Hyaluronidase fusion protein, yeast engineered strain, and construction method therefor and use thereof

Abstract

A hyaluronidase fusion protein, a yeast engineered strain, and a construction method therefor and a use thereof are provided, belonging to the technical field of genetic engineering. Specifically, a hyaluronidase fusion protein, the amino acid sequence being as shown in SEQ ID NO. 1; a yeast engineered strain, which is obtained by introducing an encoding gene of a hyaluronidase fusion protein into yeast, the nucleotide sequence of the encoding gene being as shown in SEQ ID NO.5 ; the encoding gene sequence of the enzyme of the fusion protein is recombined into the genome of Pichia pastoris to obtain a Pichia pastoris engineered strain. It has been found that the Pichia pastoris engineered strain can effectively express the described fusion protein, and the expressed fusion protein has high enzyme activity and exhibits the activities of two enzymes.

Description

A hyaluronidase fusion protein, yeast engineering bacteria, and construction method and application Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to a hyaluronidase fusion protein, a yeast engineering bacterium, and a construction method and application. Background Art

[0002] Hyaluronic acid (HA), also known as hyaluronan, is a naturally occurring glycosaminoglycan found in living organisms. It is composed of repeating disaccharide units of D-glucuronic acid and N-acetylglucosamine, linked by alternating β(1-3) and β(1-4) glycosidic bonds. Hyaluronidase is an enzyme that can degrade HA, efficiently producing low-molecular-weight HA oligosaccharides. Hyaluronidase has broad applications in a variety of medical fields, including cosmetics, medical devices, formulations, and APIs.

[0003] Currently, most hyaluronidases sold on the market are obtained by extraction from animal testicles. Although a hyaluronidase extraction and preparation process suitable for the pharmaceutical field has been established and hyaluronidase protein with enzymatic activity has been obtained, the protein yield of hyaluronidase in this process is low, a large amount of organic chemical reagents are used in the extraction, and the production cost is high. The process of obtaining hyaluronidase is often costly and cumbersome, and there may be a risk of cross-infection of animal viruses during application.

[0004] Research on the preparation of hyaluronidase by biological means at home and abroad has achieved certain results. Studies on the preparation of hyaluronidase by Bacillus subtilis and Escherichia coli have been reported. Chinese patent CN200810134513.6 uses Escherichia coli to express hyaluronidase protein with enzymatic activity, but the expression product is located in the bacteria, resulting in a complex separation and purification process, affecting the yield and increasing costs and pollution risks. Chinese patent CN201410555212.6 uses Bacillus subtilis to prepare hyaluronidase, but the copy number expressed by Bacillus subtilis is usually small, and the expression level is lower than that of yeast, which has disadvantages such as difficulty in transformation and complex genetic manipulation.

[0005] The demand for hyaluronidase in industrial production is still huge. In order to realize the industrialization prospects of hyaluronidase, the market has higher expectations for the enzymatic activity of hyaluronidase. Hyaluronidase fermented at high density in fermentation tanks has certain price and purity advantages. Yeast is highly recognized in multiple fields such as medicine, beauty, and food, and is more easily accepted by consumers.

[0006] Traditional Pichia pastoris hyaluronidase expression requires strict methanol induction. However, this presents certain risks during factory scale-up: methanol is toxic and flammable, requiring explosion-proof workshops; the more methanol consumed, the greater the heat generated, requiring higher cooling capacity for the equipment; methanol, as a petrochemical product, is unsuitable for the production of some food additives, and with the onset of the oil crisis, methanol production costs have increased; and the H2O2 produced by methanol metabolism also has a certain impact on fermentation. Chinese patent documents CN201310597818.1 and CN202110245290.6 utilize methanol as an inducer.

[0007] The biological functions and specific applications of hyaluronic acid depend on its molecular weight. High-molecular-weight hyaluronic acid has a stable structure and possesses advantages such as strong water retention, high viscosity, and low fluidity. Low-molecular-weight hyaluronic acid can maintain joint lubrication and long-term moisturization, and has significant therapeutic effects in the treatment of osteoarthritis. Small-molecule hyaluronic acid can penetrate the dermis and dilate capillaries, and is widely used in the cosmetics field. Hyaluronic acid oligosaccharides have unique biological activities, such as stimulating fibroblast proliferation, collagen synthesis, and selectively killing cancer cells. Hyaluronic acid oligosaccharides have important application prospects in the food, health care, and pharmaceutical fields. Compared with physical and chemical methods, the hydrolysis method using hyaluronidase to prepare oligomeric hyaluronic acids of varying degrees of polymerization has the advantages of mild reaction, non-toxicity, and good reproducibility. Hyaluronidase is commonly used in the enzymatic preparation of hyaluronic acid oligosaccharides, primarily by cleaving the β(1-3) or β(1-4) glycosidic bonds at one position. The resulting hydrolysis products are mostly even-numbered oligosaccharides, such as hexasaccharides and octasaccharides, as described in Chinese patent applications CN103484513A and 202110937316.3. Currently, there are no successful studies using a single enzyme to prepare odd-numbered hyaluronic acid oligosaccharides.

