Method for producing antibodies

Abstract

The present application provides a method for enabling efficient production of recombinant antibodies at a low cost. Specifically, provided is a method for producing antibodies or fragments thereof, the method being characterized by using cells into which is introduced a vector that includes four copies of DNA encoding the L chain of an antibody or a fragment of said L chain and two copies of DNA encoding the H chain of the antibody or a fragment of said H chain. Also provided, inter alia, are: a recombinant vector that includes four copies of DNA encoding the L chain of the antibody or a fragment of said L chain and two copies of DNA encoding the H chain of the antibody or a fragment of said H chain; and transformed cells into which such a vector is introduced.

Description

Antibody production method

[0001] The present invention relates to a method for producing an antibody.

[0002] When recombinant antibodies useful as medicines are produced using genetic engineering techniques, animal cells are capable of complex post-translational modifications and folding that cannot be performed by prokaryotic cells, and therefore animal cells have been widely used as host cells for recombinant antibody production.

[0003] In recent years, many biopharmaceuticals, such as antibodies and physiologically active proteins, have been produced. In particular, antibody drugs typically require a single dose in the milligram order, requiring a considerable amount of antibody as the active ingredient. Technology to efficiently produce recombinant antibodies in animal cells will lead to lower costs for antibody drugs and ensure a stable supply to patients.

[0004] Therefore, there is a need for a method for producing recombinant antibodies with higher production efficiency. For example, it is important to develop an expression system for efficiently producing recombinant antibodies in animal cells.

[0005] EP2439269 (Patent Document 1) discloses the use of an expression vector containing a drug selection marker gene expression cassette into which an mRNA destabilizing sequence has been introduced, and a gene expression stabilizing element, in order to establish transformed cells that express antibody heavy and / or light chain polypeptide genes at high levels.

[0006] When preparing host cells for producing recombinant antibodies, one copy of DNA encoding the antibody's H chain and one copy of DNA encoding its L chain are typically introduced into the host cells (Non-Patent Documents 1 and 2).

[0007] However, WO 2009 / 051108 (Patent Document 2) discloses a method for high-level antibody production using transformed cells containing more copies of DNA encoding the antibody light chain than of DNA encoding the antibody heavy chain. In WO 2009 / 051108, a plasmid containing one copy of DNA encoding the heavy chain and two copies of DNA encoding the light chain of a desired recombinant antibody is introduced into the cells.

[0008] The heavy and light chain polypeptides that make up an antibody molecule assemble with the support of BiP (immunoglobulin heavy chain binding protein), and then fold to complete the complete antibody structure. This assembly process is dependent on the light chain polypeptide (Non-Patent Document 3). Therefore, it is thought that increasing the ratio of the light chain genes and the proportion of light chain polypeptides will promote the assembly of heavy and light chain polypeptides, thereby increasing production yields.

[0009] A method for producing antibodies by transient expression or stable expression using Chinese hamster ovary (CHO) cells containing a greater number of copies of foreign DNA encoding the antibody light chain than the DNA encoding the heavy chain has been disclosed (Non-Patent Document 4). In this antibody production method, the foreign DNA encoding the antibody light chain and the foreign DNA encoding the antibody heavy chain are each introduced into the cells using separate vectors.

[0010] However, it has been suggested that the amount of H chain expression is particularly important in the case of stable transformants that express recombinant antibodies in a constitutive expression system, because the amount of H chain expression is lower than in transient expression systems (Non-Patent Document 4). Therefore, in the case of a constitutive expression system, it is unclear how to control the ratio of H chain to L chain expression levels in order to increase antibody production.

[0011] EP2439269WO 2009 / 051108

[0012] Reff ME, Carner K, Chambers KS, Chinn PC, Leonard JE, Raab R et al. Depletion of B cells in vivo by a chimeric mouse human monoclonal antibody to CD20. Blood. 1994 Jan 15; 83(2):435-45.Presta LG, Chen H, O'Connor SJ, Chisholm V, Meng YG, Krummen L, et al. Humanization of an anti-vascular endothelial growth factor monoclonal antibody for the therapy of solid tumors and other disorders. Cancer Res. 1997 Oct 15; 57(20):4593-9.Young-Kwang Lee, Joseph W. Brewer, Rachel Hellman, and Linda M. Hendershot. BiP and immunoglobulin light chain cooperate to control the folding of heavy chain and ensure the fidelity of immunoglobulin assembly. Molecular Biology of the Cell, 1999, 10, 2209Stefan Schlatter, et al. On the Optimal Ratio of Heavy to Light Chain Genes for Efficient Recombinant Antibody Production by CHO Cells. Biotechnol. Prog., 2005, 21, 122

[0013] An object of the present invention is to provide a method for producing antibodies in high amounts.

[0014] The present inventors prepared CHO cells into which an expression vector containing four copies of DNA encoding an antibody light chain and two copies of DNA encoding the heavy chain was introduced, and found that a cell line with higher antibody production ability could be obtained than 1) cells into which a vector containing two copies of the light chain and one copy of the heavy chain was introduced, 2) cells into which a vector containing six copies of the light chain and three copies of the heavy chain was introduced, and 3) cells into which a vector containing eight copies of the light chain and four copies of the heavy chain was introduced, thereby completing the present invention.

