CFAP52 inhibitors and their use in preparing drugs for treating and / or preventing esophageal squamous cell carcinoma

Abstract

The present invention provides CFAP52 inhibitors and their use in the preparation of medicaments for treating and / or preventing esophageal squamous cell carcinoma. The CFAP52 inhibitors are nucleic acid inhibitors, specifically ribozymes, antisense molecules, oligonucleotide inhibitors, aptamers, microRNAs, or siRNAs. The CFAP52 inhibitors provided by the present invention can effectively kill esophageal squamous cell carcinoma tumor cells, significantly inhibiting the proliferation and migration of esophageal squamous cell carcinoma cells in vitro, ultimately blocking the spread and dissemination of tumor cells in esophageal squamous cell carcinoma patients, thereby exerting a favorable anti-tumor effect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to CFAP52 inhibitors and their use in treating and / or preventing esophageal squamous cell carcinoma. Background Art

[0002] Cancer is the first or second leading cause of death in humans before the age of 70. According to the latest estimates from the International Agency for Research on Cancer (IARC), there will be nearly 20 million new cancer cases and 9.7 million cancer deaths in 2022. Among them, esophageal cancer is the seventh most deadly cancer in the world. See Bray, F. et al. (2024) "Global cancer statistics 2022: GLOBOCANestimates of incidence and mortality worldwide for 36 cancers in 185 countries" CA Cancer J Clin, 74(3): 229-263. There are two main histological subtypes of esophageal cancer, including esophageal adenocarcinoma and esophageal squamous cell carcinoma (ESCC). Esophageal adenocarcinoma is common in developed Western countries, while esophageal squamous cell carcinoma is common in developing countries. See Codipilly DC et al. (2022) "Squamous Cell Carcinoma of the Esophagus"

[0003] Gastroenterol Clin North Am, 51(3):457-484. Due to the lack of early diagnostic biomarkers and effective treatment strategies, the 5-year survival rate of patients with esophageal squamous cell carcinoma is close to 18%, see Paiboonrungruang, C. et al. (2021) "Development of targeted therapy of NRF2 highesophageal squamous cell carcinoma” Cell Signal, 86:110105. In recent years, due to the limited effectiveness of traditional treatments for patients with advanced esophageal squamous cell carcinoma, molecular targeted therapy has become a research hotspot in the field and has made breakthrough progress in the treatment of some malignant tumors including esophageal squamous cell carcinoma. See Kashyap, MK et al. (2018) “Expression, regulation and targeting of receptor tyrosine kinases in esophageal squamous cell carcinoma” Mol Cancer, 17(1):54.

[0004] Therefore, developing more effective target molecules has become the key to conquering esophageal squamous cell carcinoma. Summary of the Invention

[0005] In order to solve the above problems, the purpose of the present invention is to provide a CFAP52 inhibitor that can specifically kill esophageal squamous cell carcinoma tumor cells, thereby inhibiting the malignant proliferation and spread and metastasis of esophageal squamous cell carcinoma.

[0006] Another object of the present invention is to provide use of a CFAP52 inhibitor in the preparation of a drug for treating and / or preventing esophageal squamous cell carcinoma.

[0007] In order to achieve the above object, the present invention provides a CFAP52 inhibitor, which is a nucleic acid inhibitor.

[0008] Preferably, the nucleic acid inhibitor is a ribozyme, an antisense molecule, an oligonucleotide inhibitor, an aptamer, a microRNA, a siRNA or a shRNA.

[0009] More preferably, the CFAP52 inhibitor is siRNA.

[0010] Specifically, the CFAP52 inhibitor is siCFAP52-1, siCFAP52-2 or siCFAP52-3, wherein the forward sequence of siCFAP52-1 is shown in Seq ID No.1, the reverse sequence is shown in Seq ID No.2, the forward sequence of siCFAP52-2 is shown in Seq ID No.3, the reverse sequence of siCFAP52-2 is shown in Seq ID No.4, the forward sequence of siCFAP52-3 is shown in Seq ID No.5, and the reverse sequence of siCFAP52-3 is shown in Seq ID No.6.

[0011] The present invention also provides use of the above-mentioned CFAP52 inhibitor in the preparation of a drug for treating and / or preventing esophageal squamous cell carcinoma.

[0012] Preferably, the esophageal squamous cell carcinoma is from a mammal.

[0013] Specifically, the mammal is a human.

[0014] The present invention provides a method for treating and / or preventing esophageal squamous cell carcinoma in a mammal, comprising administering to a patient suffering from symptoms of said cancer a therapeutically effective amount of a CFAP52 inhibitor.

[0015] The beneficial effects of the present invention are:

[0016] The present invention provides the use of a CFAP52 inhibitor in the preparation of a medicament for the treatment and / or prevention of esophageal squamous cell carcinoma. This CFAP52 inhibitor can specifically target and kill esophageal squamous cell carcinoma tumor cells, thereby inhibiting the growth and metastasis of esophageal squamous cell carcinoma while also avoiding the side effects of traditional chemotherapy and radiotherapy for esophageal squamous cell carcinoma. Furthermore, the CFAP52 inhibitor provided by the present invention is a double-stranded RNA nucleic acid molecule, which has low economic cost, good therapeutic effect, and promising clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1A Representative tissue microarray images of CFAP52 expression in tumor tissues from 112 patients with esophageal squamous cell carcinoma and 68 of their paired adjacent cancer tissues.

[0018] Figure 1B Figure 2 shows the expression statistics of CFAP52 in tumor tissues of 112 patients with esophageal squamous cell carcinoma and their 68 paired adjacent cancer tissues.

[0019] Figure 1C Figure 3 is the Kaplan-Meier survival curve of CFAP52 expression level and survival rate of patients with esophageal squamous cell carcinoma.

[0020] Figure 2 Western blot images of CFAP52 expression in two normal esophageal epithelial cell lines and 10 esophageal squamous cell carcinoma cell lines.

[0021] Figure 3 Western blot images of KYSE410 and KYSE450 cells overexpressing CFAP52.

[0022] Figure 4A Statistical graph of cell viability of KYSE410 cells overexpressing CFAP52.

[0023] Figure 4B Statistical graph of cell viability of KYSE450 cells overexpressing CFAP52.

[0024] Figure 5A Photographs showing the colony formation of KYSE410 and KYSE450 cells overexpressing CFAP52.

[0025] Figure 5B Statistical graph showing the colony formation of KYSE410 and KYSE450 cells overexpressing CFAP52.

[0026] Figure 6A The figure shows the analysis of the cell cycle distribution of KYSE410 cells overexpressing CFAP52.

