Pharmaceutical composition for inhibiting nfkbiz gene expression, and use

Abstract

The present application belongs to the technical field of biomedicine, and provides a pharmaceutical composition for inhibiting NFKBIZ gene expression, and a use. The present application designs a double-stranded nucleic acid molecule capable of targeting and regulating NFKBIZ gene expression. By means of verifying the gene regulation efficiency of nucleic acid molecules, multiple nucleic acid molecules capable of inhibiting NFKBIZ gene expression are obtained from screening, and efficient inhibition of IκB-ζ protein expression is achieved at the protein level. In addition, the present application verifies a use of a pharmaceutical composition formed by the conjugation of the described nucleic acid molecules and targeting ligand molecules in ophthalmic diseases. The pharmaceutical composition can solve the problems with existing small molecule immunomodulatory drugs of low delivery efficiency and poor therapeutic effect, providing small nucleic acid drugs having tissue-targeted delivery functions, and has the advantages of long duration of efficacy and low side effects. In addition, the pharmaceutical composition has simple ingredients, is easy to synthesize, and has good prospects for translational applications.

Description

A pharmaceutical composition for inhibiting NFKBIZ gene expression and its application

[0001] This application claims priority to a Chinese patent application filed with the Patent Office of China on January 13, 2024, with application number 202410054022.X and invention name “A pharmaceutical composition and application for inhibiting NFKBIZ gene expression”, the entire contents of which are incorporated herein by reference. Technical Field

[0002] The present application belongs to the field of biomedicine technology, and specifically relates to a pharmaceutical composition and application for inhibiting NFKBIZ gene expression. Background Art

[0003] IκB-ζ (inhibitor of nuclear factor κB ζ) is an atypical member of the IκappaB protein family. IκB-ζ is located in the cell nucleus and primarily controls the expression of genes involved in the nuclear factor κB (NF-κB) signaling pathway. The NF-κB signaling pathway plays a key role in numerous cellular processes, including cell growth, differentiation, and apoptosis, and is particularly crucial in immune and inflammatory responses. IκB-ζ is encoded by the NFKBIZ gene. Activation and upregulation of NFKBIZ promote the expression and secretion of a series of inflammatory factors downstream of the NF-κB signaling pathway, broadly regulating the functions of various cells, including the mononuclear phagocyte system, natural killer (NK) cells, T cells, B cells, and epithelial cells. It has been shown to be a key regulator of inflammatory processes and immune regulation. Ocular surface diseases, such as dry eye, keratitis, conjunctivitis, and blepharitis, are among the most common ophthalmic conditions, all of which are associated with inflammation. Inhibiting the expression of inflammatory factors can be therapeutically effective. Therefore, regulating NFKBIZ gene expression is a potential therapeutic approach for treating these conditions.

[0004] Small interfering RNA (siRNA), a key effector molecule in RNA interference (RNAi) technology, induces the specific degradation of target gene mRNA in vivo through double-stranded RNA (dsRNA), leading to varying degrees of gene silencing and holds great potential for therapeutic treatment. Compared to small molecule drugs, siRNA offers advantages such as a rich target population, reduced resistance, long-lasting efficacy, and ease of synthesis and production. Compared to the challenges faced by antibodies, which include high cost, potential systemic toxicity, and anti-antibody production, siRNA offers the advantages of longer-lasting efficacy and greater safety. Furthermore, siRNA drugs have gained increasing favor among pharmaceutical companies in recent years due to their higher probability of drug success and time-saving and convenient R&D and production processes. Therefore, targeting inflammatory response-related genes, such as NFKBIZ, through siRNA technology for immune regulation holds great promise. However, limited reports exist on siRNA targeting NFKBIZ, and their knockdown efficiency is low, failing to meet the requirements for efficient inhibition of NFKBIZ gene expression.

[0005] In addition, several siRNA drugs have been approved for the treatment of liver-related diseases, but research and development is still needed for the treatment of non-liver diseases. As one of the most delicate organs in the human body, the eye has unique anatomical and physiological characteristics, and the common method of drug administration is local administration to the eye, with eye drops, eye ointments, and eye gels as the main dosage forms. For immune-related diseases, existing small molecule immunomodulatory drugs in clinical practice have difficulties in drug delivery, such as poor water solubility, toxic side effects of high-frequency repeated administration, low bioavailability, only 5% to 10% of the dose reaching the target tissue, and poor patient compliance. Summary of the Invention

[0006] In view of this, the purpose of the present application is to provide a pharmaceutical composition for inhibiting NFKBIZ gene expression, which is a conjugate formed by a targeting ligand molecule and a nucleic acid molecule with gene regulatory function. The targeting ligand molecule is used to target ocular tissue-specific proteins, thereby improving the efficiency of nucleic acid molecules entering ocular surface cells and efficiently downregulating NFKBIZ gene expression, thereby efficiently inhibiting the expression of IκB-ζ protein at the protein level, ultimately solving the problem of gene drug delivery, improving the bioavailability of drugs, and achieving effective treatment of related diseases.

[0007] The present application provides a pharmaceutical composition for inhibiting NFKBIZ gene expression, comprising a nucleic acid molecule for inhibiting NFKBIZ gene expression and a targeting ligand molecule for targeting ocular tissue-specific proteins.

[0008] Preferably, the nucleic acid molecule comprises at least one nucleotide sequence selected from the following items A and B:

[0009] A. the sense strand of the nucleic acid molecule is selected from at least one of the following numbered nucleotide sequences: SEQ ID NO: 1 to SEQ ID NO: 18, SEQ ID NO: 25 to SEQ ID NO: 49, SEQ ID NO: 51 to SEQ ID NO: 89, SEQ ID NO: 93 to SEQ ID NO: 108, SEQ ID NO: 113 to SEQ ID NO: 132, SEQ ID NO: 134 to SEQ ID NO: 135, SEQ ID NO: 138, SEQ ID NO: 143 to SEQ ID NO: 152, SEQ ID NO: 154 to SEQ ID NO: 161, SEQ ID NO: 169 to SEQ ID NO: 185, and SEQ ID NO: 421;

[0010] The antisense strand of the nucleic acid molecule is selected from at least one of the following numbered nucleotide sequences: SEQ ID NO: 211 to SEQ ID NO: 228, SEQ ID NO: 235 to SEQ ID NO: 259, SEQ ID NO: 261 to SEQ ID NO: 299, SEQ ID NO: 303 to SEQ ID NO: 318, SEQ ID NO: 323 to SEQ ID NO: 342, SEQ ID NO: 344 to SEQ ID NO: 345, SEQ ID NO: 348, SEQ ID NO: 353 to SEQ ID NO: 362, SEQ ID NO: 364 to SEQ ID NO: 371, SEQ ID NO: 379 to SEQ ID NO: 395, and SEQ ID NO: 422;

[0011] B. Based on the nucleotide sequence of item A, 2 to 3 bases are added, deleted or replaced continuously or discontinuously, and the nucleotide sequence has a nucleotide sequence that targets the NFKBIZ gene and exerts an inhibitory effect.

[0012] Preferably, a dangling single strand is further provided at the end of the sense strand or antisense strand of the nucleic acid molecule.

[0013] Preferably, the length of the dangling single strand is 1 to 3 nt.

[0014] Preferably, the nucleic acid molecule comprises any one or more of the following modified nucleotides: deoxy-nucleotides, 3'-terminal deoxy-thymine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, conformationally restricted nucleotides, constrained ethyl nucleotides, abasic nucleotides, 2'-amino modified nucleotides, 2'-O-allyl modified nucleotides, 2'-C-alkyl modified nucleotides, 2'-hydroxyl modified nucleotides, 2'-methoxyethyl modified nucleotides, 2'-O-alkyl modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides containing non-natural bases, tetrahydropyran modified nucleotides, 1,5-anhydrohexitol modified nucleotides, cyclohexenyl modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphates and nucleotides containing 5'-phosphate mimetics.

[0015] Preferably, the targeting ligand molecule targeting ocular tissue-specific proteins comprises at least one of the following: a nucleic acid aptamer targeting ocular tissue-specific proteins, a compound modified with boronic acid or its derivatives, or a compound modified with phenylboronic acid or its derivatives.

[0016] Preferably, the eye tissue-specific protein comprises at least one of the following: mucin, integrin and CD44;

[0017] The mucin comprises at least one of the following: MUC-1, MUC-4, and MUC-16;

[0018] The integrin includes at least one of the following: α V β1, α V β3, α V β6, α5β1, α6β1, α V β1, α V β5, α6β4 and α1β1.

[0019] Preferably, the nucleotide sequence of the nucleic acid aptamer targeting mucin MUC-1 is shown in SEQ ID NO: 423;

[0020] The nucleotide sequence of the nucleic acid aptamer targeting mucin MUC-16 is shown in SEQ ID NO: 424;

[0021] Targeting integrin α V The nucleotide sequence of the nucleic acid aptamer of β3 is shown in SEQ ID NO: 425.

[0022] The nucleotide sequence of the CD44-targeting nucleic acid aptamer is shown in SEQ ID NO: 426.

[0023] Preferably, the nucleic acid aptamer further comprises a nucleic acid aptamer modified with enhanced stability;

[0024] The stability-enhancing modifications include at least one of the following: phosphorothioate backbone modification, 2'-oxymethyl modification, 2'-methoxyethyl modification, 2'-fluoro modification, inverted thymidine (Inverted dT) modification, deoxythymidine nucleotide, and polyethylene glycol terminal conjugation.

[0025] Preferably, the compound modified with boronic acid or its derivatives or the compound modified with phenylboronic acid or its derivatives is a linear or branched compound with terminal modification of boronic acid or phenylboronic acid or its derivatives;

[0026] The number of modified boronic acid or its derivatives or phenylboronic acid or its derivatives on the linear or branched compound is 1 to 40;

[0027] Preferably, the structural formula of the compound modified with boronic acid or its derivatives or the compound modified with phenylboronic acid or its derivatives is as shown in any one of Formulas 1 to 10:

[0028] In formulas 1 to 10, A and G are each independently absent, -(CH2) h -or-(CH2) h - is a group in which any one or more methylene groups are replaced by M groups; said h is 0 to 15; said M groups include: -O-, -S-, -C(O)-, -C(O)O-, -C(O)NH-, -CH(T C )-, -C(T')(T”)-, -NH-, -N(T N )-, -SS-, -C(T')=C(T”)-, -C≡C-, and One or more of the following;

[0029] T in the M group C 、T N , T', T" indicates that any one or more hydrogen atoms on the designated atom are replaced by L, provided that the normal valence of the designated atom is not exceeded and the substitution forms a stable compound, the designated atom includes a carbon atom or a nitrogen atom; the L group includes any one of the following: C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, hydroxyl, oxo, carboxyl, cycloalkyl, cycloalkenyl, heterocyclyl, heteroaryl, aryl, ketone, alkoxycarbonyl, aryloxycarbonyl, heteroaryloxycarbonyl or halogen; the halogen includes F, Cl, Br or I; (O) in A represents a carbonyl oxygen atom;

[0030] D, E, and H are each independently absent, -O-, -S-, -C(O)-, -NH-, -CH2-, -C(O)NH-, -NHC(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)NH-, -NHC(O)O-, and One or more of the following: (O) in the D, E, and H groups represents a carbonyl oxygen atom; Indicates the connection position of the structural formula; the A, G, D, E, and H are not absent at the same time;

[0031] K represents boric acid or its derivatives or phenylboronic acid and its derivatives; m, n, and t are independently 1 to 15.

[0032] Preferably, the targeting ligand molecule is directly covalently coupled to the end of the nucleic acid molecule.

[0033] Preferably, when the targeting ligand molecule is a nucleic acid aptamer, the phosphate group of the nucleic acid aptamer is covalently coupled to the ribose of the nucleic acid molecule.

[0034] Preferably, when the targeting ligand molecule is a compound modified with boronic acid or its derivatives or a compound modified with phenylboronic acid or its derivatives, the targeting ligand molecule is covalently coupled to the phosphate group or base at the end of the nucleic acid molecule;

[0035] When covalently coupled to the phosphate group at the end of the nucleic acid molecule, the targeting ligand molecule is coupled via the X group; the X group represents -O- or -S-.

[0036] Preferably, the targeting ligand molecule is covalently coupled to the nucleic acid molecule via an extension sequence connected to the end of the nucleic acid molecule.

[0037] Preferably, the extension sequence includes an extension sequence with only one end connected to the end of the nucleic acid molecule and / or an extension sequence with one end connected to the 3' end of one chain of the nucleic acid molecule and the other end connected to the 5' end of the complementary chain of the nucleic acid molecule or not connected to form a stem-loop structure.

[0038] Preferably, the length of the extended sequence is 1 to 40 nt; and the extended sequence is a random nucleotide sequence.

[0039] Preferably, when the targeting ligand molecule is a nucleic acid aptamer, the phosphate group of the nucleic acid aptamer is covalently coupled to the ribose of the extension sequence.

[0040] Preferably, when the targeting ligand molecule is a compound modified with boronic acid or its derivatives or a compound modified with phenylboronic acid or its derivatives, the targeting ligand molecule is covalently coupled to one or more phosphate groups or bases on the extended sequence;

[0041] When covalently coupled to the phosphate group of the extension sequence, the targeting ligand molecule is coupled via the X group; the X group represents -O- or -S-.

[0042] The present application provides the use of the pharmaceutical composition in preparing drugs for preventing and / or treating eye diseases.

[0043] Preferably, the eye disease includes one or more of the following: dry eyes, keratitis, conjunctivitis and blepharitis.

[0044] The present application provides a pharmaceutical composition for inhibiting NFKBIZ gene expression, comprising the nucleic acid molecule and a targeting ligand molecule. By coupling the nucleic acid molecule and the targeting ligand molecule, the present application addresses the problems of existing immunomodulatory drugs commonly used for ophthalmic diseases, such as poor water solubility, poor compliance with high-frequency repeated dosing, toxic side effects, low bioavailability, and poor patient compliance. Furthermore, the present application screens target molecules specifically recognized by ocular surface tissue based on the structural characteristics of ocular tissue, enabling targeted and efficient delivery of functional nucleic acids, thereby enabling the functional nucleic acids to effectively exert their biological effects. Furthermore, the pharmaceutical composition provided herein for inhibiting NFKBIZ gene expression is simple in composition and easy to synthesize, offering promising prospects for translational applications.

[0045] Furthermore, the present application specifically defines the sequence of the nucleic acid molecule. Using the NFKBIZ gene (GenBank accession number: NM_031419.4) as a template, the present application obtained 210 pairs of double-stranded ribonucleic acid molecules through siRNA design, and further verified the gene silencing efficiency of the siRNA at the gene level and protein level using qPCR and Western blot. The results showed that the multiple siRNAs screened in the present application were able to effectively inhibit the expression of NFKBIZ mRNA, and were confirmed to have the property of inhibiting the expression of IκB-ζ at the protein level. It can be seen that the present application provides a group of nucleic acid molecules that can specifically inhibit the expression of the NFKBIZ gene and protein IκB-ζ. Compared with existing small molecule immune drugs, they have advantages such as low resistance and long-term effectiveness, providing a basis for preventing and treating inflammatory-related diseases by inhibiting the expression of inflammatory factors.

[0046] Furthermore, the targeting ligand molecules involved in this application are specifically limited to two categories, one is nucleic acid aptamers, and the other is boric acid / phenylboronic acid and its derivatives. Among them, nucleic acid aptamers are coupled to nucleic acid molecules. Based on the targeting effect of nucleic acid aptamers and eye-specific tissue proteins, the efficiency of nucleic acid molecules entering cells is improved, thereby improving the NFKBIZ gene inhibition effect in ocular surface cells, improving the retention and adhesion ability of gene drug compositions on the ocular surface, increasing bioavailability and reducing drug loss, and achieving effective treatment of ocular surface diseases. At the same time, this application can effectively improve the entry of nucleic acid molecules into cells and improve the NFKBIZ gene inhibition effect by coupling boric acid / phenylboronic acid and its derivatives of different valence states to nucleic acid molecules directly or through extended sequences, thereby achieving the treatment of ocular surface diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] FIG1 is a schematic diagram of a pharmaceutical composition formed by a nucleic acid molecule and a targeting ligand molecule provided by the present application;

[0048] Figure 2 is a schematic diagram of the coupling of nucleic acid aptamers with nucleic acid molecules through extended sequences, wherein Represents the part of the nucleic acid molecule, the base can be A adenine, G guanine, C cytosine, U uracil; represents the extended sequence portion, which can be a ribonucleotide molecule or a deoxyribonucleotide molecule, and the base can be any one of A adenine, G guanine, C cytosine, and T thymine, and n is 1-40 bases in length; represents the aptamer part;

[0049] Figure 3 is a schematic diagram of the covalent coupling of a nucleic acid molecule to form a stem-loop structure and a targeting ligand molecule;

[0050] FIG4 is a graph showing the qPCR results of siRNA screening for inhibiting the NFKBIZ gene;

[0051] FIG5 is a Western-blot result of siRNA for inhibiting NFKBIZ gene on IκB-ζ protein expression;

[0052] FIG6 is a polyacrylamide gel electrophoresis diagram of the Apt-siNFKBIZ gene drug composition;

[0053] FIG7 shows the results of targeted uptake of the Apt-siNFKBIZ-Cy3 gene drug composition by HCEC cells; A is the result of laser confocal microscopy, and B is the result of flow cytometry;

[0054] FIG8 is a graph showing the qPCR results of the NFKBIZ gene silencing effect of the Apt-siNFKBIZ gene pharmaceutical composition on HCEC cells;

[0055] FIG9 is a Western-blot result showing the inhibition of IκBζ protein expression in HCEC cells by the Apt-siNFKBIZ gene drug composition;

[0056] FIG10 is a fluorescence imaging diagram of the Apt-siNFKBIZ-M gene drug composition retained in mouse ocular surface tissue sections;

[0057] FIG11 shows the in vivo dry eye treatment results of the Apt-siNFKBIZ-M gene drug composition, wherein A is a sodium fluorescein staining image; B is a sodium fluorescein staining score image; and C is a tear secretion result image;

[0058] FIG12 is a synthetic route of the PBA-siNFKBIZ gene pharmaceutical composition;

[0059] FIG13 is a result of verifying the cellular uptake ability of the PBA-siNFKBIZ-Cy3 gene drug composition; A is a laser confocal micrograph; B is a flow cytometry quantitative image;

[0060] FIG14 is a qPCR validation of the cell gene regulation ability of the PBA-siNFKBIZ gene medicine composition;

[0061] FIG15 shows the results of the in vivo dry eye treatment evaluation of the PBA-siNFKBIZ-M gene drug composition, wherein A shows the analysis of the sodium fluorescein score of the mouse ocular surface on days 0, 7, and 14 of treatment; B shows the results of the phenol red cotton thread tear test on days 0, 7, and 14 of treatment;

[0062] Figure 16 is a synthetic route for 2PBA-MAL;

[0063] Figure 17 is a H-NMR spectrum of compound 3;

[0064] Figure 18 is a C NMR spectrum of compound 3;

[0065] Figure 19 is a H-NMR spectrum of compound 4;

[0066] Figure 20 is a C NMR spectrum of compound 4;

[0067] Figure 21 is a H-NMR spectrum of compound 5;

[0068] Figure 22 is the C NMR spectrum of compound 5;

[0069] Figure 23 is a synthetic route for the 2PBA-siNFKBIZ-S conjugate;

[0070] FIG24 is a 20% non-denaturing polypropylene gel verifying the synthesis of the 2PBA-siNFKBIZ gene drug composition;

[0071] FIG25 is a result of verifying the cellular uptake ability of the 2PBA-siNFKBIZ-Cy3 gene drug composition, wherein A is a laser confocal micrograph; B is a flow cytometry quantitative image;

[0072] FIG26 is a qPCR validation of the cell gene regulation ability of the 2PBA-siNFKBIZ pharmaceutical composition;

[0073] FIG27 shows the results of the in vivo dry eye treatment evaluation of the 2PBA-siNFKBIZ-M gene drug composition, wherein A is a sodium fluorescein staining image of the mouse ocular surface; B is the data analysis of the sodium fluorescein score of the mouse ocular surface on days 0, 7, and 14 of treatment; C is the results of the phenol red cotton tear test on days 0, 7, and 14 of treatment of the mouse;

[0074] Figure 28 is a 4PBA-NH2 synthesis route;

[0075] Figure 29 is a H-NMR spectrum of compound 7;

[0076] Figure 30 is the C NMR spectrum of compound 7;

[0077] Figure 31 is a H-NMR spectrum of compound 8;

[0078] Figure 32 is the C NMR spectrum of compound 8;

[0079] Figure 33 is the H-NMR spectrum of compound 11;

[0080] Figure 34 is the C NMR spectrum of compound 11;

[0081] Figure 35 is a synthetic route for the 4PBA-siNFKBIZ-S conjugate;

[0082] FIG36 is a 20% non-denaturing polypropylene gel verifying the synthesis of the 4PBA-siNFKBIZ gene drug composition;

[0083] FIG37 is an evaluation of the cellular uptake ability of the 4PBA-siNFKBIZ-FAM gene drug composition; A is a laser confocal micrograph; B is a flow cytometry quantitative image;

[0084] Figure 38 shows the results of cell biological evaluation of the 4PBA-siNFKBIZ gene drug composition. A is a qPCR result of the 4PBA-siNFKBIZ gene drug composition regulating the NFKBIZ gene; B is a Western-blot result of the 4PBA-siNFKBIZ gene drug composition regulating the IκB-ζ protein.

