Nucleotide derivative and use thereof

By designing molecularly-free scar nucleotide derivatives, the problem of fluorescent marker residues in second-generation sequencing affects the sequencing read length is solved, achieving higher sequencing accuracy and throughput, and reducing costs.

WO2025152366A1PCT designated stage expired Publication Date: 2025-07-24SHENZHEN ARCHEAN-TECH CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/102816
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-16
Filing Date
2024-07-01
Publication Date
2025-07-24

AI Technical Summary

Technical Problem

In the existing second-generation sequencing technology, nucleotide derivatives retain molecular scars after fluorescent labeling cleavage, affecting the stability of DNA double helix structure and limiting the length of sequencing reads, resulting in high error rate, low throughput and high cost.

Method used

Design a nucleotide derivative with no residual molecular scar after cleavage of fluorescent groups and 3'-end blocking groups. Nucleotide derivatives modified by specific structures such as AF532, IF700, Cy5, etc. are used for nucleic acid sequencing, reducing sequencing error rate, extending read length, and improving throughput and quality.

Benefits of technology

Effectively reduce the sequencing error rate, extend the sequencing read length, improve the sequencing throughput and quality, reduce sequencing costs, and avoid repeated sequencing of the same sample.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024102816_24072025_PF_FP_ABST
    Figure CN2024102816_24072025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a nucleotide derivative and the use thereof. The nucleotide derivative has a structure as represented by formula I. After the cleavage of a sequencing fluorescent group and a 3-terminal blocking group of the nucleotide derivative, there is no residual molecular scar on the nucleotide. A sequencing error rate can be effectively reduced, and a sequencing read length is prolonged, so that the sequencing throughput and the sequencing quality are improved, the sequencing cost is reduced, and repeated sequencing of the same sample is avoided.
Need to check novelty before this filing date? Find Prior Art

Description

Nucleotide derivative and its application Technical Field

[0001] The present application belongs to the field of gene sequencing technology, and specifically relates to a nucleotide derivative and its application. Background Art

[0002] Since the launch of the Human Genome Project in 1990, gene sequencing technology has undergone continuous advancements. First-generation sequencing (NGS) is a DNA sequencing method pioneered by Sanger and Coulson in the 1970s using the dideoxy chain termination method, also known as Sanger sequencing. DNA sequencing is achieved by incorporating fluorescently labeled ddNTPs to block the 3-terminal hydroxyl group. With read lengths up to 1000 base pairs and an accuracy of 99.999%, it is considered the gold standard in sequencing. However, its high cost and low throughput have severely limited the large-scale commercial application of Sanger sequencing. Furthermore, the rise of second-generation sequencing (NGS) has further squeezed the application of Sanger sequencing. Second-generation sequencing (NGS), also known as Next Generation Sequencing (NGS), achieves large-scale, high-throughput sequencing and is currently the most mainstream sequencing technology. In recent years, third- and fourth-generation sequencing technologies have been developed, enabling single-molecule real-time sequencing and identifying structural base variations. These technologies have broad application scenarios, but their development is still immature and their high error rates and costs have limited widespread adoption.

[0003] The characteristics of next-generation sequencing are speed, accuracy, and high throughput. By modifying the nucleotide structure, DNA polymerase can recognize deoxynucleoside triphosphate (dNTPs) derivatives modified with recognition signal groups and integrate them into the nucleic acid chain. Each modified dNTP base carries a fluorescent tag that allows for chain cleavage and a cleavable protecting group (such as an N3, vinyl group, or a disulfide bond) at the 3'-OH end. This base derivative is also called a fluorescently labeled reversible terminator nucleotide. Different nucleotides are labeled with different fluorescent markers, and the fluorescent signal can be used to determine the base sequence of the DNA. Accurate sequencing by synthesis (SBS) is achieved by amplifying the fluorescent signal of the sequencing base using PCR amplification of the template chain. However, SBS sequencing also has an unresolved pain point that affects sequencing read length. After cleaving the fluorophore, the reversible terminator nucleotide analogs currently developed for SBS sequencing still leave a small molecular group, also known as a molecular scar, on the base (such as the ethylene glycol-modified propargyl amino group, as shown in Figure 1). This residual molecular scar accumulates on the newly formed DNA duplex as sequencing proceeds. Once accumulated to a certain extent, these residues may affect the stability and secondary structure of the DNA double helix, hindering DNA polymerase recognition and terminating the chain growth reaction, thereby limiting sequencing read length.

[0004] Therefore, developing a molecular scar-free nucleotide for sequencing can effectively solve the pain points of second-generation sequencing, expand its application scenarios, and further reduce sequencing costs.

[0005] Summary of the Invention

[0006] The present application provides a nucleotide derivative and its application. After cleavage of the sequencing fluorescent group and the 3-terminal blocking group, the nucleotide derivative provided in the present application leaves no residual molecular scar on the nucleotide, effectively reducing the sequencing error rate, extending the sequencing read length, thereby improving sequencing throughput and sequencing quality, reducing sequencing costs, and avoiding repeated sequencing of the same sample.

[0007] In a first aspect, the present application provides a nucleotide derivative, the structure of which is shown in Formula I:

[0008] Wherein, R1 is selected from any one of the following structures:

[0009] Base is a base, and the base is selected from any one of adenine, guanine, cytosine, thymine or uracil;

[0010] Linker is selected from substituted or unsubstituted C6-C15 hydrocarbon groups; and

[0011] Dye is a fluorescent marker, and the fluorescent marker is selected from any one of AF532, IF700, Cy5, ROX, Cy3, Cy7, AF405, AF430, AF660, BODIPY 650X, AT590, AT550, AT565, AF680, AF700, AF750, AF594, AF546, AF568, AF350, AF488, AF514, AT532, AT390, AT425, AT465, AT488, AT495, AT514, AT520, AT565, AT590 or AT610.