[0008] Furthermore, in the prior art, when hydrolyzing hyaluronic acid from the β(1-3) and β(1-4) sites, two enzyme solutions need to be added in two steps, and one of the two enzyme solutions is a hydrolase and the other is a lyase prepared by an extraction method. The disadvantage of this method is that if you want to prepare these two enzyme solutions, you need to prepare them twice: ferment the β(1-3) hydrolase once and then extract the β(1-4) enzyme once, which is relatively cumbersome. In addition, the β(1-4) enzyme prepared by the extraction method has a cumbersome process. If purchased directly, it is expensive and is not suitable for large-scale factory applications.

[0009] Summary of the Invention

[0010] In response to the deficiencies of the prior art, the present invention provides a hyaluronidase fusion protein, a yeast engineered bacterium, and a construction method and application.

[0011] A hyaluronidase fusion protein, the amino acid sequence of the hyaluronidase fusion protein is shown in SEQ ID NO.1.

[0012] The coding gene of the above-mentioned hyaluronidase fusion protein, the nucleotide sequence of the coding gene is shown in SEQ ID NO.5.

[0013] A yeast engineering bacterium, wherein the yeast engineering bacterium is a yeast into which a gene encoding a hyaluronidase fusion protein is introduced, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO.5.

[0014] Preferably according to the present invention, the yeast is Pichia pastoris.

[0015] A Pichia pastoris HAase(an)-His-9K-GS115 was deposited in the China Center for Type Culture Collection, with the deposit address being Wuhan University, Wuhan, China, with the deposit number being CCTCC NO: M20231485 and the deposit date being August 15, 2023.

[0016] The method for constructing the above-mentioned yeast engineering bacteria comprises the following steps:

[0017] (1) The hyaluronidase fusion protein encoding gene sequence SEQ ID NO. 5 was inserted into the EcoRI and NotI restriction sites of the pPIC9K vector by homologous recombination to obtain the recombinant plasmid pPIC9K-HAase-Fus;

[0018] (2) The hyaluronidase fusion protein encoding gene sequence SEQ ID NO. 5 was inserted into the pGAPZαA vector by homologous recombination to obtain the recombinant plasmid pGAPZαA-HAase-Fus;

[0019] (3) The recombinant plasmid pPIC9K-HAase-Fus obtained in step (1) was linearized using the restriction endonuclease SalI to obtain a linearized fragment, which was then transformed into Pichia pastoris competent cells to screen and obtain the engineered bacteria P. pastoris / pPIC9K-HAase-Fus containing the recombinant hyaluronidase fusion gene;

[0020] (4) The recombinant plasmid pGAPZαA-HAase-Fus obtained in step (2) was linearized using restriction endonuclease AvrII to obtain a linearized fragment, which was then transformed into competent cells of the engineered bacteria P. pastoris / pPIC9K-HAase-Fus obtained in step (3), and the engineered bacteria P. pastoris / pPIC9K-HAase-Fus / pGAPZαA-HAase-Fus containing the recombinant hyaluronidase fusion gene was screened.

[0021] According to the present invention, preferably, in step (3), the Pichia pastoris is Pichia pastoris GS115.

[0022] Preferably, according to the present invention, in step (3), after culturing in MD medium, screening is performed in a medium containing Geneticin G418.

[0023] Preferably, according to the present invention, in step (4), screening is performed using a culture medium containing bleomycin.

[0024] The use of the above-mentioned yeast engineering bacteria, Pichia pastoris HAase(an)-His-9K-GS115, in the preparation of a hyaluronidase fusion protein, the amino acid sequence of the hyaluronidase fusion protein is shown in SEQ ID NO.1.

[0025] The application of the above-mentioned yeast engineering bacteria, Pichia pastoris HAase(an)-His-9K-GS115, in the degradation of hyaluronic acid.

[0026] The application of the above-mentioned yeast engineering bacteria, Pichia pastoris HAase(an)-His-9K-GS115, in the production of odd-numbered hyaluronic acid oligosaccharides.

[0027] Preferably, according to the present invention, the odd-numbered hyaluronic acid oligosaccharides include trisaccharides, pentasaccharides, heptasaccharides and nonasaccharides.

[0028] The beneficial effects of the present invention are as follows:

[0029] 1. The present invention is the first to fuse leech hyaluronidase with mountain giant ant hyaluronidase to form a new enzyme, namely a fusion protease. The inventors recombined the coding gene sequence of the fusion protease into the genome of Pichia pastoris to obtain Pichia pastoris engineered bacteria. The inventors found that the Pichia pastoris engineered bacteria can not only effectively express the fusion protein, but also that the expressed fusion protein has high enzymatic activity and has the activity of two enzymes. It can simultaneously hydrolyze from the β (1-3) and β (1-4) sites, effectively degrading hyaluronic acid to produce odd-numbered hyaluronic acid oligosaccharides, including trisaccharides, pentasaccharides, heptasaccharides, nonasaccharides, etc.

