Liver cancer target, and liver cancer inhibition reagent and use thereof

Abstract

The present invention provides a liver cancer target, and a liver cancer inhibition reagent and a use thereof. According to the present invention, an important pathogenic factor EC-HBV-Fs of liver cancer is determined, the pathogenic factor EC-HBV-Fs can be used as a target to prepare a targeted regulation reagent, and is used for treating liver cancer and blocking a liver cancer process, or the pathogenic factor EC-HBV-Fs can be used as a target to screen for a reagent for targeted regulation. The present invention further provides a nucleic acid inhibitor for targeted regulation. The present invention further provides a target for liver cancer detection. The present invention provides a new way for clinical treatment and detection of liver cancer.

Description

Liver cancer targets, liver cancer inhibitory agents and their applications

[0001] This application claims priority to patent application No. CN 202311870164.5, filed on December 29, 2023; the entire contents of which are incorporated herein. Technical Field

[0002] The present invention relates to the field of biomedicine; in particular, the present invention relates to liver cancer targets, liver cancer inhibitory agents and applications thereof. Background Art

[0003] Liver cancer is a complex disease that is closely associated with multiple risk factors. Risk factors such as aflatoxin, alcohol consumption and smoking, hepatitis B virus, and hepatitis C virus may all contribute to the occurrence and development of liver cancer. Due to its high malignancy, rapid development, and strong metastatic ability, liver cancer is prone to recurrence after treatment. Clinically, simple surgical treatment, hepatic artery ligation and catheterization, interventional treatment, local treatment, radiotherapy, and other treatment methods are difficult to achieve satisfactory results. In terms of therapeutic drugs, sorafenib is an inhibitory drug approved for the treatment of liver cancer. However, some studies have shown that adjuvant sorafenib therapy does not improve recurrence-free survival and overall survival rates; the efficacy of various other treatment options for liver cancer is also not ideal or is still imperfect.

[0004] As one of the risk factors for liver cancer, hepatitis B virus (HBV) belongs to the Hepadnaviridae family and is a DNA virus with a circular genome of 3200bp in length (PMID: 32102898). In recent years, the development of small nucleic acid drugs has progressed rapidly, providing a new direction for the treatment of HBV-related diseases, but no drugs have been approved for clinical use. The current main research and development strategy for chronic HBV infection is to target the HBV virus itself, and there is still a lack of key targets for blocking the interaction between HBV virus and humans. In addition, no targets that are closely related to the HBV genome and have an effect on the treatment of liver cancer have been found in this field.

[0005] Therefore, it is urgent to find new targets and targeted inhibitors for treating liver cancer and blocking the progression of liver cancer. Summary of the Invention

[0006] The purpose of the present invention is to provide a novel liver cancer target (therapeutic target or detection target), a liver cancer inhibitory agent and applications thereof.

[0007] In a first aspect of the present invention, there is provided the use of an isolated polynucleotide in preparing (i) a targeted agent for inhibiting liver cancer and its progression; wherein the polynucleotide comprises: (a) a polynucleotide having a nucleotide sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and / or SEQ ID NO: 5, or a polynucleotide homologous thereto; or (b) a fragment or variant of the polynucleotide of (a).

[0008] In one or more embodiments, the variant or homologous polynucleotide is a polynucleotide having more than 80%, more than 85%, more than 90%, more than 92%, more than 95%, more than 96%, more than 98%, more than 99%, more than 99.5%, or more than 99.8% sequence identity compared to the polynucleotide of the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and / or SEQ ID NO: 5.

[0009] In one or more embodiments, the isolated polynucleotide does not include a full-length viral genomic sequence.

[0010] In one or more embodiments, the isolated polynucleotide has a sequence length of 20-500, 20-400, 20-300, 20-200, 20-180 or 21-30 bp (eg, 21, 23, 25, 26 bp).

[0011] In one or more embodiments, the polynucleotides of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and / or SEQ ID NO: 5 are used respectively.

[0012] In one or more embodiments, two or more of the polynucleotides having nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and / or SEQ ID NO: 5 are combined (e.g., fused, concatenated or mixed, etc.) for use.

[0013] In one or more embodiments, the isolated polynucleotide comprises a polynucleotide having a nucleotide sequence shown in SEQ ID NO: 1.

[0014] In one or more embodiments, the inhibition of liver cancer includes inhibition of liver cancer at various stages (including early, middle or late stage tumors), or its precancerous lesions.

[0015] In one or more embodiments, the liver cancer includes carcinoma in situ and metastatic cancer.

[0016] In one or more embodiments, in (b), the polynucleotide fragment is a fragment comprising a core sequence; the core sequence comprises: the nucleotide sequence shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and / or SEQ ID NO: 11.

[0017] In one or more embodiments, the targeting agent is a targeting inhibition agent, which targets the polynucleotide and interferes with or inhibits the function of the polynucleotide (such as DNA level), its transcript (such as RNA level) or its translation product (such as protein level); preferably, the targeting inhibition agent includes (but is not limited to): antisense nucleotides (ASOs), interfering molecules (such as siRNA, miRNA, shRNA, dsRNA, etc.), gene editing agents (such as sgRNA, etc.), or constructs that can express or form the antisense nucleotides, interfering molecules, and gene editing agents; preferably, the targeting agent is an antisense nucleotide, targeting the core sequence; more preferably, the sequence of the antisense nucleotide is such as SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17.

[0018] In one or more embodiments, the targeted agent inhibits the proliferation of liver cancer cells, or inhibits the migration / metastasis of liver cancer cells.

[0019] In another aspect of the present invention, a method for preparing a targeted agent for inhibiting liver cancer and its progression is provided, comprising:

[0020] (1) Providing an isolated polynucleotide, comprising: (a) a polynucleotide having a nucleotide sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and / or SEQ ID NO: 5, or a polynucleotide homologous thereto; or (b) a fragment or variant of the polynucleotide of (a); preferably, in (b), the polynucleotide fragment is a fragment comprising a core sequence; the core sequence comprises: a nucleotide sequence as shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and / or SEQ ID NO: 11;

[0021] (2) Using the polynucleotide of (1) as a target, designing a targeting agent that specifically targets the target; the targeting agent is a targeting inhibitory agent, which uses the polynucleotide as a target to interfere with or inhibit the function of the polynucleotide, its transcript or its translation product; preferably, the targeting inhibitory agent includes (but is not limited to): antisense nucleotides (ASOs), interfering molecules (such as siRNA, miRNA, shRNA, dsRNA, etc.), gene editing agents (such as sgRNA, etc.), or constructs that can express or form the antisense nucleotides, interfering molecules, and gene editing agents; preferably, the targeting agent is an antisense nucleotide that targets the core sequence; more preferably, the sequence of the antisense nucleotide is such as SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17.

[0022] In one or more embodiments, for the target, one group (for one polynucleotide) or multiple groups (for multiple polynucleotides) of targeting agents can be prepared.

[0023] In one or more embodiments, the targeting agent comprises a modified or unmodified nucleic acid agent. The modifications are, for example, based on techniques such as nucleic acid backbone modification, and do not substantially alter the binding properties of the oligonucleotide molecule; modifications that enhance the stability of the nucleic acid molecule are preferred. For example, the modifications include dU modification, thiolation, or alkylation at the 2' position of the ribose sugar.

[0024] In one or more embodiments, the liver cancer is liver cancer induced by HBV infection.

[0025] In one or more embodiments, the liver cancer is caused by the interaction (such as long-term or continuous interaction) between the HBV virus and the infected person.

[0026] In another aspect of the present invention, a targeted agent for inhibiting liver cancer and its progression is provided, which is a targeted inhibitory agent targeted to an isolated polynucleotide; wherein the polynucleotide comprises: (a) a polynucleotide having a nucleotide sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and / or SEQ ID NO: 5, or a polynucleotide homologous thereto; (b) a fragment or variant of the polynucleotide of (a); preferably, in (b), the fragment of the polynucleotide is a fragment comprising a core sequence; the core sequence comprises: SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and / or SEQ ID NO: 11. NO: The nucleotide sequence shown in 11; wherein the targeting agent is a targeted inhibition agent, which targets the polynucleotide and interferes with or inhibits the function of the polynucleotide, its transcript or its translation product; preferably, the targeted inhibition agent includes (but is not limited to): antisense nucleotides (ASOs), interfering molecules (such as siRNA, miRNA, shRNA, dsRNA, etc.), gene editing reagents (such as sgRNA, etc.), or constructs that can express or form the antisense nucleotides, interfering molecules, and gene editing reagents.