[0012] Preferably, the C6-C15 hydrocarbon group can be a C6-C15 alkyl group, a C6-C15 alkenyl group or a C6-C15 alkynyl group, where C6-C15 respectively refers to a structure containing six carbon atoms, seven carbon atoms, eight carbon atoms, etc., and so on, which will not be repeated here.

[0013] After the cleavage of the sequencing fluorescent group and the 3-terminal blocking group, the above-mentioned nucleotide derivatives with specific structures have no residual molecular scars on the nucleotides (as shown in Figure 2), which can effectively reduce the sequencing error rate, extend the sequencing read length, thereby improving the sequencing throughput and sequencing quality, reducing sequencing costs, and avoiding repeated sequencing of the same sample.

[0014] Preferably, the R1 is selected from any one of the following structures:

[0015] Preferably, the substituted substituent is selected from any one of halogen, amino, carbonyl, oxo, amide, nitro, sulfonic acid, sulfonyl, or hydroxyl.

[0016] Preferably, the substituted substituent is selected from any one of amino, oxo, or amide.

[0017] Preferably, the linker is selected from oxo- and amide-substituted C6-C15 hydrocarbon groups.

[0018] Preferably, the linker is selected from oxo- and amide-substituted C10-C15 alkenyl groups.

[0019] Preferably, the base is selected from any one of adenine, guanine, cytosine or thymine.

[0020] Preferably, the fluorescent marker is selected from any one of AF532, IF700, Cy5 or ROX.

[0021] Preferably, the nucleotide derivative is selected from any one of the following structures:

[0022] The above nucleotide derivatives can be synthesized by any conventional method in the art, and this application does not impose any additional restrictions on this.

[0023] In a second aspect, the present application also provides the use of the nucleotide derivatives described in the first aspect in nucleic acid sequencing.

[0024] Compared with the prior art, this application has the following beneficial effects:

[0025] The present application provides a nucleotide derivative with a specific structure. After the cleavage of the sequencing fluorescent group and the 3-terminal blocking group during the sequencing process, no molecular scar remains on the nucleotide, which can effectively reduce the sequencing error rate, extend the sequencing read length, thereby improving the sequencing throughput and sequencing quality, reducing sequencing costs, and avoiding repeated sequencing of the same sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] FIG1 is a schematic diagram of the molecular scars produced by existing SBS sequencing.

[0027] FIG2 is a schematic diagram of the molecular scar-free sequencing process of nucleotide derivatives provided in this application. DETAILED DESCRIPTION

[0028] The technical solution of the present application is further described below through specific implementation methods. Those skilled in the art should understand that the embodiments are only used to help understand the present application and should not be regarded as specific limitations of the present application.

[0029] Preparation Example 1

[0030] This preparation example provides a preparation method for compound T-2, and the synthetic route is as follows:

[0031] Synthesis of Compound T-2: Weigh 5g of Compound T-1, add 90mL of 6M hydrochloric acid and 150mL of acetone, mix thoroughly, cool to 0°C, and dropwise add 150mL of 0.4mol / L sodium nitrite solution. React at 0°C for 2h. Then, add 2.5g of aniline, and adjust the pH of the reaction solution to alkaline by dropwise addition of triethylamine at 5°C. Continue reacting at 0°C for 1h, then at 20°C for another 1h. Purify by column chromatography to yield 2.2g of Compound T-2.

[0032] Characterization data: LC-MS (ESI + )m / z 224.24(M+H) + ; 1 HNMR (400MHz, DMSO-d6) δ8.62(t,1H),8.01-7.85(m,2H),7.65-7.52(m,3H),4.02(s,2H),3.52(t,2H),3.18(q,2H).

[0033] Example 1

[0034] This example provides a nucleotide derivative fluorescence reversibly blocked modified dATP compound 10, the synthesis route is as follows:

[0035] The specific method is as follows:

[0036] Synthesis of compound 2: Weigh 30g of compound 1 and 10.86g of imidazole, add 300mL of anhydrous DMF to dissolve, replace with nitrogen and stir at 0°C. Weigh 14.42g of TBSCl (tert-butyldimethylsilyl chloride), add 140mL of anhydrous DMF to dissolve, slowly add dropwise to the nucleoside after dissolution, move to 20°C and react for 2h. After the reaction is completed, the reaction solution is added to ice water to quench the reaction and filtered to obtain a white solid. The white solid is slurried with n-hexane and dichloromethane, filtered to obtain a white solid, and spin-dried to obtain 35g of compound 2.

[0037] Synthesis of Compound 3: Weigh 10 g of Compound 2, add 100 mL of 7 M NH₃ methanol solution, 0.3 g of Fe₂O₃, 0.3 g of CuI, and 20 mL of anhydrous ethanol, and react under reflux at 90°C for 18 h. After the reaction, the reaction solution was dried and purified by column chromatography to obtain 3 g of Compound 3.

[0038] Synthesis of Compound 4: Weigh 5g of Compound 3, dissolve in 32mL of 6M hydrochloric acid, add 50mL of acetone, mix thoroughly, cool to 0°C, add 50mL of 0.4mol / L sodium nitrite solution dropwise, and react at 0°C for 3h. Then, add 2.66g of (E)-4-aminobut-2-enoic acid, and adjust the pH of the reaction solution to alkaline by adding triethylamine dropwise at 5°C. The reaction was continued at 0°C for 1h, and then at 20°C for another 1h. Purification by column chromatography afforded 1.6g of Compound 4.

