Recombinant vibrio natriegens capable of alginic acid metabolism and method for producing isopentenol using same

Abstract

The present invention relates to a method in which Vibrio natriegens, which cannot naturally metabolize alginic acid, is transformed to be capable of alginic acid metabolism and used to produce isopentenol. A recombinant Vibrio natriegens imparted with the ability to metabolize alginic acid and provided with an additional isopentenol production pathway was developed and can be used to metabolize alginic acid and produce isopentenol with high productivity.

Description

Recombinant Vibrio natrigens capable of metabolizing alginate and method for producing isopentenol using the same

[0001] The present invention relates to a recombinant Vibrio natriegens capable of alginate metabolism and a method for producing isopentenol using the same. The present invention relates to a method for transforming Vibrio natriegens, which is naturally incapable of alginate metabolism, to be capable of alginate metabolism and using the same to produce isopentenol.

[0002] Biomass is energy derived from living organisms, encompassing plants, animals, and all materials derived from them. Biomass offers the advantages of being renewable and environmentally friendly, and thus offers the potential to overcome existing problems such as the depletion and environmental pollution of fossil fuels. Therefore, bio-industries utilizing biomass have recently been attracting attention. Interest in seaweed as a new biomass source is growing, and among them, brown macroalgae, a third-generation biomass, are abundant in the ocean and, due to their rapid carbon cycle, are advantageous for the development of eco-friendly, low-cost processes.

[0003] However, existing industrial strains cannot metabolize alginate, a component of brown algae, making process development impossible. Conversely, some bacteria capable of metabolizing alginate are pathogenic or have limited genetic manipulation amenability, limiting the development of biochemical processes utilizing alginate. Therefore, to develop processes utilizing brown algae, a non-pathogenic, easily manipulated alginate-metabolizing strain is essential. However, no such strain has yet been developed.

[0004] Meanwhile, Vibrio natriegens boasts the fastest growth rate among Gram-negative bacteria and is non-pathogenic, attracting attention as a platform strain to replace E. coli, but it also does not have the ability to metabolize alginate.

[0005] Alginate, a promising eco-friendly, low-cost biomass, is not readily available to naturally metabolize. Even among strains capable of alginate metabolism, high pathogenicity and low genetic manipulation susceptibility hinder the development of biochemical processes utilizing alginate. Therefore, the present invention aims to develop a recombinant strain by introducing an alginate metabolic pathway acquired from a closely related species into Vibrio natriegens, a candidate for a next-generation platform strain. Furthermore, the present invention aims to develop and provide a method for producing isopentenol using this strain.

[0006] The present invention provides a recombinant Vibrio natriegens for producing isopentenol, characterized in that it is transformed to express an alginate cluster for alginate metabolism by introducing the alginate cluster from the outside, and to express a nudB gene, which is a hydrolase that converts IPP and DMAPP into isopentenol, and to express an atoB gene, an mvaS gene, an mvaA gene, a mk gene, a pmk gene, and a pmd gene for a mevalonate pathway, and to possess a dxs gene, a dxr gene, an ispD gene, an ispE gene, an ispF gene, an ispG gene, and an ispH gene for a non-mevalonate pathway.

[0007] Meanwhile, in the recombinant Vibrio natriegens of the present invention, the alginate cluster is preferably derived from Vibriosp.dhg.

[0008] Meanwhile, in the recombinant Vibrio natriegens of the present invention, the dxs gene, dxr gene, ispD gene, ispE gene, ispF gene, ispG gene, and ispH gene for the non-mevalonate pathway may be transformed to be overexpressed.

[0009] In addition, the present invention provides a method for producing isopentenol, characterized by culturing the recombinant Vibrio natriegens.

[0010] The present invention has developed a recombinant Vibrio natriegens that has been granted alginate metabolism and an isopentenol production pathway, thereby enabling alginate metabolism and the production of isopentenol with high productivity.

[0011] Figure 1 is a schematic diagram (a) showing the process by which the strain VnAlg of the present invention produced below acts on alginic acid metabolism, and a diagram (b) showing a method for cloning the same.