[0027] In another aspect of the present invention, there is provided use of the targeting agent in preparing a pharmaceutical composition for inhibiting liver cancer and its progression.

[0028] In another aspect of the present invention, a pharmaceutical composition or a medicine kit for inhibiting liver cancer is provided, wherein the pharmaceutical composition comprises the targeting agent; or the medicine kit comprises the pharmaceutical composition.

[0029] In another aspect of the present invention, a method for screening potential substances for alleviating or treating liver cancer is provided, the method comprising: (1) treating a system expressing or containing a polynucleotide with a candidate substance; and (2) detecting the transcription, expression or activity of the polynucleotide in the system; wherein, if the candidate substance can reduce the transcription, expression or activity of the polynucleotide (preferably significantly, such as by more than 20%, preferably by more than 50%, and more preferably by more than 80%), it indicates that the candidate substance is a potential substance for alleviating or treating liver cancer.

[0030] In one or more embodiments, step (1) includes: in the test group, adding the candidate substance to the system expressing or containing the polynucleotide.

[0031] In one or more embodiments, step (2) includes: detecting the transcription, expression or activity of the polynucleotide in the system of the test group and comparing it with the control group, wherein the control group is a system that does not add the expression of the candidate substance or contains the polynucleotide.

[0032] In one or more embodiments, if the transcription, expression or activity of the polynucleotide in the test group is statistically lower than that in the control group, it indicates that the candidate is a potential substance for alleviating or treating liver cancer.

[0033] In one or more embodiments, the system is selected from: a cell system (such as a cell expressing the polynucleotide, more particularly a hepatocyte or hepatoma cell) (or a cell culture system), a subcellular system, a solution system, a tissue system, an organ system or an animal (model) system.

[0034] In one or more embodiments, the candidate substances include (but are not limited to): interfering molecules designed for the polynucleotide, nucleic acid inhibitors, binding molecules (such as antibodies or ligands), small molecule compounds, etc.

[0035] In one or more embodiments, the system is a cell system, such as a liver cancer cell system, and the method further comprises: further analyzing the proliferation ability of the liver cancer cells in the system; if the proliferation ability decreases, the candidate substance is a potential substance for alleviating or treating liver cancer.

[0036] In one or more embodiments, the system is a cell system, such as a liver cancer cell system, and the method further comprises: further analyzing the metastasis / migration ability of the liver cancer cells in the system; if the metastasis / migration ability is decreased, the candidate substance is a potential substance for alleviating or treating liver cancer.

[0037] In one or more embodiments, the method further comprises: performing further cell experiments and / or animal tests on the obtained potential substances to further select and determine substances useful for alleviating or treating liver cancer from the candidate substances.

[0038] In another aspect of the present invention, a method for inhibiting liver cancer cells (including in vivo or in vitro (such as isolated liver cancer cells (culture) level)) is provided, comprising: administering an effective amount of the targeted agent or pharmaceutical composition to a subject to be inhibited (including liver cancer cells in an animal or human individual, or isolated liver cancer cells (culture)).

[0039] In one or more embodiments, the method of inhibiting liver cancer comprises a non-therapeutic method.

[0040] In one or more embodiments, the targeted agent acts by inhibiting the proliferation of liver cancer cells.

[0041] In one or more embodiments, the targeted agent acts by inhibiting the migration / metastasis of liver cancer cells.

[0042] In another aspect of the present invention, use of a polynucleotide in preparing a detection reagent or kit for detecting liver cancer is provided.

[0043] In another aspect of the present invention, the use of a detection reagent that specifically recognizes or amplifies a polynucleotide is provided for preparing a kit for detecting liver cancer; preferably, the detection reagent includes (but is not limited to): a primer that specifically amplifies the polynucleotide, a probe that specifically recognizes the polynucleotide, or a chip that specifically recognizes the polynucleotide.

[0044] In another aspect of the present invention, a method for preparing a detection reagent for liver cancer detection is provided, comprising: using a polynucleotide as a target, preparing a reagent that specifically recognizes or amplifies the polynucleotide; preferably, the detection reagent includes (but is not limited to): a primer that specifically amplifies the polynucleotide, a probe that specifically recognizes the polynucleotide, or a chip that specifically recognizes the polynucleotide.

[0045] In one or more embodiments, the detecting includes distinguishing liver cancer from other liver diseases.

[0046] In one or more embodiments, the other liver diseases include: hepatitis, cirrhosis, and liver fibrosis.

[0047] In another aspect of the present invention, a method for diagnosing liver cancer is provided, comprising: using a detection reagent or kit that specifically recognizes or amplifies polynucleotides to detect the presence of polynucleotides in an in vitro sample of a subject (such as a tissue in situ of the disease or a body fluid tissue (blood or serum, etc.)).

[0048] In one or more preferred embodiments, the primers are primers with sequences shown as SEQ ID NO: 19 and SEQ ID NO: 20.

[0049] In one or more embodiments, the method comprises: extracting total RNA from a sample, converting it into cDNA, synthesizing and labeling cRNA, hybridizing, washing, scanning, and signal analysis.

[0050] In one or more embodiments, the method includes: extracting total RNA from a sample, converting it into cDNA, performing fluorescent PCR amplification, and performing qualitative or quantitative analysis on the amplified product.

[0051] In one or more embodiments, when making a judgment, if the expression of the polynucleotide in the test sample is significantly higher than that in the other liver diseases (such as compared with the hepatitis sample or the cirrhosis sample, there is the following significant difference: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001), it indicates that the subject has liver cancer or is at risk / high risk of liver cancer.

[0052] Other aspects of the present invention will be apparent to those skilled in the art in view of the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1A. After Huh7 cells were infected with lentivirus that simultaneously expressed five pathogenic fragments, the relative expression of the corresponding pathogenic fragments in the cells was analyzed by RT-qPCR.

[0054] Figure 1B. Enrichment analysis of upregulated genes caused by EC-HBV-Fs overexpression.

[0055] Figure 2A: After pHBV1.3 was transfected into HepG2 cells, the expression of the five pathogenic fragments was detected by RT-qPCR.

[0056] Figure 2B, RT-qPCR analysis of EC-HBV-Fs expression in tissue samples from HBV-positive and -negative patients with HCC.

[0057] Figure 2C: EC-HBV-F002 lentivirus was prepared using HEK293T cells and infected with liver cancer cells Huh7. RNA-seq analysis was performed to analyze the upregulated differential genes.

[0058] FIG3A , CCK8 assay analysis of the effect of EC-HBV-F002 overexpression on Huh7 cell proliferation.

[0059] FIG3B , Tranwell assay analysis of the effect of EC-HBV-F002 overexpression on Huh7 cell migration.

[0060] Figure 4A, CCK8 assay analysis of the effects of recombinant expression of EC-HBV-F002 and EC-HBV-F002M on the proliferation of liver cancer cells.

[0061] Figure 4B. Tranwell assay analysis of the effects of recombinant expression of EC-HBV-F002 and EC-HBV-F002M on the migration of liver cancer cells.

[0062] FIG5A , CCK8 assay analysis of the effect of EC-HBV-F002 ASO (ASO-F002) on the proliferation of liver cancer cells.

[0063] FIG5B , Tranwell assay analysis of the effect of EC-HBV-F002 ASO (ASO-F002) on the migration of liver cancer cells.

[0064] 6A-D , analysis of tumorigenesis in Huh7-EC-HBV-F002 cells treated with ASO and control Huh7 cells not treated with ASO.

[0065] Figure 7A-B. Tumor tissues treated with different methods were separated, and Ki67 expression was detected by immunohistochemistry and the proportion of positive cells was counted.

[0066] Figure 8A, Establishment of HBV infection mouse model and model evaluation.

[0067] Figure 8B-C, expression analysis of HBV epigenetic antigens in r-AAV8-HBV1.3 and ASO-NC treated groups.

