Mutant enzyme for producing kestose with high yield
A mutant β-fructofuranosidase enzyme with targeted amino acid mutations enhances kestose production efficiency by reducing by-product formation, addressing the challenges of kestose separation and crystallization in industrial fructooligosaccharide production.
Patent Information
- Application Number
- PCT/KR2024/021170
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-29
- Filing Date
- 2024-12-26
- Publication Date
- 2025-07-03
AI Technical Summary
Existing methods for producing fructooligosaccharides, particularly kestose, face challenges in achieving high conversion rates and low by-product production, leading to inefficient and costly purification processes due to the difficulty in separating and crystallizing kestose from by-products like nystose, limiting its industrial application.
A mutant enzyme with specific amino acid mutations, derived from β-fructofuranosidase, is developed to enhance kestose conversion rates and reduce by-product formation, specifically targeting enzymes like Aspergillus niger-derived β-fructofuranosidase, optimized for expression in Pichia pastoris, achieving high kestose content and low nystose production.
The mutant enzyme achieves a high kestose content of up to 57.97 wt% with minimal nystose content of less than 5 wt%, significantly improving the efficiency and cost-effectiveness of kestose production.
Smart Images

Figure KR2024021170_03072025_PF_FP_ABST
Abstract
Description
A mutant enzyme that produces high levels of kestose
[0001] The present invention relates to a mutant enzyme for producing kestose having a high kestose conversion rate and a low by-product production rate, a strain expressing the enzyme, and a method for producing kestose using the enzyme or strain, thereby providing a method for reducing the cost of purifying kestose and producing high-purity kestose.
[0002] Fructooligosaccharide (FOS) is an oligosaccharide with 1 to 3 fructose units added to sugar. It exists in small quantities in nature in burdock, asparagus, and honeybees. Industrially, it refers to a mixed sugar of oligosaccharides composed of kestose (sugar + fructose, GF2), nystose (sugar + fructose + fructose, GF3), and fructosylnystose (sugar + fructose + fructose + fructose, GF4), which are manufactured by reacting sugar with fructofuranosidase in the Meiji period of Japan.
[0003] Fructooligosaccharides are listed as a health functional food, possessing functions such as a prebiotic that promotes the growth of beneficial bacteria like Bifidobacterium, promoting intestinal health, and promoting calcium absorption. As the high-calorie and high-blood-sugar side effects of sugar become increasingly apparent in modern society, interest in fructooligosaccharides, a sugar-derived ingredient that is low in calories and does not cause blood sugar spikes, is growing.
[0004] Industrial production of FOS is currently carried out according to two strategies: partial hydrolysis of inulin or enzymatic synthesis from sucrose using β-fructofuranosidases with high transfructosylase activity or FTF produced mainly by fungi (Aspergillus niger, A. japonicus, A. oryzae, A. aculeatus and Aureobasidium pullulans). These two technologies produce FOS mixtures with a degree of polymerization (DP) varying from 2 to 10 and mainly composed of 1-kestose (GF2), nystose (GF3), fructosylnytose (GF4), bifructose (GF3), inulobiose (F2), inulotriose (F3) and inulotetraose (F4). From a commercial point of view, 1-kestose is the most valuable FOS due to its dual importance as a natural prebiotic sweetener and as a useful low-calorie sweetener as a sugar substitute for diabetics.
[0005] However, fructooligosaccharides are highly hygroscopic and cannot be manufactured into a crystalline form like sugar, which limits their application in products such as chocolate where crystalline sugar is used. Fungal beta-fructofuranosidase, an enzyme that produces fructooligosaccharides from sugar, is characterized by high transfer activity and low production of isomers, but its selectivity for oligosaccharide production is not as high as that of plant-derived sugar (sucrose): sucrose fructosyl transferase (SST), which only produces 1-kestose, and can only produce a mixture of oligosaccharides with a degree of polymerization of 2 to 6. Therefore, fructooligosaccharides are used as liquids (syrups) or powders, and because these are non-crystalline mixtures, they have problems such as high moisture absorption and poor processability compared to crystalline food ingredients such as sugar (sucrose).
[0006] Among fructooligosaccharide components, kestose has been reported to be capable of being manufactured into a sugar-like crystal form, overcoming these shortcomings of fructooligosaccharides. Because kestose exhibits physical crystalline properties similar to sugar, it can be developed into a sugar substitute formulation. Furthermore, it has been reported to possess physiological properties, such as atopy reduction and suppression of blood sugar elevation, in addition to the existing functional properties of fructooligosaccharides.
[0007] Since the existing fructooligosaccharides contain GF3, which cannot be crystallized, in the same ratio as GF2, the yield was bound to be low during the crystallization process. In the case of mass production of 1-kestose in fructooligosaccharides, nystose or 1-F-fructofuranosylnystose, which are converted together with 1-kestose, have similar physical properties to 1-kestose, making it very difficult to separate and purify them. Therefore, in order to produce large quantities industrially efficiently, an enzyme that selectively converts 1-kestose in excess compared to the above two components or a strain having the enzyme is needed to produce 1-kestose efficiently.
[0008] β-Fructofuranosidase is an enzyme that recognizes the fructose in sucrose and hydrolyzes sucrose into fructose and glucose (sucrose hydrolysis activity). Among β-fructofuranosidases, there are also those that convert fructose produced by hydrolysis into sucrose (fructose transfer activity) and produce kestose, a trisaccharide formed by combining one molecule of glucose and two molecules of fructose.
[0009] When producing kestose using β-fructofuranosidase, the tetrasaccharide nystose is usually produced as a by-product. Nystose is difficult to separate from kestose by chromatography, and tends to remain in the reaction solution even after a chromatographic separation and purification process. Furthermore, a certain amount of nystose present in the solution inhibits the crystallization of kestose during the crystallization process. For this reason, reducing the production of nystose is necessary for the efficient production of kestose. Therefore, a β-fructofuranosidase that produces a low rate of by-products such as nystose and can efficiently produce kestose is in demand.
[0010] The purpose of the present invention is to provide an enzyme protein for producing kestose having a high kestose conversion rate and a low by-product production rate, a nucleic acid molecule encoding the enzyme protein, a recombinant vector comprising the nucleic acid molecule, or a transformant comprising the nucleic acid molecule or the recombinant vector.
[0011] Another object of the present invention is to provide a composition for producing a sugar conversion product including kestose from a substrate including sucrose, the composition including at least one selected from the group consisting of the enzyme protein, the recombinant microorganism, cells of the microorganism, cell lysates of the microorganism, cultures of the microorganism, supernatants obtained from the cultures, and extracts thereof.
[0012] Another object of the present invention is to provide a method for producing a sugar conversion product containing kestose with a high conversion rate and high content by reacting at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, and an extract thereof with a substrate containing sucrose.
[0013] Another object of the present invention is to provide a sugar-converting composition (e.g., fructooligosaccharide) comprising a high content of kestose (e.g., 1-kestose) produced biologically from a substrate comprising sucrose.
[0014] Another object of the present invention is to provide a recombinant microorganism, such as yeast and mold, expressing an enzyme having a high kestose conversion rate and a low by-product production rate.
[0015] Another object of the present invention is to provide a use for producing a sugar conversion product including kestose from a substrate including sucrose, a composition including at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, cells of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, and extracts thereof.
[0016] Another object of the present invention is to provide a use for producing a composition for producing a sugar conversion product including kestose from a substrate including sucrose of the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, or an extract thereof.
[0017] The present invention relates to an enzyme for producing kestose having a high kestose conversion rate and a low by-product production rate, an enzyme protein comprising the amino acid sequence of the enzyme, a nucleic acid molecule encoding the enzyme protein, a recombinant vector comprising the nucleic acid molecule, a recombinant microorganism expressing the enzyme, and a method for producing kestose using the enzyme protein and / or the recombinant microorganism.
[0018] The method for producing kestose according to the present invention relates to a method for producing highly pure kestose while reducing the cost of purifying kestose. The enzyme is a mutant enzyme of beta-fructofuranosidase (FFase), and the beta-fructofuranosidase (FFase) typically includes a polypeptide encoded by the fopA gene. An example of the polypeptide encoded by the fopA gene may include a signal peptide of SEQ ID NO: 2, or may be a mature protein that does not include a signal peptide of SEQ ID NO: 1.
[0019] Specifically, the present inventors studied the improvement of FFase to maximize the ratio of kestose (GF2) and nystose (GF3) in the FOS conversion reaction by FFase, and through this, developed a technology for mass production of kestose. In addition, by introducing the gene encoding the mutant enzyme into a strain of the genus Pichia, which mainly belongs to the yeast family, an enzyme capable of producing high amounts of kestose was produced.
