucleoside is selected from 2'-O- methoxyethyl-RNA (2’-MOE) and LNA nucleosides; preferably, wherein the antisense oligonucleotide comprises any number of LNAs at the 5’ end; and / or wherein the antisense oligonucleotide comprises any number of LNAs at the 3’ end.

11. An antisense oligonucleotide according to claim 10, wherein the antisense oligonucleotide comprises one or more 2'-MOE nucleosides; preferably wherein the antisense oligonucleotide comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32, 33, 34, 35, 36, 37, 38, 39 or 40 2'-MOE nucleosides.

12. An antisense oligonucleotide according to any of claims 10 to 11 , wherein the antisense oligonucleotide is a gapmer; preferably wherein the antisense oligonucleotide comprises the oligonucleotide of SEQ ID NO 290, SEQ ID NO 299 or SEQ ID NO 301 .

13. An antisense oligonucleotide according to claim 12, wherein the antisense oligonucleotide is SEQ ID NO: 290.

14. An antisense oligonucleotide according to claim 12, wherein the antisense oligonucleotide is SEQ ID NO: 299.

15. An antisense oligonucleotide according to claim 12, wherein the antisense oligonucleotide is SEQ ID NO: 301.

16. An antisense oligonucleotide according to any of claims 1 to 15, wherein the antisense oligonucleotide is capable of at least one of:(a) recruiting RNase H1 ; preferably wherein the antisense oligonucleotide is capable of recruiting RNase H1 to two sites on the LIBE3A pre-mRNA transcript;(b) reducing the level of the LIBE3A pre-mRNA transcript by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99% in a cell, compared to a control that has not been exposed to the antisense oligonucleotide;preferably wherein the antisense oligonucleotide is capable of reducing the level of the LIBE3A pre-mRNA transcript by at least 40% to 80%, such as 50% to 70%, in a cell, compared to a control that has not been exposed to the antisense oligonucleotide; and(c) reducing the level of expression of E3 ligase E6-associated protein (E6AP) by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99% in a cell, compared to a control that has not been exposed to the antisense oligonucleotide; preferably wherein the antisense oligonucleotide is capable of reducing the level of expression of E6AP by at least 40% to 80%, such as 50% to 70%, in a cell, compared to a control that has not been exposed to the antisense oligonucleotide.

17. A pharmaceutical composition comprising the antisense oligonucleotide according to any of claims 1 to 16, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

18. An in vivo or in vitro method for reducing the level of LIBE3A pre-mRNA transcript in a target cell, the method comprising exposing said cell to an effective amount of an antisense oligonucleotide of any of claims 1 to 16 or a pharmaceutical composition of claim 17; preferably wherein the cell is either a human cell or a mammalian cell.

19. The method of claim 18, wherein the level of at least one of LIBE3A pre-mRNA transcript and expression of E6AP is decreased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 99%, compared to a control cell that has not been exposed to the antisense oligonucleotide preferably wherein the level of at least one of LIBE3A pre-mRNA transcript and expression of E6AP is decreased by at least 40% to 80%, such as 50% to 70%, compared to a control cell that has not been exposed to the antisense oligonucleotide.

20. A method of treating or preventing a disease comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide of any of claims 1 to 16 or a pharmaceutical composition of claim 17 to a subject suffering from or susceptible to the disease; preferably wherein the disease is:(a) associated with increased levels of LIBE3A pre-mRNA transcript;(b) selected from hypotonia, motor delays, intellectual disability (ID), and autism spectrum disorder (ASD); and / or(c) Dup15q syndrome.

21. The antisense oligonucleotide according to any of claims 1 to 16, or the pharmaceutical composition according to claim 17 for use in the treatment of a disease or for use in the preparation of a medicament for the treatment of a disease; preferably wherein the disease is:(a) associated with increased levels of LIBE3A pre-mRNA transcript;(b) selected from hypotonia, motor delays, intellectual disability (ID), and autism spectrum disorder (ASD); and / or(c) Dup15q syndrome.

Citation Information

Patent Citations

  • Novel bicyclonucleoside and oligonucleotide analogues

    WO1998039352A1

  • Oligonucleotide analogues

    WO1999014226A2

  • Novel nucleosides and oligonucleotide analogues

    WO2000047599A1

  • L-RIBO-LNA analogues

    WO2000066604A2

  • Human rnase h and oligonucleotide compositions thereof

    WO2001023613A1