Use of indigestible maltodextrin for improving muscle strength or for preventing, alleviating, or treating muscle loss-related diseases

Abstract

The present disclosure relates to a composition comprising indigestible maltodextrin for the prevention, alleviation, or treatment of muscle loss-related diseases.

Description

Use for preventing, improving, or treating diseases related to muscle strength improvement or muscle loss, including indigestible maltodextrin

[0001] The present invention relates to a composition for improving muscle strength or preventing, improving or treating diseases related to muscle loss, comprising indigestible maltodextrin.

[0002] Skeletal muscle is the largest organ in the human body, accounting for 40-50% of its mass. Skeletal muscle mass declines by approximately 1% annually after age 30, with a rapid decline occurring after age 65. As we age, the functional capacity of muscles (strength and power) also gradually declines. This age-related loss of muscle mass, strength, and performance is called sarcopenia.

[0003] Sarcopenia is caused by a variety of factors, but research on each of these factors remains incomplete. It is induced by decreased growth hormone levels, neurological changes, altered physical activity, metabolic changes, increased levels of sex hormones, increased levels of fat or catabolic cytokines, and altered balance between protein synthesis and differentiation.

[0004] Exercise, protein, and calorie supplementation are known to help with sarcopenia. However, they are not particularly effective in the elderly, who account for the majority of sarcopenia patients. Therefore, treatments for sarcopenia are urgently needed. However, currently available treatments for sarcopenia that directly improve muscle loss and increase muscle mass are still in the clinical trial stage, and no medications have received final FDA approval.

[0005] Therefore, there is a need for a food composition for improving muscle function, such as increasing exercise capacity, increasing muscle strength, or increasing muscle mass, using natural substances that are safe for consumption by patients with sarcopenia or the elderly and can be taken for a long period of time, a food composition for improving or preventing sarcopenia, or a pharmaceutical composition for treating or preventing sarcopenia.

[0006] One example of the present invention relates to a composition for improving muscle strength comprising indigestible maltodextrin.

[0007] A further example of the present invention relates to a composition for preventing, improving or treating sarcopenia comprising indigestible maltodextrin, wherein the composition may be a food composition or a pharmaceutical composition.

[0008] One example of the present invention relates to a method for improving muscle strength, or a method for preventing, improving or treating sarcopenia, comprising a step of administering indigestible maltodextrin or a starch hydrolyzate containing the same to a subject in need thereof.

[0009] One example of the present invention relates to the use of indigestible maltodextrin or a starch hydrolyzate containing the same for improving muscle strength or preventing, improving or treating sarcopenia.

[0010] One example of the present invention relates to a composition for improving muscle strength and / or a composition for preventing, improving or treating a disease related to muscle loss, comprising indigestible maltodextrin. The composition according to the present invention exhibits effects of increasing muscle mass, increasing muscle protein and generating muscle mass without side effects, and is therefore very useful as a preventive, improving or treating agent for a disease related to muscle loss such as sarcopenia.

[0011] In the present specification, improvement in muscle strength may include improving the phenomenon of muscle strength decline due to a decrease in muscle mass, a decrease in muscle quality, etc., or increasing muscle strength, promoting muscle recovery, preventing muscle loss, preventing muscle degeneration, preserving muscle, etc. As a specific example, in the present invention, the results showing an increase in limb muscle strength of indigestible mice using the limb hanging test in animals fed indigestible maltodextrin (see FIGS. 2 and 3), and changes in muscle endurance of mice administered indigestible maltodextrin can be confirmed through an exercise stress test (see FIGS. 4 and 5).

[0012] The composition according to the present invention can exhibit muscle strengthening effects through muscle differentiation, muscle regeneration, and increased muscle mass, and thus can be used to promote muscle production or improve muscle function. Furthermore, indigestible maltodextrin can increase muscle mass or prevent muscle loss. The composition may have one or more properties selected from the group consisting of the following properties (1) to (3):

[0013] (1) Induction of muscle cell growth and differentiation;

[0014] (2) Increased expression of myogenic regulatory factors, and

[0015] (3) Increased expression of myokine factors.

[0016] More specifically, the factor related to the induction of growth and differentiation of the muscle cells may be at least one selected from the group consisting of PI3K, Akt, mTOR, and S6K1, the myogenic regulatory factor may be at least one selected from the group consisting of Myf5, MyoD, MEF2, and Myogenin, or the myokine factor may be at least one selected from the group consisting of FNDC5, LIF, and Metrn1.