[0068] Figure 8D. The effect of targeted blockade of EC-HBV-F002 on HBV genome levels.

[0069] Figure 9A-B. Analysis of the enrichment of upregulated genes after recombinant expression of EC-HBV-F001 and EC-HBV-003 in primary hepatocytes.

[0070] Figure 10A-B. Analysis of the enrichment of upregulated genes after recombinant expression of EC-HBV-F004 and EC-HBV-005 in primary hepatocytes.

[0071] Figure 11A. EC-HBV-F002 expression is significantly higher in liver cancer (RT-qPCR). There was a significant difference in EC-HBV-F002 expression between hepatitis B (10 cases) and liver cirrhosis (10 cases), P < 0.05; there was a significant difference in EC-HBV-F002 expression between hepatitis B (10 cases) and liver cancer (11 cases), P < 0.0001; there was a significant difference in EC-HBV-F002 expression between liver cirrhosis (10 cases) and liver cancer (11 cases), P < 0.05.

[0072] Figure 11B, Sensitivity and specificity analysis: ROC curves of EC-HBV-F002 expression in samples from hepatitis B patients (10 cases) and samples from patients with cirrhosis (10 cases).

[0073] Figure 11C, Sensitivity and specificity analysis: ROC curves of EC-HBV-F002 expression in samples from patients with cirrhosis (10 cases) and patients with liver cancer (11 cases).

[0074] Figure 11D, Sensitivity and specificity analysis: ROC curves of EC-HBV-F002 expression in hepatitis B patient samples (10 cases) and liver cancer patient samples (11 cases). DETAILED DESCRIPTION

[0075] After in-depth research, the inventors have identified EC-HBV-Fs, a key pathogenic factor in liver cancer. This can be used as a target for the preparation of targeted regulatory (downregulatory) agents for liver cancer treatment; alternatively, it can be used as a target for screening agents for targeted regulatory (downregulatory) treatment. The present invention also provides nucleic acid inhibitors for targeted regulation. The present invention also provides targets for liver cancer detection. This invention provides a new approach for the clinical treatment and detection of liver cancer.

[0076] EC-HBV-Fs

[0077] This study reveals that five nucleic acid fragments (EC-HBV-Fs) transcribed from the HBV viral genome are key factors in liver cancer (including HBV-induced liver cancer). These fragments, designated EC-HBV-F001, EC-HBV-F002, EC-HBV-F003, EC-HBV-F004, and EC-HBV-F005, are key factors in the development of liver cancer. After extensive analysis and experimentation, the inventors identified EC-HBV-Fs as a target for liver cancer.

[0078] Focusing on the target, in a specific embodiment of the present invention, the inventors conducted in-depth experimental demonstrations, including demonstrations at the cellular and animal levels. These demonstrations include: (1) the discovery of EC-HBV-Fs as a therapeutic target for liver cancer (overexpression analysis); (2) the effects of expression of EC-HBV-Fs itself and its targeted inhibitory agents (such as ASO) on the proliferation ability of liver cancer cells; (3) the effects of expression of EC-HBV-Fs itself and its targeted inhibitory agents on the metastasis / migration ability of liver cancer cells; and (4) the effects of EC-HBV-Fs itself and its targeted inhibitory agents on in vivo transplanted tumors.

[0079] In order to demonstrate the function of the nucleic acid fragment, the inventors connected the first five fragments together in series through molecular cloning, used them for lentiviral packaging, and infected liver cancer cells. The results showed that after the fragment was introduced into liver cancer cells, the upregulated genes were significantly enriched in angiogenesis regulatory pathways and cell proliferation and migration-related pathways, which were consistent with the clinical manifestations of liver cancer. Furthermore, the inventors deeply explored the specific functions of EC-HBV-F002 and found that overexpression of EC-HBV-F002 promoted the proliferation and migration of liver cancer cells, while the use of targeted inhibitory agents targeting this sequence (such as ASO) could significantly inhibit the proliferation and migration of liver cancer cells caused by EC-HBV-F002. Furthermore, nude mouse tumor formation experiments confirmed that overexpression of EC-HBV-F002 significantly promoted tumor growth, while the use of targeted inhibitory agents to block EC-HBV-F002 significantly inhibited tumor growth. Therefore, EC-HBV-Fs is a key factor closely related to liver cancer, and designing targeted drugs based on this target can effectively alleviate or treat liver cancer.

[0080] In the present invention, a new key target related to liver cancer was identified for the first time, and the purpose of treating liver cancer was achieved through targeted inhibitory reagents (such as molecules that bind to EC-HBV-Fs (EC-HBV-Fragments) with antisense complementarity and block their function, ASO).

[0081] In the present invention, EC-HBV-F002, EC-HBV-F001, EC-HBC-F003, EC-HBV-F004, and EC-HBV-F005 are polynucleotides having the nucleotide sequences set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5, respectively. Furthermore, the present invention also encompasses polynucleotides, fragments, or variants homologous to the aforementioned sequences. For example, if the sequence contains some variations (e.g., nonsense variations) that do not alter the key pathogenicity of the polynucleotide, resulting in minor differences in the target sequence, polynucleotides with such variations are also encompassed by the present invention. For example, the variant or homologous polynucleotide is a polynucleotide having a sequence identity of 80% or more, 85% or more, 90% or more, 92% or more, 95% or more, 96% or more, 98% or more, 99% or more, 99.5% or more, or 99.8% or more to the polynucleotide of the nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and / or SEQ ID NO: 5. However, the isolated polynucleotide does not include the full-length viral genome sequence.

[0082] Fragments from the above polynucleotides can also be applied to the present invention. In a preferred embodiment, the fragments of the polynucleotides include core fragments.

[0083] EC-HBV-Fs targeted inhibitors and their applications

[0084] Based on the above new findings, the present invention provides the use of a targeted inhibitor of EC-HBV-Fs for preparing a composition (including a pharmaceutical composition) for inhibiting liver cancer.

[0085] As used herein, the EC-HBV-Fs targeted inhibitors include inhibitors, downregulators, blockers, and the like, and these terms can be used interchangeably.

[0086] The targeted inhibitors of EC-HBV-Fs include substances that can reduce the stability of EC-HBV-Fs, reduce the expression of EC-HBV-Fs, inhibit the transcription / translation of EC-HBV-Fs, etc. These substances can be used in the present invention as substances useful for the targeted inhibition of EC-HBV-Fs, and thus can be used to inhibit liver cancer. As a preferred embodiment of the present invention, the inhibitor is a nucleic acid inhibitor. For example, the targeted inhibitor includes an interfering RNA molecule or an antisense nucleotide (including a locked nucleic acid antisense nucleotide) that specifically interferes with the expression of EC-HBV-Fs.

[0087] As a preferred embodiment of the present invention, antisense compounds that specifically hybridize to one or more nucleic acids encoding EC-HBV-Fs are used to modulate EC-HBV-Fs expression. Specific hybridization of the oligomer with its target nucleic acid interferes with the normal function of the nucleic acid. This regulation of target nucleic acid function by compounds that specifically hybridize to the target nucleic acid is generally referred to as "antisense."

[0088] Preferably, the antisense compound is an antisense nucleotide. As used herein, "antisense nucleotide," also known as "antisense nucleic acid" or "antisense oligonucleotide (AS-ONs, antisense-oligonucleotides)" or "antisense drug," refers to a DNA molecule or RNA molecule of about 15-30 bases in length, a modified form thereof, or an analog thereof, which is complementary to mRNA.

[0089] The present invention provides target sequences suitable for designing antisense nucleotides, and in particular, provides sequence segments comprising core sequences. In addition, the targets or antisense nucleotides provided by the present invention can be appropriately modified while retaining their activity, and these variations can be used in the present invention. A variety of antisense nucleotides that can inhibit or silence the EC-HBV-Fs are all useful in the present invention, and their types are not limited to DNA or RNA. For example, the antisense nucleotides of the EC-HBV-Fs are sequences that are substantially (preferably completely) complementary to the sequence of EC-HBV-Fs. For example, the antisense nucleotides of the EC-HBV-Fs have more than 80% identity with the nucleotide sequences shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and / or SEQ ID NO: 11 (or sequences complementary thereto), preferably more than 85% identity, more preferably more than 90% identity, and even more preferably more than 95% identity, such as 96%, 97%, 98% or 99% identity; they have the same functions as the antisense nucleotides listed in the embodiments of the present invention.