[0020]
[0021] Hereinafter, the present invention will be described in more detail.
[0022] Mutant enzyme protein having β-fructofuranosidase activity
[0023] The enzyme protein according to the present invention having a high kestose conversion rate and a low by-product production rate can be produced by introducing a mutation in at least one amino acid at a specific position in an amino acid sequence including an amino acid sequence having 90% or more sequence identity or homology with the amino acid sequence of a β-fructofuranosidase enzyme protein, for example, the amino acid sequence of SEQ ID NO: 1, and the mutation is preferably an amino acid substitution.
[0024] Specifically, an amino acid mutation is a deletion, substitution, insertion or addition of one or more amino acids, and the number of amino acids to be deleted, substituted, inserted or added may be, for example, 1 to 200, 1 to 180, 1 to 160, 1 to 140, 1 to 120, 1 to 100, 1 to 80, preferably 1 to 60, more preferably 1 to 50, even more preferably 1 to 40, and even more preferably 1 to 30.
[0025] According to an example of the present invention, a beta-fructofuranosidase enzyme protein may be derived from a peptide including an amino acid sequence of SEQ ID NO: 3 derived from an Aspergillus genus strain (specifically, Aspergillus niger) (Accession No. KCTC13139 BP). The amino acid sequence of SEQ ID NO: 3 is a mature form of the beta-fructofuranosidase enzyme protein excluding the signal sequence (MKLTTTTLALATGAAAAEA) consisting of 19 amino acids, and may be an immature protein derived from the strain and having the amino acid sequence of the enzyme protein including the signal peptide shown in SEQ ID NO: 4. Aspergillus niger, from which the prototype enzyme protein is derived, is a strain that was deposited with the KCTC on October 28, 2016 and assigned the accession number KCTC 13139BP.
[0026] The enzyme protein according to the present invention may have one or more amino acids mutated, for example substituted, in an amino acid sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 1, and may have β-fructofuranosidase activity. Preferably, the enzyme protein has a high kestose conversion rate and a low by-product production rate.
[0027] The present invention provides an enzyme protein having β-fructofuranosidase activity, comprising an amino acid sequence in which an amino acid corresponding to at least one amino acid selected from the group consisting of the 62nd, 220th, 313th, 329th, and 440th amino acids from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is mutated.
[0028] In a specific example, the enzyme protein may have an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.3%, or 99.5% sequence identity or homology with the amino acid sequence of SEQ ID NO: 1, and may include an amino acid sequence in which an amino acid corresponding to one or more amino acids selected from the group consisting of the 62nd, 220th, 313th, 329th, and 440th amino acids from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is mutated, and has β-fructofuranosidase activity, and preferably has a high kestose conversion rate and a low by-product production rate. Such a comparison of identity and homology can be performed by calculating the identity and homology between two or more sequences as a percentage (%) using a commercially available computer program. The above enzyme protein may be an enzyme protein excluding an enzyme protein comprising the amino acid sequence of sequence number 1.
[0029] It is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, or added is also included within the scope of the present application, as long as it has the identity or homology mentioned in the present invention and exhibits an activity corresponding to the enzyme protein. That is, even if the present application describes "a protein having or including an amino acid sequence described by a specific sequence number," it is obvious that a protein having (or including) an amino acid sequence in which some sequences are deleted, modified, substituted, or added can also be used in the present application, as long as it has the same or corresponding activity as a protein consisting of the amino acid sequence of the corresponding sequence number.
[0030] In the present invention, the "corresponding amino acid" refers to an amino acid residue at a corresponding position in an enzyme protein having β-fructofuranosidase activity, or an amino acid residue that is similar, identical, or homologous to the amino acid residue at that position. Identifying the amino acid at the corresponding position may determine a specific amino acid of a sequence that references a specific sequence. In the present invention, the "corresponding position" generally refers to a similar or corresponding position in the amino acid sequence of a related protein or a reference sequence. For example, any amino acid sequence may be aligned with SEQ ID NO: 3, and based on this, each amino acid residue of the amino acid sequence may be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 3. For example, the position of the corresponding amino acid, or the position where a modification such as a substitution, insertion, or deletion occurs, may be identified by comparing it with a query sequence (also referred to as a "reference sequence") using a sequence alignment algorithm known in the art.
[0031] The above amino acid mutation position is based on the amino acid sequence of SEQ ID NO: 1, which is the mature form, and may be the 81st, 239th, 332nd, 348th or 459th amino acid based on the amino acid sequence of SEQ ID NO: 2, which is the immature form of the enzyme protein including the signal peptide.
[0032] The above mutant amino acid sequence may be substituted with an amino acid at an amino acid position corresponding to one or more amino acids selected from the group consisting of the 62nd, 220th, 313th, 329th, and 440th amino acids from the N-terminus of the amino acid sequence of SEQ ID NO: 1, for example, the substituted amino acid may be substituted with one or more amino acids selected from the group consisting of tryptophan (Trp; W), alanine (Ala; A), lysine (Lys; K), and threonine (Thr; T).
[0033] In a specific example, the substituted amino acid sequence is at least one (e.g., 1, 2, 3, 4, or 5) selected from the group consisting of a substitution of an amino acid corresponding to the 62nd glycine (Gly; G) from the N-terminus with a tryptophan, a substitution of an amino acid corresponding to the 220th valine (Val; V) with an alanine, a substitution of an amino acid corresponding to the 313th histidine (His; H) with a lysine, a substitution of an amino acid corresponding to the 329th glutamic acid (Glu; E) with a lysine, and a substitution of an amino acid corresponding to the 440th arginine (Arg; R) with a threonine in the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.3%, or 99.5% homology or identity therewith, May include, but is not limited to, 5.
[0034] In one example of the present invention, the enzyme protein may include one or more amino acid substitutions selected from the group consisting of G62W, V220A, H313K, E329K, and R440T in the amino acid sequence of SEQ ID NO: 1.
[0035] In one example of the present invention, the enzyme protein may include one amino acid substitution selected from the group consisting of G62W, V220A, H313K, E329K, and R440T, or two or more amino acid substitutions. For example, the enzyme protein with one amino acid substitution may include G62W, V220A, H313K, E329K, or R440T in the amino acid sequence of SEQ ID NO: 1, and specifically, may include and / or be represented by the amino acid sequence of SEQ ID NO: 6 or SEQ ID NO: 7.
[0036] An enzyme protein with two amino acid substitutions comprises two amino acid substitutions selected from the group consisting of G62W, V220A, H313K, E329K and R440T (e.g., G62W / V220A, G62W / H313K, G62W / E329K, G62W / R440T, V220A / H313K, V220A / E329K, V220A / R440T, H313K / E329K, H313K / R440T or E329K / R440T), an example of an enzyme protein with three amino acid substitutions is G62W / V220A / H313K, G62W / V220A / H313K, G62W / V220A / E329K, It may include G62W / V220A / E329K, G62W / V220A / R440T, G62W / V220A / R440T, G62W / H313K / E329K, G62W / H313K / R440T, V220A / H313K / E329K, V220A / H313K / E329K, V220A / H313K / R440T, etc., and an example of a mutant enzyme including three mutant amino acids may be represented by the amino acid sequence shown in SEQ ID NO: 7 as a peptide corresponding to G62W / H313K / R440T. Examples of enzyme proteins containing four amino acid substitutions include G62W / V220A / H313K / E329K, G62W / V220A / H313K / R440T, G62W / H313K / E329K / R440T, V220A / H313K / E329K / R440T, and an example of a mutant enzyme containing four mutant amino acids may be represented by the amino acid sequence shown in SEQ ID NO: 6 as a peptide corresponding to V220A / H313K / E329K / R440T.
[0037] In one example of the present invention, as a method for increasing a low crystal yield, the content ratio of kestose / nistose (e.g., 1-kestose / nistose) based on the weight % of sugar solid content included in the reaction product, for example, the content ratio in weight % (content ratio) can be increased.
[0038] In one embodiment, the fructooligosaccharide of the present invention can be produced by reacting a reaction substrate (e.g., sugar (sucrose)) with a nucleic acid molecule encoding the enzyme protein and / or a recombinant microorganism expressing the enzyme protein (specifically, a sugar conversion reaction), and can be included in a reaction product and / or conversion product (specifically, a sugar conversion product) produced by the reaction.