[0017] As used herein, the term "sarcopenia" refers to a disease in which muscle mass and strength progressively decline. Sarcopenia includes muscular atrophy, myasthenia gravis, muscular dystrophy, muscle rigidity, hypotonia, muscle weakness, muscular dystrophy, amyotrophic lateral sclerosis, or myasthenia gravis.

[0018] Sarcopenia is a progressive, age-related syndrome characterized by a generalized, diffuse decrease in the volume, quantity, and quality of skeletal muscle fibers, and a decline in strength and / or function; it is often accompanied by an increase in connective and adipose tissue, and the main clinical symptoms of patients include decreased muscle strength, muscle laxity, decreased energy, increased skin wrinkling, decreased body mass, and decreased grip strength.

[0019] In the present invention, muscle loss or sarcopenia may be caused by various causes, for example, aging or obesity, or may be caused by both aging and obesity.

[0020] Sarcopenic obesity, a condition characterized by both obesity and sarcopenia, inhibits protein metabolism in muscles, leading to a decrease in muscle mass. This, in turn, reduces physical activity and basal metabolic rate, creating a vicious cycle of increased body fat. Sarcopenic obesity not only causes problems such as osteoarthritis, falls, decreased exercise capacity, a decreased quality of life, and increased mortality due to decreased muscle mass and muscle dysfunction, but also increases the risk of obesity-related metabolic syndrome, diabetes, dyslipidemia, and cardiovascular disease.

[0021] The term "sarcopenia due to aging" of the present invention refers to a decrease in skeletal muscle mass, muscle strength, muscle function, and muscle density due to aging. Among these, skeletal muscle mass decreases by about 1% per year after the age of 30, and decreases rapidly after the age of 65. In other words, it refers to a condition in which aging directly causes a decrease in skeletal muscle mass and a decline in muscle strength, which may result in a decrease in and disability of various physical functions. The muscle-related diseases due to aging may be, but are not limited to, age-related sarcopenia, motor neuron disease, metabolic muscle disease, inflammatory myopathy, neuromuscular junction disease, and endocrine myopathy.

[0022] The above muscle weakness or sarcopenia or a disease related thereto includes a muscle disease caused by muscle function decline, muscle degeneration, or muscle loss, and is preferably selected from the group consisting of, but not limited to, muscular atrophy, disuse atrophy, spinal muscular amyotrophy, muscular dystrophy, dystrophy, myotonia, muscular hypotonia, muscular weakness, amyotrophic lateral sclerosis, spinal bulbar muscular atrophy, myasthenia, and myasthenia gravis.

[0023] The term “subject” or “subject” of the present invention means any animal, including humans, that has already developed or is likely to develop muscle weakness and / or sarcopenia, and by administering the composition of the present invention to the subject, the symptoms and / or diseases can be effectively prevented, improved, or treated.

[0024] One example of the present invention relates to a food for preventing or improving sarcopenia, containing indigestible maltodextrin as an active ingredient. The term "improvement" as used herein refers to reducing a parameter associated with the condition being treated, such as the severity of symptoms. In the present invention, the food may increase muscle mass or prevent muscle loss, preferably increasing muscle mass.

[0025]

[0026] The health functional food of the present invention may include all foods in the conventional sense, and may be used interchangeably with terms known in the art, such as functional food. The term "functional food" of the present invention refers to a food manufactured and processed using raw materials or ingredients having functionality useful to the human body according to Act No. 6727 on Health Functional Foods, and "functionality" means that it is consumed for the purpose of obtaining a useful effect for health purposes, such as regulating nutrients for the structure and function of the human body or physiological action. The term "health functional food" of the present invention refers to a food manufactured and processed using a specific ingredient as a raw material or a specific ingredient contained in a food raw material by a method such as extraction, concentration, purification, or mixing for the purpose of health supplementation, and refers to a food designed and processed so that the above-mentioned ingredients can sufficiently exert bioregulatory functions, such as biological defense, biological rhythm regulation, disease prevention and recovery, on the body, and the above-mentioned health food composition can perform functions related to disease prevention and disease recovery.

[0027] When the food composition of the present invention is used as a food additive, the composition may be added as is or used together with other foods or food ingredients, and may be used appropriately according to a conventional method.

[0028] The food of the present invention can be manufactured in all forms, including functional food, nutritional supplement, health food, and food additives.

[0029] There is no limitation on the types of foods for which the composition of the present invention can be used. Furthermore, the composition of the present invention can be prepared by mixing other appropriate auxiliary ingredients and known additives that can be included in foods, as selected by those skilled in the art.

[0030] Indigestible maltodextrin (NMD) is a water-soluble dietary fiber obtained by hydrolyzing starch. It has been reported to have the effects of suppressing postprandial blood sugar rise, improving blood triglyceride levels, increasing satiety, increasing hunger, reducing weight, reducing blood sugar rise, and reducing insulin resistance. It is an anticipated functional food material for diabetes prevention and dietary therapy.