[0090] Prior art has suggested that some variations of antisense nucleotides are desirable and can also exert inhibitory effects against corresponding target sequences. For example, the article "Design and delivery of antisense oligonucleotides to block microRNA function in cultured Drosophila and human cells" (NATURE PROTOCOLS; Vol. 3 No. 10; 2008; 1537-1549) reviewed multiple studies and concluded that, in general, extending the antisense nucleotide by a few bases on either side is acceptable. Furthermore, when the affinity between the antisense nucleotide and the miRNA is very high (e.g., with locked nucleic acid modification), the antisense nucleotide can be truncated to approximately two-thirds of its length.

[0091] As an optional method of the present invention, the CRISPR / Cas (such as Cas9) system can be used for targeted gene editing to downregulate (including knockout) EC-HBV-Fs. Common methods for downregulating EC-HBV-Fs include: co-transferring sgRNA or a nucleic acid capable of forming the sgRNA, Cas mRNA or a nucleic acid capable of forming the Cas mRNA into a targeted region or a targeted cell. After the target site is determined, known methods can be used to introduce sgRNA and Cas into the cell. The nucleic acid capable of forming the sgRNA is a nucleic acid construct or an expression vector, or the nucleic acid capable of forming the Cas9 mRNA is a nucleic acid construct or an expression vector, and these expression vectors are introduced into the cell to form an active sgRNA and Cas9 enzyme in the cell.

[0092] As an alternative approach of the present invention, homologous recombination can be used to specifically target EC-HBV-Fs, causing expression defects or loss of expression. For example, Cre and loxp methods can be used to selectively knock out relevant genes in the genome of animals or cells, resulting in reduced expression or inactivation.

[0093] As a preferred embodiment of the present invention, the targeted inhibitor can be an interfering RNA molecule (such as siRNA, shRNA, miRNA, etc.) specific for EC-HBV-Fs. Those skilled in the art will appreciate that such interfering RNA molecules can be prepared based on the EC-HBV-Fs sequence information provided herein. There are no particular limitations on the methods for preparing interfering RNA molecules, including but not limited to chemical synthesis and in vitro transcription. The interfering RNA can be delivered into cells using an appropriate transfection reagent, or using various techniques known in the art.

[0094] As an embodiment of the present invention, RNAi is used to inhibit EC-HBV-Fs. RNAi is an evolutionarily conserved cellular defense mechanism used to control the expression of foreign genes in most eukaryotic organisms, including humans. RNAi is usually triggered by double-stranded RNA and causes sequence-specific mRNA degradation of single-stranded target RNA. The mediator of mRNA degradation is small interfering RNA duplexes (siRNAs), which are usually produced by enzymatic cleavage of long dsRNA in cells. siRNAs are usually about 21 nucleotides in length (e.g., 21-23 nucleotides). After small RNA or RNAi is introduced into cells, it is believed that the sequence is delivered to an enzyme complex called RISC (RNA-induced silencing complex). RISC recognizes the target and cuts it with an endonuclease. It is worth noting that if a larger RNA sequence is delivered to the cell, the RNase III enzyme (Dicer) will convert the longer dsRNA into 21-23nt ds-siRNA fragments.

[0095] As one embodiment of the present invention, shRNA technology is used for interference. shRNA is an RNA sequence that can be twisted into a tight hairpin and can be used to silence gene expression through RNA interference. shRNA uses a vector that is introduced into cells and uses a promoter (such as U6) to ensure that the shRNA is always expressed. This vector is usually passed to daughter cells, allowing gene silencing to be inherited. The shRNA hairpin structure is cleaved into siRNA by the cellular machinery and then binds to the RNA-induced silencing complex (RISC). This complex binds and cleaves mRNAs that match the siRNA it binds to. shRNA is transcribed by RNA polymerase III.

[0096] In the present invention, various nucleic acid inhibitors (e.g., antisense nucleotides) also include modified forms, wherein the modifications do not substantially alter the activity of the nucleic acid inhibitor. More preferably, the modifications enhance the activity, stability, or therapeutic effect of the nucleic acid inhibitor. Modifications to nucleic acid inhibitors include, but are not limited to, methoxylation, thiolation, cholesterol, alkylation, locked nucleic acid, peptide nucleic acid, and / or nucleic acid inhibitors in which the phosphate backbone is replaced by a phospholipid linkage.

[0097] As one embodiment of the present invention, the targeted inhibitor is a small molecule compound directed against EC-HBV-Fs. Those skilled in the art can screen such small molecule compounds using methods suitable for screening small molecule compounds. The screening can be based on various compound libraries currently available or to be developed in the art, or by establishing new compound libraries.

[0098] The above are some representative methods for downregulating EC-HBV-Fs. After those skilled in the art understand the overall scheme of the present invention, they can also adopt other methods known in the art or methods under development to regulate EC-HBV-Fs, and these methods are also included in the present invention.

[0099] It is particularly preferred that the antisense nucleotide is designed for the sequence segment where the core sequence of EC-HBV-Fs is located. According to the analysis results of the embodiments of the present invention, the antisense nucleotide exerts a significant inhibitory effect on liver cancer not only at the cellular level but also at the animal level, and has great clinical value.

[0100] Drug screening

[0101] Knowing that EC-HBV-Fs is a liver cancer target and that its expression (effective, normal, or high) is closely related to liver cancer, we can screen for substances that inhibit EC-HBV-Fs based on this characteristic. Among these substances, we can find truly effective drugs for inhibiting liver cancer.

[0102] Therefore, the present invention provides a method for screening potential substances (candidate substances or candidate drugs) for inhibiting liver cancer, the method comprising: treating a system expressing EC-HBV-Fs with a candidate substance; and detecting the transcription, expression or activity of EC-HBV-Fs in the system; if the candidate substance can inhibit the transcription, expression or activity of EC-HBV-Fs, it indicates that the candidate substance is a potential substance for inhibiting liver cancer.

[0103] The EC-HBV-Fs expression system is preferably a cell (or cell culture) system. The cells can be cells that endogenously express EC-HBV-Fs or cells that recombinantly express EC-HBV-Fs. Furthermore, the usefulness of the potential substance can be assessed by observing the interactions between EC-HBV-Fs and its upstream and downstream genes / proteins.

[0104] In combination with the research results of the present inventors, as a preferred method of the screening method of the present invention, the proliferation ability of liver cancer cells in the system can be further analyzed; if the proliferation ability is reduced, the candidate substance is a potential substance for reducing liver cancer.

[0105] In combination with the research results of the present inventors, as a preferred method of the screening method of the present invention, the metastasis / migration ability of liver cancer cells in the system can be further analyzed; if the metastasis / migration ability is reduced, the candidate substance is a potential substance for reducing liver cancer.

[0106] In a preferred embodiment of the present invention, a control group (control) may be set up during screening to more easily observe changes in EC-HBV-Fs transcription, expression, or activity. The control group may be an EC-HBV-Fs-expressing system without the candidate substance. Such control groups include, but are not limited to, blank controls without the candidate substance and empty plasmid controls.

[0107] As a preferred embodiment of the present invention, the method further comprises: conducting further cell experiments and / or animal experiments on the obtained potential substances to further select and determine substances that are truly useful for inhibiting liver cancer.

[0108] In another aspect, the present invention also provides potential liver cancer inhibitory substances obtained using the screening method. These initially screened substances can constitute a screening library, from which people can ultimately screen for substances that can inhibit the transcription, expression, and activity of EC-HBV-Fs, and thus inhibit liver cancer.

[0109] Pharmaceutical composition

[0110] The present invention also provides a pharmaceutical composition comprising an effective amount (e.g., 0.000001-50 wt%; preferably 0.00001-20 wt%; more preferably 0.0001-10 wt%) of the EC-HBV-Fs targeted inhibitor and a pharmaceutically acceptable carrier. Preferably, the pharmaceutical composition is used to inhibit liver cancer.