[0085] FIG39 shows the results of the in vivo dry eye treatment efficacy evaluation of the 4PBA-siNFKBIZ-M gene drug composition, wherein A is a sodium fluorescein staining image of the mouse ocular surface; B is the data analysis of the sodium fluorescein score of the mouse ocular surface on days 0, 7, and 14 of treatment; C is the results of the phenol red cotton tear test on days 0, 7, and 14 of treatment of the mouse;

[0086] Figure 40 is a synthetic route for 6PBA-N3;

[0087] Figure 41 is the H NMR spectrum of compound 13;

[0088] Figure 42 is the H NMR spectrum of compound 15;

[0089] Figure 43 is the C NMR spectrum of compound 15;

[0090] Figure 44 is a synthetic route of 6PBA-siNFKBIZ-S conjugate;

[0091] FIG45 is a 20% non-denaturing polypropylene gel verifying the synthesis of the 6PBA-siNFKBIZ gene drug composition;

[0092] FIG46 shows the evaluation results of the cellular uptake ability of the 6PBA-siNFKBIZ-FAM gene drug composition, wherein A is a laser confocal microscopy image; B is a flow cytometry quantitative image;

[0093] Figure 47 shows the results of cell biological evaluation of the 6PBA-siNFKBIZ gene drug composition, A is a graph showing the qPCR results of the 6PBA-siNFKBIZ gene drug composition regulating the NFKBIZ gene; B is a graph showing the Western-blot results of the 6PBA-siNFKBIZ gene drug composition regulating the IκB-ζ protein;

[0094] FIG48 shows the results of the in vivo dry eye treatment efficacy evaluation of the 6PBA-siNFKBIZ-M gene drug composition, wherein A is a sodium fluorescein staining image of the mouse ocular surface; B is the data analysis of the sodium fluorescein score of the mouse ocular surface on days 0, 7, and 14 of treatment; C is the results of the phenol red cotton thread tear test on days 0, 7, and 14 of treatment of the mouse;

[0095] Figure 49 shows PBA 10 -Synthetic route of siNKKBIZ-S conjugates;

[0096] Figure 50 is a 10% non-denaturing polyacrylamide gel to verify PBA 10 -Synthesis of siNFKBIZ gene drug composition;

[0097] Figure 51 is the flow cytometer verification of PBA 10-The results of the cellular uptake ability of the siNFKBIZ-FAM gene drug composition at different times;

[0098] Figure 52 is a qPCR experiment to verify PBA 10 -Gene regulation ability of siNFKBIZ gene drug combination;

[0099] Figure 53 shows PBA 10 - Results of in vivo dry eye treatment efficacy evaluation of the siNFKBIZ-M gene drug composition, where A is a fluorescein sodium staining image of the mouse ocular surface; B is the data analysis of the fluorescein sodium score of the mouse ocular surface on days 0, 7, and 14 of treatment; C is the results of the phenol red cotton tear test of the mouse on days 0, 7, and 14 of treatment;

[0100] Figure 54 is a synthetic route for 2PBA-Br;

[0101] Figure 55 is the H NMR spectrum of compound 18;

[0102] Figure 56 is the C NMR spectrum of compound 18;

[0103] Figure 57 shows the synthetic route of the PBA6-siNKKBIZ-S conjugate.

[0104] FIG58 is a diagram showing the synthesis of the PBA6-siNFKBIZ gene drug composition verified by 20% non-denaturing polyacrylamide;

[0105] Figure 59 is the evaluation results of the cellular uptake ability of the PBA6-siNFKBIZ-FAM gene drug composition, wherein A is a confocal image of HCEC cells taking up the PBA6-siNFKBIZ-FAM gene drug composition; B is a flow cytometry quantitative image of HCEC cells taking up the PBA6-siNFKBIZ-FAM gene drug composition;

[0106] Figure 60 shows the results of cell biological evaluation of the PBA6-siNFKBIZ gene pharmaceutical composition, A is a graph showing the qPCR results of the PBA6-siNFKBIZ gene pharmaceutical composition regulating the NFKBIZ gene; B is a graph showing the Western-blot results of the PBA6-siNFKBIZ gene pharmaceutical composition regulating the NFKBIZ gene;

[0107] Figure 61 shows the evaluation results of the in vivo dry eye treatment effect of the PBA6-siNFKBIZ-M gene drug composition, wherein A is a picture of sodium fluorescein staining of the mouse ocular surface; B is the data analysis results of the sodium fluorescein score of the mouse ocular surface on the 0th, 7th and 14th days of treatment; C is the phenol red cotton thread tear test results of the mouse on the 0th, 7th and 14th days of treatment. DETAILED DESCRIPTION

[0108] The present application provides a pharmaceutical composition for inhibiting NFKBIZ gene expression, comprising a nucleic acid molecule for inhibiting NFKBIZ gene expression and a targeting ligand molecule for targeting ocular tissue-specific proteins.

[0109] In the present application, the nucleic acid molecule is a double-stranded nucleic acid molecule designed based on the NFKBIZ gene (GenBank accession number: NM_031419.4) as a template and according to the siRNA design principles, which has a complementary relationship with at least 15 consecutive nucleotides in the sense chain or antisense chain of the NFKBIZ gene. In the present application, the nucleic acid molecule comprises at least one of the following nucleotide sequences: A. the sense strand of the nucleic acid molecule is selected from at least one of the following numbered nucleotide sequences: SEQ ID NO: 1 to SEQ ID NO: 18, SEQ ID NO: 25 to SEQ ID NO: 49, SEQ ID NO: 51 to SEQ ID NO: 89, SEQ ID NO: 93 to SEQ ID NO: 108, SEQ ID NO: 113 to SEQ ID NO: 132, SEQ ID NO: 134 to SEQ ID NO: 135, SEQ ID NO: 138, SEQ ID NO: 143 to SEQ ID NO: 152, SEQ ID NO: 154 to SEQ ID NO: 161, SEQ ID NO: 169 to SEQ ID NO: 185, and SEQ ID NO: 421; the antisense strand of the nucleic acid molecule is selected from at least one of the following numbered nucleotide sequences: SEQ ID NO: 211 to SEQ ID NO: 228, SEQ ID NO: 235 to SEQ ID NO: 259, SEQ ID NO: 261 to SEQ ID NO: 299, SEQ ID NO: 301 to SEQ ID NO: 310 SEQ ID NO: 303 to SEQ ID NO: 318, SEQ ID NO: 323 to SEQ ID NO: 342, SEQ ID NO: 348, SEQ ID NO: 344 to SEQ ID NO: 345, SEQ ID NO: 353 to SEQ ID NO: 362, SEQ ID NO: 364 to SEQ ID NO: 371, SEQ ID NO: 379 to SEQ ID NO: 395, and SEQ ID NO: 422; B. Based on the nucleotide sequence of item A, the sequence continuously or discontinuously adds, deletes, or replaces 2 to 3 bases, and has a nucleotide sequence that targets the NFKBIZ gene and exerts an inhibitory effect. Experiments have shown that the nucleic acid molecules protected in this application can effectively target the NFKBIZ gene sequence. Double-stranded nucleic acid molecules have advantages over existing small molecule immune drugs, such as low resistance to drug resistance and long-term effectiveness. The length of the nucleic acid molecule is preferably 15 to 30 bp.A total of 210 pairs of nucleic acid molecules were designed in this application. Their inhibitory effects on the NFKBIZ gene were verified by qPCR technology, and their inhibition of the expression of the IκB-ζ protein encoded by the NFKBIZ gene was verified by Western blot technology. The results showed that the nucleic acid molecules protected by the present application scheme have the characteristics of high target gene silencing efficiency compared with other nucleic acid molecules designed in the same batch. The nucleic acid molecules can be synthesized by standard methods known in the art, such as by using an automated nucleic acid synthesizer. In specific embodiments, the species of the NFKBIZ gene preferably includes human and / or mouse sources.

[0110] In the present application, the end of the sense strand or antisense strand of the nucleic acid molecule is preferably further provided with a hanging single strand. The length of the hanging single strand is preferably 1 to 3 nt, more preferably 2 nt. The present application has no special restrictions on the nucleotide sequence of the hanging single strand, and the sequence of the hanging single strand well known in the art can be used. In the embodiments of the present application, the sequence of the hanging single strand is preferably a sequence formed by U or T oligomerization or a sequence complementary to the downstream sequence of the nucleic acid molecule targeting region on the NFKBIZ gene template. The position of the hanging single strand is preferably at one end of the nucleic acid molecule. When the nucleic acid molecule is connected to an extension sequence, the hanging single strand and the extension sequence are preferably connected to different ends of the nucleic acid molecule, respectively.

[0111] In the present application, the nucleic acid molecule comprises any one or more of the following modified nucleotides: deoxy-nucleotides, 3'-terminal deoxy-thymine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, conformationally restricted nucleotides, constrained ethyl nucleotides, abasic nucleotides, 2'-amino modified nucleotides, 2'-O-allyl modified nucleotides, 2'-C-alkyl modified nucleotides, 2'-hydroxyl modified nucleotides, 2'-methoxyethyl modified nucleotides, 2'-O-alkyl modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides containing non-natural bases, tetrahydropyran modified nucleotides, 1,5-anhydrohexitol modified nucleotides, cyclohexenyl modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate esters and nucleotides containing 5'-phosphate mimetics. The modifications are beneficial to improving the stability of the nucleic acid molecule.

[0112] In this application, the schematic structural diagram of the pharmaceutical composition is shown in Figure 1. The targeting ligand molecule targeting ocular tissue-specific proteins preferably includes a nucleic acid aptamer, a compound modified with boronic acid or its derivatives, or a compound modified with phenylboronic acid or its derivatives. The ocular tissue-specific proteins preferably include at least one of the following: mucins, integrins, and CD44. The mucins preferably include at least one of the following: MUC-1, MUC-4, and MUC-16. Ocular mucins are a group of high-molecular-weight glycoproteins that are widely present on the ocular surface. They are classified into two major types: secretory and membrane-associated mucins. They play a vital role in lubricating the ocular surface and maintaining ocular surface homeostasis. Ocular mucins are closely associated with various ocular surface diseases, including dry eye, infection, allergies, and immune-related disorders. Mucins bind water to form gels, preventing tear evaporation, and interact with various inflammatory factors, playing a vital role in maintaining the ocular epithelial barrier. Mucins are classified into two major types: secretory and membrane-associated mucins. MUC1, MUC4, and MUC16 are the main membrane-associated mucins in the human eye and can be detected in the cornea, conjunctiva, and lacrimal glands. MUC1 and MUC16 mRNA are expressed in equal amounts in the conjunctiva and cornea, but MUC4 mRNA is expressed most highly in the conjunctival epithelium and less highly in the corneal epithelium. Corneal epithelial cells have been shown to express integrins and are a source of inflammatory cytokines in dry eye. In addition, inflammatory Th17 cells express a large amount of α V β3 integrin, which is crucial for maintaining the Th17 inflammatory phenotype, such as the production of IL-17 in dry eyes and IL-17-induced corneal epithelial barrier destruction. In addition, CD44 protein is a transmembrane protein expressed on the surface of corneal epithelial cells. CD44 protein is involved in the migration and adhesion process of damage repair. Therefore, this application is based on targeting mucin, integrin and CD44 protein to improve the efficiency of nucleic acid molecule silencing, and designs ocular surface tissue cell-targeted nucleic acid aptamers and gene drug compositions (Apt-siNFKBIZ) that inhibit the NFKBIZ gene. Nucleic acid aptamers targeting mucin MUC-1 (Apt MUC1 The nucleotide sequence of ) is preferably as shown in SEQ ID NO: 423. Nucleic acid aptamer targeting mucin MUC-16 (Apt MUC16 ) is preferably represented by SEQ ID NO: 424. Targeting integrin α V The nucleotide sequence of the nucleic acid aptamer targeting β3 is shown in SEQ ID NO: 425. The nucleotide sequence of the nucleic acid aptamer targeting CD44 protein is shown in SEQ ID NO: 426.

[0113] In the present application, the nucleic acid aptamer preferably also includes a nucleic acid aptamer modified to enhance stability. The stability-enhancing modification preferably includes at least one of the following: phosphorothioate backbone modification, 2'-oxymethyl modification, 2'-methoxyethyl modification, 2'-fluoro modification, reverse thymidine modification, deoxythymidine nucleotide, and polyethylene glycol terminal conjugation.

[0114] In the present application, the compound modified with boronic acid or its derivatives or the compound modified with phenylboronic acid or its derivatives is a linear or branched compound with terminal modification of boronic acid or phenylboronic acid. The number of modifications of boronic acid or its derivatives or phenylboronic acid or its derivatives on the linear or branched compound is 1 to 40, more preferably 2 to 20, and even more preferably 3 to 10. The structural formula of the compound modified with boronic acid or its derivatives or the compound modified with phenylboronic acid or its derivatives is shown in any one of Formulas 1 to 10:

[0115] In formulas 1 to 10, A and G are each independently absent, -(CH2) h -or-(CH2) h - is a group in which any one or more methylene groups are replaced by M groups; said h is 0 to 15; said M groups include: -O-, -S-, -C(O)-, -C(O)O-, -C(O)NH-, -CH(T C )-, -C(T')(T”)-, -NH-, -N(T N )-, -SS-, -C(T')=C(T”)-, -C≡C-, and One or more of the following;

[0116] T in the M group C 、T N , T', T" indicates that any one or more hydrogen atoms on the designated atom are replaced by L, provided that the normal valence of the designated atom is not exceeded and the substitution forms a stable compound, the designated atom includes a carbon atom or a nitrogen atom; the L group includes any one of the following: C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, hydroxyl, oxo, carboxyl, cycloalkyl, cycloalkenyl, heterocyclyl, heteroaryl, aryl, ketone, alkoxycarbonyl, aryloxycarbonyl, heteroaryloxycarbonyl or halogen; the halogen includes F, Cl, Br or I; (O) in A represents a carbonyl oxygen atom;

[0117] D, E, and H are each independently absent, -O-, -S-, -C(O)-, -NH-, -CH2-, -C(O)NH-, -NHC(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)NH-, -NHC(O)O-, and One or more of the following: (O) in the D, E, and H groups represents a carbonyl oxygen atom; represents the connection position of the structural formula; the A, G, D, and H are not absent at the same time; K represents boronic acid or its derivatives or phenylboronic acid and its derivatives; m, n, and t are independently 1 to 15.

[0118] In this application, phenylboronic acid and its derivatives, or boric acid and its derivatives, can reversibly covalently bind to 1,2-dihydroxy compounds or 1,3-dihydroxy compounds, effectively recognizing substances such as sialic acid and carbohydrates. Numerous compounds such as carbohydrates and glycoproteins exist on cell membrane surfaces. Phenylboronic acid can form cyclic boronates with polyhydroxy compounds such as carbohydrates, thus finding widespread application in carbohydrate and cell recognition. Ocular epithelial cells contain a glycocalyx barrier composed of numerous highly glycosylated glycoproteins, the primary components of which are the transmembrane mucins MUC1, MUC4, MUC16, and galectin-3, which act as lubricants, moisturizers, and barriers on the ocular surface. Therefore, in this application, a pharmaceutical composition was designed and prepared based on dynamic covalent or non-covalent interactions between phenylboronic acid and protein glycosyl groups, by grafting the sense chain of siNFKBIZ onto the end of the compound. This composition exhibits excellent ocular surface retention properties. The specific interaction between phenylboronic acid and the MUC protein expressed on the surface of ocular surface cells effectively promotes cellular uptake and more efficiently exerts its biological effects.

[0119] In the present application, the targeting ligand molecule is preferably directly covalently coupled to the end of the nucleic acid molecule.

[0120] When the targeting ligand molecule is a nucleic acid aptamer, the phosphate group of the nucleic acid aptamer is preferably covalently coupled to the ribose of the nucleic acid molecule. When the targeting ligand molecule is a compound modified with boronic acid or its derivatives or a compound modified with phenylboronic acid or its derivatives, the targeting ligand molecule is preferably covalently coupled to the phosphate group or base at the end of the nucleic acid molecule backbone. When the targeting ligand molecule is preferably covalently coupled to the phosphate group at the end of the nucleic acid molecule, the structural formula of the pharmaceutical composition is preferably at least one of Formulas 11 to 20;

[0121] In Formulae 11 to 20, the X group represents -O- or -S-.

[0122] In the present application, when the targeting ligand molecule is preferably covalently coupled to the base at the end of the nucleic acid molecule, the structural formula of the pharmaceutical composition is preferably at least one of Formulas 21 to 30:

[0123] In formulas 21 to 30, Q represents a base, and R represents -H or -OH;

[0124] In Equations 11 to 30, Represents a nucleic acid molecule.

[0125] In the present application, the targeting ligand molecule is preferably covalently coupled to the nucleic acid molecule via an extension sequence attached to the terminus of the nucleic acid molecule. The extension sequence preferably includes an extension sequence that is attached to the terminus of the nucleic acid molecule at only one end and / or an extension sequence that is attached to the 3' end of one strand of the nucleic acid molecule at one end and, or not attached to the 5' end of the complementary strand of the nucleic acid molecule at the other end, forming a stem-loop structure. The extension sequence is preferably 1 to 40 nt in length and is preferably a random nucleotide sequence, such as an oligonucleotide sequence, such as TTTTTT.

[0126] In the present application, when the targeting ligand molecule is preferably a nucleic acid aptamer, the phosphate group of the nucleic acid aptamer is preferably covalently coupled to the ribose of the extension sequence. Figure 2 is a schematic diagram of a pharmaceutical composition formed by covalently coupling a nucleic acid aptamer to a nucleic acid molecule through an extension sequence. The length of the extension sequence is preferably 1 to 40 nt, which can be used to couple a nucleic acid aptamer and boronic acid or phenylboronic acid or its derivatives. The targeting ligand molecule can also be coupled to a nucleic acid molecule through an extension sequence having a stem-loop structure to form a pharmaceutical composition. The length of the extension sequence is preferably 10 to 40 nt, wherein the 5' end of the extension sequence is connected to a chain of the nucleic acid molecule, and the 3' end of the extension sequence is connected to the end of the complementary chain of the nucleic acid molecule or not connected to form a stem-loop structure, which is mainly used for coupling boronic acid or phenylboronic acid or its derivatives. Figure 3 shows a 16-base stem-loop structure formed at the 3' end of the positive strand of the nucleic acid molecule, and the loop portion of the stem-loop structure is modified with three phosphorothioate backbones (phosphorothioate, PS) (3PS-siNFKBIZ-S), enabling it to couple with the bromo group modified on bromo-diphenylboronic acid (2PBA-Br).