[0031] In one example of the present invention, the indigestible maltodextrin may be a hydrolyzed product of starch containing indigestible maltodextrin or an enzymatic hydrolyzed product of roasted dextrin.

[0032] The term "resistant maltodextrin" according to the present invention refers to maltodextrin that is not decomposed or is decomposed very slowly by human digestive enzymes, and may also refer to an enzymatic hydrolyzate of roasted dextrin or a hydrolyzate of starch containing the resistant maltodextrin. In the present invention, the resistant maltodextrin can be purchased and used commercially or manufactured directly.

[0033] In the present invention, an example of an enzymatic hydrolyzed product of indigestible maltodextrin or a hydrolyzed product of starch containing the same or a hydrolyzed product of maltodextrin contains an alpha-1,6 glycosidic bond, an alpha-1,2 glycosidic bond and / or an alpha-1,3 glycosidic bond that is not digested by digestive enzymes in the human body, and preferably contains an alpha-1,6 glycosidic bond that is more difficult to digest than an alpha-1,4 glycosidic bond.

[0034] Specifically, in the present invention, the indigestible maltodextrin may have a ratio of α-1,6 glycosidic bonds among the total glycosidic bonds of 20 to 40%, or 20 to 35%. Specifically, the indigestible maltodextrin may have an α-1,6 glycosidic bond ratio of 20 to 40% or 20 to 35%, and may additionally include an α-1,2 bond and / or an α-1,3 bond, for example, the α-1,6 glycosidic bond ratio may be 20 to 40% or 20 to 35%, the α-1,2 glycosidic bond ratio may be 5 to 25%, 5 to 20%, or 10 to 25%, and the α-1,3 glycosidic bond ratio may be 10 to 30% or 10 to 25%. The above-mentioned indigestible maltodextrin may comprise α-1,6 glycosidic linkages, α-1,2 linkages and / or α-1,3 linkages, and may further comprise α-1,4 glycosidic linkages, wherein the α-1,4 glycosidic linkages may be 30 to 50%, or 35 to 47%.

[0035] More specifically, the indigestion-resistant maltodextrin of the present invention may have an α-1,2 glycosidic bond ratio of 5% to 25%, 5 to 23%, 5 to 20%, or 5 to 18% among the total glycosidic bonds. The indigestion-resistant maltodextrin of the present invention may have an α-1,3 glycosidic bond ratio of 10% to 30%, 10 to 25%, 10 to 20%, or 10 to 18%, 12% to 30%, 12 to 25%, 12 to 20%, or 12 to 18% among the total glycosidic bonds.

[0036] In addition, an example of the indigestible maltodextrin or the enzymatic hydrolyzate of roasted dextrin containing the same or the hydrolyzate of starch may have a DE value of 1 to 20, specifically 8 to 20 or 8 to 18, and an average molecular weight of 2,000 to 3,000, or the total content including DP1 saccharides and DP2 saccharides may be less than 10 wt%, less than 9 wt%, less than 8 wt%, less than 7 wt%, less than 6 wt% or less than 5 wt% based on 100 wt% of the total saccharide solid content of the composition. In the present invention, an example of the indigestible maltodextrin or the enzymatic hydrolyzate of roasted dextrin containing the same or the hydrolyzate of starch may have a dietary fiber content of 50 wt% or more, 60 wt% or more, 70 wt% or more, 80 wt% or more, 85 wt% or more or 90 wt% or more.

[0037] There are various known methods for producing indigestible maltodextrin, for example, a method in which roasted dextrin prepared by adding a small amount of hydrochloric acid to starch and heating it, and then reacting the resulting roasted dextrin with hydrolytic enzymes, α-amylase and glucoamylase, and then undergoing a purification process, or a method in which roasted dextrin obtained by treating starch with acid is subjected to an enzymatic reaction and then fractionating the indigestible component, but is not limited thereto. The enzymatic reaction may be performed using one or more enzymes selected from the group consisting of α-amylase, β-amylase, and maltogenic amylase.