[0111] In a preferred embodiment of the present invention, the targeted inhibitors include but are not limited to: nucleic acid inhibitors (preferably antisense nucleotides, but may also include siRNA, etc.), reagents for knocking out or silencing EC-HBV-Fs, chemical small molecule antagonists or inhibitors for EC-HBV-Fs, etc. In a more specific embodiment, the targeted inhibitors include but are not limited to: CRISPR gene editing reagents for EC-HBV-Fs, interfering molecules that specifically interfere with the expression of genes encoding EC-HBV-Fs, homologous recombination reagents or site-directed mutagenesis reagents for EC-HBV-Fs, which cause loss-of-function mutations in EC-HBV-Fs.

[0112] As used herein, the "effective amount" refers to an amount that can produce a function or activity in humans and / or animals and can be accepted by humans and / or animals. The "pharmaceutically acceptable carrier" refers to a carrier used for the administration of therapeutic agents, including various excipients and diluents. This term refers to pharmaceutical carriers that are not necessary active ingredients themselves and are not overly toxic after administration. Suitable carriers are well known to those of ordinary skill in the art. Pharmaceutically acceptable carriers in the composition may contain liquids such as water, saline, and buffer solutions. In addition, auxiliary substances such as fillers, lubricants, glidants, wetting agents or emulsifiers, pH buffer substances, etc. may also be present in these carriers. The carrier may also contain a cell transfection reagent.

[0113] After knowing the use of the EC-HBV-Fs targeted inhibitor, various methods well known in the art can be used to administer the targeted inhibitor or its encoding gene, or its pharmaceutical composition to mammals or humans.

[0114] Preferably, gene therapy can be used. For example, the EC-HBV-Fs targeted inhibitor can be directly administered to the subject by methods such as injection; alternatively, an expression unit (such as an expression vector or virus, or siRNA) carrying the EC-HBV-Fs targeted inhibitor can be delivered to the target site through a specific route to allow expression of the active EC-HBV-Fs targeted inhibitor. The specific circumstances will depend on the type of targeted inhibitor, and are well known to those skilled in the art.

[0115] The effective amount of the EC-HBV-Fs targeted inhibitor of the present invention may vary depending on the mode of administration and the severity of the disease to be treated. The preferred effective amount can be determined by one of ordinary skill in the art based on various factors (e.g., through clinical trials). These factors include, but are not limited to: pharmacokinetic parameters of the EC-HBV-Fs targeted inhibitor, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, and the route of administration.

[0116] In the specific embodiments of the present invention, certain dosing regimens are provided for animals, such as mice. Conversion of dosages for animals, such as mice, to dosages suitable for humans is readily accomplished by those skilled in the art, for example, by calculation using the Meeh-Rubner formula. It should be understood that the dosage conversion may vary depending on the drug and clinical situation, based on the assessment of an experienced pharmacist.

[0117] The present invention also provides a drug kit containing the pharmaceutical composition or directly containing the EC-HBV-Fs targeted inhibitor. In addition, the drug kit may also include instructions for using the drugs in the drug kit.

[0118] Liver cancer detection

[0119] The “marker” or “marker” is a gene whose expression level in a tissue or cell is altered compared to the expression level in normal or healthy cells or tissues.

[0120] Those skilled in the art will appreciate that the utility of the present invention is not limited to quantifying gene expression of any specific variant of the marker gene of the present invention. As a non-limiting example, the marker gene may have the nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments, the marker gene has a sequence that is at least 85% identical or similar to the sequence set forth in SEQ ID NO: 1, such as at least 80%, 85%, 90%, 92%, 95%, 96%, 98%, 99%, 99.5%, or 99.8% identical or similar to the sequence set forth above.

[0121] The present invention can utilize any method known in the art to measure gene expression. It will be understood by those skilled in the art that the means of measuring gene expression is not an important aspect of the present invention. The expression level of the marker can be detected at the transcriptional level.

[0122] In some embodiments, the expression level of the marker is detected at the transcriptional level. A variety of methods utilizing nucleic acid hybridization techniques to carry out specific DNA and RNA measurements are well known to those skilled in the art. Some methods relate to electrophoretic separation (e.g., Southern blotting for detecting DNA and Northern blotting for detecting RNA), but DNA and RNA measurements (e.g., by dot blot) can also be performed without electrophoretic separation. Southern blotting of genomic DNA (e.g., from humans) can be used to screen for restriction fragment length polymorphisms (RFLPs) to detect the presence of genetic disorders that affect polypeptides of the present invention. All forms of RNA can be detected.

[0123] Based on the inventors' novel discovery, EC-HBV-F002 can be used as a marker for liver cancer. By analyzing the expression of EC-HBV-F002 in a test sample, the subject's disease status can be determined, providing a basis for disease diagnosis or prognosis. In preferred embodiments, the test sample is a patient's tissue sample or body fluid.

[0124] A variety of techniques known in the art can be used to detect the expression of EC-HBV-F002, all of which are encompassed by the present invention. Existing techniques for detecting nucleic acids include (but are not limited to): gene chip technology, probe hybridization technology, polymerase chain reaction (PCR), Northern Blot, and the like.

[0125] The present invention provides reagents that specifically recognize or amplify EC-HBV-F002. Any reagent capable of recognizing EC-HBV-F002 is encompassed by the present invention. Examples of such reagents include, but are not limited to, primers that specifically amplify EC-HBV-F002 or probes that specifically recognize EC-HBV-F002.

[0126] The reagent that specifically recognizes EC-HBV-F002 can also be fixed on a test paper, a glass slide, or other solid phase carriers to prepare an immune colloidal gold test paper or similar detection material.

[0127] As an alternative approach to the present invention, quantitative or semi-quantitative polymerase chain reaction (PCR) is used to analyze the expression and level of EC-HBV-F002 in the sample, thereby enabling a determination. Preferably, detection is achieved by real-time quantitative PCR. The reagents employed are primers that specifically amplify EC-HBV-F002. Once the nucleotide sequence of EC-HBV-F002 is known, primers can be designed based on this sequence.

[0128] As an alternative approach to the present invention, gene chip technology can be used to detect EC-HBV-F002. Once the nucleotide sequence of EC-HBV-F002 is known, probes can be easily designed based on this information. For example, if the solid phase carrier is a modified glass or silicon wafer, and the 5' end of the probe contains an amino-modified poly-dT string, the oligonucleotide probes can be prepared into a solution, then spotted onto the modified glass or silicon wafer using a spotter, arranged into a predetermined sequence or array, and then left overnight to fix. This yields the gene chip of the present invention. If the oligonucleotide probes are not amino-modified, their preparation methods can also refer to existing known techniques.

[0129] Specifically, suitable probes can be designed based on the EC-HBV-F002 described herein and immobilized on a solid support to form an "oligonucleotide array." The "oligonucleotide array" refers to an array having addressable locations (i.e., locations characterized by a distinctive, accessible address), each containing a characteristic oligonucleotide associated therewith. The oligonucleotide array can be divided into multiple subarrays as needed. The solid support may include plastic products, microparticles, membrane supports, and the like.

[0130] The present invention also provides a kit for detecting liver cancer, comprising a reagent that specifically recognizes EC-HBV-F002, or a carrier loaded with the reagent. Examples of the reagent that specifically recognizes EC-HBV-F002 include primers that specifically amplify EC-HBV-F002, probes that specifically recognize EC-HBV-F002, or a chip that specifically recognizes EC-HBV-F002.

[0131] The kit may also contain a marker for labeling RNA samples and a substrate corresponding to the marker. Furthermore, the kit may also contain auxiliary reagents: nucleic acid extraction reagents (e.g., nucleic acid extraction solution, phenol, chloroform, isoamyl alcohol, NaCl, etc.); and / or polymerase chain reaction reagents (e.g., dNTPs, Taq enzyme, PCR buffer, DNA polymerase, etc.); and / or enzyme chain immunoassay reagents (e.g., color development solution or hybridization solution, etc.).

[0132] In addition, the kit also includes instructions for use and / or chip image analysis software.

[0133] The present invention will be further described below with reference to specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. Experimental procedures in the following examples, where specific conditions are not specified, were generally performed under conventional conditions, such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, or according to the conditions recommended by the manufacturer.