[0015] The gist of the present invention is as follows: (1) A method for producing an antibody or a fragment thereof using a cell transfected with a vector containing four copies of DNA encoding an antibody light chain or a fragment thereof and two copies of DNA encoding the antibody heavy chain or a fragment thereof. (2) The method of claim 1, comprising producing an antibody or a fragment thereof by constructing a recombinant vector containing four copies of DNA encoding an antibody light chain or a fragment thereof and two copies of DNA encoding the antibody heavy chain or a fragment thereof, introducing the vector into a cell, and culturing the transformed cell into which the vector has been introduced to produce the antibody or a fragment thereof. (3) The method of (1) or (2), wherein the cell is an animal cell. (4) The method of any of (1) to (3), wherein the animal cell is a Chinese hamster ovary cell. (5) The method of any of (1) to (4), wherein the antibody is a chimeric antibody, a humanized antibody, or a human antibody. (6) The method of any of (1) to (5), wherein the antibody is a switch antibody, a recycling antibody, or a sweeping antibody. (7) The antibody is selected from the group consisting of an anti-CD137 antibody, an anti-latent TGF-β1 antibody, an anti-latent myostatin antibody, an anti-complement (C1s) antibody, an anti-IL-8 antibody, an anti-IL-6 receptor antibody, an anti-IL-6 antibody, an anti-glypican-3 antibody, an anti-CD3 antibody, an anti-CD20 antibody, an anti-GPIIb / IIIa antibody, an anti-TNF antibody, an anti-CD25 antibody, an anti-EGFR antibody, an anti-Her2 / neu antibody, an anti-RSV antibody, an anti-CD33 antibody, an anti-CD52 antibody, an anti-IgE antibody, an anti-CD11a antibody, an anti-VEGF antibody, and an anti-VLA4 antibody, and is preferably an anti-CD137 agonist switch antibody STA551, an anti-latent TGF-β1 The method according to any one of (1) to (6), wherein the antibody is the monoclonal antibody SOF10 / RG6440, the anti-latent myostatin sweeping antibody GYM329 / RG6237, the anti-complement (C1s) antibody RAY121, the antibody S12pre, or the anti-IL-8 recycling antibody AMY109. (8) The method according to any one of (1) to (7), wherein the cell stably expresses the antibody or a fragment thereof. (9) A recombinant vector comprising four copies of DNA encoding the antibody light chain or a fragment thereof and two copies of DNA encoding the antibody heavy chain or a fragment thereof. (10) A cell into which the vector according to (9) has been introduced.(11) A cultured cell into which a vector containing four copies of foreign DNA encoding an antibody L chain or a fragment thereof and two copies of foreign DNA encoding the antibody H chain or a fragment thereof has been introduced. (12) The cell according to (10) or (11), which constitutively expresses an antibody or a fragment thereof. (13) The antibody is selected from the group consisting of an anti-CD137 antibody, an anti-latent TGF-β1 antibody, an anti-latent myostatin antibody, an anti-complement (C1s) antibody, an anti-IL-8 antibody, an anti-IL-6 receptor antibody, an anti-IL-6 antibody, an anti-glypican-3 antibody, an anti-CD3 antibody, an anti-CD20 antibody, an anti-GPIIb / IIIa antibody, an anti-TNF antibody, an anti-CD25 antibody, an anti-EGFR antibody, an anti-Her2 / neu antibody, an anti-RSV antibody, an anti-CD33 antibody, an anti-CD52 antibody, an anti-IgE antibody, an anti-CD11a antibody, an anti-VEGF antibody, and an anti-VLA4 antibody, and is preferably an anti-CD137 agonist switch antibody STA551, an anti-latent TGF-β1 (14) The method of any of (1) to (8), the vector of (9), or the cell of any of (10) to (13), wherein the antibody is a humanized anti-CD137 antibody (e.g., STA551). (15) A method for producing a pharmaceutical containing an antibody or a fragment thereof, comprising the steps of producing an antibody or a fragment thereof by the method of any of (1) to (8), and mixing the obtained antibody with a pharmaceutically acceptable carrier or additive to form a formulation, thereby producing the pharmaceutical.

[0016] In the present invention, by setting the copy numbers of antibody L-chain and H-chain cDNA contained in the expression vector to a specific value (four copies for the L chain and two copies for the H chain), it is possible to obtain transformed cells that produce a high amount of the desired recombinant antibody. The present invention makes it possible to provide a novel method for producing recombinant antibodies with high production efficiency. Furthermore, since the plasmid size is smaller than the H3L6 plasmid, which is composed of three copies of the H chain and six copies of the L chain, and the H4L8 plasmid, which is composed of four copies of the H chain and eight copies of the L chain, it is expected to facilitate plasmid construction, be highly efficiently introduced into cells, and be stably maintained after introduction into the host cell genome.

[0017] Figure 1 shows the H2L4 plasmid, which is composed of two copies of the heavy chain and four copies of the light chain of a humanized anti-CD137 antibody gene. Figure 2 shows the H3L6 plasmid, which is composed of three copies of the heavy chain and six copies of the light chain of a humanized anti-CD137 antibody gene. Figure 3 shows the H4L8 plasmid, which is composed of four copies of the heavy chain and eight copies of the light chain of a humanized anti-CD137 antibody gene. Figure 4 shows a graph comparing the titers of clone cell lines transfected with the H2L4 plasmid (median), clone cell lines transfected with the H3L6 plasmid (mean), and clone cell lines transfected with the H4L8 plasmid (median). Figure 5 shows the H1L2 plasmid, which is composed of one copy of the heavy chain and two copies of the light chain of a humanized anti-CD137 antibody gene. Figure 6 shows a graph comparing the titers of clone cell lines transfected with the H1L2 plasmid (median) and clone cell lines transfected with the H2L4 plasmid (median).

[0018] Embodiments of the present invention are described in more detail below. The present invention provides a method for producing an antibody or a fragment thereof, which comprises producing an antibody or a fragment thereof using cells transfected with a vector containing four copies of foreign DNA encoding an antibody L chain or a fragment thereof and two copies of foreign DNA encoding the antibody H chain or a fragment thereof. In the production method of the present invention, the four copies of DNA encoding the L chain or a fragment thereof and the two copies of DNA encoding the H chain or a fragment thereof are all contained within the same vector.

[0019] The present invention also provides a recombinant vector comprising four copies of foreign DNA encoding an antibody L chain or a fragment thereof, and two copies of foreign DNA encoding the antibody H chain or a fragment thereof.

[0020] The present invention also provides cells into which a vector containing four copies of foreign DNA encoding an antibody light chain or a fragment thereof and two copies of foreign DNA encoding the antibody heavy chain or a fragment thereof has been introduced.

[0021] The present invention also provides cultured cells into which a vector containing four copies of foreign DNA encoding an antibody light chain or a fragment thereof and two copies of foreign DNA encoding the antibody heavy chain or a fragment thereof has been introduced.

[0022] In the present invention, the above-mentioned cells or cultured cells are preferably transformed cells into which a vector containing four copies of DNA encoding the L chain or a fragment thereof of a desired recombinant antibody and two copies of DNA encoding the H chain or a fragment thereof of the antibody has been introduced, and which produce the recombinant antibody or a fragment thereof.