[0039] Synthesis of Compound 5: Weigh 1g of Compound 4, add 5mL of anhydrous DMF, and stir to dissolve. Add 0.8mL of triethylamine. Weigh 0.83g of 9-fluorenylmethyl-N-succinimidyl carbonate and dissolve it in 2mL of anhydrous DMF. Add slowly dropwise and allow to react for 1h. The reaction mixture is quenched and purified by column chromatography to yield 1.3g of Compound 5.

[0040] Synthesis of Compound 6: Weigh 243 mg of 2-(2-azidoethoxy)acetic acid and 20.5 mg of 4-dimethylaminopyridine in 5 mL of anhydrous DMF and stir to dissolve. Add 433 mg of N,N'-dicyclohexylcarbodiimide and stir for 1 hour before use. In another eggplant-shaped flask, weigh 1 g of Compound 5 and dissolve it in 10 mL of anhydrous DMF. Add the resulting active ester dropwise to the flask containing Compound 5 and continue the reaction for 1 hour. The reaction mixture was purified by column chromatography to yield 0.6 g of Compound 6.

[0041] Synthesis of Compound 7: Weigh 1g of Compound 6 and dissolve it in 5mL of anhydrous DMF. Cool to 0°C with stirring. Add 0.26mL of triethylamine and 0.54g of TSTU (2-succinimidyl-1,1,3,3-tetramethyluronium tetrafluoroborate). After reacting for 1 hour, add 0.8g of 3,6,9,12-tetraoxatetradecane-1,14-diamine dissolved in acetonitrile and continue stirring for 1 hour. The reaction mixture was quenched with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried, and dissolved in 5mL of THF. Stir at 0°C. Weigh 0.9g of tetrabutylammonium fluoride and dissolve it in 5mL of THF. Slowly inject the mixture into the reaction mixture and stir overnight. The reaction mixture was purified by column chromatography to yield 507mg of Compound 7.

[0042] Synthesis of Compound 8: Weigh 50 mg of Compound 7 and dissolve it in 5 mL of trimethyl phosphate. Add 60 mg of tri-n-butylamine, replace the atmosphere with nitrogen, and stir at -5°C. Add 9.3 μL of phosphorus oxychloride. After reacting for 50 minutes, add a mixture of 150 mg of ammonium pyrophosphate, 60 mg of tri-n-butylamine, and 5 mL of anhydrous acetonitrile and continue reacting for 20 minutes. Quench the reaction solution with 10 mL of triethylamine carbonate buffer. After spin drying at 25°C, dilute to 100 mL, purify with DEAE column chromatography, and obtain 11 mg of Compound 8 using C18 reverse phase chromatography.

[0043] Synthesis of Compound 9: Weigh 5 mg of Compound 8 and dissolve it in 0.1 mL of 0.1 mol / L sodium bicarbonate solution. Stir at 0°C. Weigh 6 mg of AF532-NHS and dissolve it in 100 μL of anhydrous DMF. Slowly inject the solution into the nucleotide solution and allow to react for 1 h. The reaction mixture is diluted to 50 mL, purified with DEAE, and then spin-dried to yield 6 mg of Compound 9.

[0044] Synthesis of Compound 10: Weigh 5 mg of Compound 9, dissolve in 1 mL of 30% diethylamine in DMF, and allow to react at 15°C overnight. Dilute the reaction solution to 50 mL with 50 mmol of triethylamine carbonate aqueous solution and purify by DEAE column chromatography. After spin drying, purify on C18 column to obtain 2 mg of Compound 10. Characterization data are as follows: LC-MS (ESI + )m / z 1571.42(M+H) + .

[0045] Example 2

[0046] This example provides a nucleotide derivative fluorescence reversibly blocked modified dATP compound 15, the synthesis route is as follows:

[0047] The specific steps are as follows:

[0048] Synthesis of Compound 11: Weigh 380 mg of Compound T-2 and 40 mg of 4-dimethylaminopyridine, add 5 mL of anhydrous DMF, and stir to dissolve. Add 433 mg of N,N'-dicyclohexylcarbodiimide, and stir at 10°C for 2 hours before use. In another eggplant-shaped flask, weigh 1 g of Compound 5 and dissolve it in 10 mL of anhydrous DMF. Add the resulting active ester dropwise to the flask containing Compound 5 and continue the reaction for 1 hour. The reaction mixture was purified by column chromatography to yield 0.52 g of Compound 11.

[0049] Synthesis of Compound 12: Weigh 1g of Compound 11 and dissolve it in 5mL of anhydrous DMF. Cool to 0°C with stirring. Add 0.23mL of triethylamine and 0.5g of TSTU. After reacting for 1 hour, add 0.7g of 3,6,9,12-tetraoxatetradecane-1,14-diamine dissolved in acetonitrile and continue stirring for 1 hour. The reaction mixture was quenched with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried by rotary evaporation, and dissolved in 5mL of THF. Stir at 0°C. Weigh 0.84g of tetrabutylammonium fluoride and dissolve it in 5mL of THF. Slowly inject the mixture into the reaction mixture and stir overnight. The reaction mixture was purified by column chromatography to yield 415mg of Compound 12.

[0050] Synthesis of Compound 13: Weigh 50 mg of Compound 12 and dissolve it in 5 mL of trimethyl phosphate. Add 125 mg of tri-n-butylamine, replace the atmosphere with nitrogen, and stir at -15°C. Add 9.1 μL of phosphorus oxychloride. After reacting for 50 minutes, add a mixture of 150 mg of ammonium pyrophosphate, 90 mg of tri-n-butylamine, and 5 mL of anhydrous acetonitrile and continue reacting for 20 minutes. Quench the reaction solution with 10 mL of triethylamine carbonate buffer. After spin drying at 25°C, dilute to 100 mL, purify with DEAE column chromatography, and prepare 9 mg of Compound 13 using C18 reverse phase chromatography.