[0027] Figure 6B Statistical graph of the cell cycle distribution of KYSE410 cells overexpressing CFAP52.

[0028] Figure 7A The figure shows the analysis of the cell cycle distribution of KYSE450 cells overexpressing CFAP52.

[0029] Figure 7B Statistical graph of the cell cycle distribution of KYSE450 cells overexpressing CFAP52.

[0030] Figure 8A Photographs showing the migration of KYSE410 and KYSE450 cells overexpressing CFAP52.

[0031] Figure 8B Statistical graph showing the migration of KYSE410 and KYSE450 cells overexpressing CFAP52.

[0032] Figure 9A Photographs of the scratch healing of KYSE410 cells overexpressing CFAP52.

[0033] Figure 9B Statistical graph of the scratch healing of KYSE410 cells overexpressing CFAP52.

[0034] Figure 10A Photographs of the scratch healing of KYSE450 cells overexpressing CFAP52.

[0035] Figure 10B Statistical graph of the scratch healing of KYSE450 cells overexpressing CFAP52.

[0036] Figure 11Western blot photos of CFAP52 expression in YES2 and KYSE410 cells transfected with siRNA.

[0037] Figure 12A Statistical graph of cell viability of siRNA-transfected YES2 cells.

[0038] Figure 12B Statistical graph of cell viability of KYSE410 cells transfected with siRNA.

[0039] Figure 13A The following are photographs of the colony formation of KYSE410 cells transfected with siRNA.

[0040] Figure 13B Statistical graph of the colony formation of KYSE410 cells transfected with siRNA.

[0041] Figure 14A This is an analysis diagram of the cell cycle distribution of YES2 cells transfected with siRNA.

[0042] Figure 14B Statistical graph of cell cycle distribution of siRNA-transfected YES2 cells.

[0043] Figure 15A This is an analysis diagram of the cell cycle distribution of KYSE410 cells transfected with siRNA.

[0044] Figure 15B Statistical graph of cell cycle distribution of KYSE410 cells transfected with siRNA.

[0045] Figure 16A These are photographs of the migration of YES2 and KYSE410 cells transfected with siRNA.

[0046] Figure 16B Statistical graph of the migration of YES2 and KYSE410 cells transfected with siRNA.

[0047] Figure 17A These are photographs of the wound healing process in YES2 cells transfected with siRNA.

[0048] Figure 17B Statistical graph of the scratch healing of siRNA-transfected YES2 cells.

[0049] Figure 18A The photographs show the wound healing of KYSE410 cells transfected with siRNA.

[0050] Figure 18B Statistical graph of the scratch healing of KYSE410 cells transfected with siRNA. DETAILED DESCRIPTION

[0051] The embodiments of the present invention will be described in detail and comprehensively below so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more precise definition of the protection scope of the present invention.

[0052] CFAP52, also known as cilia and flagella associated protein 52, also known as WDR16 (WD repeat domain 16), is a member of the large WD-40 repeat protein family (see Constanza Tapia Contreras et al. (2020) “The WD40-protein CFAP52 / WDR16 is a centrosome / basalbody protein and localizes to the manchette and the flagellum in male germ cells” Scientific Reports 10(1):14240). CFAP52 is located in band 3, subband 1, region 1, short arm of chromosome 17 (17p13.1). Its NCBI accession number is Gene ID: 146845, and its encoded protein contains 620 amino acids. CFAP52 is an intramicrotubule protein, part of the dynein-modified double microtubules in the ciliary axon, and is involved in regulating the normal beating of cilia and flagella (see Gerard W Dougherty et al. (2020) “CFAP45 deficiency causes situsabnormalities and asthenospermia by disrupting an axonemal adenine nucleotidehomeostasis module” Nature Communications 11(1):5520). It may play an important role in cell growth and survival (see Fabio Pittella Silva et al. (2005) “WDRPUH, a novel WD-repeat-containing protein, is highly expressed in human hepatocellular carcinoma and involved in cell proliferation” Neoplasia 7(4):348-55). Studies have reported that CFAP52 mutations can cause motile ciliopathies and have been identified in human patients with complete situs inversus.In addition, homozygous deletion of CFAP52 exon 2 mutations leads to male infertility (see Bingbing Wu et al. (2023) “The cilia and flagellaassociated protein CFAP52 orchestrated with CFAP45 is required for sperm motility in mice” J Biol Chem 299(7):104858), and has been shown to be a novel diagnostic target for the identification of male infertility with defects of sperm head-tail connection and flagella development (see Huijuan Jin et al. (2023) “Identification of CFAP52 as a novel diagnostic target of male infertility with defects of sperm head-tail connection and flagella development” Elife 12:RP92769). There is very little research on the role of CFAP52 in the occurrence and development of human tumors, and no clear literature reports have yet been released.

[0053] As used herein, the term "nucleic acid inhibitor" refers to a nucleic acid molecule, such as an aptamer, that inhibits the activity of a CFAP52 polypeptide by binding to the polypeptide in a manner similar to that described for the antibodies described above, or a nucleic acid molecule that binds to a polynucleotide encoding a CFAP52 polypeptide, thereby inhibiting the transcription or translation of the polynucleotide. For example, an inhibitory nucleic acid can function as a triple helix-forming oligonucleotide by interfering with the proper transcription of the CFAP52 gene. Furthermore, an inhibitory nucleic acid can be a ribozyme, which specifically binds to and degrades CFAP52 transcripts.

[0054] Alternatively, it can be an antisense, siRNA, microRNA or shRNA that is capable of binding to, degrading the transcript or at least inhibiting its efficient translation. The latter type of inhibitory nucleic acid is characterized by a nucleic acid sequence that is complementary to the sequence normally contained in the CFAP52 transcript. The complementary sequence should be sufficiently long and should contain a sufficient number of matching nucleotides to allow specific hybridization with the transcript in the cell.

[0055] According to the present invention, a "ribozyme" is an RNA molecule comprising a sequence complementary to a CFAP52 transcript. Ribozyme technology is well known in the art, and one skilled in the art is able to design and apply suitable ribozymes without difficulty; see, for example, Khan 2006, Clin. Chim. Acta 367(1-2):20-27; Kalota 2004, Cancer Biology & Therapy 3(1):4-12.

[0056] As used herein, "antisense molecule" refers to a therapeutic antisense RNA complementary to a CFAP52 transcript or a morpholino oligonucleotide capable of binding to a CFAP52 transcript. Antisense technology, including the use of morpholino oligonucleotides, is well known in the art, see, for example, Kalota 2004, Cancer Biology & Therapy 3(1):4-12; Morcos 2007, Biochem Biophys Res Commun 358(2):521-7.