[0038] Indigestible maltodextrin has completely different properties from dextrin. Dextrin is a general term for polysaccharides with a smaller molecular weight than starch, and is difficult to use in large quantities in foods due to its high viscosity and strong off-flavor and odor. Therefore, the composition of the present invention does not contain dextrin, and thus does not cause the problem of off-flavor caused by dextrin. Indigestible maltodextrin has completely different properties from cyclodextrin. Cyclodextrin is a ring-shaped oligosaccharide produced by enzyme treatment, in which 6 to 12 glucose units are each linked by α-1,4 glycosidic bonds. Such cyclodextrin has the problem of easily precipitating crystals at low temperatures when dissolved in liquid and becoming cloudy, making it difficult to use in large quantities in foods. In addition, indigestible maltodextrin usually has a DE of about 1 to 20, which is different from isomaltooligosaccharide, which is made by breaking down starch into maltose units and then transferring glucose to maltose via alpha-1,6 bonds. Isomaltooligosaccharide has a DE value of more than 20 to about 55, an average molecular weight of about 1,000 or less, and an oligosaccharide in which the sum of DP1 saccharides (monosaccharides) and DP2 saccharides (disaccharides) exceeds 10% and is 60% by weight based on 100% by weight of the total sugar solids content. It has low viscosity and low dietary fiber content (about less than 5% by weight), and therefore cannot be used as a functional raw material for health functional foods and foods with functional claims.

[0039] According to the manufacturing standards for indigestible maltodextrin specified in the Standards and Specifications for Korean Health Functional Foods, indigestible maltodextrin refers to corn starch that is obtained by heating it, enzymatically decomposing it with α-amylase (from Bacillus subtilis or Bacillus licheniformis) and amyloglucosidase (from Aspergillus niger), and refining it, and then fractionating the indigestible components to make it suitable for consumption. In addition, in the case of indigestible maltodextrin, if it is not in liquid form as a functional raw material for health functional foods, it must contain at least 85% of dietary fiber, and if it is in liquid form, it must contain at least 58%.

[0040] In the present specification, indigestible maltodextrin can be used without limitation as long as the dietary fiber content is above a certain level. For example, indigestible dextrin means dextrin containing 55% (w / w) to 99% (w / w) of dietary fiber, which is obtained by fractionating the indigestible component from the enzymatically decomposed and purified roasted dextrin. Preferably, the dietary fiber content may be 850 mg / g or more in the case of powder, and 580 mg / g or more in the case of liquid. The dietary fiber content can be analyzed by a soluble dietary fiber quantitative method using liquid chromatography (HPLC) among the dietary fiber analysis methods in the Food Code.

[0041] The composition according to the present invention may have a daily intake of 2 g to 50 g or 4 to 30 g as indigestible maltodextrin dietary fiber.

[0042] A composition for improving muscle strength or preventing, improving, or treating sarcopenia can be manufactured as a health functional food composition. When the composition of the present invention is manufactured as a health functional food composition, it includes ingredients typically added during food manufacturing, such as proteins, carbohydrates, fats, nutrients, and seasonings.

[0043] The composition for improving muscle strength or preventing, improving or treating sarcopenia, comprising indigestible maltodextrin according to the present invention, provides a food composition for improving muscle function such as increasing exercise capacity, increasing muscle strength or increasing muscle mass, a food composition for improving or preventing sarcopenia or a pharmaceutical composition for treating or preventing sarcopenia, using a natural substance that is safe for consumption by patients with sarcopenia or the elderly and can be taken for a long period of time.

[0044] Figure 1 is an overall experimental plan for animal model construction and dietary administration experiment according to an example of the present invention.

[0045] Figures 2 and 3 are results showing an increase in limb muscle strength in mice by administration of indigestible maltodextrin using a limb hanging test method according to an example of the present invention.

[0046] Figures 4 and 5 are results showing changes in muscle endurance of mice due to administration of indigestible maltodextrin through a treadmill test according to an example of the present invention.

[0047] Figures 6 and 7 are results showing changes in skeletal muscle mass of experimental animals administered indigestible maltodextrin according to an example of the present invention.

[0048] Figures 8 and 9 are results showing changes in the hind limb muscle mass of experimental animals administered indigestible maltodextrin according to an example of the present invention.

[0049] Figure 10 is a result showing changes in the mRNA expression level of the PI3K / Akt / mTOR pathway due to administration of indigestible maltodextrin according to an example of the present invention.

[0050] Figure 11 is a result showing changes in the mRNA expression levels of Myf5, MyoD, MEF2, and Myogenin due to administration of indigestible maltodextrin according to an example of the present invention.

[0051] Figure 12 is a result showing changes in the mRNA expression levels of FNDC5, LIF, and Metrnl due to administration of indigestible maltodextrin according to an example of the present invention.

[0052] The present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not intended to be limited to the following examples.

[0053]

[0054] Preparation Example 1: Establishing an Animal Model of Sarcopenia Using Aged Mice

[0055] The overall schedule for the animal model construction and dietary administration experiment in this experiment is shown in Figure 1.