[0030] 2. The present invention also constructed a Pichia pastoris engineered strain with high-yield hyaluronidase fusion protein, which further improved the enzyme activity of the fusion protein, reaching 153386U / mL in the shake flask stage and 1243462.72U / mL after high-density fermentation in the fermenter. At the same time, the high-yield hyaluronidase fusion protein recombinant strain can be induced with methanol or glycerol, and different inducers can be selected for fermentation in industrial production; the glycerol induction method can greatly improve the safety in actual operation and reduce the harm to the environment.

[0031] 3. The inventors also found that the growth rate of the engineered Pichia pastoris was almost the same as that of the control Pichia pastoris. That is, the gene sequence encoding the fusion protease was recombined into the genome of Pichia pastoris and expressed without affecting the growth of Pichia pastoris.

[0032] 4. The hyaluronidase fusion protein constructed by the present invention can provide a new strategy for the in vitro preparation of low-molecular-weight hyaluronic acid, realizes the strategy of using Pichia pastoris recombinant transformants to secrete and express hyaluronidase, and lays the foundation for the industrial production of recombinant hyaluronidase. It can produce hyaluronidase proteins with good hydrophilicity, complete structure, and excellent function in large quantities and use them as raw materials for cosmetics, medical beauty products, etc. The odd-numbered hyaluronic acid oligosaccharides prepared by the present invention not only enrich the diversity of oligosaccharide structures, but also have very important significance for studying the relationship between hyaluronic acid oligosaccharides of different structural types and the occurrence and development of diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] FIG1 is a diagram showing the PCR amplification results of pPIC9K-HAase-Fus;

[0034] In the figure: M is a 5000 bp DNA marker; 1 is the result of PCR test using vector universal primers.

[0035] Figure 2 is a graph showing the results of 4 g / L geneticin screening.

[0036] FIG3 is a polyacrylamide gel electrophoresis diagram of the fermentation supernatant;

[0037] In the figure: M is a 250 kDa protein molecular weight marker; 1 is the supernatant after 48 hours of shake flask induction; 2 is the supernatant after 96 hours of shake flask induction.

[0038] FIG4 is a polyacrylamide gel electrophoresis diagram of the purified protein;

[0039] In the figure: M is a 250 kDa protein molecular weight marker; 1 is the purified fusion protein.

[0040] Figure 5 shows the results of hyaluronidase activity detection in a 3L fermentation tank fermentation of the hyaluronidase fusion protein of P. pastoris / pPIC9K-HAase-Fus yeast.

[0041] FIG6 is a graph showing the screening results of 1 g / L bleomycin.

[0042] Figure 7 is a polyacrylamide gel protein electrophoresis diagram;

[0043] In the figure: M is a 250 kDa protein molecular weight marker;

[0044] 1 is the blank control GS115 fermentation supernatant;

[0045] 2 is the fermentation supernatant of recombinant hyaluronidase fusion protein P. pastoris GS115 / pPIC9K-HAase-Fus induced by methanol method;

[0046] 3 is the fermentation supernatant of P. pastoris GS115 / pPIC9K-HAase-Fus / pGAPZαA-HAase-Fus with high yield of recombinant hyaluronidase fusion protein induced by methanol method;

[0047] 4 is the fermentation supernatant of P. pastoris GS115 / pPIC9K-HAase-Fus / pGAPZαA-HAase-Fus, which was induced by the glycerol method to produce high-yield recombinant hyaluronidase fusion protein.

[0048] Figure 8 is a graph showing the results of hyaluronidase activity detection in a 3L fermentation tank fermentation of the hyaluronidase fusion protein of the yeast P. pastoris GS115 / pPIC9K-HAase-Fus / pGAPZαA-HAase-Fus induced by methanol.

[0049] Figure 9 shows the results of hyaluronidase activity detection in a 3L fermentation tank of the hyaluronidase fusion protein of the yeast P. pastoris GS115 / pPIC9K-HAase-Fus / pGAPZαA-HAase-Fus induced by glycerol.

[0050] Figure 10 is a diagram of oligosaccharide detection by LC-MS;

[0051] The mass-to-charge ratio of 558.2059 in the figure is hyaluronate trisaccharide C 19 H 29 NO 18 [MH] - peak.

[0052] Figure 11 is a diagram of oligosaccharide detection by LC-MS;

[0053] The mass-to-charge ratio of 937.6176 in the figure is hyaluronic acid pentasaccharide C 33 H 51 N3O 28 [MH] - peak.

[0054] Figure 12 is a diagram of oligosaccharide detection by LC-MS;

[0055] The mass-to-charge ratio of 1302.4556 in the figure is hyaluronic acid heptasaccharide C 46 H 70 N4O 39 [MH] - peak.