[0023] The present inventors have found that by using transformed cells into which a vector containing four copies of DNA encoding the L chain and two copies of DNA encoding the H chain of a recombinant antibody has been introduced, the production amount of the desired recombinant antibody is significantly increased compared to: 1) transformed cells into which two copies of the L chain and one copy of the H chain have been introduced; 2) transformed cells into which six copies of the L chain and three copies of the H chain have been introduced; and 3) transformed cells into which eight copies of the L chain and four copies of the H chain have been introduced.

[0024] Therefore, the production method of the present invention is characterized by using a transformed cell into which a vector containing four copies of DNA encoding the L chain or a fragment thereof of a recombinant antibody and two copies of DNA encoding the H chain or a fragment thereof is introduced.

[0025] In the production method of the present invention, a recombinant vector containing four copies of DNA encoding the L chain or a fragment thereof of a target antibody and two copies of DNA encoding the H chain or a fragment thereof is prepared, the vector is introduced into cells, and the transformed cells into which the vector has been introduced are cultured to produce the target antibody or a fragment thereof, thereby producing the antibody or a fragment thereof. The construction of the recombinant vector, the introduction of the vector into host cells, and the selection of transformed cells into which the vector has been introduced can be performed using common means well known to those skilled in the art. Those skilled in the art can also appropriately culture transformed cells to produce the target polypeptide.

[0026] The production method of the present invention may include selecting transformed cells into which the above-mentioned vector has been introduced based on their ability to produce the desired recombinant antibody or a fragment thereof, to obtain clonal cell lines (multiple types) that produce the antibody or a fragment thereof at high levels, and then culturing each of the obtained clonal cell lines to produce the antibody or a fragment thereof. Here, the clonal cell lines are derived from the selected single cells. When the product is to be used as an antibody pharmaceutical, the clonal cell lines are further selected based on the quality of the product and cell stability to become seed culture strains suitable for production culture. The selected clonal cell lines, i.e., the seed cell lines, are expanded and then typically dispensed into several hundred vials and frozen and stored as a cell bank for use in the production of antibody drug substances.

[0027] The production method of the present invention can be applied to antibodies against any antigen, including, but not limited to, recombinant antibodies such as anti-CD137 antibody, anti-latent TGF-β1 antibody, anti-latent myostatin antibody, anti-complement (C1s) antibody, anti-IL-8 antibody, anti-IL-6 receptor antibody, anti-IL-6 antibody, anti-glypican-3 antibody, anti-CD3 antibody, anti-CD20 antibody, anti-GPIIb / IIIa antibody, anti-TNF antibody, anti-CD25 antibody, anti-EGFR antibody, anti-Her2 / neu antibody, anti-RSV antibody, anti-CD33 antibody, anti-CD52 antibody, anti-IgE antibody, anti-CD11a antibody, anti-VEGF antibody, and anti-VLA4 antibody.

[0028] Antibodies produced by the production method of the present invention include not only monoclonal antibodies derived from animals such as humans, mice, rats, hamsters, rabbits, sheep, camels, and monkeys, but also artificially modified recombinant antibodies such as chimeric antibodies, humanized antibodies, human antibodies, and minibodies.

[0029] The immunoglobulin class of the antibody is not particularly limited, and may be any class such as IgG (e.g., IgG1, IgG2, IgG3, IgG4), IgA, IgD, IgE, or IgM, but IgG and IgM are preferred when used as a pharmaceutical.

[0030] Furthermore, in the present invention, the desired recombinant antibody may be an antibody modified using antibody engineering techniques, such as a switched antibody, a recycling antibody, or a sweeping antibody.

[0031] DNA encoding the L chain and DNA encoding the H chain of an antibody can generally be prepared as follows: mRNA is extracted from hybridomas, cells, phages, ribosomes, etc. that contain the antibody expression gene. cDNA is produced from this mRNA by reverse transcription using reverse transcriptase. The L chain gene or H chain gene is amplified by PCR using cDNA and primers with complementary nucleotide sequences to the L chain gene or H chain gene, and each gene is obtained by ligating it with a cloning plasmid.

[0032] The desired recombinant antibody of the present invention includes not only whole antibodies but also antibody fragments such as Fab, F(ab')2, and Fv. Gene fragments encoding the antibody L-chain fragment and the H-chain fragment, that is, DNA encoding the antibody L-chain fragment, can also be cloned by methods similar to those described above.

[0033] When the product is used as an antibody drug, the amino acid sequence of the antibody chain may be determined based on the gene obtained by the above-mentioned method or obtained by another method, and then modifications may be made to improve efficacy, function, physical properties, etc. Such modifications include modifications made using antibody engineering techniques, which are also referred to herein.

[0034] Vectors are useful for maintaining DNA encoding a recombinant antibody or a fragment thereof in host cells and for expressing the recombinant antibody or a fragment thereof. In the present invention, there are no particular limitations on the host cells into which the vector is introduced, and for example, Escherichia coli and various animal cells can be used.

[0035] For example, when Escherichia coli (e.g., JM109, DH5α, HB101, XL1Blue) is used as a host, the vector preferably has an "ori" for amplification in E. coli in order to amplify the vector and prepare it in large quantities, and further has a selection gene for the transformed E. coli (e.g., a drug resistance gene that can be detected by a drug (ampicillin, tetracycline, kanamycin, chloramphenicol)). Examples of known vectors include M13 vectors, pUC vectors, pBR322, pBluescript, and pCR-Script. In addition to the above vectors, examples of vectors used for the purpose of cDNA subcloning and excision include pGEM-T, pDIRECT, and pT7. Many vectors derived from these are commercially available and can be used in the present invention.

[0036] In one embodiment of the present invention, the vector is an expression vector intended for the expression of an antibody or a fragment thereof in animal cells. Expression vectors can be plasmid vectors or non-plasmid vectors such as viral vectors, cosmid vectors, bacterial artificial chromosomes (BACs), and yeast artificial chromosomes (YACs). In a preferred embodiment, the expression vector of the present invention is a plasmid vector intended for expression in animal cells. In the present invention, the expression vector is constructed to contain four copies of DNA encoding the L chain or a fragment thereof of the target antibody and two copies of DNA encoding the H chain or a fragment thereof, and is used to establish a cell line with high productivity of the target antibody molecule or antibody fragment.