[0051] Synthesis of Compound 14: Weigh 5 mg of compound 14 and dissolve it in 0.1 mL of 0.1 mol / L sodium bicarbonate solution. Stir at 0°C. Weigh 6 mg of AF532-NHS and dissolve it in 100 μL of anhydrous DMF. Slowly inject the solution into the nucleotide solution and allow to react for 1 h. The reaction mixture is diluted to 50 mL, purified with DEAE, and then spin-dried to yield 6 mg of compound 14.

[0052] Synthesis of Compound 15: 5 mg of Compound 14 was weighed and dissolved in 1 mL of 30% diethylamine DMF solution. The mixture was allowed to react at 15°C overnight. The reaction solution was diluted to 50 mL with 50 mmol of triethylamine carbonate aqueous solution and purified by DEAE column chromatography. After spin drying, the mixture was purified by C18 preparative purification to obtain 3 mg of Compound 15. Characterization data are as follows: LC-MS (ESI + )m / z 1649.43(M+H) + .

[0053] Example 3

[0054] This example provides a nucleotide derivative fluorescence reversibly blocked modified dCTP compound 25, the synthesis route is as follows:

[0055] The specific steps are as follows:

[0056] Synthesis of Compound 17: 50g of Compound 16 and 29g of imidazole were dissolved in 500mL of anhydrous DMF. After nitrogen replacement, the mixture was stirred and cooled to 0°C. 25.6g of TBSCl was dissolved in 100mL of anhydrous DMF and slowly added dropwise to the nucleoside. After addition, the reaction mixture was heated to 20°C and continued for 1h. After completion, the reaction mixture was quenched by adding ice water. Filter the obtained white solid, which was slurried with n-hexane and dichloromethane to yield 60g of Compound 18.

[0057] Synthesis of Compound 18: Weigh 15g of Compound 17, add 80mL of 7M NH3 methanol solution, 1g of Fe2O3, 1g of CuI, and 20mL of anhydrous ethanol, and heat under reflux at 80°C for 24h. After the reaction, the reaction solution was spin-dried and purified by column chromatography to obtain 5.2g of Compound 18.

[0058] Synthesis of Compound 19: Weigh 5g of Compound 18, add 30mL of 6M hydrochloric acid and 50mL of acetone, mix thoroughly, cool to 0°C, and dropwise add 50mL of 0.4mol / L sodium nitrite solution. React at 0°C for 2h. Then, add 2.5g of (E)-4-aminobut-2-enoic acid. Adjust the pH of the reaction solution to alkaline by dropwise addition of triethylamine at 5°C. Continue reacting at 0°C for 1h, then at 20°C for another 1h. Purify by column chromatography to yield 1.5g of Compound 19.

[0059] Synthesis of Compound 20: Weigh 2g of Compound 19 and dissolve it in 20mL of anhydrous DMF with stirring. Add 1.4mL of triethylamine. Dissolve 1.43g of 9-fluorenylmethyl-N-succinimidyl carbonate in 5mL of anhydrous DMF and slowly add dropwise. Allow to react for 1h. The reaction mixture is quenched and purified by column chromatography to yield 2.5g of Compound 20.

[0060] Synthesis of Compound 21: Weigh 504 mg of 2-(2-azidoethoxy)acetic acid and 42 mg of 4-dimethylaminopyridine, add 5 mL of anhydrous DMF, and stir to dissolve. Add 870 mg of N,N'-dicyclohexylcarbodiimide, and stir to react for 1 hour before use. In another eggplant-shaped flask, weigh 2 g of Compound 20 and dissolve it in 10 mL of anhydrous DMF. Add the resulting active ester dropwise to the flask containing Compound 20 and continue the reaction for 1 hour. The reaction mixture was purified by column chromatography to yield 1.4 g of Compound 21.

[0061] Synthesis of Compound 22: Weigh 1g of Compound 21 and dissolve it in 5mL of anhydrous DMF. Cool to 0°C with stirring. Add 0.4mL of triethylamine and 0.6g of TSTU. After reacting for 1 hour, add 0.7g of 3,6,9,12-tetraoxatetradecane-1,14-diamine dissolved in acetonitrile and continue stirring for 1 hour. The reaction mixture was quenched with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried by rotary evaporation, and dissolved in 5mL of THF. Stir at 0°C. Weigh 0.8g of tetrabutylammonium fluoride and dissolve it in 5mL of THF. Slowly inject the solution into the reaction mixture and stir overnight. The reaction mixture was purified by column chromatography to obtain 600mg of Compound 22.

[0062] Synthesis of Compound 23: Weigh 50 mg of Compound 22 and dissolve it in 5 mL of trimethyl phosphate. Add 80 mg of tri-n-butylamine, replace the atmosphere with nitrogen, and stir at -5°C. Add 9.6 μL of phosphorus oxychloride. After reacting for 50 minutes, add a mixture of 143 mg of ammonium pyrophosphate, 90 mg of tri-n-butylamine, and 5 mL of anhydrous acetonitrile and continue reacting for 20 minutes. Quench the reaction solution with 10 mL of triethylamine carbonate buffer. After spin drying at 25°C, dilute to 100 mL, purify with DEAE column chromatography, and prepare 25 mg of Compound 23 using C18 reverse phase chromatography.

[0063] Synthesis of Compound 24: Weigh 5 mg of Compound 23 and dissolve it in 0.1 mL of 0.1 mol / L sodium bicarbonate solution. Stir at 0°C. Weigh 8 mg of IF700-NHS and dissolve it in 100 μL of anhydrous DMF. Slowly inject the solution into the nucleotide solution and allow to react for 1 h. The reaction mixture was diluted to 50 mL, purified with DEAE, and then spin-dried to yield 7 mg of Compound 24.