[0127] In this application, the method for preparing a pharmaceutical composition obtained by coupling a nucleic acid aptamer to a nucleic acid molecule preferably involves linking the nucleic acid aptamer directly or via an extended sequence to one strand of the nucleic acid molecule, assembling the aptamer with the complementary strand of the nucleic acid molecule through complementary base pairing, and verifying the result using a non-denaturing polyacrylamide gel to obtain a gene-pharmaceutical composition. This application does not specifically limit the method of coupling; any coupling method known in the art, such as nucleic acid solid-phase synthesis, can be used.

[0128] In one embodiment of the present application, MUC1, MUC16, integrin α V β3, CD44 protein targeting nucleic acid aptamers, and prepared a pharmaceutical composition formed by connecting the extended sequence to the nucleic acid molecule that inhibits the NFKBIZ gene (Apt MUC1 -siNFKBIZ、Apt MUC16 -siNFKBIZ、Apt αvβ3 -siNFKBIZ and Apt CD44 -siNFKBIZ), the pharmaceutical composition is used for the efficient targeted treatment of dry eye. Mucin is a group of high molecular weight glycoproteins that are widely present on the ocular surface. It is divided into two major categories: secretory mucin and membrane-associated mucin. It plays an important role in lubricating the eye and maintaining ocular homeostasis. Ocular mucin is closely related to a variety of ocular diseases, including dry eye, infection, allergy and immune-related diseases. Mucin can connect water to gel and prevent tear evaporation; it can also interact with a variety of inflammatory factors and play an important role in maintaining the ocular epithelial cell barrier. Corneal epithelial cells have been shown to express integrins and are the source of inflammatory cytokines for dry eye; in addition, inflammatory Th17 cells express a large amount of α V β3 integrin, which is crucial for maintaining the Th17 inflammatory phenotype, such as the production of IL-17 in dry eyes and IL-17-induced corneal epithelial barrier destruction. CD44 is a transmembrane protein expressed on the surface of corneal epithelial cells and is involved in the migration and adhesion process of damage repair. Therefore, this application utilizes a method based on targeting MUC1, MUC16, integrin α V β3, CD44 nucleic acid aptamers, and constructed a composition of siNFKBIZ gene drugs with targeting function (Apt MUC1 -siNFKBIZ、Apt MUC16 -siNFKBIZ、Apt αvβ3 -siNFKBIZ and Apt CD44Apt-siNFKBIZ overcomes various ocular surface barriers through its hydrophilic aptamer. It is delivered through the cornea, the largest static barrier on the ocular surface. Receptor-mediated dsRNA enters the cell, passes through the aqueous layer of the tear film, and reaches the eye. It is efficiently taken up by corneal epithelial cells and effectively adsorbed and internalized by the ocular epithelial tissue, achieving efficient delivery of the functional nucleic acid molecule siNFKBIZ. Once inside the cell, the active pharmaceutical ingredient, the nucleic acid molecule, can better exert its immunomodulatory and anti-inflammatory effects, inhibiting the production and release of proinflammatory cytokines, reducing the release of inflammatory factors (interleukin-1, interleukin-17, tumor necrosis factor α) and matrix metalloproteinases, lowering T cell activity to control the immune inflammatory response, regulating immune balance, and effectively improving the symptoms and signs of dry eye caused by long-term inflammation. It further suppresses the inflammatory response in dry eye, promotes the recovery of tear secretion in dry eye patients, interrupts the vicious cycle of dry eye inflammation, and inhibits apoptosis of lacrimal glands and goblet cells, achieving effective treatment for dry eye.

[0129] In the present application, when the targeting ligand molecule is preferably a compound modified with boronic acid or its derivatives or a compound modified with phenylboronic acid or its derivatives, the targeting ligand molecule is covalently coupled to one or more phosphate groups or bases on the extension sequence. When coupled with a phosphate group, the compound modified with boronic acid or its derivatives or the compound modified with phenylboronic acid or its derivatives is coupled to the phosphate group through an X group. The X group represents -O- or -S-. When the compound modified with boronic acid or its derivatives or the compound modified with phenylboronic acid or its derivatives is a monovalent boronic acid or a monovalent phenylboronic acid (Formula 1), when the targeting ligand molecule is coupled to a phosphate group or a base on the extension sequence, the structural formula is shown in Formulas 31 to 36.

[0130] In Equations 31 to 36, Represents a nucleic acid molecule.

[0131] In the present application, when the targeting ligand molecule is a compound modified with boronic acid or its derivatives or a compound modified with phenylboronic acid or its derivatives, the preparation method of the pharmaceutical composition is preferably to couple the compound modified with boronic acid or its derivatives or the compound modified with phenylboronic acid or its derivatives to the phosphate group or base of a chain in a nucleic acid molecule or an extended sequence through a chemical reaction to obtain a conjugate; and annealing and hybridizing the conjugate with the complementary chain of the nucleic acid molecule to obtain a gene drug composition.

[0132] In the present application, the phosphate group or base of one strand of the nucleic acid molecule or extended sequence is preferably modified with a group and then covalently coupled to a compound modified with boronic acid or phenylboronic acid or its derivatives via a chemical reaction to obtain a conjugate. The modifying groups include amino (3'-NH2, Formula 59), sulfhydryl (3'-SH, Formula 60), aldehyde (5'-CHO, Formula 61), dibenzocyclooctyne (3'-DBCO, Formula 62), and the like.

[0133] In the present application, the annealing hybridization condition is preferably such that the molar ratio of the conjugate to the complementary strand of the nucleic acid molecule is preferably 1:1. The temperature of the hybridization annealing is preferably such that the reaction system is heated to 65°C in a PCR instrument, kept at this temperature for 10 minutes, and then annealed at a rate of 4°C per minute until it reaches 25°C.

[0134] In one embodiment of the present application, a pharmaceutical composition PBA-siNFKBIZ is constructed by covalently coupling a single phenylboronic acid (PBA) molecule to a nucleic acid molecule (siNFKBIZ) targeting the nuclear factor κB inhibitor ζ (NFKBIZ) gene. The specific preparation method preferably includes the following steps:

[0135] 4-carboxyphenylboronic acid and a single-stranded nucleic acid molecule modified with an amino group at the 3' end are coupled through an amide chemical reaction to obtain a conjugate;

[0136] The conjugate and the complementary chain of the nucleic acid molecule are hybridized and annealed to obtain the pharmaceutical composition PBA-siNFKBIZ.

[0137] In the present application, the single-stranded nucleic acid molecule modified with an amino group at the 3' end can be commissioned to a gene synthesis company. The amidation reaction condensation agent is preferably dicyclohexylcarbodiimide (DCC), diisopropylcarbodiimide (DIC), 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI), preferably EDCI. The activation reagent of the amidation reaction is preferably N-hydroxysuccinimide (NHS). The temperature of the amidation chemical reaction is preferably 20-55°C, more preferably 25°C. The time of the amidation chemical reaction is preferably 12-48h, more preferably 24h. The amidation chemical reaction is preferably accompanied by shaking, and the shaking speed is preferably 200-4000rpm, more preferably 1000rpm. After the amidation chemical reaction is completed, it is preferred to remove excess 4-carboxyphenylboronic acid and water. The method for removing the 4-carboxyphenylboronic acid is preferably extraction with ethyl acetate. The method for removing water is preferably completed by concentration and distillation. The structural formula of the conjugate is shown in Formula 55.

[0138] in, Represents a connected nucleic acid molecule, and Base represents any type of base.

[0139] In the present application, the molar ratio of the conjugate to the complementary chain of the nucleic acid molecule is preferably 1: 1. The complementary conditions are preferably as follows: the reaction system is heated to 65°C in a PCR instrument, kept at this temperature for 10 minutes, and then annealed at a rate of 4°C per minute to 25°C.

[0140] In the present application, the PBA-siNFKBIZ can be used for the treatment of eye diseases. The present application can achieve targeted delivery of nucleic acid drugs for inhibiting the NFKBIZ gene to achieve targeted treatment of dry eyes by constructing a PBA-siNFKBIZ covalent conjugate. The present application constructs a siNFKBIZ pharmaceutical composition (PBA-siNFKBIZ) based on the dynamic covalent bond between phenylboronic acid and protein glycosyl, and designs and prepares it by grafting the end of the siNFKBIZ positive chain. It has good ocular surface retention properties, and the specific interaction between phenylboronic acid and the sugar chains on the MUC glycoprotein overexpressed on the surface of ocular cells can effectively promote cellular uptake and more efficiently exert biological effects. In addition, small interfering RNA (siNFKBIZ) targeting the NFKBIZ gene can effectively knock down the expression of the NFKBIZ gene in corneal epithelial cells, thereby reducing the expression of IκB-ζ protein, reducing the level of cellular inflammation, and regulating immune balance. The PBA-siNFKBIZ covalent conjugate can enhance its interaction with ocular surface tissue cells due to the presence of PBA. Compared with unmodified oligonucleotides, the PBA-siNFKBIZ conjugate can be better internalized by cells, thereby better exerting its gene regulatory effect and achieving good dry eye treatment effects.

[0141] In one embodiment of the present application, the present application constructs a pharmaceutical composition (2PBA-siNFKBIZ) for inhibiting NFKBIZ gene expression by covalently coupling two PBA molecules to siNFKBIZ by grafting the positive chain end of siNFKBIZ. The specific preparation method preferably includes the following steps:

[0142] The compound of structural formula 37 and the compound of structural formula 38, 4-carboxyphenylboronic acid pinacol ester, were dissolved, EDCI and DMAP (4-dimethylaminopyridine) were added, and the mixture was reacted under nitrogen protection to obtain a compound of structural formula 39;

[0143] reacting the compound of structural formula 39, sodium periodate, and ammonium acetate under nitrogen protection to obtain a compound of structural formula 40;

[0144] The compound of structural formula 40 and 4-maleimidobutyric acid are dissolved in methanol, and 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM) and N-methylmorpholine (NMM) are added for reaction to obtain a compound of structural formula 41;

[0145] The compound of structural formula 41 and a nucleic acid molecule chain modified with a thiol group at the 3' end are subjected to an oscillation reaction to obtain a 2PBA-siNFKBIZ-S conjugate;

[0146] The 2PBA-siNFKBIZ-S conjugate and the complementary chain of the nucleic acid molecule are annealed and hybridized to obtain the pharmaceutical composition 2PBA-siNFKBIZ.

[0147] In the present application, the concentration of the compound having the structural formula 37 is preferably 75.00 mg / mL. The concentration of the 4-carboxyphenylboronic acid pinacol ester is preferably 29.00 mg / mL. The concentration of the EDCI is preferably 22.50 mg / mL. The concentration of the DMAP is preferably 0.75 mg / mL. The reaction temperature is preferably 20 to 50°C, more preferably 25°C. The reaction time is preferably 4 to 48 hours, more preferably 24 hours. After completion of the reaction, the solvent is preferably removed by distillation under reduced pressure and separation and purification are preferably performed. The separation and purification method is preferably crystallization.

[0148] In the present application, the working concentration of the compound of formula 39 is preferably 21.40 mg / mL. The working concentration of sodium periodate is preferably 28.25 mg / mL. The working concentration of ammonium acetate is preferably 10.30 mg / mL. The reaction temperature is preferably 15-50°C, more preferably 25°C. The reaction time is preferably 2-24 hours, more preferably 10 hours. After the reaction is completed, the organic solvent is removed by distillation under reduced pressure, and after washing, the water is removed to obtain a compound of formula 40.

[0149] In the present application, the working concentration of the compound of formula 40 is preferably 14.10 mg / mL. The working concentration of 4-maleimidobutyric acid is preferably 12.20 mg / mL. The working concentration of DMTMM is preferably 19.20 mg / mL. The working concentration of NMM is preferably 68 mg / mL. The reaction temperature is preferably 15 to 50°C, more preferably 25°C. The reaction time is preferably 1 to 10 hours, more preferably 2 hours. After the reaction is completed, the organic solvent is removed by distillation under reduced pressure, and after washing, the water is removed to obtain a compound of formula 41.

[0150] In the present application, a single-stranded nucleic acid molecule modified with a thiol group at the 3' end is commissioned to a gene synthesis company. The temperature of the click chemistry reaction is preferably 20 to 55°C, more preferably 40°C. The time of the click chemistry reaction is preferably 12 to 48 hours, more preferably 24 hours. The click chemistry reaction is preferably accompanied by oscillation, and the oscillation speed is preferably 200-4000rpm, more preferably 1800rpm. After the click chemistry reaction is completed, it is preferred to remove excess compound of structural formula 41 and water. The method for removing the compound of structural formula 41 is preferably to extract and remove it with ethyl acetate. The water is removed by concentration and distillation. The structural formula of the conjugate is shown in Formula 56.

[0151] in, Represents a connected nucleic acid molecule, and Base represents any type of base.

[0152] In the present application, the molar ratio of the conjugate to the complementary chain of the nucleic acid molecule is preferably 1: 1. The hybridization annealing condition is preferably to heat the reaction system to 65°C in a PCR instrument, keep the temperature constant for 10 minutes, and then anneal at a rate of 4°C per minute to 25°C.

[0153] In the present application, the 2PBA-siNFKBIZ utilizes the targeted recognition effect of PBA, and the target head of 2PBA further improves the binding ability with the cell membrane surface membrane protein, thereby achieving efficient delivery of siNFKBIZ and realizing dry eye treatment of 2PBA-siNFKBIZ. This application uses a small molecule target 2PBA in combination with a small interfering RNA drug for the treatment of dry eye. On the one hand, PBA can improve the retention of nucleic acid drugs on the ocular surface due to its binding effect on mucin; on the other hand, PBA can resolve the cell membrane barrier of siNFKBIZ gene drugs to achieve efficient cell delivery due to its recognition effect on MUC protein; secondly, this application utilizes the key role of IκB-ζ in immune regulation to design siRNA drugs, which, combined with the efficient delivery of PBA, can effectively inhibit the gene expression of NFKBIZ; furthermore, compared with the PBA-siNFKBIZ covalent conjugate prepared by coupling a single PBA molecule with siRNA targeting the NFKBIZ gene, the 2PBA-siNFKBIZ covalent conjugate formed after coupling two PBA molecules can better bind to mucin, thereby achieving efficient co-delivery of siNFKBIZ gene drugs, thereby achieving a good dry eye treatment effect.

[0154] In one embodiment of the present application, the present application constructs a pharmaceutical composition (4PBA-siNFKBIZ) for inhibiting NFKBIZ gene expression formed by covalently coupling PBA tetramer molecules with siNFKBIZ by grafting the positive chain end of siNFKBIZ. The specific preparation method is as follows:

[0155] Dissolve the compound of formula 42 and 4-carboxyphenylboronic acid pinacol ester, add DMTMM and NMM, and react under nitrogen protection to obtain a compound of formula 43;

[0156] The compound of formula 43, DIEA, acetic anhydride and DMAP are mixed and reacted under nitrogen protection to separate the compound of formula 44;

[0157] Dissolve the compound of formula 44 and the compound of formula 37, add EDCI and DMAP, and react under nitrogen protection to obtain a compound of formula 45;

[0158] The acetone solution of the compound represented by the structural formula 45 is mixed with an aqueous solution containing sodium periodate and ammonium acetate, and reacted under nitrogen protection to obtain a compound represented by the structural formula 46;

[0159] The ethyl acetate solution of the compound represented by the structural formula 46 is added with hydrogen chloride-ethyl acetate under nitrogen protection to obtain the compound represented by the structural formula 47.

[0160] A click chemistry reaction is performed between the compound of formula 47 and a single-stranded nucleic acid molecule modified with an aldehyde group at the 5' end to obtain a 4PBA-siNFKBIZ-S conjugate;

[0161] Annealing and hybridizing the 4PBA-siNFKBIZ-S conjugate and the complementary strand of the nucleic acid molecule to obtain the pharmaceutical composition 4PBA-siNFKBIZ;

[0162] in,

[0163] In the present application, the working concentration of the compound of Formula 42 is preferably 2.50 mg / mL. The working concentration of 4-carboxyphenylboronic acid pinacol ester is preferably 20.65 mg / mL. The working concentration of DMTMM is preferably 23.03 mg / mL. The working concentration of NMM is preferably 8.43 mg / mL. The reaction temperature is preferably 15-45°C, more preferably 25°C. The reaction time is preferably 12-48 hours, more preferably 20 hours.

[0164] In the present application, the working concentration of the compound represented by the structural formula 43 is preferably 17.07 mg / mL. The working concentration of succinic anhydride is preferably 6.30 mg / mL. The working concentration of DMAP is preferably 0.33 mg / mL. The reaction conditions are preferably the same as above and are not further described.

[0165] In the present application, a single-stranded nucleic acid molecule modified with an aldehyde group at the 5' end is commissioned to a gene synthesis company. 5'-CHO-siNFKBIZ-S is subjected to an electrophilic substitution reaction with a compound of structural formula 47 to form a Schiff base, which is reduced to obtain a 4PBA-siNFKBIZ-S conjugate. The temperature of the electrophilic substitution reaction is preferably 20 to 55°C, more preferably 40°C. The time of the electrophilic substitution reaction is preferably 12 to 48 hours, more preferably 24 hours. The electrophilic substitution reaction is preferably accompanied by oscillation, and the oscillation speed is preferably 200 to 4000 rpm, more preferably 1800 rpm. After the electrophilic substitution reaction is completed, it is preferred to remove excess compound of structural formula 43 and water. The method for removing the compound of structural formula 47 is preferably to remove it by extraction with ethyl acetate. The water is removed by concentration and distillation. The structural formula of the conjugate is shown in Formula 57:

[0166] in, Represents a connected nucleic acid molecule, and Base represents any type of base.

[0167] In this application, the pharmaceutical composition (4PBA-siNFKBIZ) realizes the application of siNFKBIZ gene drug in the targeted treatment of dry eye based on the targeting of PBA. Four phenylboronic acid molecules are used to react with 1,2- and 1,3-diol sugars to form borate esters, which have strong eye adhesion and can be efficiently taken up by cells, effectively improving the bioavailability of nucleic acid drugs on the ocular surface. In this application, 4PBA as a target head can effectively target and identify cells related to ocular surface tissue, and after siNFKBIZ enters the cell, it can effectively knock down the expression of the inflammation-related gene NFKBIZ, further regulate the protein expression of IκB-ζ, inhibit the inflammatory response of dry eye and curb the vicious cycle of inflammation, thereby achieving better dry eye treatment effects.

[0168] In one embodiment of the present application, a 3-hydroxy azide compound was first synthesized and reacted with a 2PBA polymer via an esterification reaction to obtain a 6PBA azide-modified compound (6PBA-N3). Next, a click chemistry reaction was successfully grafted onto the end of the siNFKBIZ sense strand, and annealed with the antisense strand of siNFKBIZ to yield a PBA hexamer molecule and a pharmaceutical composition (6PBA-siNFKBIZ) that inhibits NFKBIZ gene expression. The preparation method of the pharmaceutical composition (6PBA-siNFKBIZ) preferably includes the following steps:

[0169] Dissolve the compound represented by the structural formula 48 and azidohexanoic acid, add DMTMM and NMM, and react under nitrogen protection to obtain the compound represented by the structural formula 49;

[0170] The compound represented by the structural formula 49 and the compound represented by the structural formula 44 are dissolved, EDCI and DMAP are added, and the mixture is reacted under nitrogen protection to obtain the compound represented by the structural formula 50;

[0171] The compound represented by the structural formula 50 is mixed with acetone, sodium periodate and ammonium carbonate aqueous solution, and reacted under nitrogen protection to obtain the compound represented by the structural formula 51;

[0172] The compound of formula 51 and a nucleic acid molecule with a dibenzocyclooctyne modified at the 3' end were subjected to an oscillation reaction to obtain a 6PBA-siNFKBIZ-S conjugate;

[0173] Annealing and hybridizing the 6PBA-siNFKBIZ-S conjugate and the complementary strand of the nucleic acid molecule to obtain the pharmaceutical composition 6PBA-siNFKBIZ;

[0174] in,

[0175] In the present application, the working concentration of the compound represented by Formula 48 is preferably 10.00 mg / mL. The working concentration of the azidohexanoic acid is preferably 23.35 mg / mL. The working concentration of the DMTMM is preferably 34.40 mg / mL. The working concentration of the NMM is preferably 12.40 mg / mL. The conditions of the reaction are the same as above and are not described in detail here. After the reaction is completed, the solvent is preferably removed and separated and purified. The method for removing the solvent is preferably distillation under reduced pressure. The method for separation and purification is preferably silica gel column chromatography separation and purification. During the separation and purification, the eluent is preferably ethyl acetate methanol solution. The volume ratio of ethyl acetate to methanol in the ethyl acetate methanol solution is preferably 30:1.