[0037] Various gene expression vectors that function in mammalian cells are commercially available, and the necessary one can be selected depending on the purpose. Alternatively, known gene expression vectors can be used with appropriate modifications. A homemade vector designed to efficiently express the target antibody molecule in host cells can also be used. Basic components of an expression vector include a promoter / enhancer for expressing the downstream gene, the protein coding region (ORF) of the target gene, a poly(A) addition signal for terminating transcription of the upstream ORF, a marker gene for drug selection or visualization, and a replication origin (e.g., the pUC ori replication origin in E. coli or the SV40 ori replication origin in mammalian cells). Furthermore, a Kozak sequence may be placed before the start codon in the ORF to improve translation efficiency.

[0038] When constructing a gene expression vector, for example, to establish a stable, highly expressing cell line, it is important to use a strong promoter / enhancer that functions efficiently in the target cells. An expression vector is constructed and used by inserting the gene to be expressed downstream of the promoter / enhancer. Typical examples include the SV40 promoter, MMLV-LTR promoter, EF-1α promoter, CMV promoter, mouse β-globin promoter (mBGP), and SRα promoter.

[0039] The CAG promoter is constructed as a hybrid promoter by combining a modified chicken-derived β-actin promoter with a CMV enhancer (Niwa et al., Gene. (1991) 108, 193). The CAG promoter is a strong promoter independent of cell type, and expression vectors that transcribe a target gene using the CAG promoter are expected to achieve higher expression of the target protein than expression vectors based on the CMV promoter. Promoters that are improved versions of the CAG promoter are also known (Japanese Patent No. 5670330 (WO2010 / 015079)). Another modified CAG promoter, the eCAPE promoter (SEQ ID NO: 13), is a preferred example of a promoter that can be used in the present invention for expressing antibody polypeptide chains.

[0040] The expression vector preferably contains a gene for selecting cells transformed with the vector, such as a drug resistance gene that can be distinguished by drugs (neomycin, G418, kanamycin, hygromycin, ampicillin, puromycin, etc.) or a fluorescent marker gene that can be selected by cell sorting.

[0041] When high-expressing cells are obtained through a gene amplification process in which the gene copy number is amplified in the host cell, the expression vector can contain a selection marker such as the aminoglycoside transferase (APH) gene, the thymidine kinase (TK) gene, the Escherichia coli xanthine guanine phosphoribosyltransferase (Ecogpt) gene, or the dihydrofolate reductase (dhfr) gene.

[0042] It is known that mRNA with polyA is stable within cells, and it is preferable that the expression vector has a polyA signal necessary for adding polyA to a gene, such as a mouse β-globin polyA signal, a bovine growth hormone polyA signal (bGHpA), or an SV40 polyA signal.

[0043] In the present invention, an example of an expression vector used to produce a desired antibody or fragment thereof is a plasmid vector carrying four copies of an L-chain expression unit and two copies of an H-chain expression unit. An expression unit is a unit of gene expression ranging from a promoter to a gene coding sequence and a terminator sequence (polyA signal). Typically, an L-chain expression unit is prepared by attaching a promoter upstream of an antibody L-chain gene and a polyA signal sequence downstream. Similarly, an H-chain expression unit is prepared by attaching a promoter upstream of an antibody H-chain gene and a polyA signal sequence downstream.

[0044] Cells used in the present invention for producing or expressing antibodies or fragments thereof are preferably animal cells, including mammalian cells such as CHO cells (J. Exp. Med. (1995) 108, 945), COS cells, 3T3 cells, myeloma cells, BHK (baby hamster kidney) cells, HeLa cells, and Vero cells, amphibian cells such as Xenopus oocytes (Valle, et al., Nature (1981) 291, 358-340), and insect cells such as Sf9, Sf21, and Tn5.

[0045] In animal cells, CHO cells are particularly preferred for large-scale expression. CHO cells that are deficient in the dihydrofolate reductase (DHFR) gene, such as dhfr-CHO (Proc. Natl. Acad. Sci. USA (1980) 77, 4216-4220) and CHO K-1 (Proc. Natl. Acad. Sci. USA (1968) 60, 1275), are particularly suitable. Two types of dhfr-deficient CHO cell lines, the DXB11 and DG44 strains, are widely available.

[0046] Vectors can be introduced into host cells by well-known methods such as the calcium phosphate method, the DEAE-dextran method, a method using cationic liposome DOTAP (Boehringer Mannheim), electroporation, and lipofection.

[0047] In the cells of the present invention, the antibody or a fragment thereof may be expressed in a transient expression system (Transient Expression) or a stable expression system (Stable Expression), but expression in a stable expression system is preferred.

[0048] Transient expression systems involve introducing circular plasmids into cells using techniques such as calcium phosphate, electroporation, and lipofection, resulting in expression. Circular plasmids are less efficiently integrated into chromosomes, and the target gene often resides extrachromosomally. This makes it difficult to maintain long-term expression of the target gene from a circular plasmid.

[0049] A constitutive expression system is a method in which a linear plasmid prepared by restriction enzyme treatment or the like is incorporated into cells using calcium phosphate, electroporation, lipofection, or other methods, and the plasmid is inserted into the chromosome, resulting in gene expression. This method makes it possible to maintain expression of the target gene for a long period of time. Linear plasmids are more efficiently inserted into chromosomes than circular plasmids, and the efficiency with which the target gene is maintained on the chromosome is also increased. Furthermore, introduction of a drug resistance gene into the plasmid enables drug selection, allowing efficient selection of cells in which the target gene is maintained on the chromosome. Animal cells used in constitutive expression systems include CHO cells, NS0 cells, and SP2 / 0 cells, with CHO cells being preferred.

[0050] In one aspect, the present invention aims to produce a specific antibody. Examples of the antibody of interest include the following antibodies. The anti-CD137 antibody may be, for example, the anti-human CD137 antibody described in WO2020 / 032230, and more specifically, the anti-CD137 agonist antibody called "STA551." STA551 is a switch antibody that binds to CD137 in an adenosine triphosphate (ATP)-dependent manner and exerts agonist activity.

