Primer set capable of differentiating field strain of african swine fever virus from live vaccine virus, and use thereof

Abstract

The present invention relates to a primer set capable of differentiating a field strain of African swine fever virus from a live vaccine virus, and a use thereof and, more specifically, to: 13 types of primer sets for conventional PCR and 12 types of primer sets for qRT-PCR capable of differentiating a field strain of African swine fever virus from a live vaccine virus; a kit for differentiating a field strain from a vaccine strain of African swine fever virus, comprising the primer sets; and a method for differentiating suids infected with a field strain of African swine fever virus from suids inoculated with a vaccine strain, using the primer sets.

Description

Primer set for distinguishing between field strains of African swine fever virus and live vaccine virus and its use

[0001] The present invention relates to a primer set capable of distinguishing between a field strain of African swine fever virus and a live vaccine virus and its use, and more particularly, to a method for distinguishing between a field strain of African swine fever virus and a live vaccine strain of African swine fever using a primer set having specific binding to a field strain of African swine fever virus and not binding to a live vaccine strain of African swine fever.

[0002]

[0003] This work was supported by the Ministry of Education's Science and Engineering University Research Institute Support Project (Project Number: 2021R1A6A1A03045495).

[0004] African swine fever (ASF) is an acute febrile viral infectious disease of pigs caused by infection with the African swine fever virus (ASFV) belonging to the Asfarviridae family. It was first reported in Kenya in 1921, and outbreaks have been reported mainly in sub-Saharan Africa. After being introduced to Georgia in 2007, it spread to Eastern European countries such as Russia and Poland. In particular, the outbreak spread east to west within Russia, and then spread to China in Asia in August 2018, where it first occurred, and then spread to other Asian regions such as Vietnam and Myanmar. It was first reported in a domestic pig farm in September 2019, and is currently spreading nationwide through wild boars.

[0005] African swine fever (ASF) is an acute febrile viral infectious disease that occurs only in domestic pigs and wild boars. It affects all age groups and, in acute cases, causes 100% mortality within one week. Because there is currently no commercially available effective vaccine, outbreaks have a significant impact on the pig industry. Furthermore, the virus's high resistance to environmental factors makes eradication extremely difficult after introduction. Furthermore, as it is a highly contagious disease requiring immediate treatment, diagnosis is crucial.

[0006] Currently, African swine fever vaccination is not being implemented in domestic pigs, but it is expected that African swine fever vaccination will be implemented in the future. Since a live vaccine is currently being used for African swine fever in Korea, differential diagnosis between pigs infected with the African swine fever virus in the field and pigs vaccinated with the live African swine fever vaccine virus is particularly necessary.

[0007] To effectively prevent African swine fever, a method that can efficiently distinguish between field infections and vaccination by testing the blood of pigs shipped to infected farms and slaughterhouses will be urgently needed in the future.

[0008] Meanwhile, Korean Patent Publication No. 2015-0020643 discloses a 'method for differentiating pigs infected with field swine fever virus and pigs vaccinated with genetically recombinant swine fever vaccine and a primer set therefor' using primers that bind only to the African swine fever virus and not to other pestiviruses (BVDV or BDV), and Korean Patent Publication No. 2023-0075194 discloses a 'composition for recombinant enzyme polymerase amplification reaction for rapid detection of African swine fever virus' using a molecular marker specific to the P30 gene of African swine fever virus, but the 'primer set capable of differentiating between field strains of African swine fever virus and live vaccine viruses and use thereof' of the present invention is not described.

[0009] The present invention was derived from the above-mentioned needs, and while conducting research to solve the above-mentioned problems, the inventors confirmed that African swine fever field virus and African swine fever live vaccine virus can be effectively distinguished using the specific binding properties of a primer set, thereby completing the present invention.

[0010] In order to solve the above problem, the present invention provides a conventional PCR primer set composition capable of distinguishing between a field strain and a vaccine strain of African swine fever virus, comprising any one primer set among 13 oligonucleotide primer sets characterized in that two adjacent oligonucleotides from SEQ ID NO. 1 are one primer set, in an oligonucleotide consisting of a base sequence of SEQ ID NO. 1 to 26.

[0011] In addition, the present invention provides a primer set composition for qRT-PCR capable of distinguishing between a field strain and a vaccine strain of African swine fever virus, comprising: one primer set among 12 oligonucleotide primer sets characterized in that two adjacent oligonucleotides from SEQ ID NO: 27 in the oligonucleotide primer sets consisting of the base sequences of SEQ ID NO: 27 to 50 are one primer set; and an oligonucleotide primer set consisting of the base sequences of SEQ ID NO: 51 and SEQ ID NO: 52.