[0064] Synthesis of compound 25

[0065] 5 mg of compound 24 was weighed and dissolved in 1 mL of 30% diethylamine DMF solution. The mixture was allowed to react at 15°C overnight. The reaction solution was diluted to 50 mL with 50 mmol of triethylamine carbonate aqueous solution and purified by DEAE column chromatography. After spin drying, the mixture was purified by C18 preparative purification to obtain 3 mg of compound 25. Characterization data are as follows: LC-MS (ESI + )m / z 1700.43(M+H) + .

[0066] Example 4

[0067] This example provides a nucleotide derivative fluorescence reversibly blocked modified dCTP compound 30, the synthesis route is as follows:

[0068] The specific steps are as follows:

[0069] Synthesis of Compound 26: Weigh 480 mg of Compound T-2 and 40 mg of 4-dimethylaminopyridine, add 5 mL of anhydrous DMF, and stir to dissolve. Add 665 mg of N,N'-dicyclohexylcarbodiimide, and stir at 10°C for 2 h before use. In another eggplant-shaped flask, weigh 1 g of Compound 20 and dissolve it in 10 mL of anhydrous DMF. Add the resulting active ester dropwise to the flask containing Compound 20, and continue the reaction for 1 h. The reaction mixture was purified by column chromatography to yield 0.52 g of Compound 26.

[0070] Synthesis of Compound 27: Weigh 1g of Compound 26, add 0.46mL of triethylamine, and dissolve in 10mL of anhydrous DMF. Cool to 0°C with stirring, then add 504mg of TSTU and react for 1h. Add 0.7g of 3,6,9,12-tetraoxatetradecane-1,14-diamine dissolved in acetonitrile and continue stirring for 1h. The reaction mixture is quenched with water and extracted with ethyl acetate. The organic phase is washed with saturated brine, dried by rotary evaporation, and dissolved in 5mL of THF. Stir at 0°C. Weigh 0.8g of tetrabutylammonium fluoride, dissolve in 5mL of THF, and slowly inject into the reaction mixture. Stir overnight. The reaction mixture is purified by column chromatography to yield 704mg of Compound 27.

[0071] Synthesis of Compound 28: Weigh 50 mg of Compound 22 and dissolve it in 5 mL of trimethyl phosphate. Add 80 mg of tri-n-butylamine, replace the atmosphere with nitrogen, and stir at -5°C. Add 9.4 μL of phosphorus oxychloride. After reacting for 50 minutes, add a mixture of 143 mg of ammonium pyrophosphate, 90 mg of tri-n-butylamine, and 5 mL of anhydrous acetonitrile and continue reacting for 20 minutes. Quench the reaction solution with 10 mL of triethylamine carbonate buffer. After spin drying at 25°C, dilute to 100 mL, purify with DEAE column chromatography, and prepare 25 mg of Compound 28 using C18 reverse phase chromatography.

[0072] Synthesis of Compound 29: Weigh 5 mg of Compound 28 and dissolve it in 0.1 mL of 0.1 mol / L sodium bicarbonate solution. Stir at 0°C. Weigh 8 mg of IF700-NHS and dissolve it in 100 μL of anhydrous DMF. Slowly inject the solution into the nucleotide solution and allow to react for 1 h. The reaction mixture was diluted to 50 mL, purified with DEAE, and then spin-dried to yield 6 mg of Compound 29.

[0073] Synthesis of Compound 30: 5 mg of Compound 29 was weighed and dissolved in 1 mL of 30% diethylamine DMF solution. The mixture was allowed to react at 15°C overnight. The reaction solution was diluted to 50 mL with 50 mmol of triethylamine carbonate aqueous solution and purified by DEAE column chromatography. After spin drying, the mixture was purified by C18 preparative purification to obtain 1 mg of Compound 30. Characterization data are as follows: LC-MS (ESI + )m / z 1778.47(M+H) + .

[0074] Example 5

[0075] This example provides a nucleotide derivative fluorescence reversibly blocked modified dGTP compound 40, the synthesis route is as follows:

[0076] The specific steps are as follows:

[0077] Synthesis of Compound 32: 50g of Compound 31 and 26g of imidazole were weighed and dissolved in 500mL of anhydrous DMF. After nitrogen replacement, the mixture was stirred at 0°C. 21.1g of TBSCl was weighed and dissolved in 100mL of anhydrous DMF. After dissolution, the mixture was slowly added dropwise to the nucleoside. After addition, the mixture was incubated at 20°C for 2h. After completion of the reaction, the reaction mixture was quenched by adding ice water and filtered to obtain a white solid. The white solid was slurried with n-hexane and dichloromethane, filtered to obtain a white solid, and then spin-dried to obtain 60.5g of Compound 32.

[0078] Synthesis of compound 33: Weigh 10 g of compound 32, add 1 g of CuI, 1 g of Fe2O3, 20 mL of anhydrous ethanol, and 60 mL of 7 M NH3 methanol solution, heat and reflux for 18 h, spin dry the reaction solution and purify it by column chromatography to obtain 3 g of compound 34.

[0079] Synthesis of Compound 34: Weigh 5g of Compound 33, add 31mL of 6M hydrochloric acid and 50mL of acetone, mix thoroughly, cool to 0°C, and dropwise add 50mL of 0.4mol / L sodium nitrite solution. React at 0°C for 3h. Then, add 2.55g of (E)-4-aminobut-2-enoic acid. Adjust the pH of the reaction solution to alkaline by adding triethylamine dropwise at 5°C. Continue reacting at 0°C for 1h, then at 20°C for another 1h. Purify by column chromatography to yield 1.2g of Compound 34.