[0051] The anti-latent TGF-β1 antibody may be, for example, a cross-species anti-latent TGF-β1 antibody described in WO2021 / 039945, and more specifically, a monoclonal antibody called "SOF10" or "RG6440."

[0052] The anti-latent myostatin antibody may be a sweeping antibody, such as the antibody called "GYM329" or "RG6237." The anti-IL-8 antibody may be a recycling antibody, such as the antibody called "AMY109."

[0053] In a preferred embodiment, the present invention can use a vector constructed for the purpose of expressing the antibody STA551. A specific example of the vector is pSTA551-eCAPE-bGHpA-LLLLHH (FIG. 1), which is introduced into dhfr gene-deficient CHO cells, which are host cells for antibody production.

[0054] pSTA551-eCAPE-bGHpA-LLLLHH contains four copies of the STA551 antibody light chain expression unit and two copies of the heavy chain expression unit. Each expression unit contains the eCAPE promoter upstream of the STA551 heavy chain (SEQ ID NO: 11) or light chain (SEQ ID NO: 12), and bGHpA as a polyadenylation signal downstream of the STA551 heavy or light chain. This plasmid also contains the DHFR gene followed by the SV40 polyA (SV40pA). DHFR is designed to be expressed by a chromosomal promoter when this plasmid is introduced into a cell chromosome, contributing to the selection of transformants. This plasmid also contains the SV40 promoter. This promoter drives the expression of the hygromycin B resistance gene, previously inserted into the chromosome, contributing to the selection of transformants. This plasmid also contains the pUC ori and kanamycin resistance gene (kanR). The pUC ori serves as the origin of replication in E. coli during plasmid preparation. The kanamycin resistance gene contributes to the selection of E. coli carrying the plasmid.

[0055] In one aspect, the present invention relates to a CHO cell into which a vector containing four copies of an antibody L chain expression unit and two copies of an H chain expression unit has been introduced, wherein a CAG promoter or an eCAPE promoter is positioned upstream of the H chain or L chain in each expression unit, and the antibody is preferably any of STA551, SOF10, RAY121, AMY109, GYM329, or S12pre, or also preferably STA551, SOF10, or RAY121, and even more preferably STA551.

[0056] A polypeptide encoded by a gene of interest can be obtained by transforming a cell with the gene of interest and culturing the transformed cell. In the present invention, the antibody or a fragment thereof is produced by culturing in vitro cells into which a vector containing four copies of DNA encoding the antibody L chain or a fragment thereof and two copies of DNA encoding the antibody H chain or a fragment thereof has been introduced.

[0057] In the present invention, culture can be carried out according to known methods. Media used for ordinary cell (preferably animal cell) culture can be used for cell culture, and there are no particular limitations as long as they are animal cell culture media. These typically contain amino acids, vitamins, lipid factors, energy sources, osmotic regulators, iron sources, and pH buffers. Furthermore, trace metal elements, surfactants, growth cofactors, nucleosides, etc. may also be added.

[0058] For example, commercially available cell culture media such as D-MEM (Dulbecco's Modified Eagle Medium), D-MEM / F-12 1:1 Mixture (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12), MEM, RPMI 1640, IMDM, CHO-S-SFM II (Invitrogen), CHO-SF (Sigma-Aldrich), EX-CELL 301 (JRH biosciences), CD-CHO (Invitrogen), IS CHO-V (Irvine Scientific), PF-ACF-CHO (Sigma-Aldrich), and Basal 10 (Ajinomoto Co.) can be used. Serum supplements such as fetal calf serum (FCS) can also be used. Alternatively, the medium may be serum-free. For protein purification, culturing cell lines in serum-free media is desirable.

[0059] If the host cells are CHO cells lacking the dhfr gene, hypoxanthine and thymidine are added to the medium. If the host cells are proline-auxotrophic CHO cell lines derived from the DXB11 or DG44 strains, it may be advisable to add proline to the medium.

[0060] When the cells are CHO cells, they can be cultured using methods known to those skilled in the art. For example, they can be cultured in an atmosphere with a CO concentration in the gas phase of 0 to 40%, preferably 2 to 10%, at 30 to 39°C, preferably about 37°C.

[0061] The culture period for cells suitable for producing the desired recombinant antibody or fragment thereof is usually 1 day to 3 months, preferably 1 day to 2 months, and more preferably 1 day to 1 month.

[0062] In addition, various culture apparatuses for animal cell culture may be used, such as a fermenter-type tank culture apparatus, an airlift-type culture apparatus, a culture flask-type culture apparatus, a spinner flask-type culture apparatus, a microcarrier-type culture apparatus, a fluidized bed-type culture apparatus, a hollow fiber-type culture apparatus, a roller bottle-type culture apparatus, and a packed tank-type culture apparatus.

[0063] The culture may be any of batch culture, fed-batch culture, continuous culture, etc., but fed-batch culture or continuous culture is preferred, with fed-batch culture being more preferred.

[0064] A composition containing an antibody or a fragment thereof can be recovered from a culture obtained by a cell culture process for producing a recombinant antibody or a fragment thereof. "Recovering" as used herein refers to recovering a supernatant (culture supernatant) containing the antibody or a fragment thereof from the culture or culture medium obtained by the cell culture process, or recovering a filtrate containing the antibody or a fragment thereof using a filter. The solution recovered in this manner can be purified by affinity column chromatography or other methods, as described below, and concentrated to prepare a composition containing an antibody or a fragment thereof at an appropriate concentration.

[0065] The antibodies or fragments thereof obtained by the production method of the present invention can be purified to homogeneity. Separation and purification of antibodies or fragments thereof can be performed using methods commonly used for polypeptides. For example, antibodies can be separated and purified by appropriately selecting and combining methods such as affinity chromatography columns, filters, ultrafiltration, salting out, dialysis, SDS-polyacrylamide gel electrophoresis, and isoelectric focusing (Antibodies: A Laboratory Manual. Ed Harlow and David Lane, Cold Spring Harbor Laboratory, 1988), but these methods are not limited thereto. The concentration of the antibodies obtained above can be measured by absorbance measurement or enzyme-linked immunosorbent assay (ELISA), etc.