[0057] Inhibitory oligonucleotides, as used herein, preferably refer to small double-stranded DNA molecules that can bind to specific regions of target genomic DNA, thereby achieving gene silencing (so-called triple-helix-forming oligonucleotides), or oligonucleotides that act as decoys to block transcription factors specifically required for target gene transcription. These technologies have been successfully used in vivo and have achieved results in therapy to some extent (see also Kalota 2004, Cancer Biology & Therapy 3(1):4-12).

[0058] The term "aptamer" as used herein refers to a nucleic acid aptamer that specifically binds to a CFAP52 polypeptide. A pool of aptamers can be generated, for example, using the systematic evolution of ligands by exponential enrichment (SELEX) technique. A selection step can be applied to aptamers that specifically bind to a CFAP52 polypeptide. Among the aptamers that specifically bind, those that block ligand binding, or those that block the interaction domain, can be identified as suitable aptamers within the meaning of the present invention. Techniques for generating aptamers are well known in the art, see, for example, Tuerk 1990, Science. Aug 3; 249(4968):505-10; Ellington 1990, Nature. Aug 30; 346(6287):818-822.

[0059] "MicroRNA," as used herein, refers to a single-stranded RNA molecule that is at least partially complementary to a nucleic acid sequence contained in the CFAP52 transcript. MicroRNAs are typically approximately 19 to 26 nucleotides in length. MicroRNAs are synthesized as precursors, so-called pri-microRNAs, which have a hairpin structure and two complementary, self-complementary regions that form the hairpin stem.

[0060] The term "small interfering RNA (siRNA)" refers to a nucleic acid molecule that is a double-stranded RNA agent that is complementary to a portion of the CFAP52 transcript and is capable of base pairing. siRNA works by specifically directing the enzyme in the host cell to cut the target RNA. By virtue of the specificity of the siRNA sequence and its homology to the RNA target, siRNA can cause the cutting of the target RNA chain, thereby inactivating the target RNA molecule. Preferably, the siRNA sufficient to regulate RNAi comprises the following nucleic acid sequence, which contains the target gene inverted repeat fragment and the target gene coding region (or portion). The complementary region of siRNA allows siRNA to be sufficient to hybridize with the target RNA, thereby regulating RNAi. In mammals, siRNA is a length of about 19-25 nucleotides.

[0061] In the following examples, unless otherwise indicated, the reagents used are all analytically pure and all reagents used can be obtained from commercial sources. Unless otherwise indicated, the western blot and other operations involved in the embodiments of the present invention are all performed in accordance with "Molecular Cloning Laboratory Manual (3rd Edition)" (Science Press, 2002 [U.S.] J. Sambrook DW Russell, translated by Huang Peitang et al.) and manufacturer's instructions. Cell culture, cell passage, cell recovery and freezing, cell transfection and other operations are all performed in accordance with "Animal Cell Culture Basic Technology Guide (4th Edition)" (Science Press, 2000, [British] Freshani (RI) write, translated by Zhang Jingbo et al.) and manufacturer's instructions.

[0062] Cells, tissue microarrays, plasmids, lentiviruses, siRNA

[0063] 1. Human normal esophageal epithelial cells (NEC and SHEE) and human esophageal squamous cell carcinoma cell lines (YES2, KYSE30, KYSE 70, KYSE 140, KYSE150, KYSE 180, KYSE410, KYSE450, KYSE510, and COLO680N) are all commercial cell lines, kindly provided by Professor Yutaka Shimada of Kyoto University, Japan. They can also be purchased from commercial websites.

[0064] 2. Human esophageal squamous cell carcinoma tissue chip was purchased from Shanghai Xinchao Biotechnology Co., Ltd., product model HEsoS180Su10. The chip contains tumor tissues from 112 esophageal squamous cell carcinoma patients and paired adjacent cancer tissues from 68 of these patients (adjacent cancer tissue refers to tissue 2 cm away from esophageal squamous cell carcinoma tissue). Tissue sections were obtained by wax embedding and sectioning.

[0065] 3. pLenti-Vector (Product No. VP106) and pLenti-CFAP52 plasmids and their corresponding lentiviruses were provided, constructed, and packaged by Beijing Maijin Biotechnology Co., Ltd.

[0066] 4. siCFAP52-NC, siCFAP52-1, siCFAP52-2, and siCFAP52-3 were synthesized by Guangzhou Ruibo Biotechnology Co., Ltd., catalog number: SIGS0015837-1.

[0067] Culture media, reagents, antibodies

[0068] 1. Complete culture medium was purchased from Beijing Xigong Biotechnology Co., Ltd. and is 10% FBS RPMI-1640 culture medium, which contains 10% fetal bovine serum (FBS), 100 U / ml penicillin, 100 U / ml streptomycin, 5958 mg / ml HEPES, L-glutamine, NaHCO3, and phenol red.

[0069] 2. Transfection reagent Lipofectamine 2000 Reagent (Lipofectamine 2000) was purchased from Thermo Fisher Scientific, catalog number: 11668030.

[0070] 3. MTS Kit CellTiter AQueous One Solution Cell Proliferation Assay was purchased from Promega, catalog number: G3581.

[0071] 4. Propidium iodide (PI) was purchased from BD Biosciences, catalog number: 550825.

[0072] 5. BCA protein concentration determination kit was purchased from Beijing Pulilai Gene Technology Co., Ltd., catalog number P1511.

[0073] 6.Super ECL ultrasensitive luminescent liquid (medium) was purchased from Beijing Pulilai Gene Technology Co., Ltd., product number: P1030.

[0074] 7. Antigen retrieval solution was purchased from Beijing Zhongshan Jinqiao Biological Co., Ltd., product number: ZLI 9071.

[0075] 8. The goat two-step detection kit (goat enhanced polymer detection system) was purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., catalog number PV-9003.

[0076] 9.CFAP52 antibody (primary antibody) was purchased from Abcam, catalog number: ab127559.

[0077] 10.β-actin antibody (primary antibody) was purchased from Abcam, catalog number: ab8226.

[0078] 11. The secondary antibodies used in Western blot experiments were purchased from Promega Corporation, anti-Mouse IgG (H+L), HRP Conjugate, Catalog No.: W4021; anti-Rabbit IgG (H+L), HRP Conjugate, Catalog No.: W401B.

