T cell-targeting nanoparticles based on nucleic acid aptamers and preparation and use thereof

By using T-cell-targeting lipid aptamer self-assembled nanoparticles based on nucleic acid aptamers, the problems of immune response and stability in nanodelivery systems have been solved, achieving efficient and safe drug delivery and simplified preparation, while reducing costs.

CN120249289BActive Publication Date: 2025-11-04NAJIN BIOTECHNOLOGY (TIANJIN) CO LTD

Patent Information

Application Number
CN202510732705.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-04
Publication Date
2025-11-04
Estimated Expiration
2045-06-04

AI Technical Summary

Technical Problem

Existing nanodelivery system materials are easily recognized by the immune system, leading to immune responses. They also have poor stability, complex and costly preparation processes, making large-scale production difficult.

Method used

Using a nucleic acid aptamer-based T-cell targeting lipid aptamer, hydrophobic molecules are linked to nucleic acid aptamers by chemical bonds, and self-assemble into nanoparticles with unique 3D structures to encapsulate gene molecules, thereby achieving site-specific gene reprogramming.

Benefits of technology

It improves the efficiency of targeted drug delivery, enhances the safety and economy of nanosystems, reduces production costs, and simplifies the preparation process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249289B_ABST
    Figure CN120249289B_ABST
Patent Text Reader

Abstract

The application relates to a T cell-targeting nanoparticle based on a nucleic acid aptamer and a preparation method and application thereof, in particular to a T cell-targeting lipid aptamer, wherein the lipid aptamer comprises a hydrophobic molecule and a nucleic acid aptamer, the nucleic acid aptamer comprises at least one nucleic acid aptamer for targeting a T cell surface molecule, and the molar ratio of the hydrophobic molecule and the nucleic acid aptamer is 5000:1-1:10. The lipid aptamer or the nanoparticle formed by self-assembly technology of the lipid aptamer can realize cell 'pointing' gene modification and in-vivo gene reprogramming of cells.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biomedical nanomaterials, and particularly relates to a T cell targeting lipid aptamer based on nucleic acid aptamer as well as a preparation method and application thereof. BACKGROUND

[0002] Nanodelivery technology plays a crucial role in the development and application of nanodrugs and gene drugs. Nanodelivery systems can effectively protect genes, small molecule drugs or protein drugs from degradation by various enzymes in the body, thereby prolonging the half-life of the drugs and improving their bioavailability. In addition, nanodelivery systems can achieve sustained release of drugs, maintain effective concentrations of drugs in the body, and significantly improve the therapeutic effect of genes or drugs and reduce side effects through targeting molecule modification. However, current nanodelivery systems are usually composed of multiple different nanomaterials, which are easily recognized by the immune system in the body as foreign substances and can trigger immune responses. In addition, the stability of existing delivery systems is generally poor, and the preparation process is complex, often requiring high-precision equipment and technology, which leads to high production and quality control costs, and large-scale production faces certain challenges. In order to solve the above problems, simplify the preparation process, reduce costs, and improve the stability of nanosystems while reducing potential safety hazards of nanomaterials, the present application provides a cell-targeting lipid nucleic acid aptamer molecule and a high-efficiency cell-targeting nanodelivery system with a unique 3D structure formed by self-assembly of the molecule itself. This technology can improve the efficiency of targeted drug delivery while enhancing safety and economy. SUMMARY

[0003] In view of the above technical problems to be solved, the present application provides a T cell targeting lipid aptamer based on nucleic acid aptamer and nanoparticles formed by self-assembly thereof, which comprises a nucleic acid aptamer molecule modified with a hydrophobic molecule that can target cell surface molecules and can form a spherical nanovesicle-like structure under certain conditions, and can also encapsulate various types of gene molecules to achieve "point" gene reprogramming of immune cells. Specifically:

[0004] The technical solution of the present application provides a T cell targeting lipid aptamer, wherein the lipid aptamer comprises a hydrophobic molecule and a nucleic acid aptamer, the nucleic acid aptamer comprises at least one nucleic acid aptamer that targets T cell surface molecules, and the molar ratio of the hydrophobic molecule to the nucleic acid aptamer is 5000:1-1:10.

[0005] Further, the hydrophobic molecule and the nucleic acid aptamer are connected by a chemical bond.

[0006] Further preferably, the chemical bond is selected from at least one of a disulfide bond, an amide bond, a thioester bond, an ester bond and a phosphoramide bond.

[0007] Further, the nucleic acid aptamer targeting T cell surface molecules comprises single-stranded DNA (ssDNA), RNA, XNA, TNA, or point mutants, truncations, chemically modified derivatives thereof, or chimeric DNA-TNA oligonucleotides, optionally, the chemically modified derivatives comprise derivatives of phosphodiester backbone, nucleobases, and / or sugar groups modified by chemical groups, optionally, the chemical groups are selected from amino, thiol, DBCO, carboxyl or hydroxyl.

[0008] Further, the nucleic acid aptamer targeting T cell surface molecules is selected from LD201t1, OSJ-T3, OX40, CD28Apt7, 4-1BB, CD5, CD62L or C2NP.

[0009] Further, the nucleic acid aptamer further comprises one or more nucleic acid aptamers not targeting T cell surface molecules. Further, the nucleic acid aptamer not targeting T cell surface molecules is selected from nucleic acid aptamers targeting tumor cells, stem cells, senescent cells, other immune cell surface molecules or cell surface specific receptors.

[0010] Further, the nucleic acid aptamer targeting other immune cell surface molecules is selected from nucleic acid aptamers targeting NK cell, B cell or tumor-associated macrophage surface molecules.

[0011] Further preferably, the nucleic acid aptamer targeting other immune cell surface molecules is selected from CD16a, NKp46, WXY3, CD206, A2, CD11b, CD56 or MerTK.

[0012] Further, the nucleic acid aptamer targeting tumor cell surface molecules is selected from aptamer targeting nucleolin (AS1411), aptamer targeting human epidermal growth factor 2 HER2 (Herceptamers), nucleic acid aptamer targeting chemokine CXCL12 (NOX-A12), biotinylated aptamer targeting PTK7 (Sgc8c), aptamer targeting Mucin 1 (S1.3 / S2.2), nucleic acid aptamer targeting prostate-specific membrane antigen PSMA (A10-3.2).

[0013] Further, the nucleic acid aptamer targeting stem cell surface molecules is selected from nucleic acid aptamers HM69 and Apt19S targeting mesenchymal stem cell surface molecules, nucleic acid aptamer C24S targeting tumor stem cell surface molecule CD44, nucleic acid aptamer N17 targeting hematopoietic stem cell surface molecule CD34 or nucleic acid aptamer AT-1 targeting bone marrow endothelial progenitor cell surface molecule CD31.

[0014] Further, the nucleic acid aptamer targeting the surface molecule of senescent cells is selected from the group consisting of a nucleic acid aptamer apmspdβ-gal targeting L1CAM protein and a nucleic acid aptamer molecule targeting NKG2DL.

[0015] Further, the nucleic acid aptamer targeting the non-target T cell surface molecule can also be selected from the group consisting of a nucleic acid aptamer (cl.42) targeting IL-4Ra, a nucleic acid aptamer (AIR-3A) targeting IL-6R, a nucleic acid aptamer (GS24) targeting transferrin receptor, a nucleic acid aptamer (PegS1.3 / S2.2nib (PEGylated)) targeting vascular endothelial growth factor VEGF and a nucleic acid aptamer (Apt-αvβ3) targeting integrin αvβ3.

[0016] Further, the hydrophobic molecule is a hydrocarbon molecule containing an amino group, a phosphate group, a hydroxyl group or a carboxyl group.

[0017] Further, the hydrophobic molecule is selected from at least one of 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), dipalmitoylphosphatidylcholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (sodium salt) (DOPS), dipalmitoylphosphatidylcholine (DPPC), dimyristoylphosphatidylcholine (DMPC), hydrogenated soy phospholipid (HSPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-distearoyl-sn-glycero-3-phosphatidylserine (DSPG), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dilauroylphosphatidylethanolamine (DLPE), 1,2-dipalmitoyl-sn-glycero-3-phosphatidylglycerol (DPPG), monophosphoryl lipid A (MPLA), 1,3-dilinolenin and polycaprolactone (PCL).

[0018] Further, the T cell targeting lipid aptamer provided by the present application further comprises a long-circulating stabilizer.

[0019] Further, the long-circulating stabilizer is selected from at least one of polyethylene glycol (PEG), polyvinylpyrrolidone (PVP) and poloxamer.

[0020] Further, in the T cell targeting lipid aptamer, the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), and the nucleic acid aptamer is OSJ-T3, preferably, the molar ratio is 1000:1~100:1; or

[0021] the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the aptamer is LD201tl, and the molar ratio is preferably 1000:1-100:1; or

[0022] the hydrophobic molecule is 1,2-dipalmitoyl-sn-glycero-3-phosphatidylglycerol (DPPG), the aptamer is 4-1BB, and the molar ratio is preferably 5000:1-3000:1; or

[0023] the hydrophobic molecule is polycaprolactone (PCL), the aptamer is OX40, and the molar ratio is preferably 5000:1-3000:1; or

[0024] the hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), the aptamer is CD28; or

[0025] the hydrophobic molecule is dioleoylphosphatidylserine sodium (DOPS), the aptamer is C2NP; or

[0026] the hydrophobic molecule is 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (DPPE), the aptamer is OX40 and OSJ-T3; or

[0027] the hydrophobic molecule is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), the aptamer is CD28, and the long-circulating stabilizer is poloxamer.

[0028] the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the aptamer is CD28 and NKG2DL;

[0029] the hydrophobic molecule is dioleoylphosphatidylserine sodium (DOPS), the aptamer is 4-1BB and PegS1.3 / S2.2nib (PEGylated), and the long-circulating stabilizer is PEG.

[0030] The application also provides a nanoparticle constructed by the T cell targeting lipid aptamer described above.