[0066] Examples of columns used in affinity chromatography include protein A columns and protein G columns. For example, columns using protein A columns include Hyper D, POROS, and Sepharose FF (Pharmacia).

[0067] Examples of chromatography other than affinity chromatography include ion exchange chromatography, hydrophobic chromatography, gel filtration, reverse-phase chromatography, and adsorption chromatography (Strategies for Protein Purification and Characterization: A Laboratory Course Manual. Ed. Daniel R. Marshak et al., Cold Spring Harbor Laboratory Press, 1996). These chromatographies can be performed using liquid-phase chromatography such as HPLC and FPLC.

[0068] Furthermore, before or after purification, polypeptides can be treated with an appropriate polypeptide-modifying enzyme to optionally modify or partially remove peptides. Examples of polypeptide-modifying enzymes that can be used include trypsin, chymotrypsin, lysyl endopeptidase, protein kinase, and glucosidase. Furthermore, the resulting antibodies can be chemically modified, for example, by binding them with various molecules such as polyethylene glycol (PEG), to produce modified antibodies.

[0069] If the antibody or fragment thereof produced by the method of the present invention has biological activity that allows it to be used as a pharmaceutical, a pharmaceutical product can be produced by mixing the polypeptide with a pharmaceutically acceptable carrier or additive and formulating it.

[0070] Examples of pharmaceutically acceptable carriers and additives include water, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, carboxyvinyl polymers, sodium carboxymethylcellulose, sodium polyacrylate, sodium alginate, water-soluble dextran, sodium carboxymethyl starch, pectin, methylcellulose, ethylcellulose, xanthan gum, gum arabic, casein, agar, polyethylene glycol, diglycerin, glycerin, propylene glycol, petrolatum, paraffin, stearyl alcohol, stearic acid, human serum albumin (HSA), mannitol, sorbitol, lactose, surfactants acceptable as pharmaceutical additives, and the like.

[0071] The actual additives are selected from the above alone or in appropriate combination depending on the dosage form of the therapeutic agent of the present invention, but are not limited to these. For example, when used as an injectable formulation, the purified polypeptide can be dissolved in a solvent such as physiological saline, buffer solution, glucose solution, etc., to which an adsorption inhibitor such as Tween 80, Tween 20, gelatin, human serum albumin, etc. can be added. Alternatively, the polypeptide can be lyophilized to form a dosage form that can be dissolved and reconstituted before use, and sugar alcohols and saccharides such as mannitol and glucose can be used as excipients for lyophilization.

[0072] The effective dose of the antibody or fragment thereof is selected as appropriate depending on the type of antibody or fragment thereof, the type of disease to be treated or prevented, the age of the patient, the severity of the disease, and other factors. For example, when the antibody is an anti-glypican-3 antibody and is used as an anti-cancer agent, the effective dose of the anti-glypican-3 antibody is selected from the range of 0.001 mg to 1,000 mg per kg of body weight per administration. Alternatively, a dose of 0.01 to 100,000 mg / body per patient can be selected. However, the dose is not limited to these doses.

[0073] The antibody or a fragment thereof can be administered orally or parenterally, but is preferably administered parenterally. Specific examples include injection (for example, systemic or local administration by intravenous injection, intramuscular injection, intraperitoneal injection, subcutaneous injection, etc.), nasal administration, pulmonary administration, and transdermal administration.

[0074] The present invention will be specifically described below using examples. Note that these examples are intended to illustrate the present invention and are not intended to limit the scope of the present invention. In these examples, a plasmid was prepared using the H-chain gene (SEQ ID NO: 11) and L-chain gene (SEQ ID NO: 12) of the humanized anti-CD137 antibody "STA551."

[0075] Example 1: Production of humanized anti-CD137 antibody (STA551) using H2L4 plasmid, H3L6 plasmid, and H4L8 plasmid. An eCAPE promoter (SEQ ID NO: 13) was ligated upstream of the humanized anti-CD137 antibody H-chain gene and humanized anti-CD137 antibody L-chain gene, respectively, and a bovine growth hormone (bgh) polyA signal sequence was ligated downstream to create an H-chain expression unit and an L-chain expression unit. The H-chain expression unit and the L-chain expression unit were ligated to a vector for CHO cell transfection incorporating a hygromycin resistance gene and a DHFR gene to create the H2L4 plasmid (Figure 1), which consists of two H-chain copies and four L-chain copies of the humanized anti-CD137 antibody gene; the H3L6 plasmid (Figure 2), which consists of three H-chain copies and six L-chain copies; and the H4L8 plasmid (Figure 3), which consists of four H-chain copies and eight L-chain copies, respectively. These plasmids were then introduced into CHO DXB11-derived host cells by electroporation. The cells were then cultured in the presence of 400 mg / mL hygromycin B to obtain cell lines into which the expression plasmid had been introduced, and selection was performed based on the amount of antibody produced.

[0076] Six selected clone cell lines transfected with the H2L4 plasmid, nine clone cell lines transfected with the H3L6 plasmid, and six clone cell lines transfected with the H4L8 plasmid were cultured in a fed-batch system (ambr15, Sartorius) to compare antibody production. Culture was performed in Basal 10 medium (Ajinomoto Co.) with an initial culture volume of 10 mL, at 37°C and an agitation speed of 800 rpm.

[0077] The antibody concentration in the culture medium was measured on day 14 after the start of culture. As a result, the six clone cell lines into which the H2L4 plasmid had been introduced showed significantly higher antibody production than the other clones (the three on the left in Figure 4).

[0078] Example 2: When different media were used Thirteen clone cell lines transfected with the H2L4 plasmid, six clone cell lines transfected with the H3L6 plasmid, and five clone cell lines transfected with the H4L8 plasmid were subjected to culture evaluation in the same manner as in Example 1, using a different medium, STM2.1 (Chugai proprietary chemically defined medium). As a result, the clone cell lines transfected with the H2L4 plasmid showed high antibody production even when using different media (the three on the right in Figure 4).