[0056] Specifically, aged 18-month-old male C57BL / 6 mice were divided into five groups and acclimated to the experimental environment for one week. To induce sarcopenia due to aging, the experiment was conducted for 12 weeks. Additional aging was induced in the following examples, and the experimental group was used as an animal model. Muscle tissue was obtained through dissection at the end of the experiment and used for muscle-related biomarker analysis.

[0057]

[0058] Example 1: Regular diet intake and administration of resistant maltodextrin (SCD + NMD)

[0059] The test animals of Preparation Example 1 were fed a standard chow diet for 12 weeks, and indigestible maltodextrin (5.83 mg / 35 g of body weight) dissolved in distilled water was orally administered daily. Water was allowed to be consumed freely during the experimental period. Through this example, the effect of indigestible maltodextrin on sarcopenia worsening due to aging was confirmed. The indigestible maltodextrin (Samyang Corporation product) used was a product having a dietary fiber content of 85 wt% or more, 43% of α-1,4 linkages, 25% of α-1,6 linkages, 16% of α-1,3 linkages, and 16% of α-1,2 linkages.

[0060]

[0061] Example 2: High-fat diet and administration of resistant maltodextrin (HFD + NMD)

[0062] The test animals of Preparation Example 1 were fed a high-fat diet (60% high-fat diet) in which 60% of the total energy source was fat for 12 weeks, and indigestible maltodextrin (5.83 mg / 35 g of body weight) dissolved in distilled water was administered orally daily. Through this example, the effect of indigestible maltodextrin on sarcopenia accelerated by obesity induced by a high-fat diet was confirmed.

[0063]

[0064] Comparative Example 1: Normal Diet (SCD) Intake

[0065] The animal model of Preparation Example 1 was fed the standard chow diet of Example 1 for 12 weeks, and the same amount of distilled water as in Experimental Example 1 was administered orally every day.

[0066]

[0067] Comparative Example 2: High-fat diet (HFD) intake

[0068] The animal model of Preparation Example 1 was fed the high-fat diet (60% high-fat diet) of Example 2 for 12 weeks, and the same amount of distilled water as in Experimental Example 2 was orally administered daily.

[0069]

[0070] Test Example 1: Exercise Performance Assessment

[0071] (1) Analysis of limb muscle strength through hanging (four-limb hanging test)

[0072] For the experimental animals of Examples 1 and 2 and Comparative Examples 1 and 2, a four-limb hanging test was performed to measure changes in limb muscle strength.

[0073] Specifically, the mouse was placed on a 30 x 30 cm wire mesh plate (diameter < 0.5 cm) and turned over, and the time the mouse spent hanging upside down using its limbs was measured. A rest period of 30 minutes or more was given between measurements, and a total of three measurements were taken. The experiment was conducted in weeks 1, 2, 4, 6, 8, 10, 11, and 12 of a total 12-week test period. Using the limb hanging test, the results of the limb muscle strength test of mice administered with indigestible maltodextrin were obtained as the average values ​​of the experimental animals included in each group, and are shown in Figs. 2 and 3 and Table 1 below.

[0074] Experimental parking Comparative example 1 (SCD) Example 1 (SCD + NMD) Comparative example 2 (HFD) Example 2 (HFD + NMD) 120.826.520.929.4257.245.826.339.7478.783.239.646.9698.9121.143.167.78102.3158.645.071.410114.6194.725.681.011104.2209.425.362.81293.7207.811.860.9

[0075] In FIGS. 2 and 3, compared to Comparative Example 1 or 2 in which indigestible maltodextrin was not administered, the hanging time of the mice of Example 1 or 2, which were orally administered indigestible maltodextrin together with a normal diet or a high-fat diet, significantly increased. Therefore, this is a result showing an increase in limb muscle strength of the mice due to oral administration of indigestible maltodextrin.

[0076]

[0077] (2) Analysis of muscular endurance through long-distance running (treadmill test)

[0078] For the experimental animals of Examples 1 and 2 and Comparative Examples 1 and 2, a treadmill test was performed to measure changes in muscle endurance.

[0079] Specifically, the total distance (m) run by the experimental animals until exhaustion was measured and compared on a 6-lane treadmill. During the initial adaptation period, a weak current was applied to the grid to prevent them from deviating from the rail, and they were trained to run under conditions of a 0-degree incline and a speed of 10 m / min. When measuring, running was started under conditions of a 0-degree incline and a speed of 8 m / min, and the incline and speed were increased by 2 degrees and 2 m / min every 5 minutes. The muscular endurance results were derived by converting the distance run until they stopped running and stayed on the grid with the current flowing for 15 seconds. The experiment was conducted in weeks 1, 2, 4, 6, 8, 10, 11, and 12 of the total 12-week test period. The changes in muscle endurance of mice administered indigestible maltodextrin through the treadmill test are shown in Figures 4 and 5 and Table 2.