[0056] Figure 13 is a diagram of oligosaccharide detection by LC-MS;

[0057] The mass-to-charge ratio of 1667.1687 in the figure is hyaluronic acid nonasaccharide C 59 H 89 N5O 50 [MH] - peak. DETAILED DESCRIPTION

[0058] The technical solution of the present invention is further described below in conjunction with embodiments, but the protection scope of the present invention is not limited thereto.

[0059] The contents not described in detail in the examples are based on conventional techniques in the art; the experimental materials and reagents not described in detail are common commercial products.

[0060] Pichia pastoris GS115 is available from Shanghai Zeye Biotechnology Co., Ltd. and is a common commercial product.

[0061] YDP medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L, and the balance water.

[0062] Initial expression medium BMGY: yeast extract 10 g / L, peptone 20 g / L, K2HPO4 3 g / L, KH2PO4 11.8 g / L, amino acid-free yeast nitrogen base YNB 3.4 g / L, ammonium sulfate 10 g / L, biotin 4 × 10 -4 g / L, glycerol 10g / L, the balance water.

[0063] Induction expression medium BMMY: yeast extract 10g / L, peptone 20g / L, K2HPO4 3g / L, KH2PO4 11.8g / L, YNB 3.4g / L, ammonium sulfate 10g / L, biotin 4×10 -4 g / L, methanol 10mL / L, the balance water.

[0064] BMGY medium: yeast extract 10 g / L, peptone 20 g / L, K2HPO4 3 g / L, KH2PO4 11.8 g / L, YNB 3.4 g / L, ammonium sulfate 10 g / L, biotin 4 × 10 4 g / L, glycerol 40g / L, and the balance water.

[0065] BSM medium: glycerol 40 g / L, K2SO4 18 g / L, KOH 4.13 g / L, 85% H3PO4 26.7 mL / L, CaSO4·2H2O 0.93 g / L, MgSO4·7H2O 14.9 g / L, 4.4 mL / L filter-sterilized PTM1, and the balance water.

[0066] PTM1 formula: CuSO4·5H2O 6 g / L, KI 0.09 g / L, MnSO4·H2O 3 g / L, H3BO3 0.02 g / L, MoNa2O4·2H2O 0.2 g / L, CoCl2·6H2O 0.92 g / L, ZnCl2 20 g / L, FeSO4·7H2O 65 g / L, biotin 0.2 g / L, H2SO4 5.0 mL / L, and the balance is water.

[0067] Example 1

[0068] Design of recombinant fusion proteins and their encoding genes

[0069] 1. Recombinant fusion protein molecular design

[0070] The amino acid sequence 1 of leech hyaluronidase (GenBank: KJ026763) and the amino acid sequence 2 of mountain giant ant hyaluronidase (GenBank: FX985505.1) were obtained from the NCBI website. Their respective signal peptide regions were analyzed, and the part without signal peptide was excerpted. The sequence of their CDS coding region was connected to the two gene sequences using a flexible signal peptide with the amino acid sequence (GGGGS)3 to splice into a new hyaluronidase sequence of 836 amino acids including the start codon.

[0071] 2. Theoretical properties of recombinant hyaluronidase fusion protein

[0072] The molecular weight of the recombinant hyaluronidase fusion protein is 94.84 kDa and the isoelectric point is 8.56; the amino acid sequence of the recombinant hyaluronidase fusion protein is shown in SEQ ID NO.1:

[0073] Example 2

[0074] Construction of fusion protein expression system

[0075] The flexible linker sequence is shown in SEQ ID NO.2:

[0076] GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCT connected the two genes.

[0077] Design the linker insertion primers and insert the primers designed for SEQ ID NO.2 between the two gene segments for connection:

[0078] The forward primer is shown in SEQ ID NO.3:

[0079] Primer F1: acgtcgaagcctgtaagaagGGTGGTGGTGGTTCTGGTGG

[0080] The reverse primer is shown in SEQ ID NO.4:

[0081] Primer R1: tgtggagaagaacctctcaaAGTCTTAGAACCACCACCACCAGA

[0082] The designed total gene sequence is shown in SEQ ID NO.5.

[0083] Based on the affinity of Pichia pastoris, the protein sequence was codon-optimized to obtain the recombinant fusion protein nucleotide sequence shown in SEQ ID NO. 5. The recombinant fusion protein nucleotide sequence was commissioned to BGI for whole-gene synthesis. Homologous recombination was performed using the ClonExpress II One Step Cloning Kit. EcoRI and NotI were used as restriction sites for cloning into the Pichia pastoris expression vector pPIC9K, which was then transformed into E.coil DH5α and plasmid extracted. The recombinant expression vector pPIC9K-HAase-Fus (FUS refers to fusion and HAase refers to hyaluronidase) was obtained. PCR verification and DNA sequencing comparison, as shown in Figure 1, confirmed the successful construction of the target plasmid.