[0134] Materials and methods

[0135] 1. Nucleic acid fragments derived from the HBV genome

[0136] Unless otherwise stated, the full-length sequence of the HBV genome in the examples is based on the sequence of GenBank accession number M54923.1, and the sequence in pHBV1.3 is shown in NC_003977.2.

[0137] The five nucleic acid fragments (EC-HBV-Fs) isolated from the HBV genome were named: EC-HBV-F001, EC-HBV-F002, EC-HBV-F003, EC-HBV-F004, EC-HBV-F005 (i.e.: EC-HBV-F001 / F002 / F003 / F004 / F005).

[0138] The sequence information is shown in Table 1.

[0139] Table 1

[0140] 2. Vector Construction

[0141] First, five nucleic acid fragments (EC-HBV-F001 / F002 / F003 / F004 / F005) containing the HBV genome were amplified by PCR.

[0142] Then, the fragments were inserted into the pCDH vector containing EcoR I and BamH I restriction sites by homologous recombination. At the same time, the five fragments were connected in series (fragments of SEQ ID NO: 1-5 were arranged in the order of EC-HBV-F001, EC-HBV-F002, EC-HBV-F003, EC-HBV-F004, and EC-HBV-F005 and directly connected in series) and inserted into the pCDH vector for lentiviral packaging and infection.

[0143] In addition, a vector with nucleotide mutations inserted into EC-HBV-F002 was constructed for lentiviral packaging and infection.

[0144] When analyzing a single fragment (such as EC-HBV-F002), concatenation is not performed and the single fragment is inserted into the pCDH vector for lentiviral packaging and infection.

[0145] 3. Cell Culture and Transfection

[0146] Complete DMEM cell culture medium was prepared by adding 10% fetal bovine serum and 1% penicillin / streptomycin to high-glucose DMEM culture medium for culturing HEK293T cells, Huh7 cells, HepG2 cells, and HepG2-NTCP cells.

[0147] Primary human hepatocytes (PHHs) were cultured using a dedicated 5C medium containing five chemical small molecules: FSK, SB43, DAPT, IWP2, and LDN193189.

[0148] Cell culture conditions were 37°C in a 5% CO2 incubator. HepG2 cells were transfected with the full-length HBV expression plasmid pHBV1.3 and a control plasmid (empty vector without the HBV genome inserted) to evaluate the expression of EC-HBV-Fs.

[0149] According to the experimental purpose, appropriate numbers of cells were seeded in different well plates for cell proliferation and migration experiments.

[0150] Antisense oligonucleotides (ASOs) targeting HBV viral fragments were prepared. The antisense oligonucleotide sequences were as follows (the antisense sequences of the core sequences in Table 1):

[0151] ASO targeting EC-HBV-F001:

[0152] ASO targeting EC-HBV-F002:

[0153] ASO targeting EC-HBV-F003:

[0154] ASO targeting EC-HBV-F004:

[0155] ASO targeting EC-HBV-F005:

[0156] The cell lines stably expressing HBV viral fragments were treated with the antisense nucleotides to evaluate the specific effects of blocking HBV fragments on their functions.

[0157] 4. Lentiviral packaging and infection

[0158] HEK293T cells were transfected with the pCDH vector containing the HBV viral fragment, pSPAX2, and pMD2.G at a specific ratio using lipofectamine. The culture medium was replaced with fresh 10% DMEM 6-9 hours after transfection. Cell culture fluid was collected 48 or 72 hours later and filtered through a 0.45 μm filter to remove cell debris.

[0159] Then, Huh cells were infected with different lentiviruses, and cell lines stably expressing HBV viral fragments were obtained by flow cytometry screening.

[0160] 5. RNA extraction, RT-qPCR, and RNA-seq

[0161] Total RNA was extracted from freshly harvested cells using TRIzol reagent (Invitrogen), and the concentration and purity of the extracted RNA were determined using NanoDrop.

[0162] RNA was reverse transcribed into cDNA using PrimeScript™ RT Kit (Takara), and fluorescent quantitative PCR was performed using SYBR Green Pre-Mix (TIANGEN).

[0163] Pass 2 -ΔΔct Methods The relative expression levels of HBV viral fragments were calculated.

[0164] The extracted RNA was commissioned to a biological company to complete RNA-seq. After analyzing the differentially expressed genes, GO analysis was performed on the upregulated genes to determine their enriched genes.

[0165] 6. Cell proliferation assay

[0166] Appropriate numbers of Huh7 cells stably overexpressing EC-HBV-F002 and control group cells were inoculated into 96-well plates, and cell growth was detected by CCK8 at 0 h, 24 h, 48 h, and 96 h.

[0167] In addition, Huh7 cell lines stably overexpressing EC-HBV-F002 were treated with ASO targeting EC-HBV-F002 and ASO-NC (negative control). Cell proliferation at the above time points was detected by CCK8 to evaluate the effect of ASO on Huh7 liver cancer cells at the cellular level.

[0168] ASO-NC (negative control) sequence:

[0169] 7. Cell migration assay (Tranwell)

[0170] Huh7 cells overexpressing EC-HBV-F002 and control cells were seeded into the upper chamber of a 24-well plate chamber at 40,000 cells per well and cultured in serum-free medium. In the lower chamber, 20% FBS-DMEM was added as an inducer and incubated for 36 hours. The chamber was then fixed with 100% methanol for 15 minutes.

[0171] Then, the cells were stained with 0.1% crystal violet solution and photographed under a microscope to record the cells that migrated to the lower surface.

[0172] 8. Nude mouse tumor formation experiment

[0173] Huh7 hepatocellular carcinoma cells stably expressing EV-HBV-F002 were pretreated with ASO targeting EC-HBV-F002 and a control. These cells were then inoculated subcutaneously into nude mice, allowing tumor formation in approximately one week. Eight days after inoculation of the tumor cell line, ASO and NC were injected intratumorally every three days. Tumor growth was monitored, and tumors were harvested on day 17 post-inoculation, photographed, and their mass and volume measured.

[0174] Immunohistochemical labeling of Ki67 in tumor tissues after different treatments was used to evaluate the effects of different treatments on tumor cell proliferation.

[0175] 9. Mouse model of HBV infection

[0176] rAAV8-Control: pAAV8-CAG-RFP-WPRE vector.

[0177] rAAV8-HBV1.3: The complete HBV genome sequence (NCBI accession number: NC_003977.2) was introduced into the above vector.

[0178] High-pressure injection of rAAV8-HBV-1.3 into the tail vein is a technique for inducing HBV expression in mice, in which AAV8 can effectively target the liver and promote HBV replication in the liver. Ten C57BL / 6 mice were divided into three groups:

[0179] 1) Tail vein injection of rAAV8-Control and ASO negative control (ASO-NC);

[0180] 2) Tail vein injection of rAAV8-HBV1.3 and ASO negative control (ASO-NC);

[0181] 3) Injection of rAAV8-HBV1.3 and ASO blocker (antagomir) into the tail vein.

[0182] Specifically, 10 μg of plasmid and 20 nM antagomib (or NC) were mixed in 2 mL of PBS and rapidly injected into mice via the tail vein after 3-5 seconds. One week later, the liver and blood of the mice were collected for ELISA and immunohistochemistry tests.

[0183] 10. Comparison of the effects of EC-HBV-F002 and EC-HBV-F002M on HCC cell function

[0184] HepG2 cell lines stably expressing EC-HBV-F002 and EC-HBV-F002M were constructed, and the proliferation and migration abilities of these cells were compared with those of the control group using CCK8 and cell migration assays.

[0185] Example 1: The enrichment pathways of upregulated genes after EC-HBV-Fs transfection are consistent with the clinical phenotype caused by HBV

[0186] After extensive research, comparison, and screening, the inventors identified five potential pathogenicity-related fragments in the HBV virus (EC-HBV-F001 / F002 / F003 / F004 / F005) and their tandem sequence information, as shown in Table 1.

[0187] To verify the relationship between these fragments and liver cancer, the inventors packaged lentiviruses that simultaneously expressed the five pathogenic fragments and infected hepatocellular carcinoma Huh7 cells. RT-qPCR analysis was then performed.