[0012] In addition, the present invention provides a kit for determining field strains and vaccine strains of African swine fever virus, comprising the primer set composition and a reagent for performing an amplification reaction.

[0013] In addition, the present invention provides a method for distinguishing between a field African swine fever virus-infected pig and a vaccinated pig, the method comprising: extracting genomic DNA from an isolated sample of a pig suspected of being infected with African swine fever virus; performing an amplification reaction using the isolated genomic DNA as a template and a primer set composition of the present invention to amplify a target sequence; and detecting a product of the amplification step.

[0014] The primer set composition according to the present invention and the method for differentiating field strains and vaccine strains of African swine fever virus using the same are easy to differentiate based on genetic analysis and can track mutations of the African swine fever vaccine strain virus, so they can be effectively used for the eradication of African swine fever by early differentiation and elimination of pigs infected with the African swine fever field virus.

[0015] Figure 1 shows the results of discrimination between the field strain (WT) and vaccine strain (11893-18) using a conventional PCR primer set (Table 2).

[0016] Figures 2 and 3 show the results of discrimination between the field strain (WT) and the vaccine strain (11893-18) using the qRT-PCR primer set (Table 3).

[0017] In order to achieve the purpose of the present invention, the present invention provides a conventional PCR primer set composition capable of distinguishing between a field strain and a vaccine strain of African swine fever virus, comprising any one primer set among 13 oligonucleotide primer sets characterized in that two adjacent oligonucleotides from SEQ ID NO. 1 are one primer set in an oligonucleotide consisting of a base sequence of SEQ ID NO. 1 to 26.

[0018] The present invention also provides a primer set composition for qRT-PCR capable of distinguishing between a field strain and a vaccine strain of African swine fever virus, comprising: one primer set among 12 oligonucleotide primer sets, characterized in that two adjacent oligonucleotides from SEQ ID NO: 27 in the oligonucleotide primer sets consisting of the base sequences of SEQ ID NO: 27 to 50 are one primer set; and an oligonucleotide primer set consisting of the base sequences of SEQ ID NO: 51 and SEQ ID NO: 52.

[0019] In the primer set composition capable of distinguishing between an African swine fever virus field strain and a vaccine strain according to the present invention, the African swine fever virus vaccine strain may preferably have a genome sequence of sequence number 53.

[0020] The above primers may include oligonucleotides composed of fragments of 16 or more, 17 or more, 18 or more, 19 or more, or 20 or more consecutive nucleotides within the sequence of SEQ ID NO: 1 to 52, depending on the sequence length of each primer. For example, the primer of SEQ ID NO: 1 (34 oligonucleotides) may include oligonucleotides composed of fragments of 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more, 32 or more, or 33 or more consecutive nucleotides within the sequence of SEQ ID NO: 1. Additionally, the primer may also include an addition, deletion or substitution of the base sequence of SEQ ID NO: 1 to 52.

[0021] In the present invention, a "primer" refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, and can serve as an initiation point for the synthesis of a primer extension product. The length and sequence of the primer must allow for the initiation of the synthesis of the extension product. The specific length and sequence of the primer will depend on the complexity of the desired DNA or RNA target, as well as the conditions under which the primer is used, such as temperature and ionic strength.

[0022] In the present specification, the oligonucleotide used as a primer may also include a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate or a peptide nucleic acid, or may include an intercalating agent.

[0023] The present invention also provides a kit for determining field strains and vaccine strains of African swine fever virus, comprising a primer set composition of the present invention and a reagent for performing an amplification reaction.

[0024] In the kit according to the present invention, the primer set composition may be for conventional PCR or qRT-PCR, as described above.

[0025] In this specification, unless otherwise specified, “African swine fever virus field strain” refers to an African swine fever virus strain infected from the outdoors (outside), and is a concept distinct from “African swine fever virus vaccine strain” that functions as a vaccine.

[0026] Additionally, in the kit according to the present invention, the African swine fever virus vaccine strain may preferably have a genome sequence of sequence number 53.

[0027] In one embodiment of the present invention, the kit may further include a reagent for performing an amplification reaction, and the reagent for performing the amplification reaction may include, but is not limited to, DNA polymerase, dNTPs, and a buffer.