[0039] The above reaction (specifically, the sugar conversion reaction) can be carried out at a temperature condition of 30 to 65°C, 30 to 60°C, 30 to 55°C, 30 to 50°C, 30 to 45°C, 35 to 65°C, 35 to 60°C, 35 to 55°C, 35 to 50°C, or 35 to 45°C, for example, 40°C, and at a pH of 4.5 to 8.0, pH 4.5 to 7.5, pH 4.5 to 7.0, pH 5 to 8.0, pH 5 to 7.5, pH 5 to 7.0, pH 5.5 to 8.0, pH 5.5 to 7.5, pH 5.5 to 7.0, pH 6 to 8.0, pH 6 to 7.5, pH 6 to 7.0, pH 6.5 to 8.0, pH 6.5 to 7.5 or pH 6.5 to 7.0, for example, pH 7.0, and / or may be performed for 10 minutes to 3 hours, 10 minutes to 2 hours, 10 minutes to 1 hour, 10 minutes to 40 minutes, 10 minutes to 30 minutes, 20 minutes to 3 hours, 20 minutes to 2 hours, 20 minutes to 1 hour, 20 minutes to 40 minutes, 20 minutes to 30 minutes, for example, 30 minutes, but is not limited thereto.
[0040] The content of nystose and / or fructosylnistose (1-F-fructosyl nystose, GF4) contained in the reaction product and / or conversion product may be less than 10 wt%, less than 9 wt%, less than 8 wt%, less than 7 wt%, less than 6 wt%, less than 5 wt%, for example, 6.91 wt%, 4.13 wt%, 3.74 wt% or 3.38 wt%, based on 100 wt% of the total solid content of sugars in the reaction product and / or conversion product, and may not contain the nystose and / or fructosylnistose, for example, the reaction product and / or conversion product may not contain nystose and fructosylnistose.
[0041] The content ratio (specifically, weight ratio) of kestose / nistose (e.g., 1-kestose / nistose) included in the above reaction product and / or conversion product is 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 3 to 60, 3 to 50, 3 to 40, 4 to 60, 4 to 50, 4 to 40, 5 to 60, 5 to 50, 5 to 40, 6 to 60, 6 to 50, 6 to 40, 7 to 60, 7 to 50, 7 to 40, 8 to 60, 8 to 50, 8 to 40, 9 to 60, 9 to 50, 9 to 40, 10 The ratio may be, but is not limited to, 6.28, 13.01, 13.33 or 17.15, for example, 6.28, 13.01, 13.33 or 17.15, or 10 to 50, 10 to 40, 11 to 60, 11 to 50, 11 to 40, 12 to 60, 12 to 50, 12 to 40, 13 to 60, 13 to 50, 13 to 40, for example, 6.28, 13.01, 13.33 or 17.15. The ratio may be based on the total solids weight % of the sugars included in the conversion product.
[0042] The kestose (e.g., 1-kestose) included in the reaction product and / or conversion product may be included in an amount of 43 to 70 wt%, 43 to 65 wt%, or 43 to 60 wt%, 50 to 70 wt%, for example, 43.37 wt%, 48.67 wt%, 55.06 wt%, or 57.97 wt%, based on 100 wt% of the total solid content of sugars in the reaction product and / or conversion product, but is not limited thereto.
[0043] The content of the above nystose and / or fructosylnistose, the content ratio (specifically, weight ratio) of kestose / nystose (e.g., 1-kestose / nystose) and / or the kestose content may be measured by performing a reaction (specifically, a sugar conversion reaction) of a substrate (e.g., sugar (sucrose)) with a nucleic acid molecule encoding the enzyme protein and / or a recombinant microorganism expressing the enzyme protein, and specifically, may be measured by performing a sugar conversion reaction using an enzyme protein having β-fructofuranosidase activity having 1000 unit activity for sucrose (specifically, a sucrose solution) at a concentration of 250 g / L or 500 g / L. The above reaction may be performed, for example, by mixing 150 mM Mcilvaine buffer (pH 5.0), 250 g / L sucrose substrate solution, and 1000 units of the enzyme protein in a volume ratio of 2:2:1, or 100 mM phosphate buffer (pH 7.0), 500 g / L sucrose substrate solution, and 1000 units of the enzyme protein in a volume ratio of 4:4:1. The enzyme protein used in the above sugar conversion reaction may be in the form of one or more selected from the group consisting of a recombinant microorganism expressing the enzyme protein (specifically, a microorganism of the genus Pichia), a culture of the microorganism, a supernatant obtained from the culture, and an extract thereof.
[0044] The above reaction may be carried out at a temperature condition of 30 to 65°C, 30 to 60°C, 30 to 55°C, 30 to 50°C, 30 to 45°C, 35 to 65°C, 35 to 60°C, 35 to 55°C, 35 to 50°C, or 35 to 45°C, for example, 40°C, and / or for 10 minutes to 3 hours, 10 minutes to 2 hours, 10 minutes to 1 hour, 10 minutes to 40 minutes, 10 minutes to 30 minutes, 20 minutes to 3 hours, 20 minutes to 2 hours, 20 minutes to 1 hour, 20 minutes to 40 minutes, 20 minutes to 30 minutes, for example, 30 minutes.
[0045] According to one embodiment of the present invention, a nucleic acid molecule (e.g., DNA) encoding an enzyme protein according to the present invention, a recombinant vector comprising the same, and / or a transformant comprising the nucleic acid molecule or recombinant vector are provided.
[0046] Another embodiment of the present invention is interpreted to include a nucleic acid molecule encoding the enzyme protein and a sequence that exhibits substantial identity with the nucleotide sequence of the nucleic acid molecule. The substantial identity refers to a nucleotide sequence that exhibits at least 98% identity or homology when the base sequence of the present invention is aligned with any other sequence to the greatest extent possible and the aligned sequence is analyzed using an algorithm commonly used in the art.
[0047] The nucleic acid molecule may be used as is or in the form of a recombinant vector comprising the nucleic acid molecule. The recombinant vector refers to a recombinant nucleic acid molecule comprising a target gene sequence and an appropriate nucleic acid sequence essential for expressing the gene sequence operably linked in a specific host organism, wherein the appropriate nucleic acid sequence may be a transcription and translation terminator, a transcription and translation initiation sequence, and a promoter useful for regulating the expression of a specific target nucleic acid. The vector system may be constructed as a vector for cloning or a vector for expression by various methods well known in the art. An embodiment of a preferred vector according to the present invention may comprise a nucleic acid molecule encoding an enzyme protein according to the present invention and a promoter of a fungus, for example, a promoter of a strain of the genus Pichia or a strain of the genus Aspergillus. An example of a recombinant vector according to the present invention may be a recombinant vector having a cleavage map of FIG. 1 and / or FIG. 2 and / or a vector in which a mutation has occurred in the recombinant vector.
[0048]
[0049] Recombinant microorganism containing a mutant enzyme protein
[0050] Another preferred embodiment of the present invention provides a recombinant microorganism expressing the enzyme protein, which comprises a nucleic acid molecule encoding the enzyme protein or a vector comprising the same, and / or expresses the enzyme protein, specifically, a recombinant microorganism (e.g., yeast and mold) expressing the enzyme protein, which is transformed with a recombinant expression vector comprising a base sequence encoding the enzyme protein.
[0051] Any microorganism known in the art can be used as the above microorganism (specifically, a microorganism to be transformed that can stably and continuously clone and / or express the vector) as long as it can overexpress the active form of the enzyme protein, and is not particularly limited thereto. For example, the microorganism may be at least one of a Pichia strain (e.g., pichia pastoris), an Aspergillus strain (e.g., Aspergillus niger or Aspergillus oryzae), a Saccharomyces strain (e.g., Saccharomyces cerevisiae), and a Yarrowia strain (e.g., Yarrowia lipolytica), and is preferably a Pichia strain, but is not limited thereto.
[0052] Methods for transformation using the above vector are not particularly limited and may include methods known in the art, such as fusion of bacterial protoplasts, electroporation, projectile bombardment, and infection using a viral vector.
[0053] As previously described, the enzyme protein exhibits excellent kestose conversion ability, converting sucrose into kestose, and a low kestose production rate. Therefore, the enzyme protein or a recombinant microorganism expressing the enzyme protein can produce high amounts of kestose.