[0188] The results are shown in Figure 1A . In infected Huh7 cells, the expression of EC-HBV-F001 / 002 / 003 / 004 / 005 increased, with EC-HBV-F002 showing the highest upregulation.

[0189] In addition, the upregulated genes caused by EC-HBV-Fs overexpression were significantly enriched in signaling pathways closely related to tumor occurrence and development, such as angiogenesis, cell proliferation and migration, and inflammatory response (Figure 1B), suggesting that these fragments are closely related to the occurrence of liver cancer.

[0190] Subsequently, HepG2 cells were transfected with the HBV full-length expression plasmid pHBV1.3 and the control empty vector plasmid, and then the cells were collected to extract RNA, and the expression of EC-HBV-Fs was detected by RT-qPCR.

[0191] As shown in Figure 2A , RT-qPCR detection results showed that each fragment was significantly upregulated in pHBV1.3-transfected HepG2 cells, among which EC-HBV-F002 had the highest upregulation level.

[0192] Accordingly, plasma samples were collected from HBV-positive and -negative patients with HCC, and the expression of EC-HBV-F002 was detected by RT-qPCR. The expression of EC-HBV-F002 was significantly increased in HBV-positive patients (Figure 2B).

[0193] Subsequently, EC-HBV-F002 lentivirus was prepared using HEK293T cells and infected liver cancer cell Huh7. The upregulated differentially expressed genes in RNA-seq were significantly enriched in signaling pathways related to angiogenesis, cell proliferation, and migration (Figure 2C), which were correlated with clinical liver cancer, suggesting that EC-HBV-F002 plays a more critical role in the progression of liver cancer.

[0194] Therefore, these results suggest that EC-HBV-Fs is a key target for liver cancer in which HBV infection is the pathogenesis.

[0195] Example 2: EC-HBV-F002 significantly promotes the proliferation and migration of liver cancer cells

[0196] To further confirm the function of EC-HBV-Fs, the inventors selected EC-HBV-F002, which has a higher expression level, for subsequent functional studies. EC-HBV-F002 was packaged with lentivirus and infected Huh7 cells. A stable cell line expressing EC-HBV-F002 was identified by flow cytometry and named Huh7-EC-HBV-F002.

[0197] CCK8 assay showed that overexpression of EC-HBV-F002 significantly promoted Huh7 cell proliferation compared with the control group (Figure 3A).

[0198] Tranwell assay showed that compared with the control group, Huh7 overexpressed in EC-HBV-F002 penetrated the membrane more, suggesting that EC-HBV-F002 promoted the cell migration of Huh7 ( Figure 3B ).

[0199] To further determine the effect of EC-HBV-F002 on HCC cell function, an expression vector, EC-HBV-F002M, containing a mutant of EC-HBV-F002, was constructed, and a HepG2 cell line stably expressing the mutant was established. As shown in Figure 4, compared to the control group, although overexpression of EC-HBV-F002 significantly promoted HCC cell proliferation and migration as previously described, overexpression of EC-HBV-F002M abolished this promoting effect and had no effect on HCC cell proliferation and migration, suggesting that this mutation site is critical for EC-HBV-F002 function.

[0200] Subsequently, antisense oligonucleotide ASO targeting EC-HBV-F002 (ASO-F002) and negative control (ASO-NC) were synthesized and used to treat Huh7-EC-HBV-F002 cells, respectively.

[0201] As shown in Figure 5 , compared with ASO-NC, EC-HBV-F002 ASO (ASO-F002) significantly inhibited the proliferation and migration of liver cancer cells.

[0202] Therefore, EC-HBV-F002 significantly promotes the proliferation and migration of liver cancer cells, while blocking its function with ASO can inhibit the proliferation and migration of liver cancer cells.

[0203] Example 3: ASO blocking EC-HBV-F002 significantly inhibits liver cancer growth

[0204] To further clarify the function of EC-HBV-F002, the inventors conducted a nude mouse tumor formation experiment.

[0205] First, Huh7-EC-HBV-F002 cells were pretreated with ASO targeting EC-HBV-F002 (ASO-F002) and ASO-NC, respectively.

[0206] Subsequently, ASO-pretreated Huh7-EC-HBV-F002 cells and a control group of Huh7 cells not treated with ASO were subcutaneously inoculated into nude mice. One week later, ASO was injected intratumorally, and the tumor volume was recorded every day.

[0207] As shown in Figure 6A, tumors in the EC-HBV-F002 overexpression group grew faster compared to the control group, while treatment with ASO significantly inhibited tumor growth. On day 17, tumors from different groups were harvested, photographed, and analyzed. As shown in Figures 6B-D, EC-HBV-F002 significantly promoted tumor growth compared to the control group, while ASO blockade of EC-HBV-F002 significantly inhibited tumor growth.

[0208] Subsequently, tumor tissues treated with different treatments were isolated, and Ki67 expression was detected by immunohistochemistry, and the proportion of positive cells was counted. As shown in Figure 7, compared with the control group, the proportion of Ki67 positive cells in the EC-HBV-F002 group increased significantly, while the proportion of Ki67 positive cells decreased significantly after ASO blocking its function, indicating that targeting EC-HBV-F002 significantly inhibited tumor cell proliferation.

[0209] Therefore, EC-HBV-F002 is a key target for liver cancer, and targeted blocking of its function can significantly inhibit tumor growth.

[0210] Example 4: ASO blocking EC-HBV-F002 does not affect HBV replication

[0211] This example further clarifies whether EC-HBV-F002 affects HBV replication.

[0212] As shown in Figure 8A, a mouse model infected with HBV was constructed and divided into three groups. The mice were injected with rAAV8-Control and ASO negative control (ASO-NC), rAAV8-HBV1.3 and ASO-NC, and rAAV8-HBV1.3 and ASO-F002, respectively. Serum and liver tissues were collected after 1 week to evaluate the effect of blocking EC-HBV-F002 on HBV by detecting HBV surface antigens such as HBeAg and HBsAg and HBV genome.

[0213] As shown in Figure 8B-C, compared with the control group, the HBV apparent antigen in the r-AAV8-HBV1.3 and ASO-NC treatment groups was significantly increased, but ASO-F002 targeted blockade of EC-HBV-F002 did not significantly reduce antigen expression.

[0214] Similarly, targeted blockade of EC-HBV-F002 did not affect HBV genome levels ( FIG8D ).

[0215] Therefore, targeted blockade of EC-HBV-F002 did not affect HBV replication.

[0216] Example 5: EC-HBV-F001 / 003 / 004 / 005 is a potential therapeutic target for liver cancer

[0217] After clarifying the role and potential therapeutic potential of EC-HBV-F002, the inventors tested other fragments such as EC-HBV-F001 / 003 / 005 in primary hepatocytes PHH (overexpressing the core sequence) and evaluated the effects of these HBV viral fragments on hepatocyte function using the RNA-seq system.

[0218] Similar to EC-HBV-F002, as shown in Figures 9 and 10 , there was a significant enrichment of upregulated genes in tumor growth pathways such as extracellular matrix remodeling, cell adhesion, cell proliferation and migration.

[0219] Therefore, these fragments EC-HBV-F001 / 003 / 004 / 005 are key factors in HBV-induced liver cancer and are important therapeutic targets.

[0220] In summary, the inventors have identified five key pathogenic fragments in HBV that are closely associated with liver cancer. In vitro and in vivo experiments have confirmed that ASOs targeting EC-HBV-F002 significantly inhibit liver cancer growth without affecting HBV infection and replication, suggesting that EC-HBV-Fs is an important drug target for liver cancer.

[0221] Example 6: EC-HBV-F002 can be used as a marker for liver cancer progression

[0222] 1. EC-HBV-F002 expression levels are significantly higher in liver cancer (RT-qPCR)

[0223] The inventors collected plasma from 10 patients with hepatitis, 10 patients with liver cirrhosis, and 11 patients with liver cancer, extracted RNA, and detected the expression level of EC-HBV-F002 (SEQ ID NO: 1) by RT-qPCR.