[0176] In this application, the working concentration of the compound represented by Formula 49 is preferably 3.56 mg / mL. The working concentration of the compound represented by Formula 44 is preferably 35.60 mg / mL. The working concentration of EDCI is preferably 8.49 mg / mL. The working concentration of DMAP is preferably 1.00 mg / mL. The reaction conditions are the same as above and are not further described here.

[0177] In the present application, the compound represented by the structural formula 51 is converted to the pharmaceutical composition 6PBA-siNFKBIZ by a click chemistry reaction. The single-stranded nucleic acid molecule modified with dibenzocyclooctyne at the 3' end is commissioned to a gene synthesis company. The temperature of the click chemistry reaction is preferably 25 to 60°C, more preferably 50°C. The time of the click chemistry reaction is preferably 12 to 48 hours, more preferably 24 hours. The click chemistry reaction is preferably accompanied by shaking, and the shaking speed is preferably 200 to 4000 rpm, more preferably 1800 rpm. After the click chemistry reaction is completed, the excess compound represented by formula 51 and water are preferably removed. The removal method is preferably ethyl acetate extraction removal. The water is removed by concentration distillation. The structural formula of the conjugate is shown in Formula 58.

[0178] in, Represents a connected nucleic acid molecule, and Base represents any type of base.

[0179] In this application, the pharmaceutical composition 6PBA-siNFKBIZ contains more PBA molecules, which can increase the probability of reaction with cell membrane surface glycosyl groups, enhance cell adhesion, and enter cells through receptor-mediated endocytosis, significantly improving the efficiency of cell uptake of siNFKBIZ. It further exerts a silencing effect on the NFKBIZ gene in cells, downregulating NFKBIZ gene expression, achieving IκB-ζ downregulation, inhibiting cellular inflammation, and thus exerting a therapeutic effect on dry eye.

[0180] In one embodiment of the present application, the present application constructed a pharmaceutical composition (PBA) for inhibiting NFKBIZ gene expression by grafting 10 phenylboronic acid molecules onto a DNA chain (obtained by polymerization of 12 T nucleotides) at the 3' end of the positive chain of a nucleic acid molecule targeting the NFKBIZ gene through phosphorothioate. 10 -siNFKBIZ), the preparation method preferably comprises the following steps:

[0181] A positive strand of a nucleic acid molecule with an extended sequence is artificially synthesized; the phosphate backbone of the extended sequence is modified with 10 phosphorothioate backbone modifications (10PS-siNFKBIZ-S);

[0182] The 10PS-siNFKBIZ was reacted with 4-bromomethyl-phenylboronic acid solution to obtain PBA 10 -siNFKBIZ-S conjugate;

[0183] The PBA 10 -siNFKBIZ-S conjugate and the complementary chain of the nucleic acid molecule are annealed and hybridized to obtain the pharmaceutical composition PBA 10-siNFKBIZ.

[0184] In the present application, the working concentration of 4-bromomethyl-phenylboronic acid is preferably 60 mM. The working concentration of the 10PS-siNFKBIZ is preferably 200 μM. The volume ratio of the 10PS-siNFKBIZ and 4-bromomethyl-phenylboronic acid solution is 1:1. The pharmaceutical composition (PBA 10 -siNFKBIZ) based on the targeted recognition of PBA, explore its effect in the treatment of dry eye. In this example, the 3' end of the siNFKBIZ drug sense chain was extended by 12 T bases, and phosphorothioate was used between the terminal 10 bases and synthesized using a nucleic acid synthesizer. After the phosphorothioate grafting, PBA was annealed with the antisense chain of siNFKBIZ to obtain PBA. 10 -siNFKBIZ. This composition contains 10 PBA molecules, which can better bind to the MUC protein on the ocular surface, improve the efficiency of interaction with ocular surface proteins, further increase ocular surface retention, enhance the intracellular delivery of siNFKBIZ, improve the biological effects of siNFKBIZ, and achieve effective treatment for dry eye.

[0185] In one embodiment of the present application, a siNFKBIZ pharmaceutical composition having a stem-loop structure is constructed, and three phosphorothioate modifications are performed on the stem-loop structure. A branched product of 2PBA is grafted onto the stem-loop structure to prepare a pharmaceutical composition of siNFKBIZ containing six phenylboronic acid molecules (PBA6-siNFKBIZ). The preparation method preferably comprises the following steps:

[0186] The compound represented by the structural formula 44 and the compound represented by the structural formula 52 are subjected to an esterification reaction under EDCI and DMAP condensation to obtain a compound represented by the structural formula 53;

[0187] The acetone solution of the compound represented by the structural formula 53 is mixed with an aqueous solution containing sodium periodate and ammonium carbonate, and reacted under nitrogen protection to obtain a compound represented by the structural formula 54 (2PBA-Br);

[0188] A solution of a compound having a structural formula of Formula 54 is reacted with a nucleic acid molecule having three phosphorothioate modifications in the stem-loop structure to obtain a PBA6-siNFKBIZ-S conjugate;

[0189] Annealing and hybridizing the PBA6-siNFKBIZ-S conjugate and the complementary strand of the nucleic acid molecule to obtain the pharmaceutical composition PBA6-siNFKBIZ;

[0190] in,

[0191] In this application, the pharmaceutical composition PBA6-siNFKBIZ was demonstrated to have targeted uptake effects in human corneal epithelial cells and to regulate the NFKBIZ gene and IκB-ζ protein. Results showed that PBA6-siNFKBIZ significantly promoted cellular uptake of the siNFKBIZ gene drug and inhibited NFKBIZ gene expression. Furthermore, an animal dry eye model demonstrated that the PBA6-siNFKBIZ drug composition exhibited good adhesion to the ocular surface and significantly improved the bioavailability of the siNFKBIZ gene drug on the ocular surface, effectively inhibiting NFKBIZ gene expression and curbing the vicious cycle of inflammation on the ocular surface, achieving the goal of treating dry eye.

[0192] The present application provides the use of the nucleic acid molecule or the pharmaceutical composition in the preparation of drugs for preventing and / or treating eye diseases.

[0193] In the present application, the eye disease preferably includes one or more of the following: dry eye, keratitis, conjunctivitis and blepharitis.

[0194] The following is a detailed description of a pharmaceutical composition for inhibiting NFKBIZ gene expression and its application provided by the present application in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present application.

[0195] Example 1

[0196] Screening for double-stranded RNA for inhibiting NFKBIZ gene expression

[0197] 1. Using the NFKBIZ gene (GenBan accession number: NM_031419.4) as the target gene, a total of 210 pairs of double-stranded RNAs were designed through conventional siRNA design (see Table 1). To preliminarily screen and verify the effectiveness of siRNA, we used commercial Lipofectamine 2000 to transfect human corneal epithelial cells. The expression of the NFKBIZ gene and IκB-ζ protein was verified by qPCR and Western blot experiments.

[0198] Table 1 siRNA sequences targeting NFKBIZ gene

[0199] 2. Screening of double-stranded RNA that inhibits NFKBIZ gene expression based on qPCR technology

[0200] Human corneal epithelial cells (HCEC) were cultured at 3.5×10 4Cells were seeded at a density of 10 cells / well in a 6-well plate and transfected after overnight culture. According to the manufacturer's method, Lipofectamine 2000 (Invitrogen GmbH, Karlsruhe, Germany) was incubated with siRNA using OptiMEM medium and then added to a 6-well plate, and a Lipofectamine 2000 blank control group was set up. 6 hours after transfection, the Opti-MEM medium was replaced with complete medium. 48 hours after the medium was replaced, the RNA was reverse transcribed using the Biyuntian RNA extraction kit and the TAKARA reverse transcription kit (Code No. RR036A). The reverse transcription reaction solution was prepared according to the following composition (the reaction solution was prepared on ice).

[0201] Table 2 Reverse transcription system

[0202] The specific reaction process is as follows: first, reverse transcription at 37°C for 15 minutes, followed by inactivation of the reverse transcriptase at 85°C for 5 seconds, cooling to 4°C, and finally, removing the sample and storing it at -20°C. qPCR reactions were performed using the TAKARA Real-Time Quantitative PCR Kit (Cat. No. RR820A), using GAPDH as the internal reference gene. The GAPDH forward primer is: AGAAGGCTGGGGCTCATTTG (SEQ ID NO: 427); the GAPDH reverse primer is: AGGGGCCATCCACAGTCTTC (SEQ ID NO: 428).

[0203] NKFBIZ forward primer: ACACCCACAAACCAACTCTGG (SEQ ID NO: 429);

[0204] NFKBIZ reverse primer: GGCAAAACTGTGATTCTGGACC (SEQ ID NO: 430). Prepare PCR reaction solution according to the following components (the reaction solution should be prepared on ice).

[0205] Table 3 qPCR reaction system

[0206] The specific reaction process is as follows: the first stage: pre-denaturation; cycle number: 1; 95 ° C 30 s; the second stage: PCR reaction, cycle number: 40; 95 ° C 3 s; 60 ° C 30 s; melting curve stage.

[0207] The results are shown in Figure 4 , where the Mock group represents the normal NFKBIZ mRNA expression level of cells not treated with siRNA. Using this as the normalization benchmark, siRNA sequences that can significantly inhibit NFKBIZ gene expression compared with the Mock group (sequences with mRNA expression levels lower than or equal to the dotted line in Figure 4 ) were selected as preferred sequences; through quantitative analysis of significant differences, ID1-18, ID25-49, ID51-89, ID93-108, ID113-132, ID134-135, ID143-152, and ID169-185 were able to significantly inhibit the expression of NFKBIZ gene mRNA.

[0208] 3. Verification of the biological effect of double-stranded RNA on inhibiting NFKBIZ gene expression based on Western-blot technology

[0209] In order to better verify the effect of siRNA in inhibiting the NFKBIZ gene, 7 siRNAs were selected to detect the expression of IκB-ζ protein. Human corneal epithelial cells (HCEC) were cultured at 3.5×10 4 Cells were seeded at a density of 10 cells / well in a 6-well plate and transfected after overnight culture. According to the manufacturer's method, Lipofectamine 2000 was incubated with siRNA using Opti-MEM medium, then added to a 6-well plate, and a lipofectamine 2000 blank control group was set up. 6 hours after transfection, the OptiMEM medium was replaced with complete medium. 48 hours after replacing the medium, protein was extracted for detection, and the results are shown in Figure 5. The results showed that the screened siRNAID1, siRNAID30, siRNAID70, siRNAID101, siRNAID120, and siRNAID180 were all able to inhibit the expression of IκB-ζ at the protein level, which was consistent with the qPCR results. They were able to not only inhibit the expression of the NFKBIZ gene at the gene level, but also inhibit the expression of the IκB-ζ protein, thereby exerting an anti-inflammatory effect.

[0210] Example 2

[0211] Nucleic acid aptamer targeted delivery of siNFKBIZ gene drug composition for the treatment of dry eye

[0212] Aptamers are short single-stranded DNA or RNA molecules that can selectively bind to specific targets, including proteins, peptides, carbohydrates, small molecules, toxins, etc. Compared with other targeting ligands (such as antibodies), aptamers have been shown to have lower toxicity and immunogenicity. In addition, due to the advantages of easy synthesis, chemical modification and conjugation of aptamers, aptamers have broad application prospects in the field of small nucleotide delivery. Mucin is a key factor in the quality and stability of the tear film. On the surface of the eye, mucin is secreted by conjunctival goblet cells and lacrimal glands, of which MUC1, MUC4 and MUC16 are the main transmembrane mucins highly expressed in the ocular surface area. Corneal epithelial cells have been shown to express integrins and are a source of inflammatory cytokines in dry eye; in addition, inflammatory Th17 cells express a large amount of α V β3 integrin, which is crucial for maintaining the Th17 inflammatory phenotype, such as the production of IL-17 in dry eyes and IL-17-induced corneal epithelial barrier destruction. In order to achieve efficient delivery of siRNA, this example is based on targeting MUC1, MUC16, integrin α V A siNFKBIZ gene drug composition was developed by using nucleic acid aptamers targeting β3 and CD44 proteins for the treatment of ocular surface disease dry eye.

[0213] 1. Assembly of nucleic acid aptamer-targeted delivery of siNFKBIZ gene drug composition

[0214] First, in this example, two nucleic acid aptamers targeting MUC protein were selected, namely, nucleic acid aptamer targeting MUC1 protein (Apt MUC1 Aptamers) and MUC16 protein-targeted aptamers (Apt MUC16 ), and integrin α V β3-targeted aptamers (Apt αvβ3 Aptamers) and CD44 protein-targeted aptamers (Apt CD44 The aptamer was connected to the siRNA sense strand (siNFKBIZ sense, SEQ ID NO: 1) that inhibits the NFKBIZ gene through the deoxyribonucleic acid linker TTTTT, and assembled with the siRNA antisense strand (siNFKBIZ antisense, SEQ ID NO: 211) that inhibits the NFKBIZ gene through base complementary pairing. The results were verified by non-denaturing polyacrylamide gel. The results are shown in Figure 6, which shows that Apt-siNFKBIZ sense and siNFKBIZ antisense are successfully complementary.

[0215] The siNFKBIZ gene drug sequence used in this example is as follows:

[0216] The sequence of the small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0217] Sense:5'-GAGCCGUGGCGCAGGUGU-3'(SEQ ID NO:1);

[0218] Antisense: 5'-ACACCUGCGCCACCGGCUCgc-3' (SEQ ID NO: 431).

[0219] The sequence of the small interfering RNA targeting the mouse NFKBIZ gene (siNFKBIZ-M) is

[0220] Sense:5'-GCGUCAAUGUACCAGUAUU-3'(SEQ ID NO:421);

[0221] Antisense: 5'-AAUACUGGUACAUUGACGCCU-3' (SEQ ID NO: 422).

[0222] The sequences of the aptamers are as follows:

[0223] MUC1 nucleic acid aptamer: GCAGTTGATCCTTTGGATACCCTGG (SEQ ID NO: 423);

[0224] MUC16 nucleic acid aptamer: CTCACTATAGGGAGACAAGAATAAACGCTCAA (SEQ ID NO: 424);

[0225] α V β3 nucleic acid aptamer: GGGAGACAAGAATAAACGCTCAATTCAACGCTGTGAAGGGCTTACGAGCGGATTACCCTTCGACAGGAGGCTCACAAAAGGC (SEQ ID NO: 425);

[0226] CD44 nucleic acid aptamer: ACCGGGCGTACACCGTCGCGGCACATGTCTGA (SEQ ID NO: 426).

[0227] 2. Verification of the cellular uptake efficiency of the siNFKBIZ gene drug composition with aptamer targeting function

[0228] To verify Apt MUC1The uptake efficiency of the siNFKBIZ gene drug composition at the cellular level was verified using laser confocal microscopy. The specific method is as follows: human corneal epithelial cells (HCEC) were cultured at a rate of 2×10 4 The cells were seeded at a density of 100 cells / well in a confocal microplate and cultured overnight before administration. Cy3-labeled Apt MUC1 -siNFKBIZ(Apt MUC1 -siNFKBIZ-Cy3) gene drug composition and Cy3-labeled siNFKBIZ (siNFKBIZ-Cy3), where the Cy3 equivalent concentration was 0.5μM, were incubated with HCEC cells. After 6 hours, the cells were washed with PBS and fixed with 4% paraformaldehyde; then stained with DAPI and finally observed using a laser confocal microscope. The results are shown in Figure 7A. The results show that Apt MUC1 The fluorescence brightness of cells in the -siNFKBIZ drug composition incubation group was significantly higher than that in the free siNFKBIZ group, indicating that the aptamer targeting MUC1 can significantly improve the cellular entry efficiency of siNFKBIZ and exert a gene silencing effect.

[0229] Next, flow cytometry was used to analyze the Apt MUC16 、Apt αvβ3 、Apt CD44 The targeted uptake efficiency of the siNFKBIZ drug combination at the cellular level was verified. The specific method is as follows: HCEC cells were plated at 3.0×10 5 The cells were seeded in 12-well plates and cultured in DMEM overnight. Cy3-labeled siNFKBIZ (siNFKBIZ-Cy3) was mixed with Apt MUC16 、Apt αvβ3 、Apt CD44 The relevant aptamer drug composition was added to the wells with the same Cy3 concentration (0.5 μM), incubated in Opti-MEM at 37°C for 6 h, and finally the cells were harvested with trypsin for flow cytometric analysis (BD FACSCalibur, USA). The results are shown in Figure 7B. MUC16 、Apt αvβ3 、Apt CD44 Both can significantly improve the cellular uptake efficiency of siRNA, thereby efficiently delivering siRNA into cells and exerting a gene silencing effect.

[0230] 3. Biological validation of the siNFKBIZ gene drug composition with aptamer targeting function

[0231] In order to verify the biological effect of aptamer-targeted delivery of siNFKBIZ, the expression of NFKBIZ gene and IκB-ζ protein was verified by qPCR and Western blot experiments. 5 Cells were seeded into 6-well plates at a density of 100 μg / well and allowed to adhere overnight. They were then stimulated with 100 ng / mL LPS for 12 h. After removing the supernatant, cells containing siNFKBIZ and Apt were added. MUC-1 -siNFKBIZ、Apt MUC16 -siNFKBIZ、Apt αvβ3 -siNFKBIZ、Apt CD44 -siNFKBIZ drug composition Opti-MEM medium 1mL (siNFKBIZ equivalent concentration is 500nM), incubated at 37℃ for 6h, then replaced with DMEM medium, and incubated for another 48h, cells were collected and RNA was extracted for qPCR experiments to evaluate the expression of NFKBIZ mRNA in HCEC cells, and proteins were extracted for Western-blot experiments. The qPCR experimental results are shown in Figure 8. LPS stimulated the expression of NFKBIZ gene in HCEC cells, which was upregulated by about 1.4 times; the simple siNFKBIZ gene drug can downregulate the NFKBIZ gene to about 1.2, Apt MUC1 -siNFKBIZ、Apt MUC16 -siNFKBIZ、Apt αvβ3 -siNFKBIZ、Apt CD44 -siNFKBIZ drugs can significantly inhibit the expression of NFKBIZ, achieving a gene inhibition effect of 40% to 50%. The Western-blot results are shown in Figure 9. MUC-1 -siNFKBIZ、Apt MUC16 -siNFKBIZ、Apt αvβ3 -siNFKBIZ、Apt CD44 The siNFKBIZ drug combination showed a significantly better inhibitory effect on IκB-ζ protein expression compared to the stimulation group. In summary, the aptamer-based siNFKBIZ gene drug combination was able to efficiently deliver the siNFKBIZ nucleic acid drug, achieving downregulation of the NFKBIZ gene and further inhibiting IκB-ζ protein expression, thereby suppressing the inflammatory response.

[0232] 4. Evaluation of the ocular surface retention effect of the Apt-siNFKBIZ-M gene drug combination

[0233] The retention effect of the pharmaceutical composition that inhibits NFKBIZ gene expression on the ocular surface was verified by animal experiments. All animal experiments in this example are in compliance with the statement of the Association for Research in Vision and Ophthalmology. All animal experiments were conducted in accordance with the guidelines established by the Ethics Committee of Shanghai Jiao Tong University. 30 specific pathogen-free (SPF) grade C57BL / 6 mice (60 eyes) aged 6 to 8 weeks were selected and kept in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 6 groups and benzalkonium chloride was dripped twice a day to establish a mouse dry eye model. After intraperitoneal anesthesia of C57BL / 6 mice, 5 μL of Apt was instilled into the right eye respectively: MUC1 -siNFKBIZ-Cy5.5、Apt MUC16 -siNFKBIZ-Cy5.5、Apt αvβ3 -siNFKBIZ-Cy5.5、Apt CD44 -siNFKBIZ-Cy5.5 gene drug composition and free siRNA-Cy5.5 eye drops. After 30 minutes, the mice were anesthetized and the corneas were removed for frozen section imaging. The results, as shown in Figure 10, show that compared to the siNFKBIZ-Cy5.5-administered group, the Apt-siNFKBIZ gene-expressed composition provided in this application exhibited stronger ocular surface fluorescence, demonstrating improved ocular surface retention and adhesion in vivo, reducing drug loss and improving bioavailability, indicating that the Apt-siNFKBIZ gene drug composition is indeed a promising topical drug.