[0080] Experimental parking Comparative example 1 (SCD) Example 1 (SCD + NMD) Comparative example 2 (HFD) Example 2 (HFD + NMD) 1327.7321.9329.4343.82279.4291.0235.8248.54232.8227.9188.0191.76199.6264.8161.0148.48153.8390.0133.6150.210156.3387.175.5174.011125.7348.448.4183.21286.1313.820.7128.0

[0081] In FIGS. 4 and 5, the total running distance of mice of Example 1 or 2, which were orally administered with indigestible maltodextrin together with a normal diet or a high-fat diet, significantly increased compared to Comparative Example 1 or 2, which were not administered with indigestible maltodextrin. This is a result showing an increase in the muscle endurance of mice due to oral administration of indigestible maltodextrin.

[0082]

[0083] Test Example 2: Skeletal Muscle Mass Assessment

[0084] (1)Dual Energy X-ray Absorptiometry Analysis

[0085] For the experimental animals of Examples 1 and 2 and Comparative Examples 1 and 2, dual energy X-ray absorptiometry analysis was performed using Inalyzer (Medikors, USA) before sacrificing the mice to measure changes in skeletal muscle mass.

[0086] The results of the analysis of changes in skeletal muscle mass in experimental animals administered the above-mentioned indigestible maltodextrin are shown in Figures 6 and 7 and Table 3. In Table 3 below, skeletal muscle mass is calculated as the ratio of skeletal muscle mass to total mass and expressed as a %.

[0087] Item Comparison Example 1 (SCD) Example 1 (SCD + NMD) Comparison Example 2 (HFD) Example 2 (HFD + NMD) Skeletal muscle mass (%) 65.570.244.752.1

[0088] In FIGS. 6 and 7, it was confirmed that the skeletal muscle mass of the mice of Example 1 or 2, which were orally administered with indigestible maltodextrin along with a normal diet or a high-fat diet, significantly increased compared to the skeletal muscle mass of the mice of Comparative Example 1 or 2, which were not administered with indigestible maltodextrin. This shows that oral administration of indigestible maltodextrin results in an increase in skeletal muscle mass.

[0089]

[0090] (2) Measurement of hind leg muscle tissue weight

[0091] For the experimental animals of Examples 1 and 2 and Comparative Examples 1 and 2, the muscle mass of the hind-limb muscles was analyzed. In a more detailed experimental method, after the 12-week indigestible maltodextrin intake experiment was completed, the test animals were sacrificed, dissected, and hind-limb muscle tissues were obtained, and the weight of the muscle tissues was measured. The types of hind-limb muscles measured in the test examples were the gastrocnemius (GAS), a type of white muscle that affects maximum muscle force generation, and the soleus (SOL), a type of red muscle that affects muscle endurance.

[0092] The results of the analysis of the hind limb muscles of experimental animals administered the above-mentioned indigestible maltodextrin are shown in Table 4, Figures 8 and 9. Table 4 below shows the average value of the weight % of the hind limb muscles of the experimental animals in each group compared to their body weight.

[0093] Item Comparative Example 1 (SCD) Example 1 (SCD + NMD) Comparative Example 2 (HFD) Example 2 (HFD + NMD) Gastrocnemius (GAS) Weight % 0.45 5 0.5 3 5 0.3 5 8 0.4 3 4 Soleus (SOL) Weight % 0.01 9 0.02 9 0.01 6 0.02 4

[0094] In FIGS. 8 and 9, it was confirmed that the weight of hind limb muscles in mice of Example 1 or 2, which were orally administered with indigestible maltodextrin along with a normal diet or a high-fat diet, significantly increased compared to the weight of hind limb muscles in mice of Comparative Example 1 or 2, which were not administered with indigestible maltodextrin. This shows that oral administration of indigestible maltodextrin increases hind limb muscle mass.

[0095]

[0096] Test Example 3: Confirming the expression level of muscle-related factors

[0097] To compare the expression levels of muscle-related factors in the experimental animals of Examples 1 and 2 and Comparative Examples 1 and 2, the expression levels of mRNA in the gastrocnemius muscle tissue were measured. To this end, RNA was isolated from the muscle tissue, cDNA was synthesized using reverse transcriptase, and real-time quantitative PCR analysis was performed.