[0079] Example 3: Comparison with H1L2 plasmid Furthermore, as a comparative example, an H1L2 plasmid (Figure 5) consisting of one copy of the H chain and two copies of the L chain of a humanized anti-CD137 antibody gene was prepared and evaluated in the same manner as in Examples 1 and 2.

[0080] The selected 24 clone cell lines transfected with the H1L2 plasmid and 24 clone cell lines transfected with the H2L4 plasmid were subjected to fed-batch culture using Basal 10 or STM2.1, and the antibody concentration in the culture medium was measured on day 14. When Basal 10 was used, the clone cell lines transfected with the H2L4 plasmid produced higher antibody than the clone cell lines transfected with the H1L2 plasmid (the two leftmost cells in Figure 6).

[0081] From the above, it was confirmed that introducing four copies of the L chain into host cells in comparison with two copies of the H chain results in a higher antibody production amount than with other copy numbers.

[0082] All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety.

[0083] Regarding the sequence, STA551 is described in WO2020 / 032230 under the antibody name "A551-SCF057aPh / B379-LamLib." In WO2020 / 032230, the structure and amino acid sequence of A551-SCF057aPh / B379-LamLib are described as follows (see Tables 51, 52, etc.). Here, for convenience, each sequence is represented by the SEQ ID described in WO2020 / 032230. [VH] A551 (VH: SEQ 51, HCDR1: SEQ 7, HCDR2: SEQ 15, HCDR3: SEQ 20) [CH] SCF057aPh (SEQ: 82) [VL] B379 (VL: SEQ 60, LCDR1: SEQ 25, LCDR2: SEQ 26, LCDR3: SEQ 27) [CL] Lamlib (SEQ: 63)

[0084] Specifically, the H chain (A551-SCF057aPh) is a combination of the variable region A551 and the constant region SCF057aPh, and the L chain (B379-LamLib) is a combination of the variable region B379 and the constant region LamLib. These amino acid sequences are assigned SEQ ID NOS: 1 to 10, respectively, in the Sequence Listing of the present application. The nucleotide sequences of the H chain gene and L chain gene of antibody STA551 are assigned SEQ ID NOS: 11 and 12 in the Sequence Listing of the present application.

[0085] The sequences (SEQ ID NOS: 1 to 12) of antibody STA551 ("A551-SCF057aPh / B379-LamLib" described in WO2020 / 032230) and the sequence of the eCAPE promoter (SEQ ID NOS: 13) are shown below. Table 1: Amino acid sequence of the heavy chain variable region [VH] A551 (VH: SEQ 51, HCDR1: SEQ 7, HCDR2: SEQ 15, HCDR3: SEQ 20 - shown by the SEQ ID NOS: described in WO2020 / 032230)

[0086] Table 2: Amino acid sequence of the heavy chain constant region [CH] SCF057aPh (SEQ: 82 - represented by the sequence number described in WO2020 / 032230)

[0087] Table 3: Amino acid sequence of the L chain variable region [VL] B379 (VL: SEQ 60, LCDR1: SEQ 25, LCDR2: SEQ 26, LCDR3: SEQ 27 - represented by the sequence numbers described in WO2020 / 032230)

[0088] Table 4: Amino acid sequence of the L chain constant region [CL] Lamlib (SEQ: 63 - represented by the sequence number described in WO2020 / 032230)

[0089] DNA sequence of H chain gene and L chain gene of "STA551" >STA551_H (sequence number 11) ATGGAGctgGGGCTGcgcTGGGTTTTCCTCGTTGCTATAttagaaGGTGTCCAGTGTgaa GTGCAACTGGTGGAGTCTGGGGGAGGCTTGGTCAAACCTGGGGGGTCCCTGAGACTTCCC TGTGCTGCCTCTGGATTCACCTTCTTaccttACCATGAATTGGGTCCGCCAAGCTCCC GGCAAGGGGCTGGAATGGGTGTCCATCCATTTCCatcaaaAgggTCtTATATTgagTATGCT GAATCCttcaaagtcCGATTCACCATCTCAAGAGACAACGCCAAGAACTCTCTGTTATCTG CAAATGAACTCCCTGAGAGCCGGACACCGCCGTGTATTACTGTGCCAGATATGGTatc aaaaaatgagctgaatTGGGTTTTTGACTACTGGGCCAAGGCACCCTGGTGGACAGTGTCC TCTGCCTCCACAAAaGGCCCATCCGTGTTCCCCTGCTCTTCCTCTAAGTCTACCTC GGCGGCACAGCCGCTCTGGGATGTCTGGTGAAGGATTATTTCCCTGAACCCGTGACCGTG TCTTGGAACTCCGGCGCCCTGACCTCCGGCGTGCACACATTTCCCGCCGTGCTACAGTCC TCTGGCCTGTACTCTCTGTCCTCTGGTGACAGTGCCCTCCTTCCCTGGGCACCCAG ACATATATCTGTAATGTTAATCACAAGCCCTCCAATACAAAAGTGGACAAGAGAGTGGAG CCTAAGTCTTGTGATAAGACCCATACATGCCCCCCTTGCTGCCCCTGAACTGtggaac GGCCCTTCAGTGTTCCTGTTTCCACCCAAACCAAAGGACaccCTGATGATCTCAAGGACC CCTGAGGTGACATGCGTGGTGGTGGACGTGTCTgacGAGgacCCCGAAGTGAAGTTTAATTGGTACGTGGATGCGTGGAAGTGCATAATGCCAAGACAAAGCCCAGAGAGGAGCAGTAC AACtcaACaTATAGGGTGGTGCTGTGCTGaccGTGCTGCACCgGGACTGGCTGAACGGC AAGGAGTATAAGTGCAAGGTGTCCAATaaaGCCTTGCCTaagCCCATCGAGaaACCATC TCTAAGGCTAAGGGACAGcggCGGGAGCCTCAAGTGTACACACTGCCTCCATCCAGAGAG GAGATGACCAAGAACCAAGTGTCTCTGACATGTCTGTCAAGGGCTTCTTATCCATCTGA ATCGCTGTGGGAGTGGAGTCTAATGGCCAGCCCGAGAACAATTACAAGACCACCACCCCCT GTGCTGGACTCTGATGGCTCCTTCTTTCTGTATTCCAAACTGACCGTGGATAAGTCTAGG TGGCAGCAGGGCAACGTGTTCTCTTTCTGTCATGCACGAGGCACTGCACAACCATTAC ACCCAGaagTCACTGTCACTGTCACTGTTCACCCTTGA