[0084] The reaction system is as follows:

[0085] PCR reaction system: 1 μL (about 20 ng) of recombinant fusion protein DNA template; 10 μL of PrimeSTAR Max Premix (2X); 1 μL of primer F2 (10 μM); 1 μL of primer R2 (10 μM); add ddH2O to 50 μL.

[0086] Primer F2: 5'-gctgaagcttacgtagaattcATGAAGGAAATCGCTGTCACTATTG-3'SEQ ID NO.6;

[0087] Primer R2: 5'-aaggcgaattaattcgcggccgcTTAATGCAAGGTAAACTTCTTAATAGCTG-3'SEQ ID NO.7.

[0088] PCR reaction program: 98°C, 3 min; 98°C 10 s, 55°C 10 s, 72°C 40 s, 38 cycles; 72°C 5 min; storage at 4°C; the target gene was obtained using this program.

[0089] Homologous recombination system: 2 μL of gene (about 100 ng); 2 μL of vector (about 160 ng); 4 μL of 5×CE II Buffer, 2 μL of Exnase II; add ddH2O to 20 μL; reaction conditions: 37°C for 30 min.

[0090] The recombinant plasmid pPIC9K-HAase-Fus was linearized with the restriction endonuclease SalI. The product was purified and transformed into prepared P. pastoris GS115 expression host competent cells by electroporation. Positive transformants were then plated onto histidine-deficient MD plates to screen for positive transformants. Single colonies grown on the histidine-deficient MD plates were picked onto YPD plates supplemented with 4 mg / mL Geneticin G418. P. pastoris / pPIC9K-HAase-Fus strains expressing a high copy number of the recombinant hyaluronidase fusion protein gene were screened using YPD plates supplemented with 4 mg / mL Geneticin G418 (see Figure 2).

[0091] Example 3

[0092] Shake flask fermentation of P. pastoris / pPIC9K-HAase-Fus strain expressing recombinant hyaluronidase fusion protein gene

[0093] Shake flask fermentation procedures were as follows: A P. pastoris / pPIC9K-HAase-Fus strain was inoculated into 50 mL of YPD medium and cultured at 30°C, 200 rpm, for 24 hours to prepare a seed solution. A 10% volume fraction of the seed solution was transferred to 50 mL of initial expression medium, BMGY, to enrich the cells and cultured at 30°C, 200 rpm, for 24 hours.

[0094] The cells were collected by centrifugation, washed with sterile water and replaced with 40 mL of induction expression medium BMMY, cultured at 30°C and 200 rpm, and 1% methanol (containing 1.2% (v / v) PTM1) was added to the fermentation shake flask every 24 h until the induction expression was 96 h.

[0095] Enzyme activity assay: 0.8 mL of HA (hyaluronic acid, 120 wDa) solution was mixed with 0.1 mL of supernatant and 0.1 mL of PBS (pH 7). The mixture was incubated at 37°C in a water bath for 15 minutes, then immediately boiled for 5 minutes to terminate the reaction. After cooling, the absorbance at 540 nm was measured. The enzyme activity of the recombinant hyaluronidase fermented in shake flasks was calculated to be 95,352 U / mL.

[0096] For polyacrylamide gel analysis: Take the shake flask fermentation supernatant and thoroughly mix it with 5× polyacrylamide gel electrophoresis protein loading buffer. Boil it at 100°C for 10 minutes. After cooling to room temperature, load the three groups of samples and protein molecular weight markers separately. Place the electrophoresis tank on ice and run electrophoresis at 150V for 50 minutes. Wash the gel in clean water for 15 minutes and then stain it in Coomassie Brilliant Blue solution on a shaker at room temperature for 15 minutes. Destain the gel in clean water and shake it at 50 rpm at room temperature. The next day, when protein bands are clear, analyze it.

[0097] Polyacrylamide gel detection showed that the molecular weight of the target protein was significantly produced at the predicted size of 94.84 kDa, as shown in Figure 3. After the protein was purified, polyacrylamide gel detection was performed again. As shown in Figure 4, a single band was observed, indicating that the protein band produced at 94.84 kDa was indeed the target protein, verifying that this recombinant strain can induce the expression of hyaluronidase.

[0098] Example 4

[0099] High-density fermentation of P. pastoris / pPIC9K-HAase-Fus strain expressing recombinant hyaluronidase fusion protein gene in fermenter

[0100] A single yeast colony of P. pastoris / pPIC9K-HAase-Fus was picked from the plate into 50 mL YPD liquid culture medium for strain activation. The culture was cultured at 30°C and 200 rpm for 24 hours. After the liquid became turbid, it was examined under a microscope. Once the strain morphology was confirmed to be correct, the first-level seed liquid was obtained.

[0101] The first-level seed solution was transferred to 100 mL of BMGY medium at a volume fraction of 10% by inoculation, cultured at 30°C, 200 rpm for 24 days, and then examined under a microscope. Once the strain morphology was confirmed to be correct, the second-level seed solution was obtained.