[0054]
[0055] Composition for producing a sugar conversion product including kestose, including a mutant enzyme protein, and / or method for producing a sugar conversion product including kestose
[0056] Another example of the present invention relates to a composition for producing a transglycosylation product containing kestose (e.g., 1-kestose) from a substrate containing sucrose, the composition comprising at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, cells of the microorganism, cell lysates of the microorganism, cultures of the microorganism, supernatants obtained from the cultures, and extracts thereof, and / or a method for producing a transglycosylation product containing kestose (e.g., 1-kestose) from a substrate containing sucrose. The composition for producing a transglycosylation product containing kestose can be brought into contact with a substrate or medium containing sucrose to produce a high content of kestose. The substrate or medium can contain sucrose in any form that sucrose can have, for example, can contain sucrose solids, and can be in the form of a solution containing sucrose, but is not limited thereto.
[0057] The culture medium contains an enzyme protein produced from the recombinant microorganism, and may be a cell-free form containing the recombinant microorganism or not containing the microorganism. The lysate refers to a lysate obtained by crushing the recombinant microorganism or a supernatant obtained by centrifuging the lysate, and contains an enzyme protein produced from the recombinant microorganism.
[0058] In the present specification, unless otherwise stated, the recombinant microorganism used in the production of Kestos is used to mean at least one selected from the group consisting of cells of the microorganism, cell lysates of the microorganism, cultures of the microorganism, supernatants obtained from the cultures, and extracts thereof. The cells can be obtained by centrifuging, filtration, etc. on the cultures of the microorganisms, and further, the supernatant obtained by homogenizing and centrifuging the obtained cells, or the supernatant can be fractionated, or the enzyme protein can be obtained by separation and purification through chromatography, etc.
[0059] The cultivation of the recombinant microorganism can be carried out under a medium and culture conditions easily selected by a person skilled in the art to which the present invention pertains, depending on the characteristics of the microorganism used. Any culture method known in the art, such as batch, continuous, and fed-batch culture methods, may be used, but is not limited thereto. The medium used for the culture includes any host cell, including Escherichia coli, and any culture medium, solution, solid, semi-solid, or rigid support capable of supporting or containing cell contents.
[0060] In the above production method, when a recombinant microorganism is used, the cell concentration of the strain used may be 0.1 mg (dcw: dry cell weight) / ml or more, for example, 0.1 to 100 mg (dcw) / ml, 0.1 to 50 mg (dcw) / ml, based on the total reaction product.
[0061] In one embodiment, the method for producing a sugar conversion product including the kestose may include a step of reacting at least one selected from the group consisting of a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, and an extract thereof with a substrate including sucrose. The reaction may include, but is not limited to, contacting a medium including sucrose with at least one selected from the group consisting of a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, and an extract thereof.
[0062] In another embodiment, the method for producing a sugar conversion product comprising kestose may comprise a step of reacting a recombinant microorganism expressing the enzyme protein or an enzyme protein isolated from the recombinant microorganism with a substrate comprising sucrose. The method for producing a sugar conversion product comprising kestose may further comprise a step of culturing the recombinant microorganism expressing the enzyme protein and / or recovering the sugar conversion product prior to the reaction step.
[0063] The step of reacting with a substrate containing the above sucrose can preferably be performed under optimal activation conditions of the enzyme protein. That is, it can be performed at a temperature condition of 30 to 65°C, 30 to 60°C, 30 to 55°C, 30 to 50°C, 30 to 45°C, 35 to 65°C, 35 to 60°C, 35 to 55°C, 35 to 50°C, or 35 to 45°C, for example, 40°C, and pH 4.5 to 8.0, pH 4.5 to 7.5, pH 4.5 to 7.0, pH 5 to 8.0, pH 5 to 7.5, pH 5 to 7.0, pH 5.5 to 8.0, pH 5.5 to 7.5, pH 5.5 to 7.0, pH 6 to 8.0, pH 6 to 7.5, pH 6 to 7.0, pH 6.5 to 8.0, pH 6.5 It can be performed at a pH of 7.5 or 6.5 to 7.0, for example, at pH 7.0, and / or can be performed for 10 minutes to 3 hours, 10 minutes to 2 hours, 10 minutes to 1 hour, 10 minutes to 40 minutes, 10 minutes to 30 minutes, 20 minutes to 3 hours, 20 minutes to 2 hours, 20 minutes to 1 hour, 20 minutes to 40 minutes, 20 minutes to 30 minutes, for example, 30 minutes, but is not limited thereto.
[0064] In the method for producing a sugar conversion product including the above kestose, for efficient kestose production, the concentration of sucrose used as a substrate may be 100 to 1,000 g / L, 100 to 900 g / L, 100 to 800 g / L, 100 to 700 g / L, 100 to 600 g / L, 100 to 550 g / L, 200 to 1,000 g / L, 200 to 900 g / L, 200 to 800 g / L, 200 to 700 g / L, 200 to 600 g / L, 200 to 550 g / L, for example, 250 g / L or 500 g / L, based on the total reaction substrate solution, but is not limited thereto. Specifically, the reaction may be performed by mixing, for example, 150 mM Mcilvaine buffer (pH 5.0), 250 g / L sucrose substrate solution and 1000 units of the enzyme protein in a volume ratio of 2:2:1 or 100 mM phosphate buffer (pH 7.0), 500 g / L sucrose substrate solution and 1000 units of the enzyme protein in a volume ratio of 4:4:1. The enzyme protein may refer to at least one selected from the group consisting of a culture of a microorganism in which the reaction is performed, a supernatant obtained from the culture, and extracts thereof, but is not limited thereto.
[0065] Another example provides a method for producing a sugar conversion product including kestose, comprising a step of reacting at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, and an extract thereof with a substrate including sucrose.
[0066] The method for producing a sugar conversion product including the above kestose may further include a step of isolating, recovering, and / or purifying a sugar conversion product including the above kestose from at least one selected from the group consisting of a recombinant microorganism reacted with a substrate including the above sucrose, a cell of the above microorganism, a cell lysate of the above microorganism, a culture of the above microorganism, a supernatant obtained from the culture, and an extract thereof.
[0067] One example of the present invention provides a sugar conversion composition comprising a kestose (e.g., 1-kestose) produced by a biological method from a substrate comprising sucrose, wherein the sugar conversion composition has a content of kestose of 40 wt% or more and a content of nystose of less than 10 wt% based on 100 wt% of the total solid content of sugars included in the sugar conversion composition.
[0068] The above biological method (specifically, the enzymatic method) can produce kestose by reacting at least one selected from the group consisting of an enzyme protein, a nucleic acid molecule encoding the enzyme protein or a vector including the same, and / or a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, and an extract thereof with a substrate, and specifically, it can include a method for producing a sugar conversion product including kestose, and the enzyme protein, the recombinant microorganism containing a nucleic acid molecule encoding the enzyme protein and / or expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, and an extract thereof, the production method, etc. are as described above.
[0069] The content of nystose and / or fructosylnystose (1-F-fructosyl nystose, GF4) included in the above-mentioned sugar conversion product may be less than 10 wt%, less than 9 wt%, less than 8 wt%, less than 7 wt%, less than 6 wt%, or less than 5 wt%, for example, 6.91 wt%, 4.13 wt%, 3.74 wt%, or 3.38 wt%, based on 100 wt% of the total solid content of sugars in the sugar conversion product, and may not include the nystose and / or fructosylnystose, but is not limited thereto.
[0070] The content ratio (specifically, weight ratio) of kestose / nistose (e.g., 1-kestose / nistose) included in the above-mentioned sugar conversion product is 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 3 to 60, 3 to 50, 3 to 40, 4 to 60, 4 to 50, 4 to 40, 5 to 60, 5 to 50, 5 to 40, 6 to 60, 6 to 50, 6 to 40, 7 to 60, 7 to 50, 7 to 40, 8 to 60, 8 to 50, 8 to 40, 9 to 60, 9 to 50, 9 to 40, 10 to 60, 10 to 50, 10 to 40, 11 to 60, 11 to 50, 11 to 40, 12 to 60, 12 to 50, 12 to 40, 13 to 60, 13 to 50, 13 to 40, for example, 6.28, 13.01, 13.33 or 17.15, but is not limited thereto. The above ratio may be based on the total solid weight % of the sugars included in the sugar conversion product.
[0071] Kestose (e.g., 1-kestose) included in the above-mentioned sugar conversion product may be included in an amount of 43 to 70 wt%, 43 to 65 wt%, or 43 to 60 wt%, 50 to 70 wt%, for example, 43.37 wt%, 48.67 wt%, 55.06 wt%, or 57.97 wt%, based on 100 wt% of the total solid content of sugars in the sugar conversion product, but is not limited thereto.