[0098] Specifically, gastrocnemius (GAS) tissues from aged mice were obtained and tissue RNA was extracted according to the user protocol of the RNeasy mini kit (Qiagen, Germany). The extracted RNA was synthesized into cDNA using a cDNA synthesis kit (Takara, Japan) and real-time PCR quantitative analysis was performed. Real-time PCR quantitative analysis was performed using QuantStudioTM 3 Real-time PCR Instrument (Applied Biosystems, USA). The primer sequences of the genes used in the analysis are shown in Table 5 below.

[0099] Target gene설명Nucleotide sequenceSEQ ID NOPi3KForward (5′-3′)CTGGGGGACATACTGACTGT1Pi3KReverse (5′-3′)GTTCCTGGAAAGTCTCCCCTC2AktForward (5′-3′)ACTCATTCCAGACCCACGAC3AktReverse (5′-3′)CCGGTACACCACGTTCTTCT4mTORForward (5′-3′)ATTCAATCCATAGCCCCGTC5mTORReverse (5′-3′)TGCATCACTCGTTCATCCTG6S6K1Forward (5′-3′)TGAGTCAAGCCTTGGTCGAG7S6K1Reverse (5′-3′)AAGAGTCGAGAGAGACGCCC8Myf5Forward (5′-3′)AACCAGAGACTCCCCAAGGT9Myf5Reverse (5′-3′)AGCTGGACACGGAGCTTTTA10MyoDForward (5′-3′)TGGGATATGGAGCTTCTATCGC11MyoDReverse (5′-3′)GGTGAGTCGAAACACGGATCAT12MEF2Forward (5′-3′)CAGGCGCTATGGGTCATCTG13MEF2Reverse (5′-3′)GCTACTTGGATTGCTGAACTGC14MyogeninForward (5′-3′)AGCATCACGGTGGAGGATATG15MyogeninReverse (5′-3′)CAGTTGGGCATGGTTTCGT16FNDC5Forward (5′-3′)GAGGTGCTGATCATCGTCGT17FNDC5Reverse (5′-3′)GAGCAAGCACTGAAAGGGTTT18LIFForward (5′-3′)CAAGAATCAACTGGCACAGC19LIFReverse (5′-3′)AGTGGGGTTCAGGACCTTCT20MetrnlForward (5′-3′)CTGGAGCAGGGAGGCTTATTT21MetrnlReverse (5′-3′)GGACAACAAAGTCACTGGTACAG22

[0100]

[0101] (1) Expression of factors that induce growth and differentiation of muscle cells

[0102] For the experimental animals of Examples 1 and 2 and Comparative Examples 1 and 2, the expression levels of signaling pathway factors involved in muscle cell growth and differentiation were confirmed. The PI3K / Akt / mTOR pathway induces muscle cell growth and differentiation, and the S6K1 factor is known to be a factor that stimulates protein synthesis through this pathway. The changes in the mRNA expression levels of the PI3K / Akt / mTOR pathway due to the administration of the above-mentioned indigestible maltodextrin are shown in Table 6 and Fig. 10.

[0103] Comparative Example 1 (SCD) Example 1 (SCD + NMD) Comparative Example 2 (HFD) Example 2 (HFD + NMD)PI3K1.004.490.843.63Akt1.002.550.331.31mTOR1.002.570.351.29S6K11.002.070.751.56Myf51.005.210.423.53MyoD1.002.0 90.641.89MEF21.002.860.511.62Myogenin1.006.130.441.50FNDC51.001.750.682.21LIF1.002.650.572.59Metrnl1.003.680.312.60

[0104] In Fig. 10 and Table 6, it was confirmed that the mRNA expression level of PI3K / Akt / mTOR signaling factors in the mice of Example 1 or 2, which were orally administered with indigestible maltodextrin along with a normal diet or a high-fat diet, significantly increased compared to the mRNA expression level in the mice of Comparative Example 1 or 2, which were not administered with indigestible maltodextrin. This shows that oral administration of indigestible maltodextrin increases the expression of signaling factors that affect the induction of muscle cell growth and differentiation.

[0105]

[0106] (2) Expression of muscle-building factors

[0107] The expression levels of factors affecting muscle production were determined for the experimental animals of Examples 1 and 2 and Comparative Examples 1 and 2. Muscle production is influenced by myogenic regulatory factors such as Myf5, MyoD, MEF2, and Myogenin during the differentiation of myoblasts into muscle fibers. Changes in the mRNA expression levels of Myf5, MyoD, MEF2, and Myogenin due to administration of the indigestible maltodextrin are shown in Table 6 and Figure 11.