[0080] Synthesis of Compound 35: Weigh 1 g of Compound 34, dissolve in 5 mL of anhydrous DMF with stirring, and add 0.7 mL of triethylamine. Weigh 0.78 g of 9-fluorenylmethyl-N-succinimidyl carbonate and dissolve in 2 mL of anhydrous DMF. Add slowly dropwise and allow to react for 1 hour. The reaction mixture is quenched and purified by column chromatography to yield 1.2 g of Compound 35.

[0081] Synthesis of Compound 36: Weigh 237 mg of 2-(2-azidoethoxy)acetic acid and 20 mg of 4-dimethylaminopyridine in 5 mL of anhydrous DMF and stir to dissolve. Add 423 mg of N,N'-dicyclohexylcarbodiimide and stir for 1 hour before use. In a separate eggplant-shaped flask, weigh 1 g of Compound 35 and dissolve it in 10 mL of anhydrous DMF. Add the resulting active ester dropwise to the flask containing Compound 35 and continue the reaction for 1 hour. The reaction mixture was purified by column chromatography to yield 0.72 g of Compound 36.

[0082] Synthesis of Compound 37: Weigh 1g of Compound 36 and dissolve it in 5mL of anhydrous DMF. Cool to 0°C with stirring. Add 0.25mL of triethylamine and 0.54g of TSTU. After reacting for 1 hour, add 0.8g of 3,6,9,12-tetraoxatetradecane-1,14-diamine dissolved in acetonitrile and continue stirring for 1 hour. The reaction mixture was quenched with water and extracted with ethyl acetate. The organic phase was washed with saturated brine and then dried by spin drying. 5mL of THF was added to dissolve the organic phase and stirred at 0°C. Weigh 0.9g of tetrabutylammonium fluoride and dissolve it in 5mL of THF. The mixture was slowly injected into the reaction mixture and stirred overnight. The reaction mixture was purified by column chromatography to yield 442mg of Compound 37.

[0083] Synthesis of Compound 38: Weigh 50 mg of Compound 37 and dissolve it in 5 mL of trimethyl phosphate. Add 60 mg of tri-n-butylamine, replace the atmosphere with nitrogen, and stir at -5°C. Add 9.3 μL of phosphorus oxychloride. After reacting for 50 minutes, add a mixture of 150 mg of ammonium pyrophosphate, 60 mg of tri-n-butylamine, and 5 mL of anhydrous acetonitrile and continue reacting for 20 minutes. Quench the reaction solution with 10 mL of triethylamine carbonate buffer. After spin drying at 25°C, dilute to 100 mL, purify with DEAE column chromatography, and prepare 8 mg of Compound 38 using C18 reverse phase chromatography.

[0084] Synthesis of Compound 39: Weigh 5 mg of Compound 38 and dissolve it in 0.1 mL of 0.1 mol / L sodium bicarbonate solution. Stir the mixture at 0°C. Weigh 6.3 mg of Cy5-NHS and dissolve it in 100 μL of anhydrous DMF. Slowly inject the mixture into the nucleotide solution and allow to react for 1 h. The reaction mixture was diluted to 50 mL, purified with DEAE, and then spin-dried to yield 6 mg of Compound 39.

[0085] Synthesis of Compound 40: 10 mg of Compound 39 was weighed and dissolved in 1 mL of 30% diethylamine in DMF. The mixture was allowed to react at 15°C overnight. The reaction solution was diluted to 50 mL with 50 mmol of triethylamine carbonate aqueous solution and purified by DEAE column chromatography. After spin drying, the mixture was purified by C18 preparative purification to obtain 6 mg of Compound 40. Characterization data are as follows: LC-MS (ESI + )m / z 1617.43(M+H) + .

[0086] Example 6

[0087] This example provides a nucleotide derivative fluorescence reversibly blocked modified dGTP compound 45, the synthesis route is as follows:

[0088] The specific steps are as follows:

[0089] Synthesis of Compound 41: Weigh 380 mg of Compound T-2 and 40 mg of 4-dimethylaminopyridine, add 5 mL of anhydrous DMF, and stir to dissolve. Add 433 mg of N,N'-dicyclohexylcarbodiimide, and stir at 10°C for 2 h before use. In another eggplant-shaped flask, weigh 1.1 g of Compound 35 and dissolve it in 10 mL of anhydrous DMF. The resulting active ester was added dropwise to the eggplant-shaped flask containing Compound 5, and the reaction continued for 1 h. The reaction mixture was purified by column chromatography to yield 0.42 g of Compound 41.

[0090] Synthesis of Compound 42: Weigh 1g of Compound 41 and dissolve it in 5mL of anhydrous DMF. Cool to 0°C with stirring. Add 0.23mL of triethylamine and 0.5g of TSTU. After reacting for 1 hour, add 0.7g of 3,6,9,12-tetraoxatetradecane-1,14-diamine dissolved in acetonitrile and continue stirring for 1 hour. The reaction mixture was quenched with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried by rotary evaporation, and dissolved in 5mL of THF. Stir at 0°C. Weigh 0.84g of tetrabutylammonium fluoride and dissolve it in 5mL of THF. Slowly inject the mixture into the reaction mixture and stir overnight. The reaction mixture was purified by column chromatography to yield 415mg of Compound 42.

[0091] Synthesis of Compound 43: Weigh 50 mg of Compound 42 and dissolve it in 5 mL of trimethyl phosphate. Add 120 mg of tri-n-butylamine, replace the atmosphere with nitrogen, and stir at -15°C. Add 9.2 μL of phosphorus oxychloride. After reacting for 50 minutes, add a mixture of 150 mg of ammonium pyrophosphate, 90 mg of tri-n-butylamine, and 5 mL of anhydrous acetonitrile and continue reacting for 20 minutes. Quench the reaction solution with 10 mL of triethylamine carbonate buffer. After spin drying at 25°C, dilute to 100 mL, purify by DEAE column chromatography, and prepare 9 mg of Compound 43 using C18 reverse phase chromatography.