[0072] The content of the above nystose and / or fructosylnystose, the content ratio (specifically, weight ratio) of kestose / nystose (e.g., 1-kestose / nystose) and / or the kestose content may be measured by performing a step of reacting at least one selected from the group consisting of an enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture and an extract thereof with a substrate containing sucrose, and specifically, the substrate containing sucrose may contain sucrose at a concentration of 250 g / L or 500 g / L, and the substance reacted with the substrate may have an activity of 1000 units. The above reaction may be performed by mixing, for example, 150 mM Mcilvaine buffer (pH 5.0), 250 g / L Sucrose substrate solution, and at least one selected from the group consisting of 1000 units of the enzyme protein, a recombinant microorganism expressing the enzyme protein, cells of the microorganism, a lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, and extracts thereof in a volume ratio of 2:2:1, or 100 mM phosphate buffer (pH 7.0), 500 g / L Sucrose substrate solution, and at least one selected from the group consisting of 1000 units of the enzyme protein, a recombinant microorganism expressing the enzyme protein, cells of the microorganism, a lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, and extracts thereof in a volume ratio of 4:4:1.
[0073] The step of reacting with the substrate may be performed under temperature conditions of 30 to 65°C, 30 to 60°C, 30 to 55°C, 30 to 50°C, 30 to 45°C, 35 to 65°C, 35 to 60°C, 35 to 55°C, 35 to 50°C, or 35 to 45°C, for example, 40°C, and / or time conditions of 10 minutes to 3 hours, 10 minutes to 2 hours, 10 minutes to 1 hour, 10 minutes to 40 minutes, 10 minutes to 30 minutes, 20 minutes to 3 hours, 20 minutes to 2 hours, 20 minutes to 1 hour, 20 minutes to 40 minutes, 20 minutes to 30 minutes, for example, 30 minutes.
[0074] The above-mentioned sugar conversion composition comprises kestose, sucrose and glucose, and may further comprise at least one selected from the group consisting of fructose, nystose and fructosylnystose.
[0075] In a preferred embodiment, the sugar conversion composition may additionally comprise 0 to 10 wt% fructose, 10 to 30 wt% glucose, and 10 to 30 wt% sucrose, based on 100 wt% of the composition.
[0076] Another embodiment of the present invention provides a use for producing a sugar conversion product including kestose from a substrate including sucrose, the composition including at least one selected from the group consisting of the enzyme protein, a recombinant microorganism expressing the enzyme protein, cells of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, and extracts thereof.
[0077] Another embodiment of the present invention provides a use for producing a composition for producing a sugar conversion product including kestose from a substrate including sucrose of the enzyme protein, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, or an extract thereof.
[0078] The above enzyme protein, recombinant microorganism, microbial cells, lysates, cultures, supernatants, extracts, production of sugar conversion products, etc. are as described above.
[0079] The present invention relates to an enzyme for producing kestose having a high kestose conversion rate and a low by-product production rate, a strain expressing the enzyme, and a method for producing kestose using the enzyme or strain, thereby providing a method for reducing the cost of purifying kestose and producing high-purity kestose.
[0080] Figure 1 is a cleavage map of a vector containing a β-fructofuranosidase gene without mutation for introducing the fopA gene into a Pichia strain.
[0081] Figure 2 is a cleavage map of a vector containing a β-fructofuranosidase gene mutant enzyme gene for introducing the fopA gene into a Pichia strain.
[0082] Figure 3 is a graph showing the ratio of kestose and nystose in the sugar conversion product produced by a strain into which an FFase gene has been introduced, depending on whether the FFase enzyme gene has been mutated and the location of the mutation.
[0083] The present invention will be described in more detail with reference to the following examples, but the scope of the invention is not intended to be limited to the following examples.
[0084]
[0085] Example 1. Development of a fopA gene acquisition and expression system.
[0086] Example 1-1. Securing the fopA gene of Aspergillus
[0087] In Korean Patent Publication No. 10-2018-0078086, it was confirmed that Aspergillus spp. (Accession No. KCTC13139BP) producing fructooligosaccharides had higher kestose productivity than wild-type Aspergillus spp. Accordingly, the genomic DNA of the Aspergillus spp. with increased productivity was secured, and the fopA (β-fructofuranosidase) gene sequence was confirmed.
[0088] Specifically, gDNA was obtained using a genomic DNA prep kit (Promega) for the cultured cells of the microorganism with the accession number KCTC13139BP, and PCR was performed on the gDNA using the primer pairs of sequence numbers 8 and 9 in Table 1 below, repeating 30 cycles of 94°C for 30 seconds, 60°C for 1 minute, and 72°C for 4 minutes to obtain a fopA gene (beta-fructofuranosidase, FFase) amplification product.
[0089] Primer name sequence (5' -> 3') sequence number FFst-Fgctacggatccgagctccgtcggcgaaaccc8 FFst-Rcgtagcaagcttcccgggccgatgtcttcacag9 FFaseEco-Fgccgtagaattcatgaagctcaccactaccacc10 FFaseEco-Rgctcgagaattctcaatttctctccggccaggc11 mFFaseEco-Fgccgtagaattcatgtcataccacctggacaccac12
[0090] The above-obtained gene amplification product was subjected to restriction enzyme treatment with BamHI / XhoI and ligated to pBluescript SK (+) (Stratagene) to clone the FFase gene, thereby securing the gene. As a result of confirming the sequence of the obtained gene, it was confirmed that the 459th amino acid of the fopA gene was mutated from Arginine to Threonine.
[0091] The amino acid sequence of the β-fructofuranosidase gene (FFase; SEQ ID NO: 2) of the wild-type Aspergillus microorganism and the amino acid sequence (SEQ ID NO: 4) of the β-fructofuranosidase gene (FFaseT) of the highly productive Aspergillus microorganism (Accession No. KCTC13139BP) are shown in Table 2 below.