[0079] Example 1: Detection of CFAP52 expression in 112 esophageal squamous cell carcinoma tumor tissues and 68 paired adjacent tissues

[0080] 1. Immunohistochemistry to detect the expression of CFAP52 in human esophageal squamous cell carcinoma tissue microarrays

[0081] The kit used for immunohistochemistry experiments was a goat two-step detection kit (goat enhanced polymer detection system), in which the endogenous peroxidase blocker was replaced with goat serum to achieve a better blocking effect. The remaining reagents were all provided with the kit, and the operation was carried out according to the kit instructions.

[0082] (1) Bake the tissue slides in an oven at 60°C for 2 h.

[0083] (2) Dewax the slides in xylene I for 30 min, then in xylene II for 30 min, then in anhydrous ethanol I for 5 min, then in anhydrous ethanol II for 5 min, 90% ethanol for 5 min, 75% ethanol for 5 min, and 60% ethanol for 5 min.

[0084] (3) Antigen retrieval: Place the tissue sections in EDTA antigen retrieval solution (pH 9.0), heat in a pressure cooker for 3 minutes, and cool naturally to room temperature.

[0085] (4) Wash three times with 1× PBS, 5 min each time.

[0086] (5) Add an appropriate amount of 3% H2O2 solution onto the slices and incubate in a humidified chamber for 10 min at room temperature.

[0087] (6) Wash three times with 1× PBS, 5 min each time.

[0088] (7) Add an appropriate amount of goat serum to the slices and incubate them in a wet box for 30 minutes at room temperature. Discard the serum.

[0089] (8) Add an appropriate amount of diluted primary antibody to the slice, place it in a humidified chamber, and incubate it at 4°C overnight.

[0090] (9) The next day, wash the cells three times with 1× PBS, each time for 5 minutes.

[0091] (10) Add biotin-labeled secondary antibody of appropriate concentration to the slices, place the slices in a humidified chamber, and incubate at room temperature for 30 min.

[0092] (11) Wash three times with 1× PBS, 5 min each time.

[0093] (12) Add an appropriate amount of the prepared DAB coloring solution to the slice and observe under a microscope until a satisfactory degree of staining is achieved.

[0094] (13) Place the slide in double-distilled water to terminate DAB color development and wash with double-distilled water for 10 min.

[0095] (14) Add hematoxylin to the slide to stain the cell nucleus, incubate for 2 minutes, then differentiate with 1% hydrochloric acid alcohol, and rinse under running tap water for 10 minutes;

[0096] (15) Alcohol dehydration: Dehydrate the slides in 60% ethanol, 75% ethanol, 90% ethanol, and anhydrous ethanol for 2 min each time;

[0097] (16) Place the slide in xylene for 5 minutes to clear it and place it in a fume hood to dry.

[0098] (17) After adding neutral gum, seal the slide with a coverslip.

[0099] (18) Observe with a microscope, collect and save pictures, typical pictures are as follows Figure 1A shown.

[0100] 2. Data Collection and Processing

[0101] The results of tissue microarray staining showed that the expression of CFAP52 in 112 human esophageal squamous cell carcinoma tissue samples was significantly higher than that in 68 paired adjacent tissue samples, with a statistically significant difference (P<0.05). Figure 1BThe patients were further divided into CFAP52 low expression group and CFAP52 high expression group according to the staining intensity and positive rate. The survival curve was drawn by Kaplan-Meier method, and the difference in survival rate between the two groups was tested by Log-rank test. The results are shown in the figure below. Figure 1C As shown in the table, P < 0.05 indicates that the difference is statistically significant. Figure 1C It can be seen that the survival time of esophageal squamous cell carcinoma patients in the CFAP52 low expression group was significantly longer than that in the CFAP52 high expression group, indicating that CFAP52 can be used as a target molecule for esophageal squamous cell carcinoma cells.

[0102] Example 2: Expression of CFAP52 in human normal esophageal epithelial cells and esophageal squamous cell carcinoma tumor cells

[0103] Western blot was used to detect the expression of CFAP52 in human normal esophageal epithelial cells (NEC, SHEE) and esophageal squamous cell carcinoma tumor cells (YES2, KYSE30, KYSE 70, KYSE 140, KYSE150, KYSE 180, KYSE410, KYSE450, KYSE510, COLO680N).

[0104] 1. Extraction of Total Cell Protein

[0105] (1) Two well-growing human normal esophageal epithelial cell lines (NEC, SHEE) and ten esophageal squamous cell carcinoma cell lines (YES2, KYSE30, KYSE70, KYSE140, KYSE150, KYSE180, KYSE410, KYSE450, KYSE510, COLO680N) were obtained, the culture medium was discarded, and the cells were washed three times with ice-cold 1× PBS. The cells were then scraped and centrifuged at 3000 rpm at 4°C for 5 min to collect the cell pellet.

[0106] (2) Add appropriate amount of protein lysis buffer (1 mL RIPA / 10 7 Cells were lysed on ice for 30 min, and vortexed every 10 min.

[0107] (3) Centrifuge at 12,000 rpm, 4°C for 20 min.

[0108] (4) The supernatant is the total cell protein, which should be stored in a -80℃ refrigerator for future use.

[0109] 2. Determination of Protein Concentration

[0110] The operation was performed according to the instructions of the BCA protein concentration assay kit.

[0111] (1) Prepare BCA working solution: According to the number of standards and samples, prepare an appropriate amount of BCA working solution by 50 volumes of reagent A and 1 volume of reagent B, and mix thoroughly.

[0112] (2) Add 0, 3.125, 6.25, 12.5, and 25 μL of protein standard to the protein standard wells of a 96-well plate, and add deionized water to make up to 25 μL; take 2 μL of the sample to be tested and add it to a 96-well plate, and add deionized water to make up to 25 μL.

[0113] (3) Add 200 μL of BCA working solution to the sample wells and protein standard wells (i.e., the volume ratio of sample to working solution is 1:20) and mix well.

[0114] (4) Warm bath at 37°C for 30 minutes.

[0115] (5) Measure the absorbance at a wavelength of 570 nm using an enzyme-labeled instrument.

[0116] (6) Prepare a standard curve and calculate the sample protein concentration from the standard curve.

[0117] 3. Western Blot

[0118] Sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) protein electrophoresis

[0119] (1) Gel preparation: Prepare SDS-PAGE separation gel and 5% stacking gel of corresponding concentration according to the protein molecular weight requirements. After the stacking gel layer solidifies, carefully pull out the comb, repeatedly rinse the loading wells, fix the gel glass plate on the electrophoresis device, add 1× Tris-glycine running buffer, rinse the loading wells with running buffer and then load the sample.