[0234] 5. The therapeutic effect of Apt-siNFKBIZ gene drug combination on dry eye

[0235] All animal experiments in this example were performed in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO) "Statement on the Use of Animals in Ophthalmic and Vision Research" and in compliance with relevant operating specifications. All animal experiments were performed in accordance with the guidelines established by the Ethics Committee of Shanghai Jiao Tong University. In this example, 40 6-8 week old specific pathogen-free (SPF) grade C57BL / 6 mice (80 eyes) were selected from Shanghai Slake Laboratory Animal Co., Ltd. and kept in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 8 groups and exposed to a low humidity environment (RH = 18.5% ± 5.1%, AF = 15L / min, T = 21-23°C) for 4 days. Then 5 μL of 0.2% benzalkonium chloride was instilled into each eye twice a day for 14 consecutive days to establish a mouse dry eye model. Each group of mice was topically instilled with PBS, cyclosporine CsA eye drops (Xingqi eye drops), siNFKBIZ-M, Apt twice a day in both eyes. MUC1 -siNFKBIZ-M、Apt MUC16 -siNFKBIZ-M、Apt αvβ3 -siNFKBIZ-M、Apt CD44-siNFKBIZ-M drug combination (equivalent to 0.05 mg / kg siRNA) was administered twice daily for 14 days (morning and evening). Tear secretion and corneal fluorescein staining were assessed on days 0, 7, and 14 of administration as follows: Basal tear secretion test (Schirmer's I Test): On days 0, 7, and 14 of administration, a basal tear secretion test was performed using Zone-Quick phenol red cotton thread. After mice were anesthetized intraperitoneally with 1.25% afodine (0.2 mL / 10 g), a 1 mm phenol red cotton thread was inserted into the lateral fornix of the subconjunctiva for 30 seconds. The color of the phenol red cotton thread changed from yellow to red, indicating tear secretion. The length of wetted tissue (mm) was recorded. Corneal fluorescein staining was scored by instilling 2 μL of 0.5% sodium fluorescein (w / v) onto the ocular surface. The eyelids were then manually closed 3-4 times to gently remove excess fluorescein. Fluorescein-stained images were obtained under cobalt blue illumination using a slit lamp and scored accordingly by the same experienced ophthalmologist. The cornea was divided into five quadrants, with each quadrant graded from 0 to 3: grade 0 (absent); 1) fewer than 30 punctate staining; 2) more than 30 punctate staining but not diffuse; and 3) severe diffuse staining or plaque-positive. The sum of all quadrants was used as the final score. All eyes in each group were examined and analyzed.

[0236] The experimental results are shown in Figure 11. The drug-treated groups (CsA eye drops, siNFKBIZ-M, Apt MUC1 -siNFKBIZ-M、Apt MUC16 -siNFKBIZ-M、Apt αvβ3 -siNFKBIZ-M、Apt CD44 -siNFKBIZ-M pharmaceutical composition) can effectively improve the degree of corneal damage. After one week of treatment, the eye score of mice in the cyclosporine eye drop group dropped from 12 points to about 8 points, and the phenol red cotton tear test result increased from 3mm to about 3.8mm; the eye score of mice in the siNFKBIZ-M treatment group dropped from 12 points to about 10 points, and the phenol red cotton tear test result increased from 3mm to about 3.5mm; the sodium fluorescein score of the mice in the Apt-siNFKBIZ-M treatment group was significantly reduced from about 12 points to 6 points, indicating that Apt-siNFKBIZ-M can significantly improve corneal damage; the phenol red cotton tear test result increased from about 3mm to about 5mm, indicating that Apt-siNFKBIZ-M can significantly promote tear secretion. From the above experimental results, it can be seen that the aptamer can effectively promote the cellular entry of the siNFKBIZ gene drug and exert the biological function of siNFKBIZ to achieve effective treatment of dry eye.

[0237] Example 3

[0238] Targeted delivery of nucleic acid molecules using monophenylboronic acid

[0239] 1. Synthesis and characterization of PBA-siNFKBIZ gene drug composition

[0240] 1.1 Synthesis of 4-carboxyphenylboronic acid (PBA-COOH) and NFKBIZ small interfering RNA combination (PBA-siNFKBIZ)

[0241] The small interfering RNAs targeting the NFKBIZ gene used in this example were purchased from Suzhou Beixin Biotechnology Co., Ltd. An amino group (-NH2) modification was introduced at the 3' end of the small interfering RNA to enable efficient coupling with the carboxyl group on PBA-COOH through an amide chemical reaction. The 3'-amino group modification is represented by 3'-NH2 in all the following examples, and its modified structure is shown in Formula 59:

[0242] in, Represents a connected nucleic acid molecule, and Base represents any type of base.

[0243] The siNFKBIZ gene drug sequence used in this example is as follows:

[0244] The sequence of the small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0245] Sense:5'-AGAACAUUAUCAACAUUAA-3' (SEQ ID NO: 43);

[0246] Antisense: 5'-UUAAUGUUGAUAAUGUUCUga-3' (SEQ ID NO: 432);

[0247] The sequence of the small interfering RNA targeting the mouse NFKBIZ gene (siNFKBIZ-M) is

[0248] Sense:5'-GCGUCAAUGUACCAGUAUU-3' (SEQ ID NO: 421);

[0249] Antisense: 5'-AAUACUGGUACAUUGACGCCU-3' (SEQ ID NO: 422);

[0250] The synthetic route of PBA-siNFKBIZ is shown in Figure 12:

[0251] The specific synthesis method is as follows: 0.22mg PBA-COOH (1300nmol), 0.40mg EDCI (2600nmol), and 0.30mg NHS (2600nmol) are dissolved in 1.3mL DMSO. 5OD (26nmol) of 3'-terminal amino-modified siNFKBIZ sense chain (siNFKBIZ-S-3'-NH2) is added to 0.13mL of the solution, and the mixture is shaken and reacted at 25°C for 24h. After adding 5mL of water, the EDCI / NHS and excess PBA-COOH in the reaction are extracted with dichloromethane. The aqueous solution is then concentrated and evaporated to dryness to obtain the PBA-siNFKBIZ-S conjugate molecule. Then, the PBA-siNFKBIZ-S and the antisense chain of siNFKBIZ (siNFKBIZ-A) were quantitatively mixed at a molar ratio of 1:1, incubated at 65°C for 10 minutes, and then annealed to 25°C for 10 minutes to obtain a PBA-siNFKBIZ pharmaceutical composition.

[0252] 2. Verification of the cellular uptake ability of the PBA-siNFKBIZ gene drug composition

[0253] HCEC cells were plated at 4 × 10 4 The number of cells was seeded in a 24-well culture plate, and a clean coverslip was placed in each well. The cells were cultured overnight and then incubated with PBA-siNFKBIZ-Cy3 and siNFKBIZ-Cy3 (equivalent Cy3 concentration was 0.5 μM) for 6 hours. The culture medium was then removed, the cells were washed three times with PBS, and fixed with 4% paraformaldehyde at room temperature for 15 minutes. Then, the cell nuclei were stained with DAPI for 15 minutes, washed with PBS, and observed using laser confocal microscopy. The results are shown in Figure 13A. The green fluorescence of the cells in the PBA-siNFKBIZ-Cy3 group was higher than that in the siNFKBIZ-Cy3-treated group.

[0254] In order to culture HCEC cells at 4.0 × 10 5 The cells were seeded in 12-well plates and cultured in DMEM overnight. PBA-siNFKBIZ-Cy3 was added to the cells according to the concentration of Cy3 (0.5 μM) per well and incubated in Opti-MEM at 37°C for 6 hours. siNFKBIZ-Cy3 was used as a control. The cells were collected using trypsin and collected for flow cytometry analysis. The results are shown in Figure 13B. The average fluorescence intensity of the PBA-siNFKBIZ-Cy3 group was approximately 1.2 times that of the siNFKBIZ group. In summary, the results show that the modification of PBA can enhance the uptake ability of siNFKBIZ small nucleic acid drugs and improve their intracellular effect.

[0255] 3. Evaluation of the gene regulation ability of the PBA-siNFKBIZ gene drug composition

[0256] According to 1×10 5 According to the standard of cells / well, HCEC cells were seeded into 6-well plates and cultured overnight. After 12 hours of stimulation with IL-1β, the cells were washed twice with PBS. Next, the cells were incubated with Opti-MEM medium containing siNFKBIZ and PBA-siNFKBIZ gene drug composition for 6 hours, and then replaced with DMEM complete medium and cultured for another 48 hours. Next, RNAiso reagent was used to lyse the cells and extract mRNA, and the concentration of mRNA was measured by Nanodrop. cDNA was obtained according to the reverse transcription kit, and qPCR experiments were further performed. As shown in Figure 14, after IL-1β stimulation, the expression of the NFKBIZ gene of HCEC cells was significantly upregulated to about 1.6 times that of normal cells, and the free siNFKBIZ gene drug was able to be downregulated to about 1.4 times. However, the PBA-siNFKBIZ gene drug composition was able to inhibit the expression of the NFKBIZ gene, and the expression level after inhibition was reduced to about 1.26 of the normal unstimulated group (Mock group). The above results indicate that the PBA-siNFKBIZ gene drug composition can promote the cellular entry of the siNFKBIZ gene drug to a certain extent, realize the regulation of the NFKBIZ gene, and achieve the gene inhibition effect.

[0257] 4. The therapeutic effect of PBA-siNFKBIZ gene drug combination on dry eye

[0258] All animal experiments in this example were performed in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO) "Statement on the Use of Animals in Ophthalmic and Vision Research" and in compliance with relevant operating specifications. All animal experiments were performed in accordance with the guidelines established by the Ethics Committee of Shanghai Jiao Tong University. In this example, 15 6-8 week old specific pathogen-free (SPF) grade C57BL / 6 mice (30 eyes) were selected from Shanghai Slake Laboratory Animal Co., Ltd. and kept in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 3 groups and exposed to a low humidity environment (RH = 18.5% ± 5.1%, AF = 15L / min, T = 21-23°C) for 4 days. Then 5 μL of 0.2% benzalkonium chloride was dripped into each eye twice a day for 14 consecutive days to establish a mouse dry eye model. Each group of mice received topical instillation of PBS, cyclosporine CsA eye drops (Xingqi Eye Drops), and PBA-siNFKBIZ-M (equivalent siRNA dose of 0.05 mg / kg) twice daily for 14 consecutive days, twice a day (morning and evening). Tear secretion and corneal sodium fluorescein staining were performed on days 0, 7, and 14 of administration, as described in Example 2.

[0259] The results are shown in Figure 15. The results of sodium fluorescein showed that the scores of all drug-treated groups decreased. Among them, the score of the CsA eye drop treatment group decreased significantly on the 7th day, and dropped from the initial 11 points to about 6 points on the 14th day. The results of the phenol red cotton thread tear test increased from 1.8mm to about 3.3mm. The sodium fluorescein score of mice in the PBA-siNFKBIZ-M group decreased after 14 days of treatment (from 11 points to about 8.0), and the tear secretion volume also increased (from 1.5mm to 3mm). Compared with the PBS treatment group, the CsA and PBA-siNFKBIZ-M groups were able to improve the signs of dry eye.

[0260] Example 4

[0261] Biphenylboronic acid targeted delivery of siNFKBIZ gene drug composition for the treatment of dry eye

[0262] 1. Synthesis and characterization of 2PBA-siNFKBIZ gene drug composition

[0263] 1.1 Synthesis of 2PBA-MAL

[0264] The synthesis route of 2PBA-MAL in this example is shown in FIG16 .

[0265] 1.2 Synthesis of compound 4

[0266] Take compound 1 (1000 mg) and compound 2 (1440 mg) in a 100 mL flask, add 40 mL of dichloromethane and stir until dissolved. Add EDCI (900 mg) and DMAP (30 mg), and under nitrogen protection, place the reaction at room temperature for 20 hours. After the reaction is completed, dichloromethane is removed by distillation under reduced pressure, 30 mL of water is added, and extracted twice with 30 mL of ethyl acetate. The organic phase is collected, then washed once with 30 mL of saturated sodium bicarbonate solution, and then washed once with 30 mL of saturated sodium chloride solution. The organic phase is dried over anhydrous sodium sulfate. After the solvent is spin-dried, 10 mL of ethyl acetate is added and shaken. Under stirring, n-hexane is slowly added until a large amount of white solid is precipitated, filtered, and the filter cake is washed twice with n-hexane to obtain compound 3 (859 mg) with a yield of about 84%.

[0267] Compound 3 1 The H NMR spectrum is shown in Figure 17. The solvent used in the nuclear magnetic spectrum test was CDCl3. The attribution of each proton peak is as follows: 1H NMR (600 MHz, Chloroform-d) δ 7.94 (d, J = 7.9 Hz, 4H), 7.79 (d, J = 7.9 Hz, 4H), 4.89 (d, J = 6.8 Hz, 1H), 4.47-4.36 (m, 5H), 1.35 (s, 9H), 1.29 (s, 24H). 1 The H NMR spectrum is shown in Figure 18. The solvent used in the nuclear magnetic spectrum test was CDCl3. The attribution of the characteristic carbon atoms in the product is as follows: 13 C NMR (151MHz, Chloroform-d) δ166.37,134.75,128.72,84.23,64.11,28.31,24.89.

[0268] 1.3 Synthesis of compound 4

[0269] Compound 4 (859 mg) was placed in a dry 100 mL round-bottom flask, and 20 mL of acetone was added and stirred until dissolved. Sodium periodate (1130 mg) and ammonium acetate (412 mg) were dissolved in 20 mL of water and acetone was added. Under nitrogen protection, the reaction was allowed to react at room temperature for 10 h. After the reaction was completed, the acetone was removed by distillation under reduced pressure, 20 mL of water was added, and the mixture was washed twice with 20 mL of ethyl acetate. The organic phase was then washed once with 20 mL of saturated sodium chloride solution. The organic phase was then collected and dried over anhydrous sodium sulfate. The mixture was distilled under reduced pressure to obtain a colorless oily liquid. 20 mL of ethyl acetate and 2 mL of methanol were added for redissolution, and 7 mL of 4M hydrogen chloride-ethyl acetate solution was added under ice bath. The mixture was stirred at room temperature for 4 h. A large amount of white solid precipitated, which was filtered and the filter cake was washed twice with ethyl acetate to obtain 424 mg of white solid, i.e., compound 4, with a yield of approximately 76%.

[0270] Compound 4 1 The H NMR spectrum is shown in Figure 19. The solvent used in the nuclear magnetic spectrum test was CDCl3. The attribution of each proton peak is as follows: 1 H NMR (700 MHz, DMSO-d6) δ 8.82 (s, 2H), 8.35 (s, 4H), 8.10 (d, J = 8.3 Hz, 4H), 7.94 (d, J = 8.2 Hz, 4H), 4.61 (qd, J = 11.9, 5.1 Hz, 4H), 4.05 (s, 1H). 13 The C NMR spectrum is shown in Figure 20. The solvent used in the nuclear magnetic spectrum test was CDCl3. The attribution of the characteristic carbon atoms contained in the product is as follows: 13C NMR (151 MHz, Methanol-d4) δ 166.14, 133.56, 128.41, 62.00, 49.52.

[0271] 1.4 Synthesis of compound 5

[0272] Compound 4 (424 mg) and 4-maleimidobutyric acid (366 mg) were placed in a dry 100 mL round-bottom flask, and 30 mL of methanol was added and stirred until dissolved. Next, DMTMM (557 mg) and NMM (203 mg) were added, and the reaction was allowed to react at room temperature for 2 h. After the reaction was completed, methanol was removed by distillation under reduced pressure, 20 mL of water was added, and the mixture was washed twice with 20 mL of ethyl acetate. The organic phase was washed once with 20 mL of saturated sodium chloride solution. The organic phase was collected and dried over anhydrous sodium sulfate, and distilled under reduced pressure to obtain a colorless oily liquid. 481 mg of a white solid was obtained by reverse phase column chromatography, i.e., compound 7 was obtained with a yield of about 87%.

[0273] Compound 5 1 The H NMR spectrum is shown in Figure 21. The solvent used in the NMR spectrum test was DMSO-d6. The attribution of each proton peak is as follows: 1 H NMR (600 MHz, DMSO-d6) δ 8.25 (d, J = 8.3 Hz, 1H), 7.96 (d, J = 8.3 Hz, 4H), 7.91 (d, J = 8.2 Hz, 4H), 6.97 (s, 2H), 4.61-4.52 (m, 1H), 4.45-4.36 (m, 4H), 3.39 (t, J = 7.0 Hz, 2H), 2.14 (t, J = 7.5 Hz, 2H), 1.73 (p, J = 7.2 Hz, 2H). 13 The C NMR spectrum is shown in Figure 22. The solvent used in the NMR spectrum test was DMSO-d6. The attribution of the characteristic carbon atoms in the product is as follows: 13 C NMR (151MHz, DMSO-d6) δ170.41,165.17,133.83,133.59,130.03,127.58,62.92,38.44,36.17,32.01,23.56.

[0274] 1.5 Synthesis of 2PBA-siNFKBIZ Gene Drug Composition

[0275] The small interfering RNAs targeting the NFKBIZ gene used in this example were all purchased from Suzhou Beixin Biotechnology Co., Ltd. A thiol (-SH) modification was introduced at the 3' end of the small interfering RNA, enabling efficient coupling with the maleimide group modified on 2PBA-MAL through a click chemistry reaction. The 3'-terminal thiol group modification is represented by 3'-SH in all the following examples, and its modified structure is shown in Formula 60.

[0276] in, Represents the connected nucleic acid molecules, and Base represents any type of base.

[0277] The siNFKBIZ gene drug sequence used in this example is as follows:

[0278] The sequence of the small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0279] Sense:5'-GCCCGAUUCGUUGUCUGAU-3' (SEQ ID NO: 35);

[0280] Antisense: 5'-AUCAGACAACGAAUCGGGCcc-3' (SEQ ID NO: 433);

[0281] The sequence of the small interfering RNA targeting the mouse NFKBIZ gene (siNFKBIZ-M) is

[0282] Sense:5'-GCGUCAAUGUACCAGUAUU-3' (SEQ ID NO: 421);

[0283] Antisense: 5'-AAUACUGGUACAUUGACGCCU-3' (SEQ ID NO: 422);

[0284] The synthetic route of 2PBA-siNFKBIZ-S conjugate is shown in Figure 23:

[0285] The synthesis method is as follows: 0.72 mg of 2PBA-MAL (1300 nmol) prepared in Example 4.1 was dissolved in 1.3 mL of DMSO. 5 OD (26 nmol) of the sense strand of siNFKBIZ-3'-SH (siNFKBIZ-S) was added to 0.13 mL of the solution, and the mixture was shaken at 50°C for 24 hours. After adding 5 mL of water, the excess 2PBA-MAL was extracted with ethyl acetate. The aqueous solution was then concentrated and evaporated to dryness to obtain the 2PBA-siNFKBIZ-S conjugate. 2PBA-siNFKBIZ-S was then quantitatively mixed with the antisense strand of siNFKBIZ (siNFKBIZ-A) at a molar ratio of 1:1, incubated at 65°C for 10 minutes, and annealed at 25°C for 10 minutes to obtain the 2PBA-siNFKBIZ pharmaceutical composition. The successful graft coupling of 2PBA and siNFKBIZ was verified by 20% native polyacrylamide gel electrophoresis, as shown in FIG24 .