[0102] The secondary seed liquid was inoculated into a 3L fermenter at a volume fraction of 10%. The fermenter was initially filled with 1L of BSM culture medium. The initial fermentation temperature was controlled at 30°C, the pH was adjusted to 5.5 using ammonia water, the initial stirring speed was 500 rpm, and the ventilation volume was 2.0 vvm. The dissolved oxygen in the tank was controlled to be above 20% by adjusting the stirring speed and ventilation volume.

[0103] After approximately 20 hours of fermentation, when the glycerol in the BSM medium was depleted (as monitored using a biosensor analyzer), glycerol containing 1.2% (v / v) PTM1 was fed to promote secondary bacterial growth. Using dissolved oxygen correlation, glycerol was fed for 12 hours, maintaining the dissolved oxygen at 20%-30%. When the dissolved oxygen rapidly recovered again, the biosensor analyzer was used again for monitoring. After the fed glycerol was depleted, starvation culture was continued for 1 hour. Induction was then initiated with methanol containing 1.2% (v / v) PTM1. The temperature was set at 22°C and the rotation speed was 1000 rpm, with a methanol induction rate of 5 mL / h. Dissolved oxygen changes were monitored, and the methanol-dissolved oxygen correlation was established. The dissolved oxygen was maintained at 20%-30% by feeding methanol. Fermentation continued for 120 hours, with enzyme activity samples taken every 12 hours. At the 96th hour, the enzyme activity reached a maximum of 741,638.37 U / mL (see Figure 5).

[0104] Example 5

[0105] Construction of an engineered yeast strain expressing high-yield recombinant hyaluronidase fusion protein gene

[0106] The hyaluronidase fusion protein encoding gene sequence SEQ ID NO.5 was subjected to homologous recombination using the ClonExpress II One Step Cloning Kit, and EcoRI and NotI were selected as restriction sites to clone into the pGAPZαA vector. The vector was then transformed into E.coil DH5α. After bacterial testing and sequencing confirmed that the constructed pGAPZαA-HAase-Fus sequence was correct, the recombinant expression plasmid pGAPZαA-HAase-Fus was obtained.

[0107] The reaction system is as follows:

[0108] PCR reaction system: 1 μL (about 20 ng) of recombinant fusion protein DNA template; 10 μL of PrimeSTAR Max Premix (2X); 1 μL of primer F3 (10 μM); 1 μL of primer R3 (10 μM); add ddH2O to 50 μL.

[0109] Primer F3: 5'-agagaggctgaagctgaattcATGAAGGAAATCGCTGTCACTATTG-3'SEQ ID NO.8;

[0110] Primer R3:

[0111] 5'-tgttctagaaagctggcggccgcTTAATGCAAGGTAAACTTCTTAATAGCTG-3'SEQ ID NO.9.

[0112] PCR reaction program: 98°C, 3 min; 98°C 10 s, 55°C 10 s, 72°C 40 s, 38 cycles; 72°C 5 min; storage at 4°C; the target gene was obtained using this program.

[0113] Homologous recombination system: 2 μL of gene (about 100 ng); 2 μL of vector (about 160 ng); 4 μL of 5×CE II Buffer, 2 μL of Exnase II; add ddH2O to 20 μL; reaction conditions: 37°C for 30 min.

[0114] The recombinant plasmid pGAPZαA-HAase-Fus was linearized with restriction endonuclease AvrII and then electroporated into competent cells of P. pastoris GS115 / pPIC9K-HAase-Fus. The recombinant transformants were screened on YPD plates containing 1 g / L bleomycin (as shown in Figure 6) to obtain a high-copy hyaluronidase fusion protein gene combined strain P. pastoris GS115 / pPIC9K-HAase-Fus / pGAPZαA-HAase-Fus.

[0115] P. pastoris GS115 / pPIC9K-HAase-Fus / pGAPZαA-HAase-Fus, also known as Pichia pastoris HAase(an)-His-9K-GS115, has been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M 20231485 and the deposit date on August 15, 2023.

[0116] Example 6

[0117] Shake flask fermentation of an engineered yeast strain expressing a high-yield recombinant hyaluronidase fusion protein gene

[0118] The high-yield strain P. pastoris GS115 / pPIC9K-HAase-Fus / pGAPZαA-HAase-Fus obtained in Example 5 was fermented in shake flasks according to the method of Example 3, and the enzyme activity was determined to be 153386 U / mL using the DNS method (according to the enzyme activity detection method in Example 3).

[0119] The fermentation supernatant of the shake flask was subjected to polyacrylamide gel protein electrophoresis analysis. The protein band of this high-yield strain (lane 3) and the protein band of the control strain P. pastoris GS115 / pPIC9K-HAase-Fus (lane 2) were significantly larger in lane 3 than in lane 2. The protein expression level of this high-yield strain was significantly higher than that of P. pastoris GS115 / pPIC9K-HAase-Fus, as shown in Figure 7.