[0120] (2) Loading: Take an equal amount of protein, add an equal volume of loading buffer, heat at 100℃ for 10 minutes to denature, and then load the sample.

[0121] (3) Electrophoresis conditions: 80 V, until the dye reaches the bottom edge.

[0122] Constant current wet run

[0123] (1) Prepare the transfer buffer in advance and pre-cool it.

[0124] (2) Cut the PVDF membrane to the appropriate size and activate it in methanol for 40s-60s.

[0125] (3) Remove the PAGE gel, remove the accumulated gel, and place the separation gel into the transfer solution. Follow the "white board - sponge - filter paper - membrane - gel - filter paper - sponge - black board" sequence. Be careful not to have any bubbles. After the sponge board is installed, connect the device. Black against black, red against white.

[0126] (4) Electrophoresis conditions: constant current 0.35 A, 90 min.

[0127] Western blotting

[0128] (1) Place the PVDF membrane in blocking solution (1×PBS + 5% skim milk powder) and block at room temperature for 1 hour.

[0129] (2) Dilute the primary antibody in a certain ratio with blocking solution, place it in a hybridization bag, and incubate at 37℃ for 2 hours or at 4℃ overnight.

[0130] (3) Rinse with PBST three times at room temperature, 5-10 minutes each time.

[0131] (4) Dilute the secondary antibody in a certain ratio with blocking solution, put it into the hybridization bag, and incubate at room temperature for 1 hour.

[0132] (5) Mix equal amounts of Solution A and Solution B of the Western Blot Chemiluminescence Luminol Kit and drop them onto the membrane to completely cover the PVDF membrane. Allow to stand at room temperature for 1 minute. Expose the membrane to the following results: Figure 2 shown.

[0133] from Figure 2 It can be seen that, based on the expression level of β-actin (i.e., the depth of the band color), the expression of CFAP52 in 10 esophageal squamous cell carcinoma tumor cells was significantly upregulated compared with 2 normal esophageal epithelial cells, indicating that CFAP52 is crucial for the occurrence and development of esophageal squamous cell carcinoma.

[0134] Example 3: Effect of overexpression of CFAP52 on the proliferation of esophageal squamous cell carcinoma cells

[0135] The CDS sequence of the CFAP52 gene (NM_145054) was inserted into the overexpression lentiviral vector pLenti to generate the overexpression plasmid pLenti-CFAP52. The empty vector pLenti-Vector was used as a blank control. pLenti-CFAP52 and pLenti-Vector were then packaged using lentiviruses. The plasmid construction and lentiviral packaging were commissioned to Beijing Maijin Biotechnology Co., Ltd.

[0136] The CDS sequence of the CFAP52 gene is shown in Seq ID No. 7:

[0137] ATGGATAACAAAATTTCGCCGGAGGCCCAAGTGGCGGAGCTGGAACTTGACGCC

[0138] GTGATCGGCTTCAATGGACATGTGCCCACTGGTCTCAAATGCCATCCTGACCAGG

[0139] AGCATATGATTTATCCTCTTGGTTGCACAGTCCTCATTCAGGCAATAAATACTAA

[0140] AGAGCAGAACTTCCTACAGGGTCATGGCAACAACGTCTCCTGCTTGGCCATCTCC

[0141] AGGTCTGGAGAGTACATCGCCTCCGGACAAGTCACATTCATGGGGTTCAAGGCA

[0142] GACATCATTTTGTGGGATTATAAGAACAGAGAGCTGCTTGCTCGGCTGTCCCTTC

[0143] ACAAAGGCAAAATTGAAGCTCTGGCCTTTTCTCCAAATGATTTGTACTTGGTATC

[0144] ACTAGGAGGCCCAGATGACGGAAGTGTGGTGGTGTGGAGCATAGCCAAGAGAG

[0145] ATGCCATCTGTGGCAGCCCTGCAGCCGGCCTCAATGTTGGCAATGCCACCAATGT

[0146] GATCTTCTCCAGGTGCCGGGATGAGATGTTTATGACTGCTGGAAATGGGACAATT

[0147] CGAGTATGGGAATTGGATCTTCCAAATAGAAAAATCTGGCCAACTGAGTGCCAA

[0148] ACAGGACAGTTGAAAAGAATAGTCATGAGTATTGGAGTGGATGATGATGATAGC

[0149] TTTTTCTACCTTGGCACCACGACTGGAGATATTCTAAAAATGAACCCCAGGACTA

[0150] AACTGCTGACAGATGTTGGGCCTGCGAAGGACAAATTCAGTTTGGGAGTGTCAG

[0151] CTATCAGGTGCCTGAAGATGGGGGGTTTGTTGGTGGGCTCTGGAGCCGGACTGCT

[0152] GGTCTTCTGTAAAGCCCTGGCTACAAACCCATCAAGAAGATTCAGTTACAAGG

[0153] CGGCATCACTTCTATCACACTTCGAGGAAGGACACCAGTTTCTCGTAGGAAACA

[0154] GAAGAATCGCCACATTTATCGTGTCAGCTTCACGGATTTCAAAGAGACGCTCATAG

[0155] CGACTTGTCACTTTGATGCTGTCGAGGATATTGTCTTTCCATTTGGCACTGCTGAG

[0156] CTATTTGCAACCTGTGCCAAGAAGGATATCAGGGTGTGGCCACACATCATCCAAC

[0157] AGGGAGCTGCTGCGGATCACCGTGCCCAACATGACCTGCCACGGCATCGACTTC

[0158] ATGAGGGACGGCAAAAGCATCATTTCAGCATGGAACGACGGTAAAATCCGAGCC

[0159] TTCGCCCCAGAGACAGGCCGACTGATGTATGTCATTAACAATGCTCACAGGATCG

[0160] GCGTCACCGCCATCGCCACCACCAGTGACTGTAAAAGGGTCATCAGTGCGGTG

[0161] GGGAAGGGGAGGTGAGGGTATGGCAGATAGGCTGTCAGACCCAGAAGCTGGAG

[0162] GAGGCCCTGAAGGAACACAAGTCATCAGTGTCCTGCATTAGGGTGAAGAGGAAC

[0163] AACGAGGAGTGTGTCACCGCCAGCACCGATGGGACTTGTATCATTTGGGACCTTG

[0164] TGCGTCTCAGGAGGAATCAGATGATACTAGCCAACACCTTATTCCAGTGTGTGTG

[0165] CTATCACCCTGAGGAGTTCCAGATCATCACCAGCGGAACAGACAGAAAGATTGC

[0166] TTACTGGGAAGTATTTGATGGGACAGTAATCAGAGAATTGGAAGGTTCCCTGTCT

[0167] GGGTCGATAAATGGCATGGATATCACACAGGAAGGGGTGCACTTTGTCACAGGT

[0168] GGAAATGACCATCTGGTCAAAGTTTGGGATTATAATGAGGGTGAAGTGACTCAC

[0169] GTTGGGGTGGGACACAGTGGCAACATCACACGCATCCGCATAAGTCCAGGAAAT

[0170] CAATATATTGTTAGTGTAAGTGCCGATGGAGCCATTTTGCGATGGAAGTACCCATATACCTCCTGA。

[0171] Separate 1 - 5×10 5KYSE410 cells and KYSE450 cells were plated into six-well plates. After the cells adhered, the original culture medium was discarded, the cells were washed with 1×PBS, and the PBS was discarded. 1 mL of complete culture medium and 5 μL of virus concentrate (pLenti-CFAP52 lentivirus or pLenti-Vector lentivirus) were added to each well, mixed well, and placed in an incubator for further culturing for 24 hours. 1 mL of complete culture medium was added and continued to be cultured for 24 hours. 2 μg / mL of puromycin was added to screen stable strains, and a control group (untreated group) was set up. After all the cells in the control group were killed, the stably transformed cell lines were cultured with 1 μg / mL of puromycin, and the stably transformed cell lines of KYSE410 cells and KYSE450 cells were frozen for seed preservation. Western blot experiments were then performed to detect the overexpression efficiency of CFAP52. The specific operations were the same as in Example 2, and the results were as shown in FIG. Figure 3 shown.

[0172] from Figure 3 It can be seen that compared with the pLenti-Vector control group, the expression of CFAP52 in KYSE410 and KYSE450 cells stably transfected with the pLenti-CFAP52 overexpression plasmid was significantly upregulated, indicating that the KYSE410 and KYSE450 cell lines stably overexpressing CFAP52 were successfully constructed.

[0173] MTS assay was performed to detect the cell viability of KYSE410 cells and KYSE450 cells stably overexpressing CFAP52 prepared as described above.

[0174] 1.MTS Experiment

[0175] (1) In a clean hood, digest the cells and prepare a single-cell suspension.

[0176] (2) Mix 9 μL of the single-cell suspension with 1 μL of trypan blue staining solution, and add 10 μL of the mixture to a cell counting chamber.

[0177] (3) Measure the cell density using a cell counter.

[0178] (4) Use culture medium to adjust the density of the single-cell suspension to 50,000 cells / mL.

[0179] (5) The cell suspension was plated in a 96-well plate at a volume of 100 μL per well, and the 96-well plate was placed in a cell culture incubator for culture.

[0180] (6) After the cells adhered to the wall, the cells were tested at 0 h, 24 h, 48 h, and 72 h.

[0181] (7) Mix the MTS reagent and culture medium in a ratio of 1:9, use immediately, and store in a dark place.

[0182] (8) Discard the original culture medium and add 100 μL of MTS mixture to each well. Gently shake the wells and incubate in the incubator for 1 hour in the dark.

[0183] (9) Set the parameters of the microplate reader and use a wavelength of 490 nm to measure the absorbance. Be careful not to have any bubbles in the wells.

[0184] 2. Data Analysis

[0185] The t-test was used for statistical analysis, and P < 0.05 was considered to be statistically significant. Figure 4A and Figure 4B shown.

[0186] from Figure 4A and Figure 4B As can be seen, overexpression of CFAP52 significantly enhanced the cell viability of KYSE410 and KYSE450 cells compared to the control group, indicating that CFAP52 can promote the malignant proliferation of esophageal squamous cell carcinoma cells. Therefore, inhibiting CFAP52 expression may effectively block the growth of esophageal squamous cell carcinoma cells, further improving patient treatment outcomes and quality of life.

[0187] Example 4: Effect of overexpression of CFAP52 on the clonogenicity of esophageal squamous cell carcinoma cells

[0188] The clone formation of KYSE410 cells and KYSE450 cells stably overexpressing CFAP52 prepared in Example 3 was detected.

[0189] 1. Plate colony formation experiment

[0190] (1) Transiently transfected KYSE410 and KYSE450 cells were digested and prepared into single-cell suspensions in a clean bench.

[0191] (2) Adjust the cell suspension density to 1250 cells / mL using culture medium. Add 4 mL of the cell suspension to a 6 cm cell culture dish, mix gently, and then culture in a cell incubator.

[0192] (3) When the cell clones grow to be visible to the naked eye, stop cell culture.

[0193] (4) Discard the original culture medium, wash the cells with 1× PBS, and discard the 1× PBS.

[0194] (5) Add 1 mL of methanol solution to fix the cells, incubate at room temperature for 15 min, and discard the methanol.

[0195] (6) Add 1 mL of crystal violet stain and stain at room temperature for 30 minutes.

[0196] (7) Recover the crystal violet dye solution, carefully wash off the excess dye solution, and dry it at room temperature.

[0197] (8) Use Image J software to count the number of cell clones formed, take photos and save them. The results are as follows Figure 5A shown.

[0198] 2. Data Analysis

[0199] The t-test was used for statistical analysis, and P < 0.05 was considered to be statistically significant. Figure 5B shown.

[0200] from Figure 5A and Figure 5B As can be seen, compared with the control group, overexpression of CFAP52 significantly increased the colony formation efficiency of KYSE410 and KYSE450 cells, indicating that CFAP52 can promote the proliferation of esophageal squamous cell carcinoma cells. Therefore, inhibiting CFAP52 expression may block the occurrence and development of esophageal squamous cell carcinoma cells.

[0201] Example 5: Effect of overexpression of CFAP52 on cell cycle progression in esophageal squamous cell carcinoma cells

[0202] The cell cycle distribution of KYSE410 cells and KYSE450 cells stably overexpressing CFAP52 prepared in Example 3 was detected.

[0203] 1. Cell Cycle Analysis

[0204] (1) Discard the original culture medium in the culture dish, gently wash the cells with 1× PBS, and discard the 1× PBS.

[0205] (2) Add an appropriate amount of 0.25% trypsin, and after the cells are detached from the cell culture dish, add an appropriate amount of culture medium to neutralize.

[0206] (3) Centrifuge at 780 rpm for 5 min and discard the supernatant.

[0207] (4) Wash the cells with pre-cooled 1× PBS, centrifuge at 780 rpm for 5 min, and discard the supernatant.

[0208] (5) Add 250 μL of pre-cooled 1× PBS and gently bounce the cells. Then slowly add 750 μL of pre-cooled anhydrous alcohol to the cell suspension while gently mixing.