[0090] >STA551_L (SEQ ID NO: 12) ATGGCCTGGtcCcctCTGCTCCTCACCCTCCTCgctcactgcACAGGGTCCTGGGCCCAA TCCGCACTGACTCAACCTCCATCCGCCTCTGGTTCCCCTGGACAGACAGTTACCATCTCC TGTacTGGCaccTCAACTGATGTGGGTtAtTACgaATATGTATCCTGGTATCAACAGCAC CCTGGAAAGGCTCCTAAACTGATGATTTATgagACTTCCAAAcgtctgTCTGGTGTCCCT GATCGTTTTTCCGGCTCCAAATCCGGCAACACTGCCTCCCTGACTGTTTCCGGTTTGCAA GCTGAGGACGAGGCAGACTATtacTGCTCATCcTATcgttatgaAcatcaggttTCcTTC GGCGGAGGGACCAAACTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCTGTCACTCTG TTCCCACCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTCGTATGTCTCATATCT GACTTCTACCCTGGCGCCGTGACAGTGGCCTGGAAGGCAGATTCCTCACCCGTCAAGGCT GGCGTGGAaACCACCACACCCTCCAAACAATCTAACAACAAATACGCTGCCTCATCCTAT CTGTCCCTGACTCCTGAGCAGTGGAAGTCCCACAGATCCTACTCCTGCCAAGTCACACAT GAAGGGTCCACCGTGGAGAAGACAGTGGCCCCTACAGAATGTTCCTGA

[0091] DNA sequence of eCAPE promoter (SEQ ID NO: 13) GTCGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATA GCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGC CCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAG GGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTAC ATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCG CCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACG TATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCA TCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTTAATAGCCAATCAGAG CGGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAA GCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGC CGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGG GCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGGGGGGACGGCTGCCTTCGGGGGGG ACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAA CCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCT GTCTCATCATTTTGGCAAAccggt

[0092] The present invention can be used to produce antibodies and is applicable to any antibody-producing cells.

Claims

1. A method for producing an antibody or a fragment thereof, comprising using a cell into which a vector containing four copies of DNA encoding the L chain of the antibody or a fragment thereof and two copies of DNA encoding the H chain of the antibody or a fragment thereof has been introduced.

2. The method according to claim 1, wherein the cell is an animal cell.

3. The method according to claim 2, wherein the animal cell is a Chinese hamster ovary cell.

4. The method according to any one of claims 1 to 3, wherein the antibody is a chimeric antibody, a humanized antibody or a human antibody.

5. The method according to any one of claims 1 to 3, wherein the antibody is a switch antibody, a recycling antibody, or a sweeping antibody.

6. The method according to any one of claims 1 to 3, wherein the antibody is selected from the group consisting of an anti-CD137 antibody, an anti-latent TGF-β1 antibody, an anti-latent myostatin antibody, an anti-complement (C1s) antibody, an anti-IL-8 antibody, an anti-IL-6 receptor antibody, an anti-IL-6 antibody, an anti-glypican-3 antibody, an anti-CD3 antibody, an anti-CD20 antibody, an anti-GPIIb / IIIa antibody, an anti-TNF antibody, an anti-CD25 antibody, an anti-EGFR antibody, an anti-Her2 / neu antibody, an anti-RSV antibody, an anti-CD33 antibody, an anti-CD52 antibody, an anti-IgE antibody, an anti-CD11a antibody, an anti-VEGF antibody and an anti-VLA4 antibody.

7. The method according to claim 6, wherein the antibody is an anti-CD137 agonist switch antibody STA551, an anti-latent TGF-β1 monoclonal antibody SOF10 / RG6440, an anti-latent myostatin sweeping antibody GYM329 / RG6237, an anti-complement (C1s) antibody RAY121, antibody S12pre or an anti-IL-8 recycling antibody AMY109.

8. The method according to claim 6, wherein the antibody is an anti-CD137 antibody STA551.

9. The method according to any one of claims 1 to 3, wherein the cell stably expresses the antibody or a fragment thereof.

10. A recombinant vector containing four copies of DNA encoding the L chain of the antibody or a fragment thereof and two copies of DNA encoding the H chain of the antibody or a fragment thereof.

11. A cell into which the vector according to claim 10 has been introduced.

12. The cell according to claim 11, which stably expresses the antibody or a fragment thereof.

13. The vector according to claim 10, or the cell according to claim 11 or 12, wherein the antibody is selected from the group consisting of an anti-CD137 antibody, an anti-latent TGF-β1 antibody, an anti-latent myostatin antibody, an anti-complement (C1s) antibody, an anti-IL-8 antibody, an anti-IL-6 receptor antibody, an anti-IL-6 antibody, an anti-glypican-3 antibody, an anti-CD3 antibody, an anti-CD20 antibody, an anti-GPIIb / IIIa antibody, an anti-TNF antibody, an anti-CD25 antibody, an anti-EGFR antibody, an anti-Her2 / neu antibody, an anti-RSV antibody, an anti-CD33 antibody, an anti-CD52 antibody, an anti-IgE antibody, an anti-CD11a antibody, an anti-VEGF antibody, and an anti-VLA4 antibody.

14. The vector or cell according to claim 13, wherein the antibody is an anti-CD137 agonist switch antibody STA551, an anti-latent TGF-β1 monoclonal antibody SOF10 / RG6440, an anti-latent myostatin sweeping antibody GYM329 / RG6237, an anti-complement (C1s) antibody RAY121, antibody S12pre, or an anti-IL-8 recycling antibody AMY109.

15. The vector or cell according to claim 13, wherein the antibody is an anti-CD137 antibody STA551.

16. A method for producing a pharmaceutical product containing an antibody or a fragment thereof, the method comprising the step of producing the antibody or a fragment thereof by the method according to any one of claims 1 to 9, and formulating the obtained antibody by mixing it with a pharmaceutically acceptable carrier or additive to produce a pharmaceutical product.

Images