[0012] Figure 2 is a graph showing the specific production process of the recombinant strain of the present invention and the results of measuring the growth rate. After the VnHom-CAT strain and alginate cluster template DNA were added together and natural transformation was performed, the strain was not immediately spread on an alginate minimal medium plate, but was passaged on an alginate minimal liquid medium and cultured until the fastest strain became dominant. When the medium became turbid, a portion of the culture solution was spread on an alginate minimal medium plate, and the next day, the colony with the largest size was obtained and named VnAlg. For VnAlg, the growth rate and alginate consumption in a minimal medium containing 10 g / L of alginate were measured.

[0013] Figure 3 is a diagram (A) showing the metabolism of the recombinant strain of the present invention, and a graph (B) showing the results of measuring the genome structure of the cell factory and the amount of isopentenol produced. The produced VnAlg has an endogenous mevalonate pathway, and the final products of the mevalonate pathway, IPP and DMAPP, are converted into isopentenol by the foreign gene nudB. Meanwhile, in order to increase the amount of isopentenol produced, the mevalonate pathway composed of a foreign gene can be additionally expressed. nudB and the mevalonate pathway can each be expressed based on a plasmid, and in the case of the mevalonate pathway, more stable expression is possible through genome recombination.

[0014] Figure 4 is a schematic diagram illustrating a process for producing isopentenol from alginic acid, a marine biomass, using the recombinant strain of the present invention.

[0015] Existing industrial strains are unable to metabolize alginic acid, a component of brown algae, making it difficult to develop processes for it. Even some bacteria capable of metabolizing alginic acid have high pathogenicity and limited genetic manipulation amenability, limiting the development of biochemical processes utilizing alginic acid. Therefore, the present invention aims to develop and provide a recombinant strain capable of metabolizing alginic acid, a component of brown algae suitable as a next-generation biomass feedstock, while also achieving high isopentenol productivity.

[0016] Accordingly, the present invention provides a recombinant Vibrio natriegens for producing isopentenol, characterized in that it is transformed to express an alginate cluster for alginate metabolism by introducing the alginate cluster from the outside, and to express a nudB gene, which is a hydrolase that converts IPP and DMAPP into isopentenol, and to express an atoB gene, an mvaS gene, an mvaA gene, a mk gene, a pmk gene, and a pmd gene for a mevalonate pathway, and to possess a dxs gene, a dxr gene, an ispD gene, an ispE gene, an ispF gene, an ispG gene, and an ispH gene for a non-mevalonate pathway.

[0017] Vibrio natriegens, a fast-growing, non-pathogenic strain, has been attracting attention as a platform strain to replace Escherichia coli. However, it is naturally incapable of metabolizing alginate. Therefore, the present invention developed a recombinant Vibrio natriegens capable of metabolizing alginate by transforming the alginate metabolic pathway obtained from a closely related species of Vibrio natriegens into the genome of Vibrio natriegens.

[0018] At this time, in the recombinant Vibrio natriegens of the present invention, the alginate cluster means one including alginate decomposition enzymes (alyA, alyB, alyC, alyD, oalb oalC), alginate transport channels (kdgM, toaA), and alginate metabolic enzymes (kdgF, dehR, kdgK, eda), as shown in (a) of Fig. 1. Through this, an alginate metabolic pathway can be secured. Preferably, the alginate cluster is derived from Vibrio sp. dhg, and more preferably, it is a nucleic acid sequence represented by SEQ ID NO: 35.

[0019] Meanwhile, in the present invention, in the transformation, since the length of the alginate cluster of SEQ ID NO: 35 is about 34 kb, it is too long to penetrate the cell membrane using existing methods such as e-shock or heat-shock, so it is preferable to utilize the natural transformation mechanism in which a gene from outside the cell is drawn into the cell and homologous recombination occurs. At this time, the efficiency of natural transformation can be increased by overexpressing a master regulator gene called tfox, and the tfox gene is preferably derived from Vibrio cholerae, and preferably, it is preferable that it is a nucleic acid sequence represented by SEQ ID NO: 28.