[0092] 종류아미노산 서열 (N -> C) / 염기 서열 (5' -> 3')서열번호FFase_amino acids sequenceSYHLDTTAPPPTNLSTLPNNTLFHVWRPRAHILPAEGQIGDPCAHYTDPSTGLFHVGFLHDGDGIAGATTANLATYTDTSDNGSFLIQPGGKNDPVAVFDGAVIPVGVNNTPTLLYTSVSFLPIHWSIPYTRGSETQSLAVARDGGRRFDKLDQGPVIADHPFAVDVTAFRDPFVFRSAKLDVLLSLDEEVARNETAVQQAVDGWTEKNAPWYVAVSGGVHGVGPAQFLYRQNGGNASEFQYWEYLGEWWQEATNSSWGDEGTWAGRWGFNFETGNVLFLTEEGHDPQTGEVFVTLGTEGSGLPIVPQVSSIHDMLWAAGEVGVGSEQEGAKVEFSPSMAGFLDWGFSAYAAAGKVLPASSAVSKTSGVEVDRYVSFVWLTGDQYEQADGFPTAQQGWTGSLLLPRELKVQTVENVVDNELVREEGVSWVVGESDNQTARLRTLGITIARETKAALLANGSVTAEEDRTLQTAAVVPFAQSPSSKFFVLTAQLEFPASARSSPLQSGFEILASELERTAIYYQFSNESLVVDRSQTSAAAPTNPGLDSFTESGKLRLFDVIENGQEQVETLDLTVVVDNAVVEVYANGRFALSTWARSWYDNSTQIRFFHNGEGEVQFRNVSVSEGLYNAWPERN1FFase_full_amino acidssequenceMKLTTTTLALATGAAAAEASYHLDTTAPPPTNLSTLPNNTLFHVWRPRAHILPAEGQIGDPCAHYTDPSTGLFHVGFLHDGDGIAGATTANLATYTDTSDNGSFLIQPGGKNDPVAVFDGAVIPVGVNNTPTLLYTSVSFLPIHWSIPYTRGSETQSLAVARDGGRRFDKLDQGPVIADHPFAVDVTAFRDPFVFRSAKLDVLLSLDEEVARNETAVQQAVDGWTEKNAPWYVAVSGGVHGVGPAQFLYRQNGGNASEFQYWEYLGEWWQEATNSSWGDEGTWAGRWGFNFETGNVLFLTEEGHDPQTGEVFVTLGTEGSGLPIVPQVSSIHDMLWAAGEVGVGSEQEGAKVEFSPSMAGFLDWGFSAYAAAGKVLPASSAVSKTSGVEVDRYVSFVWLTGDQYEQADGFPTAQQGWTGSLLLPRELKVQTVENVVDNELVREEGVSWVVGESDNQTARLRTLGITIARETKAALLANGSVTAEEDRTLQTAAVVPFAQSPSSKFFVLTAQLEFPASARSSPLQSGFEILASELERTAIYYQFSNESLVVDRSQTSAAAPTNPGLDSFTESGKLRLFDVIENGQEQVETLDLTVVVDNAVVEVYANGRFALSTWARSWYDNSTQIRFFHNGEGEVQFRNVSVSEGLYNAWPERN2FFaseT_amino acidssequenceSYHLDTTAPPPTNLSTLPNNTLFHVWRPRAHILPAEGQIGDPCAHYTDPSTGLFHVGFLHDGDGIAGATTANLATYTDTSDNGSFLIQPGGKNDPVAVFDGAVIPVGVNNTPTLLYTSVSFLPIHWSIPYTRGSETQSLAVARDGGRRFDKLDQGPVIADHPFAVDVTAFRDPFVFRSAKLDVLLSLDEEVARNETAVQQAVDGWTEKNAPWYVAVSGGVHGVGPAQFLYRQNGGNASEFQYWEYLGEWWQEATNSSWGDEGTWAGRWGFNFETGNVLFLTEEGHDPQTGEVFVTLGTEGSGLPIVPQVSSIHDMLWAAGEVGVGSEQEGAKVEFSPSMAGFLDWGFSAYAAAGKVLPASSAVSKTSGVEVDRYVSFVWLTGDQYEQADGFPTAQQGWTGSLLLPRELKVQTVENVVDNELVREEGVSWVVGESDNQTATLRTLGITIARETKAALLANGSVTAEEDRTLQTAAVVPFAQSPSSKFFVLTAQLEFPASARSSPLQSGFEILASELERTAIYYQFSNESLVVDRSQTSAAAPTNPGLDSFTESGKLRLFDVIENGQEQVETLDLTVVVDNAVVEVYANGRFALSTWARSWYDNSTQIRFFHNGEGEVQFRNVSVSEGLYNAWPERN3FFaseT_full_amino acidssequenceMKLTTTTLALATGAAAAEASYHLDTTAPPPTNLSTLPNNTLFHVWRPRAHILPAEGQIGDPCAHYTDPSTGLFHVGFLHDGDGIAGATTANLATYTDTSDNGSFLIQPGGKNDPVAVFDGAVIPVGVNNTPTLLYTSVSFLPIHWSIPYTRGSETQSLAVARDGGRRFDKLDQGPVIADHPFAVDVTAFRDPFVFRSAKLDVLLSLDEEVARNETAVQQAVDGWTEKNAPWYVAVSGGVHGVGPAQFLYRQNGGNASEFQYWEYLGEWWQEATNSSWGDEGTWAGRWGFNFETGNVLFLTEEGHDPQTGEVFVTLGTEGSGLPIVPQVSSIHDMLWAAGEVGVGSEQEGAKVEFSPSMAGFLDWGFSAYAAAGKVLPASSAVSKTSGVEVDRYVSFVWLTGDQYEQADGFPTAQQGWTGSLLLPRELKVQTVENVVDNELVREEGVSWVVGESDNQTATLRTLGITIARETKAALLANGSVTAEEDRTLQTAAVVPFAQSPSSKFFVLTAQLEFPASARSSPLQSGFEILASELERTAIYYQFSNESLVVDRSQTSAAAPTNPGLDSFTESGKLRLFDVIENGQEQVETLDLTVVVDNAVVEVYANGRFALSTWARSWYDNSTQIRFFHNGEGEVQFRNVSVSEGLYNAWPERN4FFaseT_pichia DNAsequenceccgggtttctggactgggggttcagcgcctacgctgcggcgggcaaggtgctgccggccagctcggcggtgtcgaagaccagcggcgtggaggtggatcggtatgtctcgttcgtctggttgacgggcgaccagtacgagcaggcggacgggttccccacggcccagcaggggtggacggggtcgctgctgctgccgcgcgagctgaaggtgcagacggtggagaacgtcgtcgacaacgagctggtgcgcgaggagggcgtgtcgtgggtggtgggggagtcggacaaccagacggccacgctgcgcacgctggggatcacgatcgcccgggagaccaaggcggccctgctggccaacggctcggtgaccgcggaggaggaccgcacgctgcagacggcggccgtcgtgccgttcgcgcaatcgccgagctccaagttcttcgtgctgacggcccagctggagttccccgcgagcgcgcgctcgtccccgctccagtccgggttcgaaatcctggcgtcggagctggagcgcacggccatctactaccagttcagcaacgagtcgctggtcgtcgaccgcagccagactagtgcggcggcgcccacgaaccccgggctggatagctttactgagtccggcaagttgcggttgttcgacgtgatcgagaacggccaggagcaggtcgagacgttggatctcactgtcgtcgtggataacgcggttgtcgaggtgtatgccaacgggcgctttgcgttgagcacctgggcgagatcgtggtacgacaactccacccagatccgcttcttccacaacggcgagggcgaggtgcagttcaggaatgtctccgtgtcggaggggctctataacgcctggccggagagaaattga5
[0093] (상기 표 2에서, 변이가 발생한 서열 부분을 굵은글씨 및 밑줄로 표시하였다)
[0094]
[0095] Example 1-2. Preparation of an expression system for fopA gene expression in Pichia pastoris.
[0096] Since the enzymatic activity of FFase derived from Aspergillus can be confirmed similarly to that of existing fungi when expressed in a eukaryotic expression system, for mutation, the FFase and FFaseT genes of Example 1-1 were each commissioned to Bioneer to produce genes in a form that can be expressed in Pichia (pichia codon optimized). The nucleic acid sequence information of the FFassT gene with codon optimization is shown in Table 2 above (SEQ ID NO: 5).
[0097] To develop an enzyme with high kestose production activity, a vector containing the gene, for which the codon optimization was performed, was prepared to confirm expression by inserting the gene into the eukaryotic strain Pichia pastoris.
[0098] Specifically, each of the above-mentioned manufactured genes was amplified using the primer pairs of sequence numbers 10 and 11 of Table 1, and additionally, the genes were amplified using the primer pairs of sequence numbers 11 and 12 to manufacture a mature form in which 19 amino acids at the N-terminus of the enzyme expressed by the above-mentioned genes were removed.
[0099] The amplified mature form of the gene was purified and treated with EcoRI restriction enzyme. In addition, the pPIC9 vector (SnapGene) was also treated with EcoRI, and subsequently treated with alkaline phosphatase. Subcloning was performed by ligation with the mature form of the gene.
[0100] The subcloned plasmid was confirmed to have been correctly inserted through base sequence analysis, and thus a pPIC9-FFase vector with the FFase gene introduced and a pPIC9-FFaseT vector with the FFaseT gene introduced were constructed. The vector maps of the pPIC9-FFase vector and the pPIC9-FFaseT vector manufactured by the above process are shown in Figures 1 and 2, respectively, and the amino acid sequences of the FFase enzyme (SEQ ID NO: 1) and FFaseT enzyme (SEQ ID NO: 3) manufactured in mature form are shown in Table 2 above.
[0101]
[0102] Example 2. Preparation of a pichia pastoris strain expressing a mutant enzyme
[0103] Example 2-1. Production of mutant genes
[0104] In order to improve the enzyme to increase the kestose production activity of FFaseT, error-prone PCR was performed on the fopA gene in the pPIC9-FFaseT vector of Example 1-2 to induce mutation.
[0105] Specifically, 5 ng of the above pPIC9-FFaseT vector was prepared as a PCR template, and PCR was performed with 1 to 2.5 mM of dCTP and dTTP, 0.1 to 2.5 mM of dATP and dGTP, 1 to 5 mM of MgCl2, and 0.5 to 1 mM of MnCl2. Additional mutated FFaseT enzyme genes (FFaseT mutants) were obtained by repeating the reaction 30 times at 94°C for 30 seconds, 59°C for 45 seconds, and 72°C for 3 minutes and 50 seconds.
[0106] The additionally mutated FFaseT mutants gene was treated with EcoRI and subcloned into the pPIC9 vector in substantially the same manner as in Example 1-2 to produce a pPIC9_FFase mutants vector having the mutant gene.
[0107]
[0108] Example 2-2. FFaseT gene transformation into Pichia pastoris
[0109] In order to integrate the β-fructofuranosidase gene into the chromosome of Pichia pastorisGS115 (Invitrogen) to express the protein, the pPIC9-FFase vector, pPIC9-FFaseT vector of Example 1-2, and the pPIC9_FFase mutants vector of Example 2-1 were cleaved with BglII (New England Biolab), and the purified DNA was transformed into Pichia.