[0031] Further, the nanoparticle has a particle size of 80-1000 nm, and further preferably 110-300 nm.

[0032] Further, the nanoparticle can load a payload.

[0033] Further, the payload is a therapeutic agent.

[0034] Further, the therapeutic agent is selected from at least one of a polynucleotide or oligonucleotide molecule, a chemotherapy drug, a small molecule targeted drug, an immune checkpoint inhibitor, an antibody conjugated drug, or a hormone drug.

[0035] Further, the polynucleotide or oligonucleotide molecule is selected from at least one of an mRNA, an siRNA, an miRNA, or a DNA molecule.

[0036] Further preferably, the mRNA is a CAR-mRNA, a LYTAC mRNA, or a PROTAC mRNA.

[0037] Further, the chemotherapy drug is selected from at least one of paclitaxel, doxorubicin, capecitabine, and gemcitabine.

[0038] Further, the small molecule targeted drug is selected from at least one of brigatinib, a HER2 inhibitor (lapatinib), a BCR-ABL inhibitor (imatinib), an EGFR-TKI inhibitor (osimertinib), and an EGFR inhibitor (cetuximab).

[0039] Further, the immune checkpoint inhibitor is selected from at least one of a PD-1 / PD-L1 inhibitor, a CTLA-4 inhibitor, a LAG-3 inhibitor, a TIM-3 inhibitor, and a TIGIT inhibitor.

[0040] Further, the antibody conjugated drug is selected from at least one of an antibody conjugated with maytansine, an Auristatin derivative, Anetumab Ravtansine, and an auristatin.

[0041] Further, the hormone drug is an agonist or an inhibitor of a hormone.

[0042] Further, the hormone drug comprises at least one of a selective estrogen receptor modulator tamoxifen, an aromatase inhibitor anastrozole, a gonadotropin-releasing hormone analogue leuprolide, an anti-androgen drug bicalutamide, and an estrogen receptor downregulator fulvestrant.

[0043] Further, in the nanoparticle, the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the aptamer is LD201t1, and the therapeutic agent is an mRNA; or

[0044] the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the aptamer is LD201t1, and the therapeutic agent is a FAP CAR mRNA; or

[0045] the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the aptamer is LD201t1, and the therapeutic agent is NKG2DL CAR mRNA; or

[0046] the hydrophobic molecule is dipalmitoyl phosphatidylcholine (DPPC), the aptamer is 4-1BB, and the therapeutic agent is mRNA; or

[0047] the hydrophobic molecule is polycaprolactone (PCL), the aptamer is OX40, and the therapeutic agent is siRNA; or

[0048] the hydrophobic molecule is 1,2-distearyl-sn-glycero-3-phosphatidylserine (DSPG), the aptamer is CD28, and the therapeutic agent is plasmid DNA; or

[0049] the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the aptamer is OSJ-T3, and the therapeutic agent is CD19 CAR mRNA.

[0050] The technical solution of the present application also provides a preparation method of the T cell-targeting lipid aptamer or nanoparticle.

[0051] reacting the hydrophobic molecule with a cross-linking agent and / or a catalyst to obtain a first product;

[0052] reacting the first product with an aptamer molecule to obtain a lipid aptamer, the aptamer molecule comprising at least one aptamer molecule targeting a T cell surface molecule.

[0053] Further, the preparation method further comprises: loading the lipid aptamer with at least one loading.

[0054] Further, the mass ratio of the hydrophobic molecule to the cross-linking agent and / or the catalyst is 10-0.1:1.

[0055] Further, the molar ratio of the hydrophobic molecule to the aptamer molecule is ≥1:10.

[0056] Further, in the step of reacting the hydrophobic molecule with the cross-linking agent and / or the catalyst to obtain the first product, the reaction temperature is 20-30°C, and the reaction time is 1.5-3 hours.

[0057] Further, in the step of reacting the first product with the aptamer molecule to obtain the lipid aptamer, the reaction temperature is 0-30°C, and the reaction time is 18-24 hours.

[0058] Further, in the step of encapsulating the aptamer and the at least one load, the reaction temperature is 20-30℃, and the reaction time is 0.5-4 hours.

[0059] Further, the T cell targeting aptamer or the nanoparticle is prepared by the preparation method.

[0060] The technical scheme of the present application also provides an application of the T cell targeting aptamer or the nanoparticle in preparing a nanomedicine for treating diseases.

[0061] Further, the diseases are tissue fibrosis, anti-aging, autoimmune diseases, or tumor diseases.

[0062] Further preferably, the tumor diseases include gastric cancer, pancreatic cancer, prostate cancer, lung cancer, ovarian cancer, nasopharyngeal cancer, breast cancer, lymphoma and leukemia.

[0063] Further, the medicine is a nanomedicine or a nanovaccine.

[0064] Inventive effect

[0065] The technical scheme provided by the present application relates to a preparation and an application of a T cell targeting aptamer, which is prepared from a hydrophobic molecule modified nucleic acid aptamer, and the nucleic acid aptamer has a T cell targeting property. The aptamer itself or other hydrophobic molecules can be constructed into a spherical nucleic acid aptamer nanoparticle with a unique 3D structure through a molecular self-assembly technology, and according to different application scenarios, the nanoparticle is modified and assisted by an appropriate long-circulating stabilizer to prepare a long-circulating nanomedicine or is prepared into a double-targeting spherical nucleic acid nanoparticle using a double-specific nucleic acid aptamer.

[0066] The hydrophobic molecule and the T cell targeting nucleic acid aptamer can be self-assembled into a nanoparticle, which can be directly used for T cell mediated targeted killing of diseases, or can be prepared into a spherical nanovesicle to encapsulate various types of mRNA, siRNA, DNA and other gene molecules. After the nanomedicine is injected into the body through the vein, it can specifically target the target cells, and under the reductive condition in the cells, the chemical bonds are broken to release mRNA, siRNA or DNA, so that the cells are “pointed” gene modified, and the in vivo gene reprogramming of the cells is realized. BRIEF DESCRIPTION OF DRAWINGS

[0067] Figure 1 Figure 4 is a transmission electron microscope image of the DOPE-LD201t1 nanoparticle in the embodiments of the present application.

[0068] Figure 2This is a schematic diagram illustrating the cytotoxicity of HUVEC cells after the DOPE-LD201t1 nanoparticles carrying mRNA act on HUVEC cells in the embodiments of this application.

[0069] Figure 3 This is a schematic diagram illustrating the uptake of DOPE-LD201t mRNA-loaded nanoparticles by T cells in an embodiment of this application.

[0070] Figure 4 This is a schematic diagram of the in vivo biological distribution of DOPE-LD201t1 nanoparticles in the embodiments of this application.

[0071] Figure 5 This is a schematic diagram illustrating the effect of DOPE-LD201t1 nanoparticles carrying mRNA on the body weight of mice with idiopathic pulmonary fibrosis in the embodiments of this application.

[0072] Figure 6 This is a particle size distribution diagram of the nanoparticles carrying FAP CAR mRNA in DOPE-LD201t1 in the embodiments of this application.

[0073] Figure 7 This is a schematic diagram of the particle size stability of the DOPE-LD201t1 nanoparticles carrying FAP CAR mRNA in the embodiments of this application.

[0074] Figure 8 In the embodiments of this application, DPPC-4-1BB nanoparticles are used to encapsulate mRNA. EGFP A schematic diagram showing the expression of the fluorescent protein EGFP.

[0075] Figure 9 This is a schematic diagram showing the encapsulation efficiency of PCL-OX40-loaded siRNA in the embodiments of this application.

[0076] Figure 10 This is a schematic diagram of the particle size distribution of the DSPG-CD28 nanoparticles carrying plasmid DNA in the embodiments of this application.

[0077] Figure 11 This is a schematic diagram illustrating the effect of DOPS-C2NP nanoparticles on the survival of T-lymphoma mice in the embodiments of this application.

[0078] Figure 12 This is an agarose gel electrophoresis image of the DOPE-OSJ-T3 lipid aptamer molecule in the embodiments of this application.

[0079] Figure 13 This is a schematic diagram illustrating the in vitro killing effect of DOPE-OSJ-T3 nanoparticles carrying CD19 CAR mRNA on tumor cells in the embodiments of this application.

[0080] Figure 14 Figure 1 is a schematic diagram of the nanoparticle size distribution of DSPC-CD28 / poloxamer in the embodiments of the present application.

[0081] Figure 15 Figure 2 is a schematic diagram of the nanoparticle size distribution of DPPE-OX40-OSJ-T3 in the embodiments of the present application.

[0082] Figure 16 Figure 3 is a schematic diagram of the effect of the nanoparticles of DOPE-LD201tl entrapping NKG2DL CAR mRNA on the plasma glucose level of aging mice in the embodiments of the present application. DETAILED DESCRIPTION

[0083] The embodiments of the present application are described in detail below by way of specific examples, but the following content should not be understood as any limitation on the present application. The scientific and technical terms mentioned in the specification have the same meaning as that generally understood by those skilled in the art, and if there is a conflict, the definition in the specification shall prevail. Those skilled in the art can make many forms under the inspiration of the present application without departing from the purpose of the present application and the scope protected by the claims, which all belong to the protection of the present application.

[0084] Secondly, the "embodiments" or "specific embodiments" referred to below refer to specific features, structures or characteristics that can be included in at least one implementation of the present application. "In an embodiment" appearing in different places in the specification does not refer to the same embodiment, nor is it an embodiment that is mutually exclusive with other embodiments. The subsequent description in the specification is a preferred embodiment for implementing the present application, but the description is for the purpose of the general principles of the specification and is not intended to limit the scope of the present application. The scope of protection of the present application shall be subject to the appended claims.

[0085] The present application relates to a T cell targeting lipid aptamer, which comprises a hydrophobic molecule and a nucleic acid aptamer, wherein the nucleic acid aptamer comprises at least one nucleic acid aptamer targeting a T cell surface molecule.