[0286] 2. Verification of the cellular uptake ability of the 2PBA-siNFKBIZ gene drug composition

[0287] HCEC cells were plated at 4 × 10 4 The number of cells was seeded in a 24-well culture plate, and a clean coverslip was placed in each well. The cells were cultured overnight and then incubated with 2PBA-siNFKBIZ-Cy3 and siRNA-Cy3 (equivalent Cy3 concentration: 0.5 μM) for 6 hours. The culture medium was then removed, the cells were washed three times with PBS, and fixed with 4% paraformaldehyde at room temperature for 15 minutes. Then, DAPI was used to stain for 15 minutes, washed with PBS, and observed using a laser confocal microscope. The results are shown in Figure 25A. The green fluorescence of the cells in the 2PBA-siNFKBIZ-Cy3 group was higher than that in the siNFKBIZ-Cy3 group.

[0288] HCEC cells were plated at 4.0 × 10 5 The cells were seeded in 12-well plates and cultured in DMEM overnight. PBA-siNFKBIZ-Cy3 was added to the cells according to the concentration of Cy3 (0.5 μM) per well and incubated in Opti-MEM at 37°C for 6 hours. siNFKBIZ-Cy3 was used as a control. The cells were collected using trypsin and collected for flow cytometric analysis. The results are shown in Figure 25B. The average fluorescence intensity of the 2PBA-siNFKBIZ-Cy3 group was approximately 1.5 times that of the siNFKBIZ-Cy3 group. In summary, the results show that the modification of 2PBA can further enhance the uptake ability of the siNFKBIZ drug and improve its intracellular effect.

[0289] 3. Evaluation of the gene regulation ability of the 2PBA-siNFKBIZ gene drug composition

[0290] According to 1×10 5HCEC cells were seeded into 6-well plates and cultured overnight, using the standard cell / well assay. After stimulation with IL-1β for 12 hours, the cells were washed twice with PBS and incubated with Opti-MEM medium containing siNFKBIZ and the 2PBA-siNFKBIZ drug combination for 6 hours, after which the medium was replaced with complete medium. Culture was continued at 37°C for 48 hours. Next, mRNA was extracted and its concentration measured. Reverse transcription was performed to obtain cDNA, and qPCR was performed. As shown in Figure 26, after IL-1β stimulation, NFKBIZ gene expression in HCEC cells was significantly upregulated to approximately 1.5-fold compared to normal cells. The siNFKBIZ gene drug alone was able to downregulate expression to approximately 1.4-fold, with no significant difference. However, the 2PBA-siNFKBIZ drug combination effectively inhibited NFKBIZ gene expression to approximately 1.1. These results demonstrate that the 2PBA-siNFKBIZ gene drug combination effectively promotes the intracellular entry of the siNFKBIZ gene drug, thereby achieving regulatory effects on the NFKBIZ gene and achieving a good gene inhibition effect.

[0291] 4. The therapeutic effect of 2PBA-siNFKBIZ gene drug combination on dry eye

[0292] All animal experiments in this example were performed in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO) "Statement on the Use of Animals in Ophthalmic and Vision Research" and in compliance with relevant operating specifications. All animal experiments were performed in accordance with the guidelines established by the Ethics Committee of Shanghai Jiao Tong University. In this example, 15 6-8 week old specific pathogen-free (SPF) grade C57BL / 6 mice (30 eyes) were selected from Shanghai Slake Laboratory Animal Co., Ltd. and kept in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 6 groups and exposed to a low humidity environment (RH = 18.5% ± 5.1%, AF = 15L / min, T = 21-23°C) for 4 days. Then 5 μL of 0.2% benzalkonium chloride was dripped into each eye twice a day for 14 consecutive days to establish a mouse dry eye model. Each group of mice received topical instillation of PBS, cyclosporine CsA eye drops (Xingqi Eye Drops), and 2PBA-siNFKBIZ (equivalent siRNA dose of 0.05 mg / kg) twice daily for 14 consecutive days, twice a day (morning and evening). Tear secretion and corneal sodium fluorescein staining were performed on days 0, 7, and 14 of administration, as described in Example 2.

[0293] The results are shown in Figure 27. The sodium fluorescein score of mice in the CsA eye drop group was reduced from 10 points to about 5 points, and the phenol red cotton tear test result increased from 2mm to about 4mm. The sodium fluorescein score of mice in the 2PBA-siNFKBIZ-M group was reduced to about 4.8 points, and the phenol red cotton tear test result increased from 2mm to about 4.5mm. It can be seen from the animal experimental results that 2PBA-siNFKBIZ-M has a good therapeutic effect on dry eye in mice. First, PBA can bind to eye proteins and promote the entry of siNFKBIZ-M into the cells. Second, after entering the cells, siNFKBIZ-M can well play the regulatory role of the NFKBIZ gene, inhibit inflammation, and achieve a good dry eye treatment effect.

[0294] Example 5

[0295] Tetraphenylboronic acid targeted delivery of siNFKBIZ gene drug composition for the treatment of dry eye

[0296] 1. Synthesis and characterization of 4PBA-siNFKBIZ gene drug composition

[0297] The synthesis route of 4PBA-NH2 in this embodiment is shown in Figure 28.

[0298] 1.1 Synthesis of compound 7

[0299] Compound 6 (100 mg) and compound 2 (826 mg) were placed in a 100 mL flask, and 40 mL of methanol was added and stirred until dissolved. DMTMM (921 mg) and NMM (337 mg) were added, and the reaction was allowed to react at room temperature under nitrogen for 20 hours. After completion of the reaction, the methanol was removed by distillation under reduced pressure, and 10 mL of ethyl acetate was added and shaken. The mixture was allowed to stand to precipitate a white solid, which was filtered to obtain compound 7 (512 mg) with a yield of approximately 84%.

[0300] Compound 7 1 The H NMR spectrum is shown in Figure 29. The solvent used in the nuclear magnetic spectrum test was CDCl3. The attribution of each proton peak is as follows: 1 H NMR (700 MHz, Chloroform-d) δ 7.82-7.73 (m, 8H), 7.30 (t, J = 6.4 Hz, 2H), 3.95 (q, J = 5.0 Hz, 1H), 3.61-3.50 (m, 4H), 1.29 (s, 24H). 13 The C NMR spectrum is shown in Figure 30. The solvent used in the nuclear magnetic spectrum test was CDCl3. The attribution of the characteristic carbon atoms in the product is as follows: 13C NMR (151MHz, Chloroform-d) δ168.08, 134.87, 133.98, 131.74, 125.25, 83.09, 69.08, 41.97, 23.85.

[0301] 1.2 Synthesis of compound 8

[0302] Compound 7 (512 mg) was placed in a 100 mL flask, and 30 mL of dichloromethane was added and stirred until dissolved. DMAP (10 mg) and DIEA (240 mg) were then added. Acetic anhydride (190 mg) was added under an ice bath, and the reaction was allowed to react at room temperature under nitrogen for 20 h. After completion of the reaction, the dichloromethane was removed by distillation under reduced pressure, 50 mL of water was added, and the mixture was washed twice with 20 mL of ethyl acetate. The organic phase was washed once with 20 mL of saturated sodium chloride solution, and dried over anhydrous sodium sulfate. The mixture was distilled under reduced pressure to obtain a colorless oily liquid. 10 mL of ether was added and the mixture was shaken. The mixture was allowed to stand to obtain a white solid. Filtered and dried to obtain 550 mg of a white solid, thus obtaining compound 8 in a yield of approximately 91%.

[0303] Compound 8 1 The H NMR spectrum is shown in Figure 31. The solvent used in the nuclear magnetic spectrum test was CDCl3. The attribution of each proton peak is as follows: 1 H NMR (700 MHz, DMSO-d6) δ 12.22 (s, 1H), 8.67 (t, J = 6.0 Hz, 2H), 7.88-7.69 (m, 8H), 5.09 (tt, J = 6.7, 4.9 Hz, 1H), 3.58 (dt, J = 13.9, 5.1 Hz, 2H), 3.43-3.38 (m, 2H), 2.51 (s, 2H), 2.48-2.44 (m, 2H), 1.31 (s, 22H). 13 The C NMR spectrum is shown in Figure 32. The solvent used in the nuclear magnetic spectrum test was CDCl3. The attribution of the characteristic carbon atoms in the product is as follows: 13 C NMR (151MHz, Chloroform-d) δ174.55,170.86,167.66,134.79,133.97,131.68,125.34,83.13,70.50,38.17,28.39,28.20,23.83.

[0304] 1.3 Synthesis of compound 9

[0305] Compound 1 (100 mg) and compound 8 (1019 mg) were placed in a 100 mL flask, and 40 mL of ethyl acetate was added and stirred until dissolved. EDCI (300 mg) and DMAP (10 mg) were added, and the reaction was allowed to react at room temperature for 20 h under nitrogen. After the reaction was completed, dichloromethane was removed by vacuum distillation, 30 mL of water (pH = 3) was added, and the mixture was washed twice with 30 mL of ethyl acetate. The organic phase was collected and washed once with 30 mL of saturated sodium bicarbonate solution and once with 30 mL of saturated sodium chloride solution. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was vacuum distilled to obtain a white foam solid, which was used directly in the subsequent reaction.

[0306] 1.4 Synthesis of compound 10

[0307] Compound 9 (647 mg) was placed in a dry 100 mL round-bottom flask, and 10 mL of acetone was added and stirred until dissolved. Sodium periodate (761 mg) and ammonium acetate (278 mg) were dissolved in 10 mL of water and added to the acetone solution. Under nitrogen protection, the reaction was placed at room temperature for 10 h. After the reaction was completed, acetone was removed by distillation under reduced pressure, 20 mL of water was added, and the mixture was washed twice with 20 mL of ethyl acetate. The organic phase was washed once with 20 mL of saturated sodium chloride solution. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was distilled under reduced pressure to obtain a colorless oily liquid, i.e., compound 10, which was directly used in subsequent reactions.

[0308] 1.5 Synthesis of compound 11

[0309] Compound 10 was placed in a dry 100 mL round-bottom flask, and 30 mL of ethyl acetate was added and stirred until dissolved. A 4 M hydrogen chloride-ethyl acetate solution (10 mL) was added under an ice bath, and the mixture was allowed to react for 3 h under nitrogen. After completion of the reaction, the hydrogen chloride-ethyl acetate solution was removed by distillation under reduced pressure, and the product was purified by reverse-phase column chromatography to obtain 392 mg of a white solid, compound 11, with a yield of approximately 83%.

[0310] Compound 11 1 The H NMR spectrum is shown in Figure 33. The solvent used in the NMR spectrum test was DMSO-d6. The attribution of each proton peak is as follows: 1 H NMR (600 MHz, DMSO-d6) δ 8.76 (s, 5H), 8.57 (d, J = 6.2 Hz, 3H), 8.24 (d, J = 20.8 Hz, 4H), 7.87 (q, J = 6.4, 5.1 Hz, 16H), 5.07 (t, J = 6.0 Hz, 2H), 4.22-4.17 (m, 4H), 3.84 (d, J = 5.0 Hz, 1H), 3.40-3.28 (m, 8H), 2.64-2.60 (m, 8H). 13The C NMR spectrum is shown in Figure 34. The solvent used in the NMR spectrum test was DMSO-d6. The attribution of the characteristic carbon atoms in the product is as follows: 13 C NMR (151MHz, DMSO-d6) δ170.82,167.16,167.08,136.19,134.40,134.23,126.59,69.00,60.23,55.38,50.81,49.05,44.06,21.23,14.55.

[0311] 1.54 Synthesis of PBA-siNFKBIZ Gene Drug Composition

[0312] The small interfering RNAs targeting the NFKBIZ gene used in this example were all purchased from Suzhou Beixin Biotechnology Co., Ltd. An aldehyde group (5'-CHO-) modification was introduced at the 5' end of the small interfering RNA, enabling it to efficiently couple with the carboxyl group modified on 4PBA-NH2 through an electrophilic substitution reaction. The 5'-terminal aldehyde group modification is represented by 5'-CHO- in all the following examples, and its modified structure is shown in Formula 61.

[0313] in, Represents the connected nucleic acid molecules, and Base represents any type of base.

[0314] The siNFKBIZ gene drug sequence used in this example is as follows:

[0315] The sequence of the small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0316] Sense:5'-UUAUCAACAUUAAGAAUGA-3' (SEQ ID NO: 44);

[0317] Antisense: 5'-UCAUUCUUAAUGUUGAUAA-3' (SEQ ID NO: 254);

[0318] In order to further increase the stability of RNA, this example performed stabilization modification, the specific sequence is:

[0319] Sense: 5'-UmUmAmUmCfAmAfCfAfUmUmAmAmGmAmAmUmsGmsAm-3' (SEQ ID NO: 44);

[0320] Antisense: 5'-UmsCfsAmUmUmCfUmUfAfAmUmGmUmUfGmAfUmsAmsAm-3' (SEQ ID NO: 254);

[0321] The sequence of the stabilized modified small interfering RNA (siNFKBIZ-M) targeting the mouse NFKBIZ gene is

[0322] Sense:5'-GmCmGmUmCfAmAfUfGfUmAmCmCmAmGmUmAmsUmsUm-3' (SEQ ID NO: 421);

[0323] Antisense: 5'-AmsAmsUmAmCmUfGmGfUfAmCmAmUmUfGmAfCmsGmsCm-3' (SEQ ID NO: 422).

[0324] Wherein, m represents 2'-O-methyl modification of the ribose sugar backbone, s represents phosphorothioate modification of the backbone, and f represents 2'-fluoro modification of the ribose sugar backbone.

[0325] The synthetic route of 4PBA-siNFKBIZ-S is shown in FIG35 .

[0326] The specific synthesis method is as follows: 0.15mg 4PBA-NH2 (1300nmol) and 0.14mg pic-BH3 (1300nmol) are dissolved in 0.13mL DMSO. 5OD (26nmol) of the sense strand of 5'-CHO-siNFKBIZ (siNFKBIZ-S) and 5μL of acetic acid are added to 0.13mL of the solution, and the reaction is shaken at room temperature for 2h. After completion of the reaction, 1mL of anhydrous ethanol and 13μL of 10× PBS are added, and the solution is incubated at -20°C overnight. After centrifugation at 12000rpm for 15min, the supernatant is discarded, and the precipitate is reconstituted with water to obtain the 4PBA-siNFKBIZ-S conjugate molecule. PBA-siNFKBIZ-S was then quantitatively mixed with the antisense strand of siNFKBIZ (siNFKBIZ-A) at a 1:1 molar ratio, incubated at 65°C for 10 minutes, and then annealed at 25°C for 10 minutes to obtain the 4PBA-siNFKBIZ pharmaceutical composition. Successful grafting of 4PBA and siNFKBIZ was confirmed by 20% native polyacrylamide gel electrophoresis (Figure 36). As shown in the figure, the grafting efficiency of 4PBA onto DBCO-siNFKBIZ was high, with a yield exceeding 90%.

[0327] 2. Verification of the cellular uptake ability of the 4PBA-siNFKBIZ drug composition

[0328] HCEC cells were plated at 4 × 10 4The number of cells was seeded in a 12-well culture plate, a clean coverslip was placed in each well, and the cells were cultured overnight. They were then cultured with 4PBA-siNFKBIZ-FAM and siRNA-FAM (equivalent FAM concentration: 0.5 μM) for 6 hours. The culture medium was then removed, washed three times with PBS, and fixed with 4% paraformaldehyde at room temperature for 15 minutes. Then, the cell nuclei were stained with DAPI for 15 minutes, washed with PBS, and observed using laser confocal microscopy. As shown in Figure 37A, the green fluorescence of the cells in the 4PBA-siNFKBIZ-FAM group was significantly higher than that in the siNFKBIZ-FAM group.

[0329] In order to culture HCEC cells at 4.0 × 10 5 The cells were seeded in 12-well plates and cultured in DMEM overnight. 4PBA-siNFKBIZ-FAM was added to the cells at a FAM concentration of 0.5 μM per well and incubated at 37°C in Opti-MEM for 6 hours. siNFKBIZ-FAM was used as a control. The cells were collected using trypsin and collected for flow cytometric analysis. The results are shown in Figure 37B. The average fluorescence intensity of the 4PBA-siNFKBIZ-FAM group was approximately 2.3 times that of the siNFKBIZ-FAM group. In summary, the results show that the modification of 4PBA can further enhance the uptake ability of siNFKBIZ small nucleic acid drugs and improve their intracellular effect.

[0330] 3.4 Evaluation of the gene regulation ability of the PBA-siNFKBIZ pharmaceutical composition

[0331] According to 1×10 5 According to the standard of cells / well, HCEC cells were seeded into 6-well plates and cultured overnight. After 12 hours of stimulation with IL-1β, the cells were washed twice with PBS. Next, the cells were incubated with Opti-MEM medium containing siNFKBIZ and 4PBA-siNFKBIZ drug composition for 6 hours, and the complete medium was replaced. The culture was continued at 37 degrees Celsius for 48 hours. Next, mRNA was extracted, the concentration of mRNA was measured, cDNA was obtained by reverse transcription, and qPCR experiments were performed. The results are shown in Figure 38 A. After IL-1β stimulation, the expression of the NFKBIZ gene in HCEC cells was significantly upregulated to about 1.8 times that of normal cells, and the simple siNFKBIZ gene drug could be downregulated to about 1.5 times. However, the 4PBA-siNFKBIZ drug composition can effectively inhibit the expression of the NFKBIZ gene to about 1.0.

[0332] According to 1×10 5HCEC cells were seeded into 6-well plates and cultured overnight using the standard cell / well. After 12 hours of stimulation with IL-1β, the cells were washed twice with PBS. Next, the cells were incubated with Opti-MEM medium containing different concentrations of the 4PBA-siNFKBIZ drug composition for 6 hours. After replacing the complete medium, the cells were cultured for another 48 hours. Next, total protein was extracted from the cells using RIPA buffer containing a protease inhibitor cocktail, the protein concentration was determined, and a Western blot experiment was performed. The results are shown in Figure 38B. The above results indicate that the 4PBA-siNFKBIZ drug composition can effectively promote the entry of the siNFKBIZ gene drug into the cells, inhibit the expression of the NFKBIZ gene, and effectively inhibit the protein expression of IκBζ.

[0333] 4.4 Effect of the PBA-siNFKBIZ Pharmaceutical Composition on Dry Eye Treatment

[0334] All animal experiments in this example were performed in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO) "Statement on the Use of Animals in Ophthalmic and Vision Research" and in compliance with relevant operating specifications. All animal experiments were performed in accordance with the guidelines established by the Ethics Committee of Shanghai Jiao Tong University. In this example, 15 6-8 week old specific pathogen-free (SPF) grade C57BL / 6 mice (30 eyes) were selected from Shanghai Slake Laboratory Animal Co., Ltd. and kept in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 3 groups and exposed to a low humidity environment (RH = 18.5% ± 5.1%, AF = 15L / min, T = 21-23°C) for 4 days. Then 5 μL of 0.2% benzalkonium chloride was dripped into each eye twice a day for 14 consecutive days to establish a mouse dry eye model. Each group of mice received topical instillation of PBS, cyclosporine CsA eye drops (Xingqi Eye Drops), and 4PBA-siNFKBIZ-M (equivalent siRNA dose of 0.05 mg / kg) twice daily for 14 consecutive days, twice a day (morning and evening). Tear secretion and corneal sodium fluorescein staining were performed on days 0, 7, and 14 of administration, as described in Example 2.

[0335] The results are shown in Figure 39. As can be seen from sodium fluorescein staining, after 14 days of treatment, compared with the PBS group, the drug-treated groups had less staining in the eyes, and the degree of corneal damage was significantly improved. Among them, the eye damage in the 4PBA-siNFKBIZ-M-treated group was significantly reduced, from the initial 9 points to about 4 points, while the CsA group score dropped to about 5. The tear secretion volume results showed that after treatment with the 4PBA-siNFKBIZ-M pharmaceutical composition, the tear secretion volume increased from about 1.5mm to about 4mm. In summary, the 4PBA-siNFKBIZ-M gene drug can increase the retention of the siNFKBIZ-M drug on the ocular surface, improve the bioavailability of the drug, promote the cellular uptake of the siNFKBIZ gene drug, thereby inhibiting the expression of the NFKBIZ gene, curbing the vicious cycle of inflammation, achieving improvement in ocular surface corneal damage, and effectively treating dry eye.