[0110] Specifically, to prepare Pichia pastoris competent cells for electroporation, 400 μl of G115 (Invitrogen) cultured cells were inoculated into 400 mL of Yeast Extract Peptone Dextrose (YPD, Yeast Extract 10 g / L, Bacto_Peptone 20 g / L, Dextrose 20 g / L) and cultured overnight to OD 600 Cells were collected when the value was 1 to 1.5.
[0111] After collecting the above cells, they were added to a medium containing 50 mL of YPD and 10 mL of 1 M HEPES, 1 mL of 1 M DTT was added to the medium, and the reaction was performed at 30°C for 30 minutes. After the reaction, the cells were lysed with the same volume of ice-cold 1 M sorbitol as the culture medium, centrifuged, and the supernatant was removed. After washing twice with the same sorbitol solution with a volume of 1 / 2 and 1 / 10 of the culture medium, the cells were lysed with 1 mL of 1 M sorbitol, and then divided into 100 μL.
[0112] The pPIC9-FFase vector, pPIC9-FFaseT vector of Example 1-2 and the pPIC9_FFase mutants vector of Example 2-1 were cleaved with BglII (New England Biolab) at 37°C for 2 to 3 hours, and 1 to 2 μg of purified DNA was electroporated into 100 μL of the washed Pichia pastoris competent cells using an Electroporator (Bio-Rad) set to Pichia pastoris (1.5 kV, 25 μF) and pulsed to transform the cells.
[0113]
[0114] Example 2-3. Selection of strains expressing FFase enzyme
[0115] For the transformed cells (strains) in the above Example 2-2, top agar made with 0.8% agar (Difco) was spread on an RD-His plate and cultured at 30°C. The composition information of the RD-His plate used is shown in Table 3 below.
[0116] Colonies were obtained by culturing for 3 to 5 days on the RD-His plate, and the colonies were equally plated on the MD plate, MS plate, and MM plate, respectively, and cultured for 1 to 2 days to confirm the growth morphology. The composition information of the plates used is shown in Table 4 below.
[0117] RD-His plateComponentg / LSorbitol182YNB1.7Ammonium sulfate5Glucose20Biotin0.04Amino acids mixture (Histidine drop out)0.5Agar20
[0118] MD plateMS plateMM plateComponentg / LComponentg / LComponentg / LYNB (Yeast Nitrogen Base)1.7YNB (Yeast Nitrogen Base)1.7YNB (Yeast Nitrogen Base)1.7Ammonium sulfate5Ammonium sulfate5Ammonium sulfate5Glucose20Sucrose20Methanol5Agar20Agar20Agar20
[0119] Taking advantage of the characteristic that Pichia pastoris does not grow well in a medium containing sucrose, a strain with FFase enzyme activity was selected through a process of selecting bacteria that grow simultaneously in MS medium containing sucrose and MM medium identified as a methylotroph, and finally, colonies grown on all plates were selected.
[0120] To confirm that the above enzyme was introduced, integration of the gene into gDNA was confirmed through colony PCR (using Bioneer premix) on selected colonies.
[0121]
[0122] Example 3. Confirmation of FFase enzyme expression and activity
[0123] Example 3-1. Cultivation of strain transformed with FFase enzyme
[0124] In order to confirm the enzyme activity through culture of the selected strains among the strains transformed with the pPIC9-FFase mutants vector in the above Example 2-3, the selected colonies were inoculated into 50 mL BMGY medium (Table 5) and cultured at 28°C and 200 rpm for 24 to 48 hours to an OD600 of 15 to 20.
[0125] The above cultured cells were centrifuged at 4000 rpm for 5 minutes, the supernatant was removed, and the cells were suspended in 10 mL of BMMY medium (Table 5) and cultured under the same culture conditions. Additionally, methanol was fed to 0.5 (w / v)% every 24 hours to culture the cells so that enzymes in the strains were expressed. The composition information of the BMGY medium and BMMY medium used is shown in Table 5 below.
[0126] BMGYBMMYComponent-Component-Yeast extract5g / LYeast extract5g / LPeptone10g / LPeptone10g / LPhosphate buffer pH 6.0100 mMPhosphate buffer pH 6.0100 mMYNB (yeast nitrogen base without amino acid)3.4 g / LYNB (yeast nitrogen base without amino acid)3.4 g / Lammonium sulfate10g / Lammonium sulfate10g / LBiotin0.002g / LBiotin0.002g / LGlycerol10g / LMethanol (over 99.99%)5 g / L
[0127]
[0128] Example 3-2. Confirmation of FFase enzyme activity
[0129] FFase enzyme activity was confirmed 4 days after culture in Example 3-1 above. In the case of cultured cells, since it is expressed in a form fused to mating factor alpha and secreted outside the cell, enzyme activity was confirmed by analyzing the supernatant of the culture solution.
[0130] Specifically, for enzyme activity analysis using the supernatant, 150 mM Mcilvaine buffer pH 5.0, 250 g / L sucrose substrate solution, and the supernatant (1000 units) of the culture solution cultured in BMMY medium in Example 3-1 were added in a volume ratio of 2:2:1 and reacted at 40°C for 30 minutes, 1 hour, or 2 hours, and the reaction solution was quantitatively analyzed using HPLC analysis. The analysis was performed using a 70% Acetonitrile solution as a mobile phase, flowing at 1 mL / min, and using a NH2P-50 column (Shodex) at 30°C and confirmed using RID (Refractive Index Detector).
[0131] The ratio of each type of sugar in the conversion product, particularly the ratio of GF2 (kestose) and GF3 (nystose) converted at 10 to 15% of the reaction substrate sugar, was confirmed according to the reaction time, and the results are shown in Table 6 below. The numerical unit in Table 6 below is the content of each constituent sugar expressed as weight% based on 100 weight% of the total sugar solid content included in the conversion product.
[0132] Response TimeFructoseGlucoseSucroseGF2GF3GF430min4.2225.6312.8439.5416.950.371 hr4.6728.1710.7129.9424.380.782 hr6.0932.827.7216.1428.781.94
[0133] The sugar ratio in the conversion product was confirmed to be due to high enzyme activity within the strain, with the substrate ratio dropping below 15% in 30 minutes. However, as the reaction time increased, excessive fructose transfer occurred, resulting in an increase in the ratios of GF3 and GF4. These results confirmed that the ratio of GF2 (kestose) decreased with each passing enzyme reaction time.
[0134]
[0135] Example 4. Expression and activity analysis of mutant enzymes
[0136] Example 4-1. Screening of mutant enzymes using TLC
[0137] To analyze the enzyme activity of the enzyme in the pPIC9_FFase mutants vector, a selected strain among the pichia strains transformed with the pPIC9_FFase mutants vector of Example 2-3 was cultured in substantially the same manner as in Example 3-1, and reacted in the same manner as in Example 3-2. The reaction was performed at 40°C for 30 minutes.
[0138] After the above reaction, the reaction solution was placed on a Thin Layer Chromatography (TLC) plate (Merck) and developed to confirm the conversion of sucrose according to the enzyme activity. The developing solvent used for TLC confirmation was a solution of acetonitrile / water in a ratio of 85 / 15, and the developed sample was confirmed using an N-naphthyldiethyllaurine dihydrochloride solution after development. In addition, a pichia strain having a mutant enzyme that confirmed that the reaction solution was used for the reaction and converted to kestose through development was secured.
[0139]
[0140] Example 4-2. Confirmation and screening of mutant enzyme activity
[0141] Among the strains transformed with FFase or FFaseT in the above Example 2-3, the selected strain and the strain obtained in the above Example 4-1 were cultured and reacted in substantially the same manner as in the above Example 4-1.
[0142] After the above reaction, the reaction solution was quantitatively analyzed using HPLC analysis in substantially the same manner as in Example 3-2, and the primary activity was confirmed, and the results are shown in Table 7 below.
[0143] Enzyme nameFructoseGlucosesucroseGF2GF3GF4FFase4.2225.6312.8439.5416.950.37FFaseT2.5123.6211.4241.4620.450.43FFa mM81.6217.8629.8143.376.91-FFa m62W9.0826.2711.248.673.74-
[0144] As a result of confirming enzyme activity, compared to FFase without mutation, fructose transfer activity of FFaseT with amino acid mutation increased, and production of GF2 and GF3 increased. In addition, it exhibited the characteristic of maintaining a high ratio of GF2 compared to wild-type FFase.