[0086] In the embodiments of the present application, the molar ratio of the reaction of the hydrophobic molecule and the nucleic acid aptamer in the T cell targeting lipid aptamer is 5000:1-1:10.

[0087] In some specific embodiments, the molar ratio of the reaction of the hydrophobic molecule and the nucleic acid aptamer can be 5000:1, 4500:1, 4000:1, 3500:1, 3000:1, 2500:1, 2000:1, 1500:1, 1000:1, 500:1, 250:1, 100:1, 1:1, 1:2, 1:4, 1:8, 1:10.

[0088] In specific embodiments, the hydrophobic molecule and the aptamer are linked by a chemical bond.

[0089] In some specific embodiments, the chemical bond is selected from at least one of a disulfide bond, an amide bond, a thioester bond, an ester bond, a phosphoramide bond.

[0090] The hydrophobic molecule in the present application refers to a molecule having mutually repulsive properties with water molecules, generally non-polar. In specific embodiments, the hydrophobic molecule is a molecule containing an amino group, a phosphate group, a hydroxyl group, or a carboxyl group.

[0091] In some specific embodiments, the hydrophobic molecule is selected from at least one of 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), dipalmitoylphosphatidylcholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (sodium salt) (DOPS), dipalmitoylphosphatidylcholine (DPPC), dimyristoylphosphatidylcholine (DMPC), hydrogenated soy phospholipid (HSPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-distearoyl-sn-glycero-3-phosphatidylserine (DSPG), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dilauroylphosphatidylethanolamine (DLPE), 1,2-dipalmitoyl-sn-glycero-3-phosphatidylglycerol (DPPG), monophosphoryl lipid A (MPLA), 1,3-dilinolenin, and polycaprolactone (PCL).

[0092] The term “aptamer” in the present application encompasses single-stranded DNA (ssDNA), RNA, or synthetic DNA analogs (such as Xeno-nucleic acid (XNA) aptamer, TNA aptamer) and their derivatives, such as their site-directed mutants, truncated versions, and chemically modified nucleic acid derivatives, which are artificially synthesized in vitro by the Systematic evolution of ligands by exponential enrichment (SELEX) technique from a library of random oligonucleotide sequences.

[0093] In 1990, Ellington and Tuerk published their research results in Nature and Science respectively, and named the nucleic acid aptamer (Aptamer). Since then, researchers have been constantly discovering new aptamers, and so far more than 2000 aptamers have been reported. Aptamers are also known as "chemical antibodies", which can specifically bind to target molecules (metal ions, drugs, small organic compounds, metabolites, proteins, viruses, bacteria, living cells, etc.) by forming secondary and / or tertiary structures, and at the same time, compared with antibodies, aptamers have the advantages of easy preparation and labeling modification, good stability, low price, etc.

[0094] The screening and optimization of nucleic acid aptamers is called SELEX. The process of classical SELEX usually includes library construction and synthesis (usually the library capacity is between 10 10 to 10 15 ), binding with target ligand, washing unbound nucleic acids, eluting bound nucleic acids, amplifying the target library. The whole screening process needs to be repeated for several rounds, and after several cycles, aptamers with high affinity and high specificity to target ligands are finally obtained. Many new SELEX techniques have been developed, including changing the binding conditions and screening platform, target type, library design and fixed matrix, such as graphene oxide (GO)-SELEX, capillary electrophoresis (CE)-SELEX, cell-SELEX, Photo-SELEX and fluorescence activated cell sorting-SELEX. The aptamers screened can form the following common structures: 1. Stem-loop structure (a stem formed by a complementary base sequence, and a single-stranded region at both ends of the stem forms a loop); 2. Hairpin structure (a stem formed by complementary base pairing, and a single-stranded region forms a hairpin loop); 3. G-quadruplex structure (multiple guanine bases form a planar tetramer through hydrogen bonds) These secondary structures can form conformational matching and multiple non-covalent interactions (hydrogen bonds, van der Waals forces, electrostatic interactions, etc.) with specific sites of the receptor, achieving specific binding. When the length of the screened aptamer is relatively long or the affinity / specificity is not strong, the aptamer can also be optimized by a series of methods. Common methods include truncation (retaining important stem-loop structures), site-directed mutagenesis, chemical modification (such as 2'-O-methyl which can improve the affinity of aptamers), multivalent aptamers, etc.

[0095] XNA is an artificially synthesized genetic polymer, usually by modifying the sugar moiety to obtain enhanced biostability, rich chemical diversity and additional functions. Various types of XNA have been synthesized, capable of storing, retrieving and encoding information, and exchanging information with natural nucleic acids. Threose nucleic acid (also known as trifluorouracil nucleic acid, TNA) is a special type of XNA, due to its simplicity in chemical structure, it is considered as a potential primitive genetic polymer, and has excellent biostability.

[0096] It has been reported that various modified nucleic acids and artificial nucleic acid polymers constructed entirely from non-natural building blocks have been developed, including modifications to the phosphodiester backbone, sugar group and nucleobase. These modifications have an impact on the biostability, chemical diversity, immunogenicity and ability to hybridize with complementary DNA and RNA of nucleic acids. In particular, the improved nuclease stability and the diversity of nucleobase chemical composition are of key significance for the selection and evolution of aptamers with nuclease resistance and high affinity as diagnostic and therapeutic tools.

[0097] Among the sugar-modified nucleic acids, TNA has been extensively studied, with particular attention to additional modifications to its structure, including changes to the phosphodiester backbone or nucleobase. TNA was first proposed by Eschenmoser as an ancestor of RNA. TNA has a 4-carbon sugar threose and a 3'-2' linked phosphodiester backbone, and has higher biostability than DNA and RNA under simulated physiological conditions. Despite the obvious structural differences from DNA and RNA, TNA can still form stable anti-parallel Watson-Crick double strands with classic nucleic acids.

[0098] In the embodiments of the present application, the nucleic acid aptamer targeting T cell surface molecules includes single-stranded DNA (ssDNA), RNA, XNA, TNA, or point mutants, truncates, chemically modified derivatives thereof, or chimeric DNA-TNA oligonucleotides targeting T cell surface molecules. In some specific embodiments, the chemically modified derivatives include derivatives of the phosphodiester backbone, nucleobase, and / or sugar group modified by a chemical group, optionally, the chemical group is selected from amino, thiol, DBCO, carboxyl or hydroxyl.

[0099] In specific embodiments, the nucleic acid aptamer targeting T cell surface molecules can be selected from LD201t1, OSJ-T3, OX40, CD28Apt7, 4-1BB, CD5, CD62L or C2NP.

[0100] The nucleotide sequences of some of the nucleic acid aptamers targeting T cell surface molecules in the present application are as follows:

[0101] 1) LD201t1 (SEQ ID NO. 1): TAGCCAAGGTAACCAGTACAAGGTGCTAAACGTAATGGCTTCGGCTTAC;

[0102] 2) OSJ-T3 (SEQ ID NO. 2): GCCGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGC;

[0103] 3) OX40 (SEQ ID NO. 3): GGGATGCGGAAAAAAGAACACTTCCGATTAGGGCCCACCCTAACGGCCGCAGAC;

[0104] 4) CD28 (SEQ ID NO. 4): GATTAGACCATAGGCTCCCAACCCCTCTGAGGTGCTCCTGCTTTGGAACTCAAGACCGTTATGTCGTGTGTACTT;

[0105] 5) 4-1BB (SEQ ID NO. 5): GGGAGAGAGGAAGAGGGATGGGCGACCGAACGTGCCCTTCAAAGCCGTTCACTAACCAGTGGCATAACCCAGAGGTCGATAGTACTGGTACCCCCC.

[0106] In some embodiments of the present application, the hydrophobic molecules and the nucleic acid aptamer targeting T cell surface molecules form a lipid aptamer nano-preparation with a unique 3D structure by molecular self-assembly technology under certain conditions, which can directly kill immune cells that mediate diseases, and can achieve precise targeted killing for diseases such as T cell lymphoma, and effectively solve the problem of drug resistance of chemotherapy drugs.

[0107] In some embodiments of the present application, the T cell targeting lipid aptamer nanoparticle is composed of two hydrophobic modified nucleic acid aptamer molecules to form a 3D spherical lipid aptamer nanoparticle structure by self-assembly. In some specific embodiments, both of the two nucleic acid aptamers can be nucleic acid aptamers targeting T cell surface molecules. In other specific embodiments, one of the two nucleic acid aptamers is a nucleic acid aptamer targeting T cell surface molecules, and the other is a nucleic acid aptamer not targeting T cell surface molecules.

[0108] In specific embodiments, the nucleic acid aptamer not targeting T cell surface molecules can be selected from at least one of a nucleic acid aptamer targeting tumor cells, stem cells, senescent cells, other immune cell surface molecules, or a nucleic acid aptamer targeting cell surface specific receptors.

[0109] In specific embodiments, the other immune cells can include immune cells other than T cells, such as NK cells, B cells, or tumor-associated macrophages.

[0110] In some specific embodiments, the NK cell surface molecule can be CD16, NKp46, or CD56.

[0111] In some specific embodiments, the tumor-associated macrophage surface molecule can be WXY3, CD206, CD11b, MerTK, or A2.

[0112] In specific embodiments, the nucleic acid aptamer targeting a tumor cell surface molecule can be selected from one or more of an aptamer targeting nucleolin (AS1411), an aptamer targeting human epidermal growth factor 2 HER2 (Herceptamers), a nucleic acid aptamer targeting chemokine CXCL12 (NOX-A12), a biotinylated aptamer targeting PTK7 (Sgc8c), and an aptamer targeting Mucin1 (S1.3 / S2.2), a nucleic acid aptamer targeting prostate-specific membrane antigen PSMA (A10-3.2).

[0113] In specific embodiments, the nucleic acid aptamer targeting a stem cell surface molecule can be selected from one of a nucleic acid aptamer targeting mesenchymal stem cell surface molecule HM69 and Apt19S, a nucleic acid aptamer targeting tumor stem cell surface molecule CD44 C24S, a nucleic acid aptamer targeting hematopoietic stem cell surface molecule CD34 N17, a nucleic acid aptamer targeting bone marrow endothelial progenitor cell surface molecule CD31 AT-1, and the like.