[0336] Example 6

[0337] Hexaphenylboronic acid targeted delivery of siNFKBIZ gene drug composition for the treatment of dry eye

[0338] 1. Synthesis and characterization of 6PBA-siNFKBIZ gene drug composition

[0339] The synthesis route of 6PBA-N3 in this example is shown in Figure 40.

[0340] 1.1 Synthesis of compound 13

[0341] Compound 12 (200 mg) and azidohexanoic acid (467 mg) were placed in a 100 mL flask and stirred with 20 mL of methanol until dissolved. DMTMM (688 mg) and NMM (248 mg) were added, and the reaction was allowed to react at room temperature under nitrogen for 20 hours. After completion of the reaction, methanol was removed by distillation under reduced pressure. The product was then purified by silica gel column chromatography using an ethyl acetate:methanol ratio of 30:1 as the eluent to obtain 356 mg of a white solid, compound 13, in an approximately 83% yield.

[0342] Compound 13 1 The HNMR spectrum is shown in Figure 41. The solvent used in the nuclear magnetic spectrum test is CDCl3. The attribution of each proton peak is as follows: 1 HNMR(700MHz,DMSO-d6)δ7.13(s,1H),4.76(t,J=5.8Hz,3H),3.51(d,J=5.7Hz,6H),3.31(t, J=6.9Hz,2H),2.14(t,J=7.4Hz,2H),1.51(ddt,J=21.1,15.1,7.3Hz,4H),1.33-1.26(m,2H).

[0343] 1.2 Synthesis of compound 14

[0344] Compound 13 (356 mg) and compound 8 (3560 mg) were placed in a 250 mL flask, 100 mL of dichloromethane was added, and the mixture was stirred until dissolved. EDCI (849 mg) and DMAP (100 mg) were added, and the reaction was allowed to react at room temperature for 20 h under nitrogen. After completion of the reaction, the dichloromethane was removed by vacuum distillation, and 100 mL of ethyl acetate was added. The mixture was washed with 100 mL of water (pH = 3) twice, 100 mL of saturated sodium bicarbonate solution twice, and 100 mL of saturated sodium chloride solution once. The organic phase was collected, dried over anhydrous sodium sulfate, and vacuum distilled to obtain a white foam solid, which was used directly in subsequent reactions.

[0345] 6.1.3 Synthesis of Compound 15

[0346] Compound 14 (1000 mg) was placed in a dry 100 mL round-bottom flask, 30 mL of acetone was added and stirred until dissolved. Sodium periodate (2379 mg) and ammonium carbonate (857 mg) were dissolved in 30 mL of water and added to the acetone solution. Under nitrogen protection, the reaction was placed at room temperature for 10 h. After the reaction was completed, acetone was removed by vacuum distillation, 100 mL of ethyl acetate was added, and the mixture was washed twice with 100 mL of water and once with 100 mL of saturated sodium chloride solution. The organic phase was collected and dried over anhydrous sodium sulfate. A white solid was obtained by vacuum distillation, which was dissolved in 10 mL of ethyl acetate. 10 mL of dichloromethane and 20 mL of petroleum ether were slowly added under stirring. A white solid was obtained by suction filtration. The solid was washed with 20 mL of petroleum ether and dried to obtain 702 mg of a white solid, i.e., compound 15, with a yield of about 91%.

[0347] Compound 15 1 The H NMR spectrum is shown in Figure 42. The solvent used in the NMR spectrum test was methanol-d4. The assignments of the proton peaks are as follows: 1 HNMR (600 MHz, Methanol-d4) δ 7.78 (t, J = 15.6 Hz, 24H), 5.22-5.18 (m, 3H), 4.32 (s, 6H), 3.71 (dd, J = 14.2, 4.8 Hz, 6H), 3.55 (dd, J = 14.3, 6.5 Hz, 6H), 3.19 (t, J = 6.8 Hz, 2H), 2.64-2.56 (m, 13H), 2.15 (t, J = 7.4 Hz, 2H), 1.51 (dq, J = 22.3, 7.4 Hz, 4H), 1.29 (ddt, J = 8.3, 5.9, 2.5 Hz, 2H). 13The C NMR spectrum is shown in Figure 43. The solvent used in the NMR spectrum test was methanol-d4. The attribution of the characteristic carbon atoms in the product is as follows: 13 C NMR (151MHz, Methanol-d4) δ175.22, 172.27 (d, J = 3.1Hz), 169.37, 137.37, 135.29, 133.63, 125. 97, 71.83, 62.03, 60.16, 57.56, 53.41, 50.85, 48.45, 40.07, 35.74, 25.82, 24.95, 19.47, 13.07.

[0348] 1.46 Synthesis of PBA-siNFKBIZ Gene Drug Composition

[0349] The small interfering RNAs targeting the NFKBIZ gene used in this example were purchased from Suzhou Beixin Biotechnology Co., Ltd. A dibenzocyclooctyne (DBCO) modification was introduced at the 3' end of the small interfering RNA to enable efficient coupling with the azide group modified on 6PBA-N3 through a click chemistry reaction. The 3'-end DBCO group modification is represented by 3'-DBCO in all the following examples, and its modified structure is shown in Formula 62:

[0350] in, Represents a connected nucleic acid molecule. Base represents any type of base;

[0351] The siNFKBIZ gene drug sequence used in this example is as follows:

[0352] The sequence of the small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0353] Sense:5'-AGUUGUUUCUAUGAAACAA-3' (SEQ ID NO: 101);

[0354] Antisense: 5'-UUGUUUCAUAGAAACAACUua-3' (SEQ ID NO: 434);

[0355] Furthermore, in this example, the sequences used were stabilized and modified as follows:

[0356] Sense:5'-AmsGmsUmUmGfUmUfUfCfUmAmUmGmAmAmAmCmAmAm-3' (SEQ ID NO: 101);

[0357] Antisense: 5'-UmsUfsGmUmUmUfCmAfUfAmGmAmAmAfCmAfAmCmUmsUmsAm-3' (SEQ ID NO: 434);

[0358] Wherein, m represents 2'-O-methyl modification of the ribose sugar backbone, s represents phosphorothioate modification of the backbone, and f represents 2'-fluoro modification of the ribose sugar backbone.

[0359] The sequence of the small interfering RNA targeting the mouse NFKBIZ gene (siNFKBIZ-M) is

[0360] Sense:5'-GCGUCAAUGUACCAGUAUU-3' (SEQ ID NO: 421);

[0361] Antisense: 5'-AAUACUGGUACAUUGACGCCU-3' (SEQ ID NO: 422);

[0362] The synthetic route of 6PBA-siNFKBIZ-S is shown in Figure 44:

[0363] The specific synthesis method is as follows: 0.15 mg of 6PBA-N3 (130 nmol) was dissolved in 0.13 mL of DMSO, 5 OD (26 nmol) of the sense strand of DBCO-siNFKBIZ (siNFKBIZ-S) was added, and the mixture was shaken at 50°C for 24 hours. After adding 5 mL of water, the excess 6PBA-N3 was extracted with ethyl acetate, and the aqueous solution was concentrated and evaporated to dryness to obtain the PBA-siNFKBIZ-S conjugate. 6PBA-siNFKBIZ-S was then quantitatively mixed with the antisense strand of siNFKBIZ (siNFKBIZ-A) in a 1:1 molar ratio, incubated at 65°C for 10 minutes, and annealed at 25°C for 10 minutes to obtain the 6PBA-siNFKBIZ pharmaceutical composition. As shown in Figure 45, the successful grafting of 6PBA and siNFKBIZ was verified by 20% denaturing polyacrylamide gel electrophoresis, with a grafting efficiency exceeding 90%.

[0364] 2. Verification of the cellular uptake ability of the 6PBA-siNFKBIZ gene drug composition

[0365] HCEC cells were plated at 4 × 10 4The number of cells was seeded in a 24-well culture plate, a clean coverslip was placed in each well, and the cells were cultured overnight. They were then cultured with 6PBA-siNFKBIZ-FAM and siNFKBIZ-FAM (equivalent FAM concentration: 0.5 μM) for 6 hours. The culture medium was then removed, washed three times with PBS, and fixed with 4% paraformaldehyde at room temperature for 15 minutes. Then, DAPI was used to stain for 15 minutes, washed with PBS, and observed using a laser confocal microscope. As shown in Figure 46A, the green fluorescence of the cells in the 6PBA-siNFKBIZ-FAM group was significantly higher than that in the siNFKBIZ-FAM-FAM group.

[0366] In order to culture HCEC cells at 4.0 × 10 5 The cells were seeded in 12-well plates and cultured in DMEM overnight. 6PBA-siNFKBIZ-FMA (FAM equivalent concentration 0.5 μM) was added to the cells and incubated in Opti-MEM at 37°C for 6 hours. siNFKBIZ-FAM was used as a control. The cells were collected using trypsin and collected for flow cytometric analysis. The results are shown in Figure 46B. The average fluorescence intensity of the 6PBA-siNFKBIZ-FMA group was approximately 3 times that of the siNFKBIZ-FAM group. In summary, the results show that the 6PBA-siNFKBIZ drug composition has more PBAs that can better interact with cell surface sugars, thereby improving the cell's ability to take up siNFKBIZ small nucleic acid drugs and significantly improving their intracellular effect.

[0367] 3. Evaluation of the gene regulation ability of the 6PBA-siNFKBIZ gene drug composition

[0368] According to 1×10 5 According to the standard of cells / well, HCEC cells were seeded into 6-well plates and cultured overnight. After 12 hours of stimulation with IL-1β, the cells were washed twice with PBS. Next, the cells were incubated with Opti-MEM medium containing siNFKBIZ and 6PBA-siNFKBIZ drug composition for 6 hours, and then replaced with DMEM complete medium. Culture was continued at 37°C for 48 hours. Next, the cells were lysed using RNAiso reagent to extract mRNA, and the concentration of mRNA was measured by Nanodrop, reverse transcribed to obtain cDNA, and qPCR experiments were performed. The results are shown in Figure 47A. After IL-1β stimulation, the expression of the NFKBIZ gene in HCEC cells was significantly upregulated to about 1.6 times that of normal cells, and the simple siNFKBIZ gene drug could be downregulated to about 1.5 times. However, the 6PBA-siNFKBIZ drug composition can effectively inhibit the expression of the NFKBIZ gene to about 0.7.

[0369] According to 1×105 HCEC cells were seeded into 6-well plates and cultured overnight, using the standard 10 cells / well protocol. They were then stimulated with IL-1β for 12 hours, washed twice with PBS, and incubated with Opti-MEM medium containing varying concentrations of the 6PBA-siNFKBIZ pharmaceutical composition for 6 hours. After replacing the medium with complete medium, the cells were cultured for an additional 48 hours. Protein was then extracted, concentrations were determined, and Western blots were performed. As shown in Figure 47B, the 6PBA-siNFKBIZ pharmaceutical composition effectively inhibited IκBζ protein expression.

[0370] 4.6 The therapeutic effect of PBA-siNFKBIZ gene drug combination on dry eye

[0371] All animal experiments in this example were performed in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO) "Statement on the Use of Animals in Ophthalmic and Vision Research" and in compliance with relevant operating specifications. All animal experiments were performed in accordance with the guidelines established by the Ethics Committee of Shanghai Jiao Tong University. In this example, 15 6-8 week old specific pathogen-free (SPF) grade C57BL / 6 mice (30 eyes) were selected from Shanghai Slake Laboratory Animal Co., Ltd. and kept in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 3 groups and exposed to a low humidity environment (RH = 18.5% ± 5.1%, AF = 15L / min, T = 21-23°C) for 4 days. Then 5 μL of 0.2% benzalkonium chloride was dripped into each eye twice a day for 14 consecutive days to establish a mouse dry eye model. Each group of mice received topical instillation of PBS, cyclosporine CsA eye drops (Xingqi Eye Drops), and 6PBA-siNFKBIZ (equivalent siRNA dose of 0.05 mg / kg) twice daily for 14 consecutive days, twice a day (morning and evening). Tear secretion and corneal sodium fluorescein staining were performed on days 0, 7, and 14 of administration, as described in Example 2.

[0372] The results are shown in Figure 48. Fluorescein staining revealed that compared to the PBS group, all treatment groups showed improvement on day 7. On day 14, the ocular score in the CsA eye drop group decreased from approximately 10 to 5, and the phenol red cotton tear test showed a significant increase in tear volume. In the 6PBA-siNFKBIZ-M group, the fluorescein sodium score decreased from 10 to approximately 3.5, and the phenol red cotton infiltration length increased from 2 mm to approximately 5.7 mm. In summary, compared to CsA eye drops, the 6PBA-siNFKBIZ-M treatment group showed a significant therapeutic effect within two weeks.

[0373] Example 7

[0374] Decaphenylboronic acid targeted delivery of siNFKBZ gene drug composition for the treatment of dry eye

[0375] 1. PBA 10 -Synthesis and characterization of siNFKBIZ gene drug composition

[0376] The thiolated-modified NFKBIZ gene small interfering RNA used in this example was purchased from Suzhou Beixin Biotechnology Co., Ltd. 12 T sequences were introduced at the 3' end of the small interfering RNA sense chain, and 10 phosphorothioate backbone modifications (PS) were modified (10PS-siNFKBIZ-S) to enable it to be coupled with the bromoacetyl bromide group modified on 4-bromomethyl-phenylboronic acid (PBA-Br). The 10 Ts extending from the 3' end of the siNFKBIZ sense chain have PS modifications and are represented by -10PS in all the following examples. The specific structure of PS is shown in Formula 63.

[0377] in, Represents a linked nucleic acid molecule.

[0378] The siNFKBIZ gene drug sequence used in this example is as follows:

[0379] The sequence of the small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0380] Sense: 5'-GCCCGAUUCGUUGUCUGAUTT*T*T*T*T*T*T*T*T*T*T-3' (SEQ ID NO: 435); wherein * indicates phosphorothioate modification;

[0381] Antisense: 5'-AUCAGACAACGAAUCGGGCcc-3' (SEQ ID NO: 433);

[0382] The sequence of the small interfering RNA targeting the mouse NFKBIZ gene (siNFKBIZ-M) is

[0383] Sense: 5'-GCGUCAAUGUACCAGUAUUTT*T*T*T*T*T*T*T*T*T*T-3' (SEQ ID NO: 436); wherein * indicates phosphorothioate modification;

[0384] Antisense: 5'-AAUACUGGUACAUUGACGCCU-3' (SEQ ID NO: 422);

[0385] PBA 10 The synthetic route of PS and Br-PBA in the synthesis of -siNKKBIZ is shown in Figure 49:

[0386] The specific synthesis steps are as follows: 4-bromomethyl-phenylboronic acid is prepared into a 60mM DMSO solution, which is then added to 200μM 10PS-siNFKBIZ in a 1:1 volume ratio in a metal bath and reacted at 50°C for 3 hours. The small molecules are then extracted with ethyl acetate, and dimethyl sulfoxide is removed by dialysis to obtain the product PBA. 10 -siNFKBIZ-S, quantify and spin dry. 10 -siNFKBIZ-S and siNFKBIZ-A were complementary paired in 1× PBS and assembled into PBA 10 The results of the non-denaturing 10% polyacrylamide gel analysis are shown in FIG50 , which demonstrate that PBA was successfully modified on the S chain of siNFKBIZ- and successfully complemented with siNFKBIZ-A.

[0387] 2. PBA 10 -Cellular uptake efficiency of siNFKBIZ gene drug composition

[0388] HCEC cells were plated at 4.0 × 10 5 The cells were seeded in 12-well plates and cultured in DMEM overnight. 10 -siNFKBIZ-FAM (FAM equivalent concentration 0.5 μM) was added to the cells and incubated in Opti-MEM at 37°C for 1 h, 3 h, and 6 h. siNFKBIZ-FAM was used as a control. Cells were harvested using trypsin and collected for flow cytometry analysis. The results are shown in Figure 51. HCEC cells showed a significant difference in PBA expression. 10 The siNFKBIZ-FAM drug combination exhibited time-dependent uptake at 1 and 3 hours, with uptake at 3 hours approximately six times that of the siNFKBIZ-FAM drug. These results suggest that PBA modification of one strand of the siNFKBIZ gene drug can enhance the uptake of the siNFKBIZ small nucleic acid drug and improve its cellular efficacy.

[0389] 3. PBA 10 -Regulatory effect of siNFKBIZ gene drug composition on NFKBIZ gene

[0390] According to 1×10 5 HCEC cells were seeded into 6-well plates and cultured overnight. IL-1β was then used to stimulate the cells for 12 h, followed by washing with PBS twice. The cells were then incubated with siNFKBIZ and PBA 10-siNFKBIZ pharmaceutical composition (siRNA equivalent concentration of 400nM) in Opti-MEM medium was incubated for 6h, and after replacing the complete medium, the culture was continued for 48h. Next, mRNA was extracted, and the mRNA concentration was measured. Reverse transcription was performed to obtain cDNA, and qPCR experiments were performed. The results are shown in Figure 52. After LPS stimulation, the expression of the NFKBIZ gene in HCEC cells was significantly upregulated to about 1.2 times that of normal cells. 10 -siNFKBIZ pharmaceutical composition can effectively inhibit the expression of NFKBIZ gene in a concentration-dependent manner. At a concentration of 400nM, the NFKBIZ gene can be inhibited by about 50% compared with the LPS stimulation group. The above results show that PBA 10 -siNFKBIZ pharmaceutical composition can effectively promote the entry of siNFKBIZ gene drug into cells, thereby realizing the regulatory effect of NFKBIZ gene and achieving better gene inhibition effect.

[0391] 4. PBA 10 -The therapeutic effect of siNFKBIZ gene drug combination on dry eye

[0392] All animal experiments in this example were conducted in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO) "Statement on the Use of Animals in Ophthalmic and Vision Research" and in compliance with relevant operating specifications. All animal experiments were conducted in accordance with the guidelines established by the Ethics Committee of Shanghai Jiao Tong University. In this example, 15 6-8 week old specific pathogen-free (SPF) grade C57BL / 6 mice (30 eyes) were selected from Shanghai Slake Laboratory Animal Co., Ltd. and kept in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 3 groups and exposed to a low humidity environment (RH = 18.5% ± 5.1%, AF = 15L / min, T = 21-23°C) for 4 days. Then 5 μL of 0.2% benzalkonium chloride was instilled into each eye twice a day for 14 consecutive days to establish a mouse dry eye model. Each group of mice was topically instilled with PBS, cyclosporine CsA eye drops (Xingqi eye drops), PBA 10 -siNFKBIZ-M (equivalent siRNA dose of 0.05 mg / kg) was administered twice a day for 14 consecutive days (morning and evening). Tear secretion and corneal fluorescein sodium staining were performed on days 0, 7, and 14 of administration, as described in Example 2.

[0393] The results are shown in Figure 53. After 14 days of treatment, the CsA eye drops and PBA 10-siNFKBIZ-M drug combination group showed significant changes in eye damage. The eye score of mice in the CsA-treated group dropped from 12 points to about 8 points, and the phenol red cotton thread tear test result increased from 2.4mm to about 3.25mm. 10 The sodium fluorescein score of mice in the -siNFKBIZ-M drug combination group decreased from 11 points to about 5.4 points, and the length of phenol red cotton thread infiltration increased from 2.0mm to about 3.35mm. From the animal experimental results, it can be seen that compared with the CsA eye drops group, PBA 10 The -siNFKBIZ-M drug composition group had a more obvious therapeutic effect on dry eye in mice.

[0394] Example 8

[0395] Hexaphenylboronic acid targeted delivery of siNFKBIZ gene drug composition via neck ring for the treatment of dry eye

[0396] 1. Synthesis and characterization of the PBA6-siNFKBIZ gene drug composition

[0397] The synthesis route of 2PBA-Br in this example is shown in Figure 54.