[0224] F primer: CGTCAGCTGTCCGAGTAGAGGGCAGGTCCCCTAGA (SEQ ID NO: 19);

[0225] R primer: TGTCAGGCAACCGTATTCACCtTCTTCT (SEQ ID NO: 20)

[0226] The RT-qPCR results are shown in Figure 11A. Compared with chronic hepatitis B (CHB), EC-HBV-F002 expression was significantly elevated in both cirrhosis and HCC. Furthermore, compared with cirrhosis, EC-HBV-F002 expression in HCC was also significantly increased.

[0227] 2. Sensitivity and specificity analysis

[0228] Subsequently, the inventors performed ROC curve analysis to determine whether its expression level can be used to distinguish patients with different types of diseases. Statistical software (GraphPad Prism) was used to draw the ROC curve and determine the sensitivity and specificity.

[0229] The results are shown in Figure 11B-D. EC-HBV-F002 can significantly distinguish chronic hepatitis from cirrhosis, with a sensitivity and specificity of 90.00%; EC-HBV-F002 can significantly distinguish cirrhosis from liver cancer, with a sensitivity and specificity of 72.73% and 90.00%, respectively; EC-HBV-F002 can significantly distinguish chronic hepatitis from liver cancer, with a sensitivity and specificity of 90.91% and 90.00%, respectively.

[0230] Therefore, the expression level of EC-HBV-F002 can be used as a marker for HCC progression.

[0231] The above-described embodiments merely represent several implementation methods of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the present invention. It should be noted that a person of ordinary skill in the art may make several modifications and improvements without departing from the scope of the present invention, and these modifications and improvements fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be based on the appended claims. At the same time, all documents mentioned in this application are cited as references in this application, just as if each document was cited as a reference individually.

Claims

1. Use of the isolated polynucleotide in the preparation of (i) a targeting agent for inhibiting liver cancer and its progression; wherein, The polynucleotides described above include: (a) a polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and / or SEQ ID NO: 5, or a polynucleotide homologous thereto; or (b) a fragment or variant of the polynucleotide of (a).

2. The use according to claim 1, characterized in that, In (b), the fragment of the polynucleotide is a fragment including a core sequence; the core sequence includes: the nucleotide sequence shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and / or SEQ ID NO:

11.

3. The use according to claim 1 or 2, characterized in that, The targeting reagent is a targeting inhibitory reagent, targeting the polynucleotide, and interfering with or inhibiting the function of the polynucleotide, its transcript, or its translation product; preferably, the targeting inhibitory reagent includes: antisense nucleotides, interfering molecules, gene editing reagents, or constructs capable of expressing or forming the antisense nucleotides, interfering molecules, gene editing reagents; preferably, the targeting reagent is an antisense nucleotide, targeting the core sequence; more preferably, the sequence of the antisense nucleotide is as shown in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17; Preferably, the targeting reagent inhibits the proliferation of liver cancer cells, or inhibits the migration / metastasis of liver cancer cells.

4. A method for preparing a targeting reagent for inhibiting liver cancer and its progression, comprising: (1) providing an isolated polynucleotide, including: (a) a polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and / or SEQ ID NO: 5, or a polynucleotide homologous thereto; or (b) a fragment or variant of the polynucleotide of (a); preferably, in (b), the fragment of the polynucleotide is a fragment including a core sequence; the core sequence includes: the nucleotide sequence shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and / or SEQ ID NO: 11; (2)Design a targeting reagent that specifically targets the polynucleotide of (1); the targeting reagent is a targeting inhibitory reagent that targets the polynucleotide and interferes with or inhibits the function of the polynucleotide, its transcript, or its translation product; preferably, the targeting inhibitory reagent includes: antisense nucleotides, interfering molecules, gene editing reagents, or constructs capable of expressing or forming the antisense nucleotides, interfering molecules, gene editing reagents; preferably, the targeting reagent is an antisense nucleotide that targets the core sequence; more preferably, the sequence of the antisense nucleotide is as shown in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:

17.

5. A targeting reagent for inhibiting liver cancer and its progression, which is a targeting inhibitory reagent targeting an isolated polynucleotide; Among them, The polynucleotide includes: (a) a polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and / or SEQ ID NO: 5 or a polynucleotide homologous thereto; (b) a fragment or variant of the polynucleotide of (a); preferably, in (b), the fragment of the polynucleotide is a fragment including the core sequence; the core sequence includes: the nucleotide sequence shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and / or SEQ ID NO: 11; wherein the targeting reagent is a targeting inhibitory reagent that targets the polynucleotide and interferes with or inhibits the function of the polynucleotide, its transcript, or its translation product; preferably, the targeting inhibitory reagent includes: antisense nucleotides, interfering molecules, gene editing reagents, or constructs capable of expressing or forming the antisense nucleotides, interfering molecules, gene editing reagents; preferably, the targeting reagent is an antisense nucleotide that targets the core sequence; more preferably, the sequence of the antisense nucleotide is as shown in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:

17.

6. Use of the targeting reagent according to claim 5 in the preparation of a pharmaceutical composition for inhibiting liver cancer and its progression.

7. A pharmaceutical composition or medicine box for inhibiting liver cancer, characterized in that, The pharmaceutical composition includes the targeting reagent according to claim 5; or, the kit includes the pharmaceutical composition.

8. A method for screening potential substances for alleviating or treating liver cancer, the method comprising: (1) Treating a system expressing or containing a polynucleotide with a candidate substance; the polynucleotide includes: (a) a polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and / or SEQ ID NO: 5 or a polynucleotide homologous thereto; or (b) a fragment or variant of the polynucleotide of (a); and (2) Detect the transcription, expression or activity of the polynucleotide in the system; Wherein, if the candidate substance can reduce the transcription, expression or activity of the polynucleotide, it indicates that the candidate substance is a potential substance for relieving or treating liver cancer.

9. The method according to claim 8, characterized in that, Step (1) includes: in the test group, adding the candidate substance to the system expressing or containing the polynucleotide; and / or Step (2) includes: detecting the transcription, expression or activity of the polynucleotide in the system of the test group and comparing it with the control group, wherein the control group is a system expressing or containing the polynucleotide without adding the candidate substance; If the transcription, expression or activity of the polynucleotide in the test group is statistically lower than that of the control group, it indicates that the candidate is a potential substance for relieving or treating liver cancer.

10. A method for inhibiting liver cancer cells, comprising: Administer an effective amount of the targeting reagent or pharmaceutical composition to the subject in need of inhibition.

11. Use of polynucleotides in the preparation of detection reagents or kits for detecting liver cancer; the polynucleotides include: (a) A polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1 or a polynucleotide homologous thereto; or (b) a fragment or variant of the polynucleotide in (a); preferably, in (b), the fragment of the polynucleotide is a fragment including the core sequence; the core sequence includes: the nucleotide sequences shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and / or SEQ ID NO:

11.

12. Use of a detection reagent for specifically recognizing or amplifying a polynucleotide, for preparing a kit for detecting liver cancer; the polynucleotide includes: (a) A polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1 or a polynucleotide homologous thereto; Or (b) a fragment or variant of the polynucleotide in (a); preferably, in (b), the fragment of the polynucleotide is a fragment including the core sequence; the core sequence includes: the nucleotide sequences shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and / or SEQ ID NO: 11; preferably, the detection reagent includes: primers for specifically amplifying the polynucleotide, probes for specifically recognizing the polynucleotide or a chip for specifically recognizing the polynucleotide; more preferably, the primers are the primers with the sequences shown in SEQ ID NO: 19 and SEQ ID NO:

20.

13. A method for preparing a detection reagent for liver cancer detection, comprising: Prepare a reagent that specifically recognizes or amplifies a polynucleotide; the polynucleotide includes: (a) a polynucleotide having the nucleotide sequence shown in SEQ ID NO: 1 or a polynucleotide homologous thereto; or (b) a fragment or variant of the polynucleotide of (a); preferably, in (b), the fragment of the polynucleotide is a fragment including a core sequence; the core sequence includes: the nucleotide sequences shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and / or SEQ ID NO: 11; preferably, the detection reagent includes: primers that specifically amplify the polynucleotide, probes that specifically recognize the polynucleotide, or chips that specifically recognize the polynucleotide; more preferably, the primers are the primers having the sequences shown in SEQ ID NO: 19 and SEQ ID NO: 20.

Images