[0114] In specific embodiments, the nucleic acid aptamer targeting a senescent cell surface molecule can be selected from a nucleic acid aptamer targeting L1CAM protein apmspdβ-gal and a nucleic acid aptamer molecule targeting NKG2DL.

[0115] In the above embodiments, the lipid aptamer nanoparticle has precise killing, and after entering the body, recruits immune cells to kill tumor cells / stem cells, enhancing the anti-tumor effect.

[0116] In embodiments of the present application, the nucleic acid aptamer targeting a non-target T cell surface molecule can also be selected from a nucleic acid aptamer targeting a cell surface specific receptor. In specific embodiments, the nucleic acid aptamer targeting a cell surface specific receptor can be selected from one of a nucleic acid aptamer targeting IL-4Ra (cl.42), a nucleic acid aptamer targeting IL-6R (AIR-3A), a nucleic acid aptamer targeting transferrin receptor (GS24).

[0117] In specific embodiments, the nucleic acid aptamer of the non-targeted T cell surface molecule can also be selected from one or more of nucleic acid aptamers targeting cell surface specific targets, such as a nucleic acid aptamer targeting prostate specific membrane antigen PSMA (A10-3.2), a nucleic acid aptamer targeting vascular endothelial growth factor VEGF (PegS1.3 / S2.2nib (PEGylated)), and a nucleic acid aptamer targeting integrin ανβ3 (Apt-ανβ3), etc.

[0118] In the above embodiments, the nucleic acid aptamer can be directed to a certain target of a cell, or to different targets of the same cell, and the nano-delivery system can enhance the delivery efficiency of a specific cell.

[0119] In some specific embodiments, the T cell-targeting lipid aptamer nanoparticle is a degradable nanoparticle that, upon entering the body, can mediate the degradation of cell surface membrane proteins through the endocytosis-lysosome pathway.

[0120] In another embodiment of the present application, the cell-targeting lipid aptamer nanoparticle is self-assembled from two parts, a hydrophobic molecule-modified nucleic acid aptamer and a long-circulating stabilizer. The nanoparticle has both targeting delivery or killing and long circulation of the drug in the blood, prolonging the half-life.

[0121] In the embodiments of the present application, the long-circulating stabilizer can be selected from one of polyethylene glycol (PEG), polyvinylpyrrolidone (PVP), poloxamer, etc.

[0122] The present application also provides a nanoparticle constructed from the T cell-targeting lipid aptamer.

[0123] In the present application, the nanoparticle can have a particle size of 80-1000 nm. For example, it can be 80 nm, 90 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 220 nm, 250 nm, 280 nm, 300 nm, 500 nm, 600 nm, 800 nm, 1000 nm, etc.

[0124] In specific embodiments, the cell-targeting lipid aptamer constructs the nanoparticle through self-assembly technology.

[0125] In some specific embodiments of the present application, the nanoparticle constructed from the cell-targeting lipid aptamer encapsulates a load.

[0126] In some embodiments, the hydrophobic molecules and aptamers are self-assembled into a spherical nanovesicle or a liposome aptamer nanoparticle with a unique 3D structure.

[0127] In some embodiments of the application, the nanoparticle is loaded with a therapeutic agent.

[0128] In some embodiments, the therapeutic agent is selected from at least one of a polynucleotide or oligonucleotide molecule, a chemotherapeutic drug, a small molecule targeted drug, an immune checkpoint inhibitor, an antibody conjugated drug, or a hormone drug.

[0129] In some embodiments, the hydrophobic molecules and aptamers are connected by disulfide bonds, which can be broken by a reducing microenvironment after being taken up by target cells, releasing the load.

[0130] In some embodiments, the hydrophobic molecules and aptamers are self-assembled into a spherical nanovesicle-like structure under certain conditions, and loaded with one or more polynucleotide or oligonucleotide molecules, which can achieve "point-to-point" gene reprogramming of immune cells. In some embodiments, the cell-targeting nanoparticles can be loaded with one or more types of mRNA (such as CAR-mRNA), siRNA, or DNA.

[0131] In some embodiments, the hydrophobic molecules and aptamers form a spherical vesicle-like nanostructure. The nanoparticles can be loaded with one or more types of therapeutic agents, such as chemotherapeutic drugs, small molecule targeted drugs, immune checkpoint inhibitors, antibody conjugated drugs, or hormone drugs.

[0132] In some embodiments, the hydrophobic molecules and aptamers are self-assembled into a spherical nanovesicle-like structure under certain conditions, and loaded with one or more types of mRNA (such as PROTAC mRNA), siRNA, miRNA, or chemotherapeutic drugs.

[0133] In embodiments of the present application, the chemotherapeutic drug can be selected from paclitaxel, doxorubicin, capecitabine, and gemcitabine, etc.; the small molecule targeted drug can be selected from brigatinib, HER2 inhibitor (lapatinib), BCR-ABL inhibitor (imatinib), EGFR-TKI inhibitor (osimertinib), and EGFR inhibitor (cetuximab), etc.; the immune checkpoint inhibitor can be selected from PD-1 / PD-L1 inhibitor, CTLA-4 inhibitor, LAG-3 inhibitor, TIM-3 inhibitor, and TIGIT inhibitor, etc.; the antibody conjugate drug can be selected from maytansine, Auristatin derivative, Anetumab Ravtansine, auristatin, etc.; the hormone drug can be selected from selective estrogen receptor modulator tamoxifen, aromatase inhibitor anastrozole, gonadotropin-releasing hormone analogue leuprolide, anti-androgen drug bicalutamide, and estrogen receptor down-regulator fulvestrant, etc.

[0134] The molecular self-assembly technology in the present application refers to a method of spontaneously forming an ordered structure through intermolecular interactions (such as hydrophobic interaction, hydrogen bonding, van der Waals force, etc.).

[0135] In specific embodiments, the self-assembly technology can be implemented by microfluidic devices, ultrasonic method, stirring method, copolymer self-assembly, etc.

[0136] In some specific embodiments, molecular self-assembly is achieved by microfluidic devices. For example, in a specific embodiment of the present application:

[0137] The hydrophobic molecule DOPE and the nucleic acid aptamer molecule LD201t1 are connected by a disulfide bond to obtain the DOPE-LD201t1 lipid aptamer molecule, and then the DOPE-LD201t1 lipid aptamer and the load FAPCAR mRNA are self-assembled by a microfluidic device to obtain the DOPE-LD201t1 nanoparticle loaded with FAP CAR mRNA.

[0138] In some specific embodiments, molecular self-assembly is achieved by ultrasonic method. For example, in a specific embodiment of the present application:

[0139] The hydrophobic molecule PCL and the nucleic acid aptamer molecule OX40 are made into PCL-OX40 lipid aptamer molecules by click reaction, and then the PCL-OX40 lipid aptamer and the load siRNA are self-assembled by ultrasonic method to obtain the PCL-OX40 nanoparticle loaded with siRNA.

[0140] In some specific embodiments, molecular self-assembly is achieved by stirring method. For example, in a specific embodiment of the present application:

[0141] The hydrophobic molecule DOPS and the nucleic acid aptamer C2NP are connected by an amide bond to obtain the DOPS-C2NP aptamer molecule, and then the DOPS-C2NP nanoparticle is obtained by self-assembly using a stirring method.

[0142] In some specific embodiments, the molecular self-assembly is achieved by a copolymer self-assembly method, for example, in one specific embodiment of the present application:

[0143] The hydrophobic molecule DOPS and the hydrophilic nucleic acid aptamer molecules 4-1BB and PegS1.3 / S2.2nib (PEGylated) are connected by an amide bond to obtain the DOPS-4-1BB and DOPS-PegS1.3 / S2.2nib (PEGylated) aptamer molecules. Then the hydrophilic DOPS-4-1BB and DOPS-PegS1.3 / S2.2nib (PEGylated) aptamer molecules are self-assembled with the lipophilic hydrophobic molecule PEG to obtain the DOPS-4-1BB / DOPS-PegS1.3 / S2.2nib (PEGylated) / PEG long-circulating dual-targeting aptamer nanoparticle.

[0144] The following are some specific T cell targeting aptamers or nanoparticles constructed by T cell targeting aptamers provided in the present application:

[0145] In one T cell targeting aptamer provided in the present application, the hydrophobic molecule is selected from 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), and the nucleic acid aptamer is selected from the aptamer OSJ-T3 targeting the T cell surface molecule. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer is 1000:1 to 100:1.

[0146] In one T cell targeting aptamer provided in the present application, the hydrophobic molecule is selected from 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), and the nucleic acid aptamer is selected from LD201tl. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer is 1000:1 to 100:1.

[0147] In one T cell targeting aptamer provided in the present application, the hydrophobic molecule is selected from 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), and the nucleic acid aptamer is selected from LD201tl. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer is 1000:1 to 100:1.

[0148] In a T cell targeting liposomal aptamer provided by the application, the hydrophobic molecule is selected from polycaprolactone (PCL), and the nucleic acid aptamer is selected from OX40. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer is 5000:1-3000:1.

[0149] In a T cell targeting liposomal aptamer provided by the application, the hydrophobic molecule is selected from distearoylphosphatidylcholine (DSPC), and the nucleic acid aptamer is selected from the aptamer CD28 targeting T cell surface molecules. In a preferred embodiment, the liposomal aptamer further comprises a long-circulating stabilizer poloxamer. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer is 5000:1-1:10.

[0150] In a T cell targeting liposomal aptamer provided by the application, the hydrophobic molecule is selected from dioleoylphosphatidylserine sodium (DOPS), and the nucleic acid aptamer is selected from C2NP.