[0120] The pure glycerol shake flask fermentation procedure is as follows: a single colony is picked and inoculated into 50 mL of YPD medium and cultured at 30°C, 200 rpm for 24 hours to prepare a seed solution. A 10% volume fraction of the seed solution is then transferred to 50 mL of initial expression medium, BMGY, to enrich the cells and culture at 30°C, 200 rpm for 96 hours.

[0121] The results of polyacrylamide gel protein electrophoresis of the supernatant of the fermentation of the pure glycerol culture combination strain are shown in Figure 7. As shown in lane 4, there is a clear protein band at a theoretical molecular weight of approximately 94.84 kDa, indicating that the combination strain can produce hyaluronidase using both methanol and glycerol as carbon sources.

[0122] Example 7

[0123] High-density fermentation of engineered yeast strains for high-yield hyaluronidase fusion protein in fermenters

[0124] High-density fermentation of the high-yielding strain P. pastoris GS115 / pPIC9K-HAase-Fus / pGAPZαA-HAase-Fus obtained in Example 5 with methanol as the carbon source was carried out in the manner of Example 4. The fermentation results are shown in FIG8 , and the enzyme activity measured at 96 h was 1,243,462.72 U / mL.

[0125] High-density fermentation using glycerol as the carbon source: A single colony of the yeast P. pastoris GS115 / pPIC9K-HAase-Fus / pGAPZαA-HAase-Fus was picked from a plate into 50 mL of YPD liquid medium for strain activation. The culture was incubated at 30°C and 200 rpm for 24 h. When the liquid became turbid, microscopic examination was performed. Once the strain morphology was confirmed to be correct, the primary seed solution was obtained.

[0126] The first-level seed solution was transferred to 100 mL of BMGY at a volume fraction of 10% inoculum, cultured at 30°C, 200 rpm, and cultured for 24 hours. The second-level seed solution was obtained after the strain morphology was confirmed to be correct by microscopic examination.

[0127] This secondary seed solution was inoculated into a 3L fermenter at a 10% volume fraction. The fermenter was initially filled with 1L of BSM medium. The initial fermentation temperature was controlled at 30°C, the pH was adjusted to 5.5 using ammonia, the initial stirring speed was 500 rpm, and the ventilation rate was 2.0 vvm. The dissolved oxygen in the tank was maintained above 20% by adjusting the stirring speed and ventilation rate. During the fermentation process, the pH was automatically controlled at 5.5 by adding ammonia. When the glycerol in the BSM medium was depleted (as detected using a biosensor analyzer), glycerol was added and 70% (v / v) glycerol containing 1.2% (v / v) PTM1 was added. The dissolved oxygen (DO) was controlled above 20% and fermented for 120 hours. The fermentation results are shown in Figure 9. According to the enzyme activity detection method in Example 3, the enzyme activity was measured at 510254.34 U / mL at the 96th hour.

[0128] Example 8

[0129] Preparation and detection of hyaluronic acid odd-number oligosaccharides

[0130] Hyaluronic acid powder with a molecular weight of 5-10wDa was dissolved in deionized water at a concentration of 40mg / mL and allowed to fully dissolve overnight. A fusion protease solution (the supernatant prepared by methanol induction in Example 7) was added at a final concentration of 5000U / mL and allowed to hydrolyze at 37°C: 12h for trisaccharide; 10h for pentasaccharide; 8h for heptasaccharide; and 4h for nonasaccharide. The solution was quenched in boiling water at 100°C and filtered through a 0.22μm filter membrane.

[0131] The product was subjected to liquid chromatography-mass spectrometry analysis. Chromatographic conditions: using Q Exactive TM Plus combined quadrupole Orbitrap TMThe mass spectrometer used a HYPERSIL GOLD™ Vanquish™ C18 column (1.9 μm, 2.1 × 100 mm) with a mobile phase consisting of 0.1% formic acid in water (A) and acetonitrile (B) at a flow rate of 0.3 mL / min and a column temperature of 30°C. Mass spectrometry conditions included a dual-jet electrospray ionization source in negative ion mode, high-purity nitrogen as the nebulizer gas, a drying gas temperature of 350°C, a flow rate of 11 L / min, and a nebulizer pressure of 45 psi. The sheath gas temperature and flow rate were the same as those for the drying gas. The capillary voltage was 4 kV, the fragmentor voltage was 120 V, the cone voltage was 60 V, and the octopole RF peak (radio frequency) voltage was 750 V. The instrument was calibrated with a tuning solution before use, and reference solution was continuously added for mass calibration during use.