[0028] Additionally, the kit may further include a user guide describing optimal reaction conditions. The guide is a printed document explaining how to use the kit, such as how to prepare reverse transcription buffer and PCR buffer, and the suggested reaction conditions. The guide includes instructions in the form of a pamphlet or leaflet, a label attached to the kit, and on the surface of the package containing the kit. The guide also includes information disclosed or provided through electronic media, such as the Internet.

[0029] The present invention also provides a method for distinguishing between a field African swine fever virus-infected pig and a vaccinated pig, comprising the steps of: extracting genomic DNA from an isolated sample of a pig suspected of being infected with African swine fever virus; performing an amplification reaction using the isolated genomic DNA as a template and a primer set composition of the present invention to amplify a target sequence; and detecting a product of the amplification step.

[0030] The method of the present invention comprises a step of isolating genomic DNA from an isolated sample of a pig suspected of being infected with African swine fever virus. The genomic DNA can be isolated using a method known in the art, for example, the CTAB method or the Wizard prep kit (Promega). An amplification reaction can be performed using the isolated genomic DNA as a template and an oligonucleotide primer set according to an embodiment of the present invention as primers to amplify a target sequence. Methods for amplifying the target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, strand displacement amplification, amplification using Qβ replicase, or any other suitable method for amplifying a nucleic acid molecule known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to the target nucleic acid using a polymerase. These PCR methods are well known in the art and commercially available kits are also available.

[0031] In one embodiment of the present invention, the method for distinguishing between a field African swine fever virus-infected pig and a vaccinated pig includes a step of detecting a product of the amplification step, and the detection of the amplification step product may be performed through gel electrophoresis, a DNA chip, radiometric measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting the amplification product, gel electrophoresis may be performed, and gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, capillary electrophoresis may be performed, and capillary electrophoresis may use, for example, ABi Sequencer. In addition, the fluorescence measurement method is performed by labeling the 5'-end of the primer with Cy-5 or Cy-3 and performing PCR, so that the target sequence is labeled with a detectable fluorescent label, and the fluorescence thus labeled can be measured using a fluorometer. In addition, the radiometric measurement method is performed when performing PCR. 32 P or 35 After labeling the amplified product by adding a radioactive isotope such as S to the PCR reaction solution, the radioactivity can be measured using a radiometric measuring device such as a Geiger counter or a liquid scintillation counter.

[0032]

[0033] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0034]

[0035] Materials and Methods

[0036] 1. ASFV outdoor and vaccine strains

[0037] The ASFV used in the present invention was provided by the National Institute of Wildlife Disease Control and Prevention and the Central Vaccine Research Institute. The ASFV field strain (ASF / Korea / Wildbore / Inje-11893 / 2021) was isolated from a wild boar with African swine fever that occurred in the Inje area of ​​Gangwon-do in 2022, and the ASFV vaccine strain was obtained by infecting the field strain with a monkey kidney cell-derived CA-CAS-01-A cell line (accession number KCTC14568BP) and passaged 18 times. The ASFV vaccine strain (11893-18) used in the present invention is MGF 100-1R, ASFV G ACD 00190, MGF 110-9L, MGF 110-10L, MGF 110-14L, ASFV G ACD 00240, MGF 110-12L, MGF 110-13La, MGF 110-13Lb, ASFV G ACD 00270, MGF 360-4L, MGF 360-6L, MGF 360-8L partial, MGF 300-1L, MGF 300-2R, MGF 300-4L, MGF 110-8L partial, ASFV G ACD 00210, ASFV G ACD 00300, ASFV G ACD It is characterized by being attenuated with deletion of the 00320, ASFV G ACD 00330, ASFV G ACD 00350, ASFV G ACD 00360 and X69R genes, and has a genome sequence of sequence number 53.

[0038]

[0039] 2. Primer set design

[0040] Primer sets for the discrimination of ASFV field strains and vaccine strains were designed using the MBiotech-South Korea IDT portal qPCR primer design program, targeting the gene region deleted in the ASFV vaccine strain based on the ASFV Georgia 2007 / 1 genome sequence (GenBank: FR6824682). In the present invention, 13 primer sets for conventional PCR and 12 primer sets for qRT-PCR (quantitative real-time PCR) were designed.