[0020] Meanwhile, isoprenyl-pyrophosphate (IPP) and dimethylally-pyrophosphate (DMAPP), which are precursors of isopentenol, are synthesized in cells through the non-mevalonate pathway (DXP Pathway) that Gram-negative bacteria possess themselves, or through the mevalonate pathway (MVA Pathway) formed by the introduction of foreign genes (Fig. 3). Since PYR (pyruvate) and G3P (glyceraldehyde-3-phosphate), which are the final products of alginate metabolism, are the starting points of the non-mevalonate pathway, there is a metabolic engineering advantage in producing isopentenol through alginate. Therefore, in the present invention, a recombinant strain transformed to additionally express the mevalonate pathway and a hydrolase that converts IPP and DMAPP into isopentenol for isopentenol production was constructed. The nudB gene for this purpose is preferably derived from Escherichia coli, and preferably has a nucleic acid sequence represented by SEQ ID NO: 27.

[0021] In addition, the atoB gene for the mevalonic acid pathway is preferably derived from E. coli, and preferably has a nucleic acid sequence represented by SEQ ID NO: 29. In addition, the mvaS gene, mvaA gene, mk gene, pmk gene, and pmd gene for the mevalonic acid pathway are preferably nucleic acid sequences represented by SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34, respectively. In addition, the atoB gene, mvaS gene, mvaA gene, mk gene, pmk gene, and pmd gene for the mevalonic acid pathway are more preferably located on an operon.

[0022] Meanwhile, in the recombinant Vibrio natriegens of the present invention, the dxs gene, dxr gene, ispD gene, ispE gene, ispF gene, ispG gene, and ispH gene for the non-mevalonate pathway may be transformed to be overexpressed.

[0023] Accordingly, in producing the recombinant Vibrio natriegens of the present invention, codon optimization, etc. were performed to increase gene expression efficiency, and the recombinant strain was completed by utilizing operons, etc.

[0024] In addition, the present invention provides a method for producing isopentenol, characterized by culturing the recombinant Vibrio natriegens.

[0025] Meanwhile, the term 'expression' used in the present invention means introducing an external gene into the strain to artificially express an enzyme that the Vibrio natriegens of the present invention cannot express on its own. In addition, the term 'overexpression' means artificially increasing the expression level of an enzyme that the Vibrio natriegens of the present invention possesses on its own through replacement of a promoter, etc.

[0026] Meanwhile, according to the following experiment, the present invention recombined alginate metabolic ability using natural transformation technology through codon optimization, etc., and introduced an additional pathway for isopentenol production to produce a Vibrio natriegens strain capable of producing isopentenol (Fig. 4), and it was confirmed that the isopentenol production ability was superior to that of a strain only endowed with alginate metabolic ability by introducing an additional pathway for isopentenol production. In addition, it was confirmed that the isopentenol production ability was superior when a recombinant strain was produced through various transformation methods to express an additional pathway for isopentenol production.

[0027] By using the recombinant strain produced in this way, it is possible to metabolize alginate, a marine biomass, compared to the wild-type strain, and thereby create a cell factory that produces isopentenol, thereby enabling economical production of industrial raw materials.

[0028]

[0029] Hereinafter, the present invention will be described in more detail through the following examples. However, the scope of the present invention is not limited to the following examples, but includes modifications of technical concepts equivalent thereto.

[0030]

[0031] The strains, plasmids, primers, and DNA sequences used in the examples and experimental examples of the present invention are shown in Tables 1 to 3 below.

[0032] Strain and plasmid usedStrain nameRelated characteristicsSourceE. coliMach-T1 RE. coliF-80(lacZ)△M15 △lacX74 hsdR(rK-mK+) △recA1398 endA1 tonAInvitrogenw3110E. coli K-12 F- λ- rph-1 INV (rrnD, rrnE) Invitrogen V. natriegens Vn (DE3) ΔDNS:: lacI-T7RNA Pcodex dna The Vmax strain purchased from the company was named Vn (DE3) VnHom-CAT ΔDNS:: Hom1-frt-CAT-frt-Hom2 The present invention VnAlg ΔDNS:: (alginate cluster) The present invention VnAlg MVAP ΔDNS:: (alginate cluster) Δxds:: (lacI-Placuv5-atoB-mvaS-mvaA-Placuv5-MK-PMK-PMD) The present invention VapNV nAlg transformed with pNudB The present invention VapM pNV nAlg co-transformed with pNudB, pMVAP The present invention VAM pNV nAlg MVAP transformed with pNudB The present invention V.sp. dhgalginate metabolizing bacterium Pohang University of Science and Technology, Hyun Gyu Lim et al. Vibriosp. dhgas a platform for the biorefinery of brown macroalgae, 2019, Nature communications Plasmid name Related characteristics Source pRSF_duet RSF ori, KanR Addgene pRSFdE_duet RSF ori, KanR ΔEcoNI Present invention pACYC_kanR p15A ori, KanR Previous research pTfoX pRSFdE_duet, Ptac-tfoX Previous research pNudB pRSF_duet, ΔKanR::cat, Ptac-nudB Present invention pMVAP p15A ori, KanR, lacI-Placuv5-atoB-mvaS-mvaA, Placuv5-MK-PMK-PMD Present invention pST-116 colE1 ori, AcrIIA4, xds sgRNA, Cas9, tfoXD. Stukenberg et al.NT-CRISPR, combining natural transformation and CRISPR-Cas9 counterselection for markerless and scarless genome editing in Vibrio natriegens, 2022, Communications BiologypST-116-xdscolE1 ori, AcrIIA4, xds sgRNA, Cas9, tfoX본 발명.