[0398] 1.1 Synthesis of compound 17

[0399] Compound 8 (776 mg) and compound 16 (200 mg) were placed in a 100 mL flask, and 20 mL of dichloromethane was added and stirred until dissolved. EDCI (285 mg) and DMAP (20 mg) were added, and the reaction was allowed to react at room temperature for 20 h under nitrogen. After completion of the reaction, dichloromethane was removed by distillation under reduced pressure, and 30 mL of ethyl acetate was added. The mixture was washed with 30 mL of water (pH = 3) twice, 30 mL of saturated sodium bicarbonate solution twice, and 30 mL of saturated sodium chloride solution once. The organic phase was collected and dried over anhydrous sodium sulfate. The mixture was distilled under reduced pressure to obtain a white foam solid, which was used directly in the subsequent reaction.

[0400] 1.2 Synthesis of compound 18

[0401] Compound 17 was placed in a dry 100 mL round-bottom flask, 20 mL of acetone was added and stirred until dissolved. Sodium periodate (852 mg) and ammonium acetate (310 mg) were dissolved in 20 mL of water and added to the acetone solution. Under nitrogen protection, the reaction was placed at room temperature for 10 h. After the reaction was completed, acetone was removed by vacuum distillation, 100 mL of ethyl acetate was added, and the mixture was washed twice with 100 mL of water and once with 100 mL of saturated sodium chloride solution. The organic phase was collected and dried over anhydrous sodium sulfate. A light yellow oily liquid was obtained by vacuum distillation. Reverse phase column chromatography was used to purify the obtained white solid 486 mg, i.e., compound 18, with a two-step yield of about 73%.

[0402] Compound 18 1 The H NMR spectrum is shown in Figure 55. The solvent used in the NMR spectrum test was DMSO-d6. The attribution of each proton peak is as follows: 1 H NMR (700 MHz, DMSO-d6) δ 8.58 (t, J = 6.0 Hz, 2H), 8.22 (s, 4H), 7.87 (d, J = 7.7 Hz, 4H), 7.81-7.74 (m, 4H), 7.41 (d, J = 7.9 Hz, 2H), 7.32 (d, J = 8.0 Hz, 2H), 5.09 (qd, J = 6.4, 3.2 Hz, 1H), 5.03 (s, 2H), 4.74 (s, 2H), 3.58 (dt, J = 13.9, 5.5 Hz, 2H), 3.42-3.39 (m, 2H), 2.63-2.57 (m, 4H). 13 The C NMR spectrum is shown in Figure 56. The solvent used in the NMR spectrum test was DMSO-D6. The attribution of the characteristic carbon atoms in the product is as follows: 13 C NMR (176MHz, DMSO-d6) δ166.28, 136.87, 134.96, 133.35, 128.32, 127.50, 125.50, 71.05, 64.57, 45.21, 39.44, 38.63, 38.51, 28.29, 28.00.

[0403] 1.3 Preparation of PBA6-siNFKBIZ gene drug composition

[0404] The thiolated-modified NFKBIZ gene small interfering RNA used in this example was purchased from Suzhou Beixin Biotechnology Co., Ltd. The 16 bases at the 3' end of the positive strand of the small interfering RNA formed a neck ring structure, and a phosphorothioate backbone (phosphorothioate, PS) was used to modify the ring structure (3PS-siNFKBIZ-S) to enable it to be coupled with the bromine group modified on bromo-diphenylboronic acid (2PBA-Br).

[0405] The siNFKBIZ gene drug sequence used in this example is as follows:

[0406] The sequence of the small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0407] Sense:5'-GCCCGAUUCGUUGUCUGAUGCAGCCG*A*A*AGGCUGC-3' (SEQ ID NO: 437);

[0408] Antisense: 5'-AUCAGACAACGAAUCGGGCcc-3' (SEQ ID NO: 433);

[0409] The sequence of the small interfering RNA targeting the mouse NFKBIZ gene (siNFKBIZ-M) is

[0410] Sense:5'-GCGUCAAUGUACCAGUAUUGCAGCCG*A*A*AGGCUGC-3' (SEQ ID NO: 438);

[0411] Antisense: 5'-AAUACUGGUACAUUGACGCCU-3' (SEQ ID NO: 422);

[0412] The synthetic route of PBA6-siNKKBIZ is shown in Figure 57.

[0413] The specific synthesis steps were as follows: Compound 18 was prepared into a 20 mM DMSO solution. This was then added to 200 μM 3PS-siNFKBIZ in a 1:1 volume ratio and reacted in a metal bath at 50°C for 3 h. Small molecules were then extracted with ethyl acetate, and dimethyl sulfoxide was removed by dialysis to yield the product, PBA6-siNFKBIZ-S. The product was then quantified and spin-dried. Finally, PBA6-siNFKBIZ-S was base-paired with siNFKBIZ-A in 1× PBS to form PBA6-siNKKBIZ. Verification was performed using a non-denaturing 20% ​​polyacrylamide gel. The results are shown in Figure 58, demonstrating that PBA was successfully modified onto the siNFKBIZ-S chain and complemented with siNFKBIZ-A.

[0414] 2. Cellular uptake efficiency of the PBA6-siNFKBIZ gene drug composition

[0415] HCEC cells were plated at 4 × 10 4 The number of cells was seeded into a 24-well culture plate, a clean coverslip was placed in each well, and the cells were cultured overnight. They were then co-cultured with PBA6-siNFKBIZ-FAM and siRNA-FAM (equivalent FAM concentration: 0.5 μM) for 4 hours. The culture medium was then removed, washed three times with PBS, and fixed with 4% paraformaldehyde at room temperature for 15 minutes. Then, DAPI was used to stain for 15 minutes, washed with PBS, and observed using a laser confocal microscope. As shown in Figure 59A, the green fluorescence of the cells in the PBA6-siNFKBIZ-FAM group was significantly higher than that in the FAM-modified siNFKBIZ-FAM group.

[0416] HCEC cells were plated at 4.0 × 10 5 The cells were seeded in 12-well plates and cultured in DMEM overnight. PBA6-siNFKBIZ-FAM was added to the cells at a concentration of FAM (0.5 μM) per well and incubated at 37°C in Opti-MEM for 6 hours. siNFKBIZ-FAM was used as a control. The cells were collected using trypsin and collected for flow cytometric analysis. The results are shown in Figure 59B. The uptake of PBA6-siNFKBIZ-FAM by HCEC cells was approximately 3.2 times the uptake of siNFKBIZ-FAM drugs. The above results indicate that PBA modification of the stem-loop structure of the siNFKBIZ gene drug can enhance the uptake capacity of the siNFKBIZ small nucleic acid drug and improve its intracellular effect.

[0417] 3. Regulatory effect of the PBA6-siNFKBIZ gene drug composition on the NFKBIZ gene

[0418] According to 1×10 5 HCEC cells were seeded into 6-well plates and cultured overnight according to the cell / well standard. After 12 hours of stimulation with IL-1β, the cells were washed twice with PBS. Next, the cells were incubated with Opti-MEM medium containing siNFKBIZ and PBA6-siNFKBIZ drug composition for 6 hours. After replacing the complete medium, the cells were cultured for another 48 hours. Next, mRNA was extracted, the mRNA concentration was measured, cDNA was obtained by reverse transcription, and qPCR experiments were performed. The results are shown in Figure 60 A. After IL-1β stimulation, the expression of the NFKBIZ gene in HCEC cells was significantly upregulated to about 1.5 times that of normal cells. The PBA6-siNFKBIZ gene drug composition can effectively inhibit the expression of the NFKBIZ gene, which can be effectively inhibited by about 50%.

[0419] According to 1×10 5HCEC cells were seeded into 6-well plates and cultured overnight according to the standard of cells / well. After 12 hours of stimulation with IL-1β, the cells were washed twice with PBS. Next, the cells were incubated with Opti-MEM medium containing different concentrations of PBA6-siNFKBIZ drug composition for 6 hours. After replacing the complete medium, the cells were cultured for another 48 hours. Total protein was extracted from the cells using RIPA buffer containing a protease inhibitor cocktail, and the protein concentration was measured for Western blot experiments. As shown in Figure 60B, the inhibitory ability of the PBA6-siNFKBIZ gene drug composition for IκBζ protein is concentration-dependent, and it can effectively inhibit protein expression at a concentration of 500nM. The above results show that the terminal modification of the stem-loop structure by PBA can effectively promote the entry of the siNFKBIZ gene drug into the cell, thereby achieving the regulatory effect of the NFKBIZ gene and inhibiting the expression of the IκBζ protein, thereby achieving better inflammation suppression.

[0420] 4. The therapeutic effect of the PBA6-siNFKBIZ gene drug combination on dry eye

[0421] All animal experiments in this example were performed in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO) "Statement on the Use of Animals in Ophthalmic and Vision Research" and in compliance with relevant operating specifications. All animal experiments were performed in accordance with the guidelines formulated by the Ethics Committee of Shanghai Jiao Tong University. In this example, 15 6-8 week-old specific pathogen-free (SPF) grade C57BL / 6 mice (30 eyes) were selected from Shanghai Slake Laboratory Animal Co., Ltd. and raised in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 3 groups and exposed to a low humidity environment (RH = 18.5% ± 5.1%, AF = 15L / min, T = 21-23°C) for 4 days. Then 5 μL of 0.2% benzalkonium chloride was dripped into each eye twice a day for 14 consecutive days to establish a mouse dry eye model. Each group of mice received topical instillation of PBS, cyclosporine CsA eye drops (Xingqi Eye Drops), and PBA6-siNFKBIZ (equivalent siRNA dose of 0.05 mg / kg) twice daily for 14 consecutive days, twice a day (morning and evening). Tear secretion was measured and corneal sodium fluorescein staining was performed on days 0, 7, and 14 of administration, as described in Example 2.

[0422] The results, as shown in Figure 61, show significant changes in ocular damage after 14 days of treatment in both the CsA eye drop and PBA6-siNFKBIZ drug combination groups. The ocular score of mice in the CsA group dropped from 11 to approximately 6, and the tear test result on the phenol red cotton thread increased from 2.1 mm to approximately 4.5 mm. In the PBA6-siNFKBIZ drug combination group, the sodium fluorescein score dropped from 11 to approximately 4, and the length of phenol red cotton thread infiltration increased from 2.6 mm to approximately 5.6 mm. The animal experimental results demonstrate that the PBA6-siNFKBIZ drug combination group exhibits a more pronounced therapeutic effect on dry eye in mice compared to the case group and the CsA eye drop group.

[0423] The above is only a preferred embodiment of the present application. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present application. These improvements and modifications should also be regarded as the scope of protection of the present application.

Claims

1. A pharmaceutical composition for inhibiting the expression of the NFKBIZ gene, characterized in that, Comprising a nucleic acid molecule that inhibits the expression of the NFKBIZ gene and a targeting ligand molecule that targets an eye tissue-specific protein.

2. The pharmaceutical composition according to claim 1, wherein The nucleic acid molecule is a double-stranded nucleic acid molecule composed of a sense strand and an antisense strand; The nucleic acid molecule comprises at least one nucleotide sequence selected from the following items A and B: A. The sense strand of the nucleic acid molecule is selected from at least one numbered nucleotide sequence: SEQ ID NO: 1 to SEQ ID NO: 18, SEQ ID NO: 25 to SEQ ID NO: 49, SEQ ID NO: 51 to SEQ ID NO: 89, SEQ ID NO: 93 to SEQ ID NO: 108, SEQ ID NO: 113 to SEQ ID NO: 132, SEQ ID NO: 134 to SEQ ID NO: 135, SEQ ID NO: 138, SEQ ID NO: 143 to SEQ ID NO: 152, SEQ ID NO: 154 to SEQ ID NO: 161, SEQ ID NO: 169 to SEQ ID NO: 185, and SEQ ID NO: 421; The antisense strand of the nucleic acid molecule is selected from at least one numbered nucleotide sequence: SEQ ID NO: 211 to SEQ ID NO: 228, SEQ ID NO: 235 to SEQ ID NO: 259, SEQ ID NO: 261 to SEQ ID NO: 299, SEQ ID NO: 303 to SEQ ID NO: 318, SEQ ID NO: 323 to SEQ ID NO: 342, SEQ ID NO: 344 to SEQ ID NO: 345, SEQ ID NO: 348, SEQ ID NO: 353 to SEQ ID NO: 362, SEQ ID NO: 364 to SEQ ID NO: 371, SEQ ID NO: 379 to SEQ ID NO: 395, and SEQ ID NO: 422; B. Based on the nucleotide sequence in item A, 2 to 3 bases are added, deleted, or replaced continuously or discontinuously, and the nucleotide sequence has the effect of targeting the NFKBIZ gene to play an inhibitory role.

3. The pharmaceutical composition according to claim 2, wherein A hanging single strand is further provided at the end of the sense strand or antisense strand of the nucleic acid molecule.

4. The pharmaceutical composition according to claim 3, wherein The length of the hanging single strand is 1 to 3 nt.

5. The pharmaceutical composition according to any one of claims 1 to 4, characterized in that, The nucleic acid molecule comprises any one or more of the following modified nucleotides: deoxynucleotide, 3'-terminal deoxythymidine nucleotide, 2'-O-methyl modified nucleotide, 2'-fluoro modified nucleotide, 2'-deoxy modified nucleotide, locked nucleic acid, conformationally restricted nucleotide, constrained ethyl nucleotide, abasic nucleotide, 2'-amino modified nucleotide, 2'-O-allyl modified nucleotide, 2'-C-alkyl modified nucleotide, 2'-hydroxy modified nucleotide, 2'-methoxyethyl modified nucleotide, 2'-O-alkyl modified nucleotide, morpholino nucleotide, phosphoramidate, nucleotide containing unnatural base, tetrahydropyran modified nucleotide, 1,5-anhydrohexitol modified nucleotide, cyclohexenyl modified nucleotide, nucleotide containing phosphorothioate group, nucleotide containing methylphosphonate group, nucleotide containing 5'-phosphate and nucleotide containing 5'-phosphate mimic.

6. The pharmaceutical composition according to claim 1, wherein The targeting ligand molecule includes a nucleic acid aptamer targeting an eye tissue-specific protein, a compound modified with boric acid or its derivative, or a compound modified with phenylboric acid or its derivative.

7. The pharmaceutical composition according to claim 6, wherein The eye tissue-specific protein includes at least one of the following: mucin, integrin, and CD44.

8. The pharmaceutical composition according to claim 7, wherein, The mucin includes at least one of the following: MUC-1, MUC-4, and MUC-16; The integrin includes at least one of the following: α V β1, α V β3, α V β6, α5β1, α6β1, α V β1, α V β5, α6β4 and α1β1.

9. The pharmaceutical composition according to claim 8, wherein The nucleotide sequence of the nucleic acid aptamer targeting mucin MUC-1 is shown as SEQ ID NO: 423; The nucleotide sequence of the nucleic acid aptamer targeting mucin MUC-16 is shown as SEQ ID NO: 424; Targeting integrin α V The nucleotide sequence of the β3 nucleic acid aptamer is shown in SEQ ID NO: 425; The nucleotide sequence of the nucleic acid aptamer targeting CD44 is shown as SEQ ID NO:

426.

10. The pharmaceutical composition according to claim 1, wherein The nucleic acid aptamer further includes a nucleic acid aptamer modified with enhanced stability. The enhanced stability modification includes at least one of the following: phosphorothioate backbone modification, 2'-O-methyl modification, 2'-methoxyethyl modification, 2'-fluoro modification, reverse thymidine modification, deoxythymidine nucleotide, and polyethylene glycol terminal conjugation.

11. The pharmaceutical composition according to claim 6, wherein The compound modified with boric acid or its derivative or the compound modified with phenylboric acid or its derivative is a linear or branched compound with a terminal modification of boric acid or phenylboric acid or its derivative; The number of boric acid or its derivative or phenylboric acid or its derivative modifications on the linear or branched compound is 1 to 40.

12. The pharmaceutical composition according to claim 11, wherein The structural formula of the compound modified with boric acid or its derivative, or the compound modified with phenylboronic acid or its derivative is shown as any one of Formula 1 to Formula 10: In Formulas 1 to 10, A and G are each independently absent, -(CH2) h -, or a group in which one or more of the methylene groups in -(CH2) h - are replaced by an M group; h is 0 to 15; the M group includes: -O-, -S-, -C(O)-, -C(O)O-, -C(O)NH-, -CH(T C )-, -C(T’)(T”), -NH-, -N(T N )-, -S-S-, -C(T’)=C(T”), -C≡C-, one or more of those in; T in the M group C , T N , T', T" represent that any one or more hydrogen atoms on the specified atom are replaced by an L group, provided that the normal valence of the specified atom is not exceeded and the substitution produces a stable compound, and the specified atoms include carbon atoms or nitrogen atoms; the L group includes any one of the following: C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, hydroxy, carboxy, cycloalkyl, cycloalkenyl, heterocyclic group, heteroaryl, aryl, ketone, alkoxycarbonyl, aryloxycarbonyl, heteroaryloxycarbonyl or halogen; the halogen includes F, Cl, Br or I; (O) in A represents a carbonyl oxygen atom; D, E, and H are each independently absent, -O-, -S-, -C(O)-, -NH-, -CH2-, -C(O)NH-, -NHC(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)NH-, -NHC(O)O-, and one or more of; in the groups D, E, H, (O) represents a carbonyl oxygen atom; the Represents the connection position of the structural formula; A, G, D, E, and H do not all disappear simultaneously; K represents boric acid or its derivative or phenylboric acid and its derivative; m, n, and t are independently 1 to 15.

13. The pharmaceutical composition according to any one of claims 6 to 12, characterized in that, The targeting ligand molecule is directly covalently coupled to the end of the nucleic acid molecule.

14. The pharmaceutical composition according to claim 13, wherein When the targeting ligand molecule is a nucleic acid aptamer, the phosphate group of the nucleic acid aptamer is covalently coupled to the ribose of the nucleic acid molecule.

15. The pharmaceutical composition according to claim 13, wherein When the targeting ligand molecule is a compound modified with boric acid or its derivative or a compound modified with phenylboric acid or its derivative, the targeting ligand molecule is covalently coupled to the phosphate group or base at the end of the nucleic acid molecule; When covalently coupled to the phosphate group at the end of the nucleic acid molecule, the targeting ligand molecule is coupled through an X group; the X group represents -O- or -S-.

16. The pharmaceutical composition according to any one of claims 6 to 12, characterized in that, The targeted ligand molecule is covalently coupled to the nucleic acid molecule through an extension sequence linked to the end of the nucleic acid molecule.

17. The pharmaceutical composition according to claim 16, wherein The extension sequence includes an extension sequence linked to the end of the nucleic acid molecule at only one end and / or an extension sequence that forms a stem-loop structure in a form where one end is linked to the 3'-end of one strand of the nucleic acid molecule while the other end is linked or not linked to the 5'-end of the complementary strand of the nucleic acid molecule.

18. The pharmaceutical composition according to claim 17, wherein The length of the extension sequence is 1 to 40 nt; the extension sequence is a random nucleotide sequence.

19. The pharmaceutical composition according to claim 18, wherein When the targeted ligand molecule is an aptamer, the phosphate group of the aptamer is covalently coupled to the ribose of the extension sequence.

20. The pharmaceutical composition according to claim 18, wherein When the targeted ligand molecule is a compound modified with boric acid or its derivative or a compound modified with phenylboric acid or its derivative, the targeted ligand molecule is covalently coupled to one or more than two phosphate groups or bases on the extension sequence; When covalently coupled to the phosphate group of the extension sequence, the targeted ligand molecule is coupled through an X group; the X group represents O or S.

21. A drug for treating eye diseases, characterized in that, The active ingredient includes the pharmaceutical composition according to any one of claims 1 to 20.

22. Use of the pharmaceutical composition according to any one of claims 1 to 20 in the preparation of a medicament for preventing and / or treating ocular diseases.

23. Use of the pharmaceutical composition according to any one of claims 1 to 20 in preventing and / or treating ocular diseases.

24. The application according to claim 22 or 23, characterized in that, The ocular diseases include one or several of the following: dry eye, keratitis, conjunctivitis, and blepharitis.

25. A treatment method for an eye disease, characterized in that, Instill the pharmaceutical composition according to any one of claims 1 to 20 or the medicament prepared from the pharmaceutical composition into the eyes of a patient.

26. The treatment method according to claim 24, wherein The pharmaceutical composition or the medicament is instilled 2 times a day; the time interval between the two instillations is 10 to 14 h.

Images