[0041]

[0042] 3. DNA extraction and polymerase chain reaction

[0043] Genomic DNA of the ASFV field strain and vaccine strain (11893-18) was extracted from infected cell lysates using the Maxwell RSC whole blood DNA kit (Promega). The extracted genomic DNA was adjusted to a concentration of 50 μg / μl and used. The composition of the reaction solutions for conventional PCR and qRT-PCR is shown in Table 1.

[0044] PCR reaction solutionconventional PCRqRT-PCRComponentVol. (㎕)ComponentVol. (㎕)DNA100 ng(1㎕)DNA5 ng(1㎕)10 pmole primer_forward58 pmole primer_forward110 pmole primer_reverse58 pmole primer_reverse12.5mM dNTPs52× SmartGene Sybr Green Q-PCR Master Mix (SMART GENE)10Taq polymerase (5 units / ㎕)1D.W.7Buffer5D.W.28

[0045]

[0046] Example 1. Discrimination of ASFV field strain and vaccine strain using conventional PCR.

[0047] Conventional PCR primer sets for distinguishing ASFV field strains from vaccine strains were designed specifically for the individual deleted genes of the ASFV vaccine strain (11893-18), and their information is shown in Table 2 below. The amplification reaction was performed with an annealing step at 48°C for 1 min and an extension step at 72°C for 1 min. The amplification products were loaded onto a 1% agarose gel to confirm the results.

[0048] Conventional PCR primer set used in the present invention ASFV gene primer sequence (5'-3') Sequence number MGF 100-1RF- AAATAAGGAAACTATCCTTAGTTAGTCGAGGAAG1R- ATTCTATAAGAAAATCCATTCCAAGAATATTTAC2MGF 110-8LF- AAGACCCATTTAGAAGAAAAAAATAAAGTTTATA3R- AAACGGCTCTAAATTTTAGTTCTTTGTCTTCAAC4MGF 110-9LF- CCCGTTGCAAAATAAGAAAAAAAAAACAAACTTA5R- TACGTTGCAGTATTGCAACCCATAAGTTGCAACT6MGF 110-10L-14LF- GTTACCACAAAAAATAAATGCTGGATTTTTAAGA7R- GCAAAATTTAAATCTTTTTTAAAATGACAGGTGC8MGF 110-12LF- TTCAAACTCTCTTATAAGTACATGTAGGAAATGG9R- TTTTTTTTAAATAACATCTGTGGTATGAACGCAA10MGF 110-13LaF- ACAGTATGTGATATACACATACCACAAAAATGTT11R- TGCTTTGTATGTGCGCTTTGTAAGAATCTGCGTC12MGF 110-13LbF- CAATGATGAAATAGAGACAGTATTGCTTTATAGA13R- TTTTTTTTTGTAAGTGCAGGTGTCATTTAGACG14MGF 300-1LF- AACCACCTAAATAAATGAACGTCTTTTTCATCTTA15R- TTTTTTTAGTAAAGACTTTTATCTAACAAATTGGA16MGF 300-2RF- AAATATTCCGTGTGCATTATTGCTTTTTAATCAGT17R- GTAATATCTGTTTGTTTTAAATACATATTATCAT18MGF 300-4LF- AATATCTGGGAAAATTATTTTTTTTTCTCATACCC19R- TACTAAAACATGATACTAACCTCATTTTAATAAA20MGF 360-4LF- TTGTATATAGGCTAATCATCTTTATATATAGATT21R-GATTACGTTTACTCCTGTTATTCATAATAATACG22MGF 360-6LF- TTTTAAATGTATTCATGGATACATTATAACATTT23R- GATTACATTTACTGCTTTCATTCATGATAATACG24MGF 360-8LF- CCTACTAAACCAAAAAAAAATCAAATTGACTAAG25R- AACTTAATTTGAGTTTTTTTTCAAGAAGTATC26

[0049] As a result of performing the amplification reaction using the primer set in Table 2 above, it was confirmed that the ASFV vaccine strain and the field strain were clearly distinguished (Fig. 1).

[0050]

[0051] Example 2. Discrimination of ASFV field strains and vaccine strains using qRT-PCR.

[0052] To detect ASFV in samples in real time, we developed qRT-PCR primer sets specific for individual deleted genes of the ASFV vaccine strain (11893-18) (Table 3). qRT-PCR was performed using a Rotor-Gene Q (QIAGEN) device, and the amplification reaction was repeated 40 times at 95°C for 3 minutes, 64°C for 15 seconds, and 72°C for 15 seconds. A primer set targeting the P72 gene of ASFV was developed and used as a positive control.