[0033] Primers used Primer name Sequence (5'→3') Sequence information For alginate cluster integration DNS_1kb_F_revisedagtgattgggtcactcattggttttgtact Sequence number 1 VN_dns-up_Ragagaacaggtatttcatag Sequence number 2 dhg_alg_newHom1_Ftttaactatgaaatacctgttctctaagcctacactcactaagccatctt Sequence number 3 dhg_alg_newHom1_Rgctgatagcattgtctctgtgaagaac Sequence number 4 frt_priming_overlap_ALG_newHom1_FtcttcacagagacaatgctatcagcTTGATCCAgatctcgcgatgc Sequence number 5frt_priming_overlap_ALG_Hom2_RgtagaagcttcttataaattgtgatttggtgaggattaCCTAAggattccSEQ ID NO: 6DHG_ALG_hom2_FatcacaatttataagaagcttctacaacatctgtSEQ ID NO: 7dhg_ALG_hom2_RcgattgtcgcgattggtgaggattacaaaggatacctgatcgagctccctattaatSEQ ID NO: 8VN_dns-down_FtaatcctcaccaatcgcgacSEQ ID NO: 9DNS_1kb_R_revisedacaccttggtcgaggtgaagatcattcSEQ ID NO: 10dhg_alg_newHom1_short_FaagcctacactcactaagccatctttgaagSEQ ID NO: 11dhg_alg_hom2_short_RcaaaggatacctgatcgagctccctSEQ ID NO: 12For MVAP integrationxds_hom1_FaaaaagacgtcaagaaccgagttaagSEQ ID NO: 13xds_hom1_lacI-MVAP_overlap_RGCTGACTTCAGGTGCTACATTTGAAgaaattcatagagatagctaattaaggSEQ ID NO: 14lacI-mvap_FTTCAAATGTAGCACCTGAAGTCAGCSEQ ID NO:15lacI-MVAP_xds_hom2_overlap_RtatgtttatcatcattgccaaatgcGACCGTGTGCTTCTCAAATGCCTGASEQ ID NO: 16xds_hom2_FgcatttggcaatgatgataaacataagSEQ ID NO: 17xds_hom2_RccgttactcaccagccacaatcaaatcSEQ ID NO: 18kanR_xds_hom2_overlap_FtttgattgtggctggtgagtaacggcgtaatgtatccgctcatgaattaattcSEQ ID NO: 19pAC_xds_hom1_overlap_RttaactcggttcttgacgtctttttGCGCAACGCAATTAATGTAAGSEQ ID NO: 20For plasmid cloningpTac_EconI_FACTCCTGCGCAAGGttgacaattaatcatcggctcgtataatgSEQ ID NO: 21T7term_BamHI_RcaaGGATCCGAGGTTTCAGCAAAAAACCCCSEQ ID NO: 221st_PCR_nudB_FtgtggaattgtgagcggataacaattAGGTAGGTAACAGTGAAGGATAAAGTGTATaagcgtccSEQ ID NO: 232nd_PCR_nudB_FgagttagCATATGacggattttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacSEQ ID NO: 241st_PCR_nudB_RTGAGCAAAATAAAAAGGGATGCCATCATGCATCCCTTTTTACGAAGGCAGTCAACGAAGSEQ ID NO: 252nd_PCR_nudB_RttgatgtGTCGACctgatacTGAGCAAAATAAAAAGGGATGCSEQ ID NO: 26