[0209] (6) Fix overnight at 4°C.

[0210] (7) The next day, centrifuge the fixed cells at 780 rpm for 5 min and discard the supernatant.

[0211] (8) Add 1× PBS for washing, centrifuge at 780 rpm for 5 min, and discard the supernatant.

[0212] (9) Add 300 μL of PI / RNase buffer and incubate for 15 min at room temperature in the dark.

[0213] 2. Data Analysis

[0214] The t-test was used for statistical analysis, and P < 0.05 was considered to be statistically significant. Figure 6A 、 Figure 6B 、 Figure 7A and Figure 7B shown.

[0215] from Figure 6A 、 Figure 6B 、 Figure 7A and Figure 7B As can be seen, compared with the control group, overexpression of CFAP52 significantly altered the cell cycle progression of KYSE410 and KYSE450 cells, with a significant increase in the proportion of cells in the S phase, indicating that CFAP52 can promote the cell cycle progression of esophageal squamous cell carcinoma cells. Therefore, inhibiting CFAP52 expression may block the malignant proliferation of esophageal squamous cell carcinoma cells.

[0216] Example 6: Effect of overexpression of CFAP52 on the migration ability of esophageal squamous cell carcinoma cells

[0217] The cell migration of KYSE410 cells and KYSE450 cells stably overexpressing CFAP52 prepared in Example 3 was detected.

[0218] 1. Transwell cell migration assay

[0219] (1) Transiently transfected KYSE410 and KYSE450 cells were digested separately in a clean bench, and then the cells were resuspended in serum-free culture medium and the cell density was adjusted to 10,000 cells / mL.

[0220] (2) Take 200 μL of cell suspension and add it to the upper chamber, and add 1 mL of cell culture medium containing 20% ​​serum to the lower chamber, and culture them in a cell culture incubator for 24 h.

[0221] (3) Discard the culture medium in the upper and lower chambers, and add 1 mL of methanol solution to the lower chamber to fix the cells for 15 min, then discard the methanol.

[0222] (4) Add 1 mL of crystal violet staining solution to the lower chamber and stain at room temperature for 30 minutes.

[0223] (5) Recover the crystal violet dye solution, carefully wash off the excess dye solution, and dry it at room temperature.

[0224] (6) Use Image J software to count the number of cells that pass through the chamber and take photos to save the results. Figure 8A shown.

[0225] 2. Data Analysis

[0226] The t-test was used for statistical analysis, and P < 0.05 was considered to be statistically significant. Figure 8B shown.

[0227] from Figure 8A and Figure 8B As can be seen, overexpression of CFAP52 significantly enhanced the migration ability of KYSE410 and KYSE450 cells compared to the control group, indicating that CFAP52 can promote the metastasis of esophageal squamous cell carcinoma cells. Therefore, inhibiting CFAP52 expression may effectively block the recurrence and metastasis of esophageal squamous cell carcinoma cells, improving the treatment effect and quality of life of patients.

[0228] Example 7: Effect of overexpression of CFAP52 on the scratch healing ability of esophageal squamous cell carcinoma cells

[0229] The scratch healing of KYSE410 cells and KYSE450 cells stably overexpressing CFAP52 prepared in Example 3 was detected.

[0230] 1. Cell scratch assay

[0231] (1) Marking the culture plate: Use a marker pen to draw horizontal lines on the back of the 6-well plate, with at least 5 lines passing through each well, and each line should be even and parallel.

[0232] (2) Cell plating: KYSE410 cells and KYSE450 cells stably overexpressing CFAP52 prepared in Example 3 were inoculated into 5-10×10 cells per well according to the cell growth rate. 5 Make sure the cells are evenly spread and allowed to grow overnight.

[0233] (3) Cell streaking: On the second day, use a 20 μL sterilized pipette tip or toothpick to scratch the black line on the back of the well plate vertically so that the scratch intersects with the marked line.

[0234] (4) Wash the cells and remove the scratched cells: After the streaking is completed, wash the cells 2-3 times with sterile PBS to remove the scratched cells so that the remaining gaps are clearly visible to the naked eye, and then replace with fresh serum-free or low-serum (<2%) culture medium.

[0235] (5) Cell culture and observation: The cells were cultured in a 37°C, 5% CO2 incubator. The cells were removed after 24 and 48 hours, respectively, and observed and photographed under a microscope.

[0236] (6) Image acquisition: After opening the image using Image J software, randomly draw 6 to 8 horizontal lines and calculate the mean of the distance between cells. The results are as follows: Figure 9A and Figure 10A shown.

[0237] 2. Data Analysis

[0238] The t-test was used for statistical analysis, and P < 0.05 was considered to be statistically significant. Figure 9B and Figure 10B shown.

[0239] from Figure 9A 、 Figure 9B 、 Figure 10A and Figure 10B As can be seen, overexpression of CFAP52 significantly enhanced the wound healing ability of KYSE410 and KYSE450 cells compared to the control group, indicating that CFAP52 can enhance the migration ability of esophageal squamous cell carcinoma cells. Therefore, inhibiting CFAP52 expression may effectively block the recurrence and metastasis of esophageal squamous cell carcinoma cells, further improving the treatment effect and quality of life of patients.

[0240] Example 8: Effect of Interference on CFAP52 Expression on the Proliferation of Esophageal Squamous Cell Carcinoma Cells

[0241] siRNA sequences targeting CFAP52, siCFAP52-1, siCFAP52-2, and siCFAP52-3, were designed. The forward sequence of siCFAP52-1 is shown in Seq ID No. 1: 5'-GGAGCAUAGCCAAGAGAGA-3', and the reverse sequence is shown in Seq ID No. 2: 5'-UCUCUCUUGGCUAUGCUCC-3'. The forward sequence of siCFAP52-2 is shown in Seq ID No. 3: 5'-GGAGCCAUUUUGCGAUGGA-3', and the reverse sequence of siCFAP52-2 is shown in Seq ID No. 4: 5'-UCCAUCGCAAAAUGGCUCC-3'. The forward sequence of siCFAP52-3 is shown in Seq ID No. 5: 5'-ACACCAGUUUCUCGUAGGA-3', and the reverse sequence of siCFAP52-3 is shown in Seq ID No.6 shows: 5'-UCCUACGAGAAACUGGUGU-3'.

[0242] Guangzhou Ruibo Biotechnology Co., Ltd. was commissioned to synthesize siCFAP52-1, siCFAP52-2, and siCFAP52-3. During synthesis, dTdT was added to the 3' end to enhance siRNA stability. The company also provided siCFAP52-NC as a control.