[0151] In a T cell targeting liposomal aptamer provided by the application, the hydrophobic molecule is selected from dioleoylphosphatidylserine sodium (DOPS), one of the nucleic acid aptamers is the aptamer 4-1BB targeting T cell surface molecules, and the other is the nucleic acid aptamer PegS1.3 / S2.2nib (PEGylated) targeting vascular endothelial growth factor VEGF, and the long-circulating stabilizer is selected from PEG. In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer is 5000:1-1:10.

[0152] In a T cell targeting liposomal aptamer provided by the application, the hydrophobic molecule is selected from 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphatidylethanolamine (DPPE), and the nucleic acid aptamer is the aptamer OX40 and OSJ-T3 (a bispecific aptamer targeting the same immune cells). In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer is 5000:1-1:10.

[0153] In a T cell targeting liposomal aptamer provided by the application, the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), and the nucleic acid aptamer is CD28 and NKG2DL (one nucleic acid aptamer targeting immune cells, and the other nucleic acid aptamer targeting senescent cells). In a preferred embodiment, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer is 5000:1-1:10.

[0154] In one nanoparticle provided in the application, the hydrophobic molecule is selected from 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the nucleic acid aptamer is selected from the aptamer LD201t1 targeting T cell surface molecules, and the therapeutic agent is mRNA.

[0155] In one nanoparticle provided in the application, the hydrophobic molecule is selected from 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the nucleic acid aptamer is selected from the aptamer LD201t1 targeting T cell surface molecules, and the therapeutic agent is mRNA.

[0156] In one nanoparticle provided in the application, the hydrophobic molecule is selected from 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the nucleic acid aptamer is selected from the aptamer LD201t1 targeting T cell surface molecules, and the therapeutic agent is mRNA.

[0157] In one nanoparticle provided in the application, the hydrophobic molecule is selected from 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the nucleic acid aptamer is selected from the aptamer LD201t1 targeting T cell surface molecules, and the therapeutic agent is mRNA.

[0158] In one nanoparticle provided in the application, the hydrophobic molecule is selected from 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the nucleic acid aptamer is selected from the aptamer LD201t1 targeting T cell surface molecules, and the therapeutic agent is mRNA.

[0159] In one nanoparticle provided in the application, the hydrophobic molecule is selected from 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the nucleic acid aptamer is selected from the aptamer LD201t1 targeting T cell surface molecules, and the therapeutic agent is mRNA.

[0160] In one nanoparticle provided in the application, the hydrophobic molecule is selected from 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the nucleic acid aptamer is selected from the aptamer LD201t1 targeting T cell surface molecules, and the therapeutic agent is mRNA.

[0161] The application also provides a preparation method of the T cell targeting lipid aptamer or nanoparticle, specifically comprising the following steps:

[0162] reacting the hydrophobic molecule with a cross-linking agent and / or a catalyst to obtain a first product;

[0163] reacting the first product with a nucleic acid aptamer molecule to obtain a lipocalin, wherein the nucleic acid aptamer comprises at least one nucleic acid aptamer targeting a T cell surface molecule.

[0164] In one specific embodiment, the preparation method further comprises the following steps:

[0165] encapsulating the lipocalin with at least one load.

[0166] In specific embodiments, the load is selected from a group consisting of a genetic molecule, a chemotherapeutic drug, a small molecule targeted drug, an immune checkpoint inhibitor, an antibody conjugated drug, and a hormone drug.

[0167] In some specific embodiments, the molar ratio of the hydrophobic molecule to the nucleic acid aptamer can be ≥ 1:10, for example, can be 5000:1, 4000:1, 3000:1, 2000:1, 1000:1, 500:1, 250:1, 100:1, 1:1, 1:2, 1:4, 1:8, 1:10.

[0168] In some specific embodiments, the mass ratio of the hydrophobic molecule to the cross-linking agent and / or the catalyst is 10~0.1:1.

[0169] In some specific embodiments, the cross-linking agent is selected from one or more of N-succinimidyl 3(2-pyridyldithio)propionate (SPDP) and N,N'-carbonyldiimidazole (CDI).

[0170] In some specific embodiments, the catalyst is selected from one or more of triethylamine (TEA) and sodium azide (NaN3).

[0171] In some specific embodiments, the first product is reacted with at least one nucleic acid aptamer molecule in a reaction buffer to obtain the lipocalin.

[0172] In some specific embodiments, the reaction buffer comprises one or more of CH2Cl2, DMSO, DMF, thionyl chloride, anhydrous ethanol, and 0.1 M HEPES buffer.

[0173] In one specific embodiment, the preparation method described in the present application comprises the following steps:

[0174] 1-a, reacting the hydrophobic molecule (containing an amino group) with the cross-linking agent (SPDP) and the catalyst (TEA) to obtain a first product.

[0175] 1-b, reacting the first product obtained in the above step with a thiol-modified nucleic acid aptamer molecule to obtain a lipocalin.

[0176] 1-c, encapsulating the above-mentioned aptamer with one or more of each type of mRNA, siRNA or plasmid DNA.

[0177] In a specific embodiment, the above-mentioned step 1-a is stirred at 20-30°C, and the reaction time is 1.5-3 hours; step 1-b is stirred at 20-30°C, and the reaction time is 18-24 hours; step 1-c is stirred at 20-30°C, and the reaction time is 0.5-2 hours.

[0178] In a specific embodiment, the preparation method described in the present application comprises the following steps:

[0179] 2-a, reacting the hydrophobic molecule (containing a phosphate group) with thionyl chloride to obtain a first product.

[0180] 2-b, reacting the first product obtained in the above step with an amino-modified nucleic acid aptamer molecule to obtain a lipid aptamer.

[0181] 2-c, encapsulating the above-mentioned aptamer with one or more of each type of mRNA, siRNA or plasmid DNA.

[0182] In a specific embodiment, the above-mentioned step 2-a is stirred at 20-30°C, and the reaction time is 1.5-3 hours; step 2-b is stirred at 0-4°C, and the reaction time is 18-24 hours. Step 2-c is stirred at 20-30°C, and the reaction time is 0.5-2 hours.

[0183] In a specific embodiment, the preparation method described in the present application comprises the following steps:

[0184] 3-a, reacting the hydrophobic molecule (containing a hydroxyl group) with a crosslinking agent (CDI) to obtain a first product.

[0185] 3-b, reacting the first product obtained in the above step with an amino-modified nucleic acid aptamer molecule to obtain a lipid aptamer.

[0186] 3-c, encapsulating the above-mentioned aptamer with one or more of each type of mRNA, siRNA or plasmid DNA.

[0187] In a specific embodiment, the above-mentioned step 3-a is stirred at 20-30°C, and the reaction time is 1.5-3 hours; step 3-b is stirred at 20-30°C, and the reaction time is 10-12 hours; step 3-c is stirred at 20-30°C, and the reaction time is 0.5-2 hours.

[0188] In one specific embodiment, the preparation method described in the present application comprises the following steps:

[0189] 4-a, the hydrophobic molecule (containing carbonyl group) is reacted with p-toluenesulfonyl chloride (PTSC) to obtain a first product.

[0190] 4-b, the first product obtained in the above step is reacted with sodium azide (NaN3) as a catalyst to obtain a second product.

[0191] 4-c, the second product obtained in the above step is reacted with a DBCO modified nucleic acid aptamer molecule to obtain a lipid aptamer.

[0192] In specific embodiments, the above step 4-a is stirred at 20-30°C, and the reaction time is 4-6 hours; step 4-b is stirred at 20-30°C, and the reaction time is 4-6 hours; step 4-c is stirred at 20-30°C, and the reaction time is 2-4 hours.

[0193] In one specific embodiment, the preparation method described in the present application comprises the following steps:

[0194] 5-a, the hydrophobic molecule (containing carboxyl group) is reacted with activated agents EDC and N-hydroxysulfo succinimide (Sulfo-NHS) to obtain a first product.

[0195] 5-b, the first product obtained in the above step is reacted with a primary amino group modified nucleic acid aptamer to obtain a lipid aptamer.

[0196] 5-c, the first product obtained in the above step is reacted with a thiol group modified nucleic acid aptamer to obtain a lipid aptamer.

[0197] In specific embodiments, the above step 5-a is stirred at 20-30°C, and the reaction time is 4-12 hours; step 5-b is stirred at 20-30°C, and the reaction time is 18-24 hours; step 5-b is stirred at 20-30°C, and the reaction time is 18-24 hours.

[0198] In one specific embodiment, the preparation method described in the present application comprises the following steps:

[0199] 6-a, the hydrophobic molecule (containing amino group) is reacted with a cross-linking agent (SPDP) and an alkaline catalyst (TEA) to obtain a first product.

[0200] 6-b, the first product obtained in the above step is reacted with a thiol group modified nucleic acid aptamer molecule to obtain a lipid aptamer.

[0201] In specific embodiments, the above step 6-a is stirred at 20-30 °C, and the reaction time is 1.5-3 hours; step 6-b is stirred at 20-30 °C, and the reaction time is 20-24 hours.

[0202] The present application relates to a kind of nucleic acid aptamer-based T cell targeting lipid aptamer and its nanoparticle construction and its use.The nanoparticle is with hydrophobic molecule modified nucleic acid aptamer as unit, it is constructed by molecular self-assembly technology.The lipid aptamer nano-preparation prepared using only hydrophobic molecule and nucleic acid aptamer with T cell targeting performance can be specifically targeted to mediate immune cells of disease after intravenous injection into body, and for T cell related diseases such as T cell lymphoma, precise targeted killing can be realized.

[0203] Further, the lipid aptamer can be modified according to different application scenarios.For example, the spherical nanoparticle prepared using two kinds of nucleic acid aptamers targeting the same immune cells can load one or more genes or therapeutic drugs for different purposes, and the bispecific nucleic acid aptamer can be prepared into a double-targeting spherical nucleotide nanomedicine.The nano-preparation can significantly improve the cell gene modification efficiency or immune killing efficiency after entering the body.Or, the spherical nanovesicle prepared using hydrophobic molecules and T cell targeting nucleic acid aptamers can encapsulate various types of mRNA, siRNA, DNA and other gene molecules, and the nano-preparation can specifically target target cells after intravenous injection into the body, and the disulfide bond is broken under the reductive conditions in the cell to release mRNA, siRNA or DNA, which can "point" gene modification of cells and realize in vivo gene reprogramming of cells.