[0053] Primer set for qRT-PCR used in the present invention ASFV gene primer sequence (5'-3') Sequence number MGF 100-1RF- CGTAGGTCTCGTAAAATCCAGG27R- CCAGGAACATTTTCTAGCAAACG28MGF 110-8LF- GTATGGGATGTTGGATTTGCG29R- CAGGATTCAAACAGATTGGCC30MGF 110-9LF- GGTCATGCCACCGGGAAACT31R- ACGAATGCGAATGCAAGCCG32MGF 110-10L-14LF- ACCCGGCTGAGATAGCCAAA33R- TCGCAATTCCTGGGGGTGTT34MGF 110-12LF- TCGCAAATGCAACGCAACCA35R- TCAATCACCAACAACCCCGTG36MGF 110-13LaF- AGGCGTATAGGTCCTTGGTA37R- TTTCGTTCTTTTGAGTATTTTGGTTTG38MGF 110-13LbF- CCATCTTGACAGTCCCAACAG39R- CTCAGTCCTCATTCTCGCAC40MGF 300-1LF- AAAGCGCACCTGTTCACGCA41R- AGCCGTAGCAAGGACGTTGT42MGF 300-2RF- ACACCCCGATAGCCGTGAAA43R- GTTACATCCGCGCCCCATTCCT44MGF 300-4LF- GCTCCCCAACACAAAAGCCG45R- CCAAACGGGCAGCAACATGG46MGF 360-4LF- CGGGTTGGCACCCAAACCTA47R- GCAGACCTTGACCGTGCCTT48MGF 360-6LF- TCGTCCTTTCCGTCTTGGCAC49R- GACAGAGCCTTGGTGAGGGC50p72(positive control)F- CTGCTCATGGTATCAATCTTTATCGA51R- GATACCACAAGATCAGCCGT52

[0054] As a result of the analysis, as disclosed in Figures 2 and 3, it was confirmed that the ASFV field strain (WT) and vaccine strain (11893-18) could be differentiated. In particular, the ASFV vaccine strain sample showed a fluorescent signal only for the positive control P72 gene, indicating that the amplification reaction was performed normally.

[0055] Through the above results, it was found that the primer set of the present invention can clearly distinguish between ASFV field strain (WT) and vaccine strain (11893-18), and through this, it was found that the primer set of the present invention can be usefully used to distinguish pigs infected with ASFV field strain or pigs vaccinated with 11893-18 vaccine strain.

Claims

1. A conventional PCR primer set composition capable of distinguishing between a field strain and a vaccine strain of African swine fever virus, comprising any one primer set from among 13 oligonucleotide primer sets, characterized in that two adjacent oligonucleotides from sequence number 1 are one primer set, among oligonucleotides consisting of base sequences of sequence numbers 1 to 26.

2. A conventional PCR primer set composition according to claim 1, characterized in that the African swine fever virus vaccine strain has a genome sequence of sequence number 53.

3. A primer set composition for qRT-PCR capable of distinguishing a field strain and a vaccine strain of African swine fever virus, comprising: one primer set from among 12 oligonucleotide primer sets characterized in that two oligonucleotides adjacent to SEQ ID NO: 27 in the oligonucleotide primer sets consisting of the base sequences of SEQ ID NO: 27 to 50 are one primer set; and an oligonucleotide primer set consisting of the base sequences of SEQ ID NO: 51 and SEQ ID NO:

52.

4. A primer set composition for qRT-PCR, characterized in that in the third paragraph, the African swine fever virus vaccine strain has a genome sequence of sequence number 53.

5. A kit for determining field strains and vaccine strains of African swine fever virus, comprising a primer set composition of clause 1 or clause 3 and a reagent for performing an amplification reaction.

6. A kit according to claim 5, wherein the reagents for performing the amplification reaction include DNA polymerase, dNTPs, and a buffer.

7. A step of extracting genomic DNA from an isolated sample of a porcine animal suspected of being infected with African swine fever virus; A step of amplifying a target sequence by performing an amplification reaction using the above separated genomic DNA as a template and the primer set composition of claim 1 or claim 3; and A method for distinguishing between a field African swine fever virus-infected porcine animal and a vaccinated porcine animal, comprising a step of detecting the product of the above amplification step.

8. A method for determining in accordance with claim 7, wherein the detection of the amplification product is performed through gel electrophoresis, a DNA chip, radiometric measurement, fluorescence measurement or phosphorescence measurement.

Images