[0034] DNA sequence usedGene nameSequence informationRemarksnudBSEQ ID NO: 27fromE. coliw3110tfoX(codon optimized)SEQ ID NO: 28gBlock synthesisatoBSEQ ID NO: 29fromE. coliw3110mvaS(codon optimized)SEQ ID NO: 30gBlock synthesismvaA(codon optimized)SEQ ID NO: 31gBlock synthesismk(codon optimized)SEQ ID NO: 32gBlock synthesispmk(codon optimized)SEQ ID NO: 33gBlock synthesispmd(codon optimized)SEQ ID NO: 34gBlock synthesisalginate clusterSEQ ID NO: 35fromV. sp.dhg

[0035]

[0036] [Example 1: Production of a recombinant Vibrio natriegens strain capable of alginate metabolism for isopentenol production]

[0037] In this example, a recombinant Vibrio natriegens strain capable of alginate metabolism for isopentenol production was constructed.

[0038] Strains known to metabolize alginate, such as Vibriosp. SP1 and Vibriosp. dhg, possess an alginate metabolism gene cluster (hereinafter referred to as the alginate cluster) of approximately 30 kb in their genome. The alginate cluster also includes alginate degrading enzymes (alyA, alyB, alyC, alyD, oalb oalC), alginate transport channels (kdgM, toaA), and alginate metabolism enzymes (kdgF, dehR, kdgK, eda) (Fig. 1 (a)).

[0039] In the present invention, the cluster in the genome of Vibriosp.dhg was obtained through PCR amplification (SEQ ID NO: 35) and introduced into the genome of Vibrio natrigens (hereinafter referred to as Vn(DE3)) in which the dns gene was replaced with the lacI gene and the T7 RNAP gene. However, the length of approximately 34 kb is too long to penetrate the cell membrane using existing methods such as e-shock or heat-shock, so the recently developed natural transformation (NT) was used. To construct the natural transformation vector pTfoX, the tfoX gene derived from Vibrio cholerae was synthesized after codon optimization (gBlocks, Integrated DNA Technologies). The empty vector pRSFdE_duet was cleaved with EcoNI and BamHI restriction enzymes, and then ligated with the tfoX gene cleaved with the same enzymes to complete the cloning of the pTfoX vector.

[0040] In order to introduce a gene into the genome, homology sequences at both ends of the alginate cluster are required in Vn(DE3). To this end, after transforming Vn(DE3) with the pTfoX vector using e-shock, 3 kb each from both ends of the alginate cluster were first naturally transformed into the lacI ~ T7 RNAP sites of the genome to produce VnHom-CAT (Fig. 1 (b)). After that, the alginate cluster obtained by PCR was naturally transformed into VnHom-CAT transformed with pTfoX to complete the VnAlg strain capable of alginate metabolism (Fig. 1 (b)).

[0041] Figure 1 is a schematic diagram (a) showing the process by which the strain VnAlg of the present invention produced below acts on alginic acid metabolism, and a diagram (b) showing a method for cloning the same.

[0042] After natural transformation, the recombinant strains were not spread on minimal solid medium, but were passaged on minimal liquid medium with alginate as the sole carbon source, so that the fast-growing individuals among the recombinant strains were dominant (Fig. 2). After about 24 hours, the culture was spread on alginate minimal solid medium to secure colonies, and the growth rate of the largest colony on alginate minimal medium was measured, and the result was 1.06±0.02 h -1 A fast speed was derived and named VnAlg (Fig. 2).

[0043]

[0044] [Experimental Example 1: Production of isopentenol using the recombinant strain of Example 1]

[0045] This experimental example was intended to confirm the productivity of isopentenol using the recombinant Vibrio natriegens strain of Example 1.

[0046] Isopentenol was selected as the target product to demonstrate the utility of cell factories. Isopentenol is a general term for isoprenol and isoprenol. It is an important compound used industrially as a precursor of pharmaceuticals and aromatic compounds, and also as a raw material for fragrances. The precursors of isopentenol, isoprenyl-pyrophosphate (IPP) and dimethylally-pyrophosphate (DMAPP), are synthesized within cells through the non-mevalonate pathway (DXP Pathway) that Gram-negative bacteria possess, or through the mevalonate pathway (MVA Pathway) created by the introduction of foreign genes. Since PYR (pyruvate) and G3P (glyceraldehyde-3-phosphate), the end products of alginate metabolism, are the starting points of the non-mevalonate pathway, the production of isopentenol using alginate was judged to have metabolic engineering advantages (Fig. 3A).