[0204] EMBODIMENT

[0205] The materials used in the test and the test method are generally and / or specifically described in the present application, and in the following examples, % represents wt%, i.e. weight percentage, unless otherwise specified. The reagents or instruments used are not marked with the manufacturer, and are conventional reagent products that can be obtained by market purchase.

[0206] Example 1 Preparation and performance study of DOPE-LD201t1 encapsulated mRNA nanoparticle

[0207] 1. Preparation of DOPE-LD201t1 encapsulated mRNA nanoparticle

[0208] The specific preparation method is as follows:

[0209] 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE) is mixed with a crosslinking agent, nitrogen-succinimidyl 3 (2-pyridyldithio)-propionate (SPDP) at a mass ratio of 1.5:1, an appropriate amount of catalyst triethylamine (TEA) is added, and the reaction is shaken at room temperature for 2 h. The activated DOPE is dialyzed using a dialysis bag and freeze-dried to obtain the activated DOPE.

[0210] The activated DOPE is reacted with the aptamer LD201t1 at a molar ratio of 250:1, and the reaction is stirred at room temperature for 24 h. The DOPE-LD201t1 hybrid molecule is obtained by dialysis using a dialysis bag.

[0211] The DOPE-LD201t1 molecule is mixed with the mRNA molecule at a concentration of 1:2, and the mRNA-loaded nanoparticles are obtained by molecular self-assembly technology. Under transmission electron microscopy, the DOPE-LD201t1 mRNA nanoparticles are uniform spherical nanovesicle-like structures (as shown in Figure 1

[0212] 2. Cell toxicity experiment

[0213] Human umbilical vein endothelial cells (HUVECs) are plated in a 96-well plate at 10 4 cells per well. After overnight incubation, DOPE-LD201t1 mRNA-loaded nanoparticles and naked mRNA (with mRNA concentrations of 0.25, 0.5, 1, 2, 4, 8, 16, and 32 μg / mL) are added to each well, respectively, and the culture is continued for 24 h. 10 μL of CCK-8 detection solution is added to each well, and the culture is continued in the incubator for 1-4 h. The absorbance at 450 nm is measured using a multifunctional full-wavelength enzyme marker (Thermo Varioskan Flash3001). The results are shown in Figure 2 DOPE-LD201t1 mRNA-loaded nanoparticles have no obvious toxic side effects on HUVEC cells and have high biological safety.

[0214] 3. Cell uptake experiment

[0215] Cy5-mRNA is prepared by labeling the mRNA with Cy5 fluorescent dye using the Label IT Nucleic Acid Labeling kit, and is encapsulated into DL NPs to prepare Cy5-mCAR NPs. After co-incubation of Cy5-mCAR NPs and naked Cy5-mRNA with T cells for 24 h, the uptake of T cells is observed by laser confocal microscopy. The results are shown in Figure 3 ​As shown, the DL NPs nanoparticles can precisely target T cells and effectively protect mRNA from degradation by RNase enzymes in the environment, improving the ability of mRNA to enter T cells and laying a good foundation for its translation into protein in T cells.

[0216] 4. In vivo biodistribution

[0217] The fluorescent dye Cy7 and DOPE-LD201t1 molecules were mixed in a certain ratio to construct DL NPs nanoparticles encapsulating fluorescent dye Cy7 through molecular self-assembly, and free Cy7 fluorescent dye was used as a control group. At different time points after administration, the fluorescence signal in the mouse body was detected using a small animal live imaging instrument to observe the distribution of DL NPs nanoparticles in vivo, and the results are shown in Figure 4 As shown, after intravenous injection, the free Cy7 fluorescence signal rapidly accumulated in the liver and gradually disappeared after 12 h. In contrast, NPs-Cy7 was significantly enriched in the lungs within 3 h after administration, which may be related to the large accumulation of T cells in the presence of lung inflammation. A certain degree of fluorescence signal was still observed in the lungs of mice 48 h after administration, indicating that DL NPs nanoparticles can precisely target T cells and maintain a high concentration in the lungs for at least 48 h.

[0218] 5. Body weight monitoring

[0219] A bleomycin-induced pulmonary fibrosis model was constructed using 6-8-week-old male C57BL / 6 mice. Specifically, isoflurane gas was used to anesthetize the mice, and an appropriate amount of bleomycin solution was rapidly injected into the glottis of the mice (the administration concentration was 3 mg / kg), and then the mouse body was gently shaken to evenly distribute the drug solution in the lungs. The body weight of the idiopathic pulmonary fibrosis mice was continuously monitored during the entire experimental period, and the results are shown in Figure 5 As shown, the body weight of all the model mice was significantly reduced within 7 days of bleomycin instillation, and then the body weight of the mice in the PBS and naked mRNA treatment groups was significantly reduced after treatment with various drug formulations. In contrast, the body weight of the mice in the DOPE-LD201t1 encapsulated mRNA nanoparticle group increased slowly with the extension of the treatment time, and there was a significant increase at the treatment endpoint, indicating that DOPE-LD201t1 encapsulated mRNA nanoparticles have good therapeutic function and can significantly improve the health status of mice.

[0220] Example 2 Preparation of DOPE-LD201t1 encapsulated FAP CAR mRNA nanoparticles

[0221] DOPE-LD201tl lipid aptamer nanoparticles (DL NPs) were prepared by the method of Example 1, and mixed with FAP CAR mRNA by a molecular self-assembly technique to obtain mCAR NPs. As shown in Figure 6 , the particle size of the DL NPs was 165.7 ± 3.4 nm, and the particle size of the mCAR NPs was 180.3 ± 6.3 nm.

[0222] As shown in Figure 7 , the particle size of the mCAR NPs was basically unchanged in aqueous solution and PBS solution, and could stably exist for more than 30 days.

[0223] Example 3 Preparation of DPPC-4-1BB encapsulated EGFP mRNA nanoparticles and testing of green fluorescent protein expression

[0224] DPPC-4-1BB lipid aptamer molecules were prepared by acyl chloride nucleophilic addition reaction, and a certain amount of EGFP mRNA was encapsulated using a self-assembly technique, and added to T cells for culture for different time. Laser confocal microscopy was used to observe the expression of green fluorescent protein EGFP.

[0225] As shown in Figure 8 , the naked mRNA without loading the DPPC-4-1BB nanoparticle shell almost did not express green fluorescence, while the DPPC-4-1BB encapsulated EGFP mRNA nanoparticles could be completely transfected into T cells and express green fluorescent protein, and the intensity of the green fluorescent protein became stronger and stronger with the extension of the incubation time.

[0226] Example 4 Preparation of PCL-OX40 encapsulated siRNA nanoparticles and testing of encapsulation efficiency

[0227] PCL was dissolved in an appropriate amount of anhydrous ethanol for standby, and p-toluenesulfonyl chloride was also dissolved in anhydrous ethanol and added to the PCL solution, and the reaction was shaken at room temperature for 6 h;

[0228] A small amount of NaN3 was dissolved in DEPC water and added to the above reaction solution for further reaction for 6 h, and then an appropriate amount of DBCO-modified nucleic acid aptamer OX40 was added to prepare PCL-OX40 lipid aptamer molecules by click reaction

[0229] siRNA was encapsulated by a molecular self-assembly technique according to different mass ratios (PCL-OX40:siRNA=10:1, 5:1, 1:1, 1:5, 1:10), and the content of siRNA in the solution before and after the lysis of the nanoparticles was measured by using Quant-iT RiboGreen RNA detection kit. The difference between the two was the amount of siRNA encapsulated by the nanoparticles, and the encapsulation efficiency was obtained.

[0230] Results as Figure 9 shown, when PCL-OX40:siRNA = 5:1, the encapsulation efficiency was 55.7%

[0231] Example 5 DSPG-CD28 encapsulated plasmid DNA nanoparticle size distribution

[0232] DSPG-CD28 liposome aptamer molecules were prepared using amide bonds, and the specific operation steps were as follows:

[0233] DSPG was reacted with crosslinking agent CDI at room temperature for 2 h at a mass ratio of 2:1 to combine the hydroxyl oxygen atoms in DSPG with the carbonyl carbon atoms of CDI to form an imide intermediate;

[0234] The amino-modified nucleic acid aptamer CD28 was added according to a molar ratio (DSPG: nucleic acid aptamer = 2:1), and the reaction was shaken at room temperature for 10 h. The DSPG-CD28 liposome aptamer was collected after dialysis with a 2000 DW dialysis bag.

[0235] A certain amount of plasmid DNA was added according to the drug loading amount, and DSPG-CD28-pDNA NPs were obtained after shaking at room temperature for 1 h.

[0236] The particle size and potential value of the nanoparticles were detected using a Malvern particle size analyzer, and the particle size was 173.4±3.72 nm, and the dispersity PDI was 0.18±0.05. The results are shown in Figure 10 .

[0237] Example 6 Preparation of DOPS-C2NP nanoparticles and test of their effect on the survival period of T lymphoma mice

[0238] DOPS-C2NP NPs were prepared using amide reaction, and the specific operation steps were as follows:

[0239] DOPS was dissolved in a dimethylformamide (DMF) solution, and excess activated agents EDC and N-hydroxysulfo succinimide (Sulfo-NHS) were added to activate the carboxyl group to form a stable NHS ester intermediate;

[0240] The primary amino-modified nucleic acid aptamer C2NP was added, and the reaction was shaken at room temperature. An appropriate amount of Tris buffer was added to terminate the reaction at the end of the coupling reaction, and DOPS-C2NP NPs were obtained after dialysis and molecular self-assembly.