[0092] Synthesis of Compound 44: Weigh 5 mg of compound 44 and dissolve it in 0.1 mL of 0.1 mol / L sodium bicarbonate solution. Stir the mixture at 0°C. Weigh 6.2 mg of Cy5-NHS and dissolve it in 100 μL of anhydrous DMF. Slowly inject the mixture into the nucleotide solution and allow to react for 1 h. The reaction mixture was diluted to 50 mL, purified with DEAE, and then spin-dried to yield 5 mg of compound 44.

[0093] Synthesis of Compound 45: 5 mg of Compound 44 was weighed and dissolved in 1 mL of 30% diethylamine in DMF. The mixture was allowed to react at 15°C overnight. The reaction solution was diluted to 50 mL with 50 mmol of triethylamine carbonate aqueous solution and purified by DEAE column chromatography. After spin drying, the mixture was purified by C18 preparative purification to obtain 2 mg of Compound 45. Characterization data are as follows: LC-MS (ESI + )m / z 1695.43(M+H) + .

[0094] Example 7

[0095] This example provides a nucleotide derivative fluorescence reversibly blocked modified dTTP compound 53, the synthesis route is as follows:

[0096] The specific steps are as follows:

[0097] Synthesis of Compound 47: 50g of Compound 46 and 29g of imidazole were dissolved in 500mL of anhydrous DMF. After nitrogen replacement, the mixture was stirred and cooled to 0°C. 25.6g of TBSCl was dissolved in 100mL of anhydrous DMF and slowly added dropwise to the nucleoside. After addition, the reaction mixture was heated to 20°C and continued for 1h. After completion, the reaction mixture was quenched by adding ice water. A white solid was obtained by filtration and slurried with n-hexane and dichloromethane to yield 63g of Compound 47.

[0098] Synthesis of Compound 48: 15 g of Compound 47 was added to 80 mL of 7 M NH₃ methanol solution, 1 g of Fe₂O₃, 1 g of CuI, and 20 mL of anhydrous ethanol. The mixture was heated under reflux at 80°C for 24 h. After completion of the reaction, the reaction mixture was evaporated to dryness and purified by column chromatography to yield 4.3 g of Compound 48.

[0099] Synthesis of Compound 49: Weigh 5g of Compound 48, add 30mL of 6M hydrochloric acid and 50mL of acetone, mix thoroughly, cool to 0°C, and dropwise add 50mL of 0.4mol / L sodium nitrite solution. React at 0°C for 2h. Then, add 2.5g of (E)-4-aminobut-2-enoic acid. Adjust the pH of the reaction solution to alkaline by adding triethylamine dropwise at 5°C. Continue reacting at 0°C for 1h, then at 20°C for 1h. Purify by column chromatography to yield 2.2g of Compound 49.

[0100] Synthesis of Compound 50: Weigh 504 mg of 2-(2-azidoethoxy)acetic acid and 42 mg of 4-dimethylaminopyridine, add 5 mL of anhydrous DMF, and stir to dissolve. Add 870 mg of N,N'-dicyclohexylcarbodiimide, and stir to react for 1 hour before use. In another eggplant-shaped flask, weigh 2 g of Compound 49 and dissolve it in 10 mL of anhydrous DMF. The resulting active ester was added dropwise to the flask containing Compound 49, and the reaction continued for 3 hours. The reaction mixture was purified by column chromatography to yield 1.2 g of Compound 50.

[0101] Synthesis of Compound 51: Weigh 1g of Compound 50 and dissolve it in 5mL of anhydrous DMF. Cool to 0°C with stirring. Add 0.3mL of triethylamine and 0.43g of TSTU. After reacting for 1 hour, add 0.53g of 3,6,9,12-tetraoxatetradecane-1,14-diamine dissolved in acetonitrile and continue stirring for 1 hour. The reaction mixture was quenched with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried by rotary evaporation, and dissolved in 5mL of THF. Stir at 0°C. Weigh 0.6g of tetrabutylammonium fluoride and dissolve it in 5mL of THF. Slowly inject the mixture into the reaction mixture and stir overnight. The reaction mixture was purified by column chromatography to yield 769mg of Compound 51.

[0102] Synthesis of Compound 52: Weigh 50 mg of Compound 51 and dissolve it in 5 mL of trimethyl phosphate. Add 60 mg of tri-n-butylamine, replace the atmosphere with nitrogen, and stir at -5°C. Add 7.3 μL of phosphorus oxychloride. After reacting for 50 minutes, add a mixture of 100 mg of ammonium pyrophosphate, 68 mg of tri-n-butylamine, and 5 mL of anhydrous acetonitrile and continue reacting for 20 minutes. Quench the reaction solution with 10 mL of triethylamine carbonate buffer. After spin drying at 25°C, dilute to 100 mL, purify with DEAE column chromatography, and prepare 38 mg of Compound 52 using C18 reverse phase chromatography.

[0103] Synthesis of Compound 53: Weigh 5 mg of Compound 52, dissolve in 0.1 mL of 0.1 mol / L sodium bicarbonate solution, and stir at 0°C. Weigh 7 mg of ROX-NHS, dissolve in 100 μL of anhydrous DMF, and slowly inject into the nucleotide solution for 1 h. The reaction solution is diluted to 50 mL, purified with DEAE, and then dried to obtain 3 mg of Compound 53. Characterization data are as follows: LC-MS (ESI + )m / z 1458.44(M+H) + .