[0108] In Fig. 11, it was confirmed that the mRNA expression levels of Myf5, MyoD, MEF2, and Myogenin in the mice of Example 1 or 2, which were orally administered with indigestible maltodextrin along with a normal diet or a high-fat diet, significantly increased compared to the mRNA expression levels in the mice of Comparative Example 1 or 2, which were not administered with indigestible maltodextrin. This shows that oral administration of indigestible maltodextrin increases the expression of myogenic regulatory factors that affect the production of muscle fibers.

[0109]

[0110] (3) Expression of myokine factors

[0111] The expression levels of myokine factors were determined for the experimental animals of Examples 1 and 2 and Comparative Examples 1 and 2. Myokines are hormones released from skeletal muscle cells and act not only on muscle tissue but also on other organs. Among them, FNDC5 is a precursor of irisin and its expression level increases during exercise, inducing muscle hypertrophy. Meanwhile, LIF increases the size of the gastrocnemius (GAS) and promotes muscle regeneration. Metrnl also promotes muscle regeneration and plays a role in transmitting the results obtained through mitochondrial biogenesis to other tissues. The changes in the mRNA expression levels of FNDC5, LIF, and Metrnl due to the administration of the above-mentioned indigestible maltodextrin are shown in Table 6 and Figure 12.

[0112] In Fig. 12, it was confirmed that the mRNA expression levels of FNDC5, LIF, and Metrnl in the mice of Example 1 or 2, which were orally administered with indigestible maltodextrin along with a normal diet or a high-fat diet, significantly increased compared to the mRNA expression levels in the mice of Comparative Example 1 or 2, which were not administered with indigestible maltodextrin. This is a result showing that oral administration of indigestible maltodextrin increases myokines.

Claims

1. A composition containing indigestible maltodextrin for improving muscle strength or preventing, improving or treating sarcopenia.

2. A composition according to claim 1, wherein the sarcopenia is at least one selected from the group consisting of muscular atrophy, muscular weakness, muscular dystrophy, muscular rigidity, hypotonia, muscular weakness, muscular dystrophy, amyotrophic lateral sclerosis, and myasthenia gravis.

3. A composition according to claim 1, wherein the sarcopenia is sarcopenia caused by aging, obesity, or aging and obesity.

4. In the first paragraph, the composition is a composition that increases muscle mass or prevents muscle loss.

5. In paragraph 1, the composition has at least one characteristic selected from the group consisting of the following characteristics (1) to (3): (1) Induction of growth and differentiation of muscle cells; (2) Increased expression of myogenic regulatory factors, and (3) Increased expression of myokine factors.

6. In paragraph 5, the factor related to the induction of growth and differentiation of the muscle cells is at least one selected from the group consisting of PI3K, Akt, mTOR and S6K1. The above-mentioned myogenic regulatory factors are at least one selected from the group consisting of Myf5, MyoD, MEF2 and Myogenin, or A composition wherein the above myokine factor is at least one selected from the group consisting of FNDC5, LIF, and Metrn1.

7. A composition according to claim 1, characterized in that the composition further comprises a food additive acceptable from a food science perspective.

8. In paragraph 1, the composition is a food composition that is a special medical food such as a beverage, a dairy product, an edible granule, a paste, a seasoning, a retort food, a fermented food, a preserved food, a processed fishery product, a processed meat product, a processed grain product, a food additive, a health functional food, a food for patients, or an animal feed.

9. In the first paragraph, the composition comprises 2 g to 50 g of indigestible maltodextrin dietary fiber as a daily intake.

10. In the first paragraph, the indigestible maltodextrin is a composition provided as a starch hydrolysate containing indigestible maltodextrin.

11. In the first paragraph, the indigestible maltodextrin is a composition having at least one characteristic selected from the group consisting of the following (a) to (c): (a) DE (dextrose equivalent) value is 1 to 20, (b) the content of monosaccharides and disaccharides is less than 10 wt%, and (c) The proportion of α-1,6 glycosidic bonds among the total glycosidic bonds is 20 to 40%.

12. A composition according to claim 1, wherein the indigestible maltodextrin has an α-1,6 glycosidic bond ratio of 20 to 40% among the total glycosidic bonds.

13. A composition according to claim 1, wherein the indigestible maltodextrin has an α-1,2 glycosidic bond ratio of 5 to 25% and an α-1,3 glycosidic bond ratio of 10 to 30% among the total glycosidic bonds.

14. A composition according to claim 1, wherein the indigestible maltodextrin has an α-1,6 glycosidic bond ratio of 20 to 40%, an α-1,2 bond ratio of 5 to 25%, an α-1,3 bond ratio of 10 to 30%, and an α-1,4 glycosidic bond ratio of 30 to 50% among the total glycosidic bonds.

Images