[0241] Preparation of T lymphoma mouse model: C57BL / 6 mice were selected as the research object, and mouse T lymphoma cells EL4 (1×10 6The mice (5 cells / mouse) were randomly divided into PBS group, Veltuzumab combined with CHP group, Free C2NP group, DOPS-C2NP NPs group. After tail vein administration, the survival curve of mice was recorded and plotted, and the results are shown in Figure 11 DOPS-C2NP NPs can effectively inhibit the growth of tumor volume and significantly prolong the survival of tumor-bearing mice.

[0242] Example 7 Preparation and characterization of DOPE-OSJ-T3 aptamer lipid molecule

[0243] The DOPE-OSJ-T3 aptamer lipid molecule was prepared by reacting the disulfide bond at a molar ratio of 500:1. The specific operation steps are as follows:

[0244] The phospholipid DOPE was mixed with the crosslinking agent SPDP at a mass ratio of 1.5:1, and an appropriate amount of catalyst triethylamine (TEA) was added, and the reaction was shaken at room temperature for 2 h. Dialsed with 500 DW dialysis bag, and freeze-dried to obtain activated DOPE;

[0245] The activated DOPE was reacted with the nucleic acid aptamer OSJ-T3 at a molar ratio of 500:1, and the reaction was carried out at room temperature for 24 h. Dialysis was performed using a 2000 DW dialysis bag to obtain the DOPE-OSJ-T3 aptamer lipid molecule.

[0246] The results of agarose gel electrophoresis show that Figure 12 the DOPE-OSJ-T3 aptamer lipid molecule is successfully coupled.

[0247] Example 8 In vitro killing effect of DOPE-OSJ-T3 encapsulating CD19 CAR mRNA nanoparticles on tumor cells

[0248] The phospholipid DOPE was mixed with the crosslinking agent SPDP at a mass ratio of 1.5:1, and an appropriate amount of catalyst triethylamine (TEA) was added, and the reaction was shaken at room temperature for 2 h. The nucleophilic addition reaction between the amino group in DOPE and the NHS ester group in SPDP was carried out to form an amide bond; then reacted with thiol-modified nucleic acid aptamer OSJ-T3 at room temperature for 24 h to obtain DOPE-OSJ-T3 aptamer lipid molecule.

[0249] DOR NPs were prepared using the molecular self-assembly technique with the mass ratio of (DOPE-OSJ-T3: CD19 CAR mRNA = 2: 1). After transfecting T cells, they were incubated with tumor cells. The LDH cytotoxicity detection kit was used to evaluate the in vitro killing effect of DOPE-OSJ-T3 encapsulated CD19 CAR mRNA nanoparticles on tumor cells. Four groups were set up: PBS control group (untreated T cells), DO NPs group (nanoparticles without mRNA loading), naked mRNA group (free CD19-CAR mRNA) and DOR NPs group. After the tumor cells were cultured to the logarithmic growth phase and the density was adjusted to 6 x 10 4 / mL, they were inoculated into a 96-well plate and co-cultured at an effector-target ratio (E:T, CAR-T cells: tumor cells) of 1:1, 1:2, 1:4, 1:8 and 0:1 (tumor cells only). After the end, the killing efficiency was evaluated by detecting the amount of LDH released.

[0250] It can be seen that, compared with the other three groups, the DOR NPs group can significantly kill tumor cells. Figure 13

[0251] Example 9 Preparation of DSPC-CD28 / Poloxamer Nanoparticles

[0252] First, DSPC was reacted with crosslinking agent SPDP and catalyst triethylamine at room temperature for 2 h, then reacted with thiol-modified nucleic acid aptamer CD28, and after dialysis, DSPC-CD28 lipid aptamer molecules were obtained. Then poloxamer was mixed with DSPC-CD28 lipid aptamer molecules to self-assemble DSPC-CD28 / poloxamer nanoparticles.

[0253] The particle size of the nanoparticles was measured by Malvern particle size analyzer, and the results are shown in Figure 14 , and the particle size was 127.9 ± 2.99 nm.

[0254] Example 10 Preparation of DOPS-4-1BB / DOPS-PegS1.3 / S2.2 nib (PEGylated) / PEG Long-Circulating Double-Targeted Lipid Aptamer Nanoparticles

[0255] DOPS was dissolved in dimethylformamide (DMF) solution, and excess activated agents EDC and N-hydroxysulfo succinimide (Sulfo-NHS) were added to activate the carboxyl group to form a stable NHS ester intermediate;

[0256] ​Then, the amino-modified nucleic acid aptamer m4-1BB and PegS1.3 / S2.2nib (PEGylated) were respectively reacted with DOPS at room temperature by shaking, and a proper amount of Tris buffer was added to terminate the reaction at the end of the coupling reaction. After dialysis, DOPS-m4-1BB and DOPS-PegS1.3 / S2.2nib (PEGylated) lipid aptamer molecules were prepared. Then, the DOPS-m4-1BB and DOPS-PegS1.3 / S2.2nib (PEGylated) lipid aptamer molecules were mixed according to a molar ratio of 3:2, and a proper amount of long-circulating stabilizer PEG was mixed. After self-assembly of the molecules, DOPS-m4-1BB-PegS1.3 / S2.2nib / PEG long-circulating dual-targeting nanoparticles were obtained.

[0257] Transmission electron microscopy results showed that the nanoparticles presented a uniform size and a uniformly dispersed spherical vesicular structure.

[0258] Example 11 Preparation of DPPE-OX40 / DPPE-OSJ-T3 dual-targeting lipid aptamer nanoparticles

[0259] The phosphate group of DPPE was changed into an acyl chloride group by using dichlorosulfide, and then the amino-modified nucleic acid aptamer OX40 and OSJ-T3 were respectively reacted with DPPE at room temperature by shaking for 24 h. After dialysis, DPPE-OX40 and DPPE-OSJ-T3 lipid aptamer molecules were obtained.

[0260] Then, DPPE-OX40 and DPPE-OSJ-T3 lipid aptamer molecules were self-assembled according to a molar ratio of 1:1 to form DPPE-OX40 / DPPE-OSJ-T3 nanoparticles. The particle size was 162.8 ± 1.67 nm, and the dispersity was 0.12 ± 0.02 (as shown in Figure 15

[0261] Example 12 Effect of NKG2DL CAR mRNA-loaded DOPE-LD201tl nanoparticles on plasma glucose level in aging mice

[0262] DOPE-LD201tl lipid aptamer nanoparticles (DL NPs) were prepared by the method of Example 1, and DL NPs were mixed with NKG2DL CAR mRNA by a molecular self-assembly technique to obtain NKG2DL mCAR NPs.

[0263] ​Construction of natural aging mouse model: select natural aging mice (such as 18-24 month old C57BL / 6 mice) as the research object, randomly divided into 4 groups PBS group and NKG2DL mCAR NPs group. The mRNA dose range is 20 μg / one. Figure 16 The results show that 3 days after the injection of the nanoparticles into the body of the aging mice, the mice in the NKG2DL mCAR NPs group showed significantly lower plasma glucose levels within 1 hour after infusion of insulin (0.5 units / kg / one) compared with the control group before infusion.

[0264] Example 13 Preparation of double-targeted lipid aptamer nanoparticles of DOPE-CD28 / DOPE-NKG2DL

[0265] The phospholipid DOPE was mixed with the crosslinking agent SPDP at a mass ratio of 1.5:1, and an appropriate amount of catalyst triethylamine (TEA) was added, and the reaction was shaken at room temperature for 2 h to make the amino group in DOPE and the NHS ester group in SPDP undergo nucleophilic addition reaction to form an amide bond; then reacted with thiol-modified nucleic acid aptamer CD28 and NKG2DL at room temperature for 24 h to obtain DOPE-CD28 and DOPE-NKG2DL lipid aptamer molecules.

[0266] Then the DOPE-CD28 and DOPE-NKG2DL lipid aptamer molecules were self-assembled into DOPE-CD28 / DOPE-NKG2DL nanoparticles at a molar ratio of 1:1, and the particle size was measured by Malvern particle size instrument to be 146.2±2.74 nm, and the dispersity was 0.09±0.08.

[0267] Example 14 Effect of hydrophobic molecule DOPE on particle size of DOPE-LD201t1 nanoparticles

[0268] DOPE-LD201t1 and DOPE molecules were mixed and self-assembled at molar ratios of 10:1, 5:1 and 1:1, respectively, and the obtained nanoparticle particle sizes were 174.7±2.5 nm, 183.3±4.8 nm and 204.6±7.3 nm, respectively.

[0269] Example 15 Test of the effect of nanoparticle preparation parameters on performance

[0270] Experiment 1. Effect of reaction molar ratio of hydrophobic molecule DOPE and nucleic acid aptamer OSJ-T3 on nanoparticle particle size and dispersity

[0271] DOPE-OSJ-T3 nanoparticles were prepared by the method of Example 7, wherein the molar ratio of the hydrophobic molecule DOPE and the nucleic acid aptamer OSJ-T3, and other preparation parameters were selected according to Table 1. The test results of the particle size and dispersity of the obtained nanoparticles are shown in Table 1.

[0272] Table 1

[0273]

[0274] Note: The concentration of Apt is 1 μg / ml, and the relative molecular mass is 12460 g / mol.

[0275] Experiment 2. Effect of the mass ratio of DOPE-OSJ-T3 nanovesicles to mRNA on the particle size and potential of nanoparticles

[0276] DOPE-OSJ-T3 nanoparticles loaded with CD19 CAR mRNA were prepared by the method of Example 8, wherein the mass ratio of the DOPE-OSJ-T3 nanoparticles (DO NPs) prepared by selecting DOPE:OSJ-T3 = 500:1 to mRNA was selected according to Table 2. The test results of the particle size and potential of the obtained nanoparticles are shown in Table 2.