[0132] The results are shown in the figure below, as follows:

[0133] The mass-to-charge ratio of 558.2059 in Figure 10 is hyaluronate trisaccharide C 19 H 29 NO 18 [MH] - peak;

[0134] The mass-to-charge ratio of 937.6176 in Figure 11 is hyaluronic acid pentasaccharide C 33 H 51 N3O 28 [MH] - peak;

[0135] The mass-to-charge ratio of 1302.4556 in Figure 12 is hyaluronan heptasaccharide C 46 H 70 N4O 39 [MH] - peak;

[0136] The mass-to-charge ratio of 1667.1687 in Figure 13 is hyaluronic acid nonasaccharide C 59 H 89 N5O 50 [MH] - peak.

[0137] The present invention is the first to fuse the genes of leech hyaluronidase and mountain giant ant hyaluronidase to form a new enzyme, namely hyaluronic acid fusion protease. The inventors found that the Pichia pastoris engineered bacteria can not only effectively express the fusion protein, but also the expressed fusion protein has high enzymatic activity. It also has the advantages of two enzymes and can simultaneously hydrolyze hyaluronic acid from the β (1-3) and β (1-4) sites, effectively degrading hyaluronic acid to produce odd-numbered hyaluronic acid oligosaccharides, including trisaccharides, pentasaccharides, heptasaccharides, nonasaccharides, etc.

[0138] The Pichia pastoris engineered strain with a high yield of hyaluronidase fusion protein provided by the present invention significantly improves the enzyme activity of the fusion protein, reaching 153,386 U / mL in the shake flask stage and 1,243,462.72 U / mL after high-density fermentation in a fermenter. At the same time, the high-yield hyaluronidase fusion protein recombinant strain can be induced with either methanol or glycerol, and different inducers can be selected for fermentation in industrial production; the glycerol induction method can greatly improve safety in actual operation and reduce harm to the environment.

Claims

1. A hyaluronidase fusion protein, the amino acid sequence of the hyaluronidase fusion protein is shown in SEQ ID NO.

1.

2. The coding gene of the hyaluronidase fusion protein according to claim 1, the nucleotide sequence of the coding gene is shown in SEQ ID NO.

5.

3. A genetically engineered yeast strain, characterized in that, The engineered yeast strain is obtained by introducing the coding gene of the hyaluronidase fusion protein into yeast, and the nucleotide sequence of the coding gene is shown in SEQ ID NO.

5.

4. The engineered yeast strain according to claim 3, wherein, The yeast is Pichia pastoris.

5. A Pichia pastoris HAase(an)-His-9K-GS115, which is deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, China, the deposit number is CCTCC NO: M20231485, and the deposit date is August 15, 2023.

6. The method for constructing the engineered yeast strain according to claim 3 or 4, comprising the following steps: (1) Insert the coding gene sequence SEQ ID NO5 of the hyaluronidase fusion protein into the EcoRI and NotI restriction enzyme sites of the pPIC9K vector by homologous recombination to obtain the recombinant plasmid pPIC9K-HAase-Fus; (2) Insert the coding gene sequence SEQ ID NO.5 of the hyaluronidase fusion protein into the pGAPZαA vector by homologous recombination to obtain the recombinant plasmid pGAPZαA-HAase-Fus; (3) Linearize the recombinant plasmid pPIC9K-HAase-Fus obtained in step (1) using the restriction enzyme SalI to obtain a linearized fragment, and transform it into Pichia pastoris competent cells, and screen to obtain the engineered strain P.pastoris / pPIC9K-HAase-Fus of the recombinant hyaluronidase fusion protein gene; (4) Linearize the recombinant plasmid pGAPZαA-HAase-Fus obtained in step (2) using the restriction enzyme AvrII to obtain a linearized fragment, and transform it into the competent cells of the engineered strain P.pastoris / pPIC9K-HAase-Fus obtained in step (3), and screen to obtain the engineered strain P.pastoris / pPIC9K-HAase-Fus / pGAPZαA-HAase-Fus of the recombinant hyaluronidase fusion protein gene.

7. The construction method according to claim 6, characterized in that In step (3), the Pichia pastoris is Pichia pastoris GS115.

8. The construction method according to claim 6, characterized in that, In step (3), after culturing with MD medium, screening is carried out in a medium containing geneticin G418.

9. The construction method according to claim 6, wherein, In step (4), screening is carried out in a medium containing bleomycin.

10. The application of the engineered yeast strain according to claim 3 or 4 and the Pichia pastoris HAase(an)-His-9K-GS115 according to claim 5 in the preparation of the hyaluronidase fusion protein, the amino acid sequence of the hyaluronidase fusion protein is shown in SEQ ID NO.

1.

11. Use of the engineered yeast strain according to claim 3 or 4, and Pichia pastoris HAase(an)-His-9K-GS115 according to claim 5 in the degradation of hyaluronic acid.

12. Use of the engineered yeast strain according to claim 3 or 4, and Pichia pastoris HAase(an)-His-9K-GS115 according to claim 5 in the production of odd-numbered hyaluronic acid oligosaccharides; The odd-numbered hyaluronic acid oligosaccharides include trisaccharide, pentasaccharide, heptasaccharide, and nonasaccharide.

Images