[0145] In addition, among the strains obtained in Example 4-1, in cases where the expression rate was low, it was difficult to confirm the activity, and the activity of the strain in which the enzyme was expressed was confirmed. As a result of confirming the primary activity, a mutant enzyme with high GF2 production activity and low GF3 conversion compared to FFase and FFaseT, and specifically a strain with low GF3 production, was selected, and the results of confirming the activity of the selected strain are shown in Table 7 above.
[0146] Specifically, strains expressing mutant enzymes with confirmed V220A (V239A), H313K (H332K), E329K (E348K), and R440T (R459T) mutations and strains expressing mutant enzymes with confirmed G62W (G81W), H313K (H332K), and R440T (R459T) mutations were selected. The above mutations refer to mutation information based on the mature form of the enzyme, and mutations in parentheses refer to mutation information based on the enzyme other than the mature form.
[0147] Among the selected enzymes, the enzyme with four mutations was named FFa mM8, and the enzyme with three mutations was named FFa m62W. The amino acid sequence of FFa mM8 (SEQ ID NO: 6) and the amino acid sequence of FFa m62W (SEQ ID NO: 7) are shown in Table 8 below.
[0148]
[0149]
[0150] Example 4-3. Confirmation of mutant enzyme activity on high-concentration substrates
[0151] After confirming the primary activity, the enzymes of the selected strains, FFa mM8 and FFa m62W, were tested for activity against high concentration substrates.
[0152] Specifically, 100 mM phosphate buffer pH 7.0, 500 g / L Sucrose solution, and the supernatant (1000 units) of the culture solution obtained by culturing each of the two strains selected in Example 4-2 in substantially the same manner as in Example 3-1 were added at a volume ratio of 4:4:1 and reacted at 40°C for 1 hour.
[0153] After the reaction, the ratio of the product was confirmed through HPLC analysis in substantially the same manner as in Example 3-2, and the HPLC analysis results of the selected strain are shown in Table 9 below. The numerical unit in Table 9 below is the content of each constituent sugar expressed as weight% based on 100 weight% of the sugar solid content included in the conversion product.
[0154] In addition, the results of synthesizing the GF2 and GF3 ratios of each enzyme in combination with the results of Example 3-2 are shown in Figure 3.
[0155] Enzyme NameFructoseGlucoseSucroseGF2GF3FFa mM81.7819.3119.7155.064.13FFa m62W3.0521.6313.7157.973.38
[0156] As a result of confirming the enzyme activity, it was confirmed that the mutant enzymes FFa mM8 and FFa m62W produced a kestose solid content exceeding 50 wt% and a nystose content less than 5 wt% based on the sugar solid content included in the sugar conversion product, and thus the kestose production activity was confirmed to be higher than that of the FFase enzyme without a mutation that has a high activity of converting kestose to nystose.
[0157] In addition, in the case of FFa m62W, it was confirmed that the mature form of FFase (the form with the signal sequence 19 amino acids removed) was produced and that this was used to produce a high content of kestose.
[0158] In combination with the results of the above Example 3-2, the ratio of GF2 / GF3, which is a measure of the reaction converting to the oligosaccharide kestose, was confirmed, and the wild type showed 2.3, but mM8 showed 13.33, and m62W showed 17.15.
[0159] Through the above results, it was confirmed that the enzyme has the characteristic of being specifically converted to kestose by residue mutations such as G62W (G81W), V220A (V239A), H313K (H332K), E329K (E348K), and R440T (R459T).
Claims
1. An enzyme protein having β-fructofuranosidase activity, comprising an amino acid sequence having 90% or more sequence identity with the amino acid sequence of sequence number 1, wherein an amino acid corresponding to at least one amino acid selected from the group consisting of the 62nd, 220th, 313th, 329th, and 440th amino acids from the N-terminus of the amino acid sequence of sequence number 1 is mutated.
2. In paragraph 1, an amino acid corresponding to at least one amino acid selected from the group consisting of the 62nd, 220th, 313th, 329th and 440th amino acids from the N-terminus of the amino acid sequence of sequence number 1 An enzyme protein having β-fructofuranosidase activity, wherein the enzyme is substituted with one or more amino acids selected from the group consisting of tryptophan (Trp; W), alanine (Ala; A), lysine (Lys; K), and threonine (Thr; T).
3. In the second paragraph, from the N-terminus of the amino acid sequence of sequence number 1, An enzyme protein having β-fructofuranosidase activity, comprising at least one selected from the group consisting of a substitution of the amino acid corresponding to glycine (Gly; G) at position 62 with tryptophan, a substitution of the amino acid corresponding to valine (Val; V) at position 220 with alanine, a substitution of the amino acid corresponding to histidine (His; H) at position 313 with lysine, a substitution of the amino acid corresponding to glutamic acid (Glu; E) at position 329 with lysine, and a substitution of the amino acid corresponding to arginine (Arg; R) at position 440 with threonine.
4. An enzyme protein according to claim 1, wherein the content of nystose included in a sugar conversion product manufactured by reacting the enzyme protein with a substrate containing sucrose is less than 10 wt% based on 100 wt% of the total solid content of sugars included in the sugar conversion product.
5. An enzyme protein according to claim 1, wherein the weight ratio of kestose / nystose contained in a sugar conversion product produced by reacting the enzyme protein with a substrate containing sucrose is 3 to 60.
6. In the fifth paragraph, the weight ratio is a ratio measured by performing a sugar conversion reaction using an enzyme protein having β-fructofuranosidase activity having an activity of 1000 units for a sucrose solution having a concentration of 250 g / L or 500 g / L.
7. In paragraph 6, the sugar conversion reaction is (1) Time conditions of 10 minutes to 3 hours; (2) Temperature conditions of 30 to 65℃; or (3) An enzyme protein that is performed under conditions of pH 4.5 to 8.
0.
8. In the 6th paragraph, the enzyme protein used in the sugar conversion reaction is an enzyme protein in the form of at least one selected from the group consisting of a Pichia genus microorganism expressing the enzyme protein, a culture of the microorganism, a supernatant obtained from the culture, and extracts thereof.
9. A nucleic acid molecule encoding an enzyme protein according to any one of claims 1 to 8.
10. A recombinant vector comprising a nucleic acid molecule according to Article 9.
11. A recombinant microorganism comprising a nucleic acid molecule according to Article 9 or a recombinant vector comprising the same.
12. A recombinant microorganism in claim 11, wherein the recombinant microorganism is a strain of the genus Pichia, a strain of the genus Aspergillus, a strain of the genus Saccharomyces, or a strain of the genus Yarrowia.
13. A composition for producing a sugar conversion product including kestose from a substrate including sucrose, comprising at least one selected from the group consisting of an enzyme protein according to any one of claims 1 to 8, a recombinant microorganism expressing the enzyme protein, cells of the microorganism, cell lysates of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, and extracts thereof.
14. A composition according to claim 13, wherein the content of nystose included in the sugar conversion product is less than 10 wt% based on 100 wt% of the total solid content of sugars included in the sugar conversion product.
15. A composition according to claim 13, wherein the weight ratio of kestose / nistose included in the sugar conversion product is 3 to 60.
16. A composition according to claim 13, wherein the substrate containing sucrose has a sucrose concentration of 100 to 1,000 g / L.
17. A method for producing a sugar conversion product including kestose, comprising a step of reacting at least one selected from the group consisting of an enzyme protein according to any one of claims 1 to 8, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, a cell lysate of the microorganism, a culture of the microorganism, a supernatant obtained from the culture, and extracts thereof, with a substrate including sucrose.
18. A sugar conversion composition comprising kestose and produced by a biological method from a substrate comprising sucrose, A sugar conversion composition, wherein the content of kestose is 40 wt% or more and the content of nystose is less than 10 wt% based on 100 wt% of the total solid content of sugars included in the sugar conversion composition.
19. A sugar conversion composition according to claim 18, further comprising 10 to 30 wt% of glucose and 10 to 30 wt% of sucrose.
Citation Information
Patent Citations
Method for preparing fructooligosaccharides comprising high content of 1-kestose
KR1020180078086A
NEW beta-FRUCTOFURANOSIDASE, METHOD FOR PRODUCING THE SAME AND USE THEREOF
JP2010148419A
Genetically modified microorganisms with sucrose metabolism ability
JP2011505869A
Recombinant microorganism having an ability of using sucrose as a carbon source by introducing β-fructofuranosidase
KR1020100047100A
Method for preparing fructooligosaccharides comprising high content of 1-kestose
KR1020180122987A