[0277] Table 2

[0278]

[0279] Note: The relative molecular mass of OSJ-T3 is 12460 g / mol

[0280] Experiment 3. Effect of preparation parameters of DOPE-LD201tl nanoparticles on performance

[0281] DOPE-LD201tl nanoparticles targeting T cells were prepared by using disulfide bonds, and the specific operation steps were as follows:

[0282] The phospholipid DOPE was reacted with the crosslinking agent SPDP and the catalyst triethylamine (TEA) at room temperature for 2 h, and then reacted with the thiol-modified nucleic acid aptamer LD201tl according to the molar ratio in Table 3, and stirred at room temperature for 24 h. After dialysis, DOPE-LD201tl nanoparticles were self-assembled.

[0283] The test results of the particle size and dispersity of the obtained nanoparticles are shown in Table 3.

[0284] Table 3

[0285]

[0286] Experiment 4. Effect of preparation parameters of DPPG-4-1BB nanoparticles on performance

[0287] DPPG-4-1BB nanoparticles were prepared by amide bond, and the specific operation steps were as follows:

[0288] DPPG was reacted with crosslinking agent CDI at room temperature for 2 h at a mass ratio of 2:1, and amino-modified aptamer 4-1BB was added at a molar ratio (DPPG: aptamer = 5000:1~1:10, as shown in Table 4), and reacted at room temperature for 18 h. DPPG-41-BB aptamer molecules were synthesized by amide bond, and DPPG-4-1BB NPs were obtained by self-assembly.

[0289] The test results of the particle size and dispersity of the obtained nanoparticles are shown in Table 4.

[0290] Table 4

[0291]

[0292] According to the above experimental results, it can be seen that in the preparation of nanolipid aptamer, the molar ratio of hydrophobic molecules reacted with aptamer by disulfide bond reaction ≥1:1 is better. The molar ratio of hydrophobic molecules reacted with aptamer by acyl chloride reaction is between 100:1~1:4. The molar ratio of hydrophobic molecules reacted with aptamer by click reaction is 500:1.

[0293] The above is only a preferred embodiment of the present application, and does not limit the present application in any form. Any skilled person in the art can modify or change the above disclosed technical content to equivalent embodiments. However, any simple modification, equivalent change and modification of the above embodiments without departing from the technical content of the present application, according to the technical essence of the present application, still belongs to the protection scope of the present application.

Claims

1. A nanoparticle constructed by self-assembly of a T cell-targeting lipocalin aptamer, characterized in that, The lipid aptamer is composed of a hydrophobic molecule and a nucleic acid aptamer, the nucleic acid aptamer at least includes one nucleic acid aptamer targeting a T cell surface molecule, wherein the molar ratio of the hydrophobic molecule and the nucleic acid aptamer is 5000:1-1:10, the hydrophobic molecule is selected from at least one of 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine (DOPE), dipalmitoyl phosphatidylcholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (sodium salt) (DOPS), dimyristoyl phosphatidylcholine (DMPC), hydrogenated lecithin (HSPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-distearoyl-sn-glycero-3-phosphatidylserine (DSPG), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphatidylethanolamine (DPPE), 1,2-dilauroylphosphatidylethanolamine (DLPE), 1,2-dipalmitoyl-sn-glycero-3-phosphatidylglycerol (DPPG), monophosphoryl lipid A (MPLA), 1,3-dilinolenin (1,3-DILINOLENIN) and polycaprolactone (PCL).

2. The nanoparticle of claim 1, wherein, The hydrophobic molecule and the nucleic acid aptamer are connected by a chemical bond.

3. The nanoparticle of claim 1, wherein, The nucleic acid aptamer targeting a T cell surface molecule includes single-stranded DNA (ssDNA), RNA, XNA, TNA, or point mutants, truncates, chemically modified derivatives thereof, or chimeric DNA-TNA oligonucleotides targeting a T cell surface molecule.

4. The nanoparticle of claim 1, wherein, The nucleic acid aptamer targeting a T cell surface molecule is selected from LD201t1, OSJ-T3, OX40, CD28Apt7, 4-1BB, CD5, CD62L or C2NP.

5. The nanoparticle of claim 1, wherein, The nucleic acid aptamer can further include one or more nucleic acid aptamers not targeting a T cell surface molecule, the nucleic acid aptamer not targeting a T cell surface molecule is selected from a nucleic acid aptamer targeting a tumor cell, a stem cell, a senescent cell, other immune cell surface molecules or a nucleic acid aptamer targeting a cell surface specific receptor.

6. The nanoparticle of claim 1, wherein, The T cell targeting lipid aptamer further includes a long-circulating stabilizer.

7. The nanoparticle of claim 6, wherein, the hydrophobic molecule is 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine (DOPE), and the nucleic acid aptamer is OSJ-T3; or the hydrophobic molecule is 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine (DOPE), and the nucleic acid aptamer is LD201t1; or the hydrophobic molecule is 1,2-dipalmitoyl-sn-glycerol-3-phosphatidylglycerol (DPPG), and the nucleic acid aptamer is 4-1BB; or the hydrophobic molecule is polycaprolactone (PCL), and the nucleic acid aptamer is OX40; or the hydrophobic molecule is polycaprolactone (PCL), and the nucleic acid aptamer is OX40; or the hydrophobic molecule is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), and the aptamer is CD28; or the hydrophobic molecule is dioleoylphosphatidylserine sodium (DOPS), and the aptamer is C2NP; or the hydrophobic molecule is 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphatidylethanolamine (DPPE), and the aptamer is OX40 and OSJ-T3; or the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), and the aptamer is CD28 and NKG2DL; or the hydrophobic molecule is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), and the aptamer is CD28, and the long-circulating stabilizer is poloxamer; or the hydrophobic molecule is dioleoylphosphatidylserine sodium (DOPS), and the aptamer is 4-1BB and PegS1.3 / S2.2nib (PEGylated), and the long-circulating stabilizer is PEG.

8. The nanoparticle of claim 1, wherein, The particle size of the nanoparticle is 80-1000 nm.

9. The nanoparticle of claim 8, wherein, The nanoparticle encapsulates a payload, and the payload is a therapeutic agent.

10. The nanoparticle of claim 9, wherein, The therapeutic agent is at least one of a polynucleotide or oligonucleotide molecule, a chemotherapeutic drug, a small molecule targeted drug, an immune checkpoint inhibitor, an antibody conjugated drug, or a hormone drug.

11. The nanoparticle of claim 10, wherein, The polynucleotide or oligonucleotide molecule is selected from mRNA, siRNA, miRNA, hnRNA, or DNA molecule.

12. The nanoparticle of claim 10, wherein, The chemotherapeutic drug is at least one of paclitaxel, doxorubicin, capecitabine, and gemcitabine.

13. The nanoparticle of claim 10, wherein, The small molecule targeted drug is at least one of biricistat, a HER2 inhibitor, a BCR-ABL inhibitor, an EGFR-TKI inhibitor, and an EGFR inhibitor.

14. The nanoparticle of claim 10, wherein, The immune checkpoint inhibitor is at least one of a PD-1 / PD-L1 inhibitor, a CTLA-4 inhibitor, a LAG-3 inhibitor, a TIM-3 inhibitor, and a TIGIT inhibitor.

15. The nanoparticle of claim 10, wherein, The antibody conjugated drug is at least one of a conjugate of an antibody and maytansine, an Auristatin derivative, Anetumab Ravtansine, and an auristatin.

16. The nanoparticle of claim 10, wherein, The hormone drug is an agonist or an inhibitor of a hormone.

17. The nanoparticle of claim 9, wherein the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the aptamer is LD201t1, and the therapeutic agent is mRNA; or the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the aptamer is LD201t1, and the therapeutic agent is FAP CAR mRNA; or the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the aptamer is LD201t1, and the therapeutic agent is NKG2DL CAR mRNA; or the hydrophobic molecule is dipalmitoyl phosphatidylcholine (DPPC), the aptamer is 4-1BB, and the therapeutic agent is mRNA; or the hydrophobic molecule is polycaprolactone (PCL), the aptamer is OX40, and the therapeutic agent is siRNA; or the hydrophobic molecule is 1,2-distearoyl-sn-glycero-3-phosphatidylserine (DSPG), the aptamer is CD28, and the therapeutic agent is plasmid DNA; or the hydrophobic molecule is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE), the aptamer is OSJ-T3, and the therapeutic agent is CD19 CAR mRNA.

18. A method of producing the nanoparticle of any one of claims 1-17, wherein, the preparation method comprises the following steps: reacting the hydrophobic molecule with a crosslinking agent and / or a catalyst to obtain a first product; and reacting the first product with an aptamer molecule to obtain a lipid aptamer, the aptamer molecule comprising at least one aptamer targeting a T cell surface molecule.

19. The method of claim 18, further comprising: encapsulating the lipid aptamer with at least one load.

20. The method of claim 18, wherein, The mass ratio of the hydrophobic molecule to the crosslinking agent and / or the catalyst is 10-0.1:

1.

21. The method of claim 18, wherein, The molar ratio of the hydrophobic molecule to the aptamer molecule is ≥1:

10.

22. The preparation method according to claim 18, characterized in that, In the step of reacting the hydrophobic molecule with the crosslinking agent and / or the catalyst to obtain the first product, the reaction temperature is 20-30°C, and the reaction time is 1.5-3 hours.

23. The preparation method according to claim 18, characterized in that, In the step of reacting the first product with the aptamer molecule to obtain the lipid aptamer, the reaction temperature is 0-30°C, and the reaction time is 18-24 hours.

24. The method of claim 19, wherein, In the step of encapsulating the lipid aptamer with at least one load, the reaction temperature is 20-30°C, and the reaction time is 0.5-4 hours.

25. Use of the nanoparticle of any one of claims 1-17 in the preparation of a nanodrug for the treatment of a disease.

Citation Information

Patent Citations

  • Nucleic acid aptamer-based mRNA targeted delivery system for spleen and subcells thereof

    CN118217417A

  • Lipid-charged molecule conjugate, inhalable lipid nanoparticle, preparation method therefor, and use thereof

    WO2024099391A1

Cited By

  • Monoclonal antibodies targeting fap and uses thereof

    CN122381190A