[0047] Since VnAlg has its own non-mevalonate pathway, we decided to additionally express nudB, a hydrolase that converts IPP and DMAPP to isopentenol. The nudB gene, amplified by PCR from the E. coli genome, was digested with NdeI and SalI restriction enzymes and cloned by ligation into the pRSFdE_duet vector. This was e-shock transformed into the VnAlg strain to complete the 'VApN' strain. The VApN strain was cultured overnight in LBv2 medium at 37°C, and then subcultured onto minimal medium containing 10 g / L alginate at 30°C. When exponential growth occurred, expression was induced with 500 uM IPTG for 24 hours to produce isopentenol. The isopentenol production was measured to be 1.07±0.11 mg / L (Fig. 3B).

[0048] To increase isopentenol production, we decided to additionally express the mevalonate pathway, which can increase the metabolic flux to IPP and DMAPP. AtoB from Escherichia coli and five codon-optimized mevalonate pathway genes (mvaS, mvaA, mk, pmk, pmd) were synthesized as an operon, and this was gibson assembled with pACYC_kanR and 1 kb of xds homologous sequence to produce pMVAP. The 'VApMpN' strain was produced by e-shock transformation of pMVAP into the VApN strain, and the isopentenol production was measured under the same experimental conditions, resulting in 2.76±0.11 mg / L.

[0049] To stably express the mevalonate pathway, template DNA was secured by PCR amplifying six genes of pMVAP and xds homologous sequences, and VnAlg was transformed with pST-116-xds to enable genome editing by Cas9. After natural transformation of MVAP template DNA for 5 hours, 200 ng / mL of anhydrotetracycline (aTC) was added to kill strains that did not undergo genome editing, and the surviving VnAlgMVAP was secured. This was transformed with the pNudB vector to complete the 'VAMpN' strain (Fig. 3B). When the production was measured under the same experimental conditions, it was 2.47±0.06 mg / L, which was not significantly different from the strain expressing the plasmid-based mevalonate pathway (VapMpN strain), and the production was confirmed to increase by approximately 2.3 times compared to when the mevalonate pathway was absent (VApN strain). In this way, it was expected that by recombination of the mevalonate pathway into the genome through Cas9, more stable expression and reduced antibiotic use would be achieved. In fact, it was confirmed that stable expression is possible by recombination into the genome, as there was no significant difference in production compared to the plasmid-based mevalonate pathway expression strain (VApMpN strain).

[0050]

[0051] In summary, the present invention has produced a Vibrio natriegens strain capable of producing isopentenol by recombining it to impart alginate metabolic ability using natural transformation technology through codon optimization, etc., and introducing an additional pathway for isopentenol production (Fig. 4).

Claims

1. An alginate cluster for alginate metabolism is introduced from outside and transformed so that the alginate cluster is expressed. Transformed so that the nudB gene, a hydrolase that converts IPP and DMAPP to isopentenol, is expressed. Transformed so that the atoB gene, mvaS gene, mvaA gene, mk gene, pmk gene, and pmd gene for the mevalonic acid pathway are expressed, A recombinant Vibrio natriegens strain for producing isopentenol, characterized by possessing the dxs gene, dxr gene, ispD gene, ispE gene, ispF gene, ispG gene, and ispH gene for the non-mevalonate pathway.

2. In paragraph 1, The above alginate cluster is, A recombinant Vibrio natriegens for producing isopentenol, characterized by being derived from Vibriosp.dhg.

3. In paragraph 1, The above recombinant Vibrio natriegens is, A recombinant Vibrio natriegens for producing isopentenol, characterized by being transformed to overexpress the dxs gene, dxr gene, ispD gene, ispE gene, ispF gene, ispG gene, and ispH gene for the non-mevalonate pathway.

4. A method for producing isopentenol, characterized by culturing any one of recombinant Vibrio natriegens selected from claims 1 to 3.

Images