[0243] Lipofectamine 2000 Reagent was used to transfect siCFAP52-1, siCFAP52-2, siCFAP52-3, and siCFAP52-NC into YES20 and KYSE410 cells, respectively. Western blot analysis was then performed to detect the expression of CFAP52 after transfection and verify the interference efficiency of siRNA. The specific operation was the same as in Example 2, and the results were shown in Figure 2. Figure 11 shown.

[0244] from Figure 11 It can be seen that compared with the siCFAP52-NC control group, the expression of CFAP52 in YES2 and KYSE410 cells was significantly weakened after transfection with siCFAP52-1, siCFAP52-2 and siCFAP52-3, indicating that the interference efficiency of siCFAP52-1, siCFAP52-2 and siCFAP52-3 was high.

[0245] MTS assay was performed to detect changes in cell viability after transfection with siCFAP52-1, siCFAP52-2, and siCFAP52-3. The specific operation was the same as in Example 3, and the results were as follows. Figure 12A and Figure 12B shown.

[0246] from Figure 12A and Figure 12B It can be seen that compared with the control group, the siCFAP52-1, siCFAP52-2, and siCFAP52-3 provided by the present invention significantly downregulated the cell viability of YES2 and KYSE410 after interfering with the expression of CFAP52, indicating that the siCFAP52-1, siCFAP52-2, and siCFAP52-3 provided by the present invention can inhibit the expression of CFAP52, thereby effectively blocking the malignant proliferation of esophageal squamous cell carcinoma cells.

[0247] Example 9: Effect of Interference on CFAP52 Expression on the Clone-Forming Ability of Esophageal Squamous Cell Carcinoma Cells

[0248] The clone formation of YES2 cells and KYSE410 cells transiently transfected with siCFAP52-1, siCFAP52-2, and siCFAP52-3 prepared in Example 8 and the control group siCFAP52-NC was detected. The specific operation was the same as that in Example 4. The results are shown in FIG. Figure 13A and Figure 13B shown.

[0249] from Figure 13A and Figure 13B It can be seen that compared with the control group, the siCFAP52-1, siCFAP52-2 and siCFAP52-3 provided by the present invention significantly downregulated the plate clone formation ability of YES2 and KYSE410 after interfering with the expression of CFAP52, indicating that the siCFAP52-1, siCFAP52-2 and siCFAP52-3 provided by the present invention can inhibit the expression of CFAP52, thereby effectively blocking the malignant proliferation of esophageal squamous cell carcinoma cells.

[0250] Example 10: Effect of Interference with CFAP52 Expression on Cell Cycle Progression of Esophageal Squamous Cell Carcinoma Cells

[0251] The cell cycle distribution of YES2 cells and KYSE410 cells transiently transfected with siCFAP52-1, siCFAP52-2, and siCFAP52-3 prepared in Example 8 and the control group siCFAP52-NC was detected. The specific operation was the same as that in Example 5, and the results were as follows. Figure 14A 、 Figure 14B 、 Figure 15A and Figure 15B shown.

[0252] As can be seen from the figure, compared with the control group, the cell cycle distribution of YES2 and KYSE410 was significantly changed after the siCFAP52 expression was interfered with by the siCFAP52-1, siCFAP52-2, and siCFAP52-3 provided by the present invention, and the proportion of cells distributed in the S phase was significantly reduced, indicating that the siCFAP52-1, siCFAP52-2, and siCFAP52-3 provided by the present invention can downregulate the expression of CFAP52, thereby effectively blocking the division process of esophageal squamous cell carcinoma cells.

[0253] Example 11: Effect of Interference on CFAP52 Expression on Migration Ability of Esophageal Squamous Cell Carcinoma Cells

[0254] The migration ability of YES2 cells and KYSE410 cells transiently transfected with siCFAP52-1, siCFAP52-2 and siCFAP52-3 prepared in Example 8 and the control group siCFAP52-NC was tested. The specific operation was the same as that in Example 6. The results are shown in FIG. Figure 16A and Figure 16B shown.

[0255] from Figure 16A and Figure 16BIt can be seen that compared with the control group, the migration ability of YES2 and KYSE410 was significantly inhibited after the siCFAP52-1, siCFAP52-2 and siCFAP52-3 provided by the present invention interfered with the expression of CFAP52, indicating that the siCFAP52-1, siCFAP52-2 and siCFAP52-3 provided by the present invention can effectively inhibit the recurrence and metastasis of esophageal squamous cell carcinoma cells by downregulating the expression of CFAP52.

[0256] Example 12: Effect of Interference with CFAP52 Expression on the Scratch Healing Ability of Esophageal Squamous Cell Carcinoma Cells

[0257] The above siRNA targeting CFAP52 and the control group siRNA were transiently transfected into YES2 and KYSE410 cells and then the cell scratch assay was performed to detect the changes in cell migration ability. The specific operation was the same as in Example 7, and the results were as follows: Figure 17A 、 Figure 17B 、 Figure 18A and Figure 18B shown.

[0258] from Figure 17A 、 Figure 17B 、 Figure 18A and Figure 18B It can be seen that siCFAP52-1, siCFAP52-2 and siCFAP52-3 provided by the present invention can interfere with CFAP52 expression, thereby significantly inhibiting the scratch healing ability of YES2 and KYSE410 cells, and effectively blocking the recurrence and metastasis of esophageal squamous cell carcinoma cells.

[0259] It can be seen from the above examples that the CFAP52 inhibitor provided by the present invention, wherein the siRNA sequence can effectively inhibit the cell viability, colony formation, cell cycle progression, wound healing and migration ability of esophageal squamous cell carcinoma.

[0260] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

Claims

1. Use of a CFAP52 inhibitor in the preparation of a drug for treating and / or preventing esophageal squamous cell carcinoma, characterized in that: The CFAP52 inhibitor is siCFAP52-1, siCFAP52-2 or siCFAP52-3, wherein the forward sequence of siCFAP52-1 is shown in Seq ID No. 1, the reverse sequence is shown in Seq ID No. 2, the forward sequence of siCFAP52-2 is shown in Seq ID No. 3, the reverse sequence of siCFAP52-2 is shown in Seq ID No. 4, the forward sequence of siCFAP52-3 is shown in Seq ID No. 5, and the reverse sequence of siCFAP52-3 is shown in Seq ID No.

6.

2. The use according to claim 1, characterized in that The esophageal squamous cell carcinoma is from a mammal.

3. The use according to claim 2, characterized in that The mammal is a human.

Images