[0104] Example 8

[0105] This example provides a nucleotide derivative fluorescence reversibly blocked modified dTTP compound 57, the synthesis route is as follows:

[0106] The specific steps are as follows:

[0107] Synthesis of Compound 54: Weigh 700 mg of Compound T-2 and 60 mg of 4-dimethylaminopyridine, add 5 mL of anhydrous DMF, and stir to dissolve. Add 1 g of N,N'-dicyclohexylcarbodiimide, and stir at 10°C for 2 h before use. In another eggplant-shaped flask, weigh 1 g of Compound 49 and dissolve it in 10 mL of anhydrous DMF. Add the resulting active ester dropwise to the flask containing Compound 49 and continue the reaction for 1 h. The reaction mixture was purified by column chromatography to yield 0.6 g of Compound 54.

[0108] Synthesis of Compound 55: Weigh 1g of Compound 54, add 0.6mL of triethylamine, and dissolve in 10mL of anhydrous DMF. Cool to 0°C with stirring, then add 671mg of TSTU and react for 1h. Add 1g of 3,6,9,12-tetraoxatetradecane-1,14-diamine dissolved in acetonitrile and continue stirring for 1h. The reaction mixture is quenched with water and extracted with ethyl acetate. The organic phase is washed with saturated brine, dried by rotary evaporation, and dissolved in 5mL of THF. Stir at 0°C. Weigh 0.10g of tetrabutylammonium fluoride, dissolve in 5mL of THF, and slowly inject into the reaction mixture. Stir overnight. The reaction mixture is purified by column chromatography to yield 480mg of Compound 55.

[0109] Synthesis of Compound 56: 50 mg of Compound 55 was weighed and dissolved in 5 mL of trimethyl phosphate. 103 mg of tri-n-butylamine was added, and the atmosphere was purged with nitrogen and stirred at -5°C. 12 μL of phosphorus oxychloride was added, and the mixture was allowed to react for 50 minutes. A mixture of 184 mg of ammonium pyrophosphate, 116 mg of tri-n-butylamine, and 5 mL of anhydrous acetonitrile was added, and the reaction was continued for 20 minutes. The reaction solution was quenched with 10 mL of triethylamine carbonate buffer. The mixture was then spin-dried at 25°C, diluted to 100 mL, and purified by DEAE column chromatography. The mixture was then prepared by C18 reverse phase chromatography to yield 33 mg of Compound 56.

[0110] Synthesis of Compound 57: Weigh 5 mg of Compound 56, dissolve in 0.1 mL of 0.1 mol / L sodium bicarbonate solution, and stir at 0°C. Weigh 8 mg of ROX-NHS, dissolve in 100 μL of anhydrous DMF, and slowly inject into the nucleotide solution for 1 h. The reaction solution is diluted to 50 mL, purified with DEAE, and then dried to obtain 3 mg of Compound 57. Characterization data are as follows: LC-MS (ESI + )m / z 1536.47(M+H) + .

[0111] Effect test:

[0112] The nucleotide derivatives provided in the above examples were subjected to DNA sequencing, and the specific method is as follows:

[0113] 1. Sequencing Library Construction

[0114] (1) Nucleic acid extraction: A rapid DNA extraction kit (TIANGEN, KG203) was used to extract and purify the genomic DNA of the E. coli sample. For specific procedures, see the operating instructions.

[0115] (2) Library construction: Use a universal library construction kit to construct the library. For specific operations, see the operating instructions. Kit model: Novozymes VAHTS Universal Plus DNA Library Prep Kit for Illumina (Cat. No. ND617-02).

[0116] (3) Library quality control: perform concentration detection and fragment length quality control on the enriched library to obtain library samples with a length of approximately 1-150 bp.

[0117] 2. Preparation of sequencing chips

[0118] Illumina's Miseq sequencer and its accompanying sequencing kit (MiSeq Reagent Kit v3) were used for library denaturation, library loading, and chip surface amplification to obtain DNA amplification clusters. The sequencing primer ACACTCTTTCCCTACACGACGCTCTTCCGATC (SEQ ID No. 1) was added. After hybridization, the DNA amplification clusters hybridized with the sequencing primers were fixed in the flow cell of the sequencing chip, awaiting the next sequencing reaction.

[0119] 3. Sequencing

[0120] (1) Preparation of sequencing reagents

[0121] Prepare the polymerization reaction solution, which contains polymerase, Mg 2+ and 1 μM of each nucleotide derivative; and an elution buffer, a pre-wash buffer, and a hypophosphorous acid removal reaction solution at pH=5.

[0122] The polymerase used in this step includes various known natural and modified nucleic acid polymerases, such as the 9°N sequencing enzymes numbered ARTN002, ARTN015, ARTN080, ARTN081, ARTN177, ARTN185, ARTN195, and ARTN202 of Taikooyu Technology Co., Ltd. The polymerase can synthesize new DNA chains using RNA or single-stranded DNA as templates. According to actual needs, a suitable polymerase can be selected to carry out nucleotide polymerization reactions, or a mixture of multiple polymerases can be used.

[0123] (2) Sequencing reaction cycle

[0124] The pre-wash buffer and polymerization solution are added sequentially to the amplified chip to initiate the polymerization reaction. After the polymerization reaction is complete, signals are collected from the entire sequencing chip to determine the base types bound by the primer strands in each amplified cluster. After signal collection is complete, the chip is rinsed with elution buffer and the excision reaction solution is added for reaction. Elution buffer is then pumped in for further cleaning.

[0125] Repeat the above steps to proceed to the next sequencing cycle, for a total of 100 sequencing cycles.

[0126] Test Example 1: Compounds 15, 30, 45, and 57 were used in the polymerization reaction solution for the above sequencing, and the excision reaction solution used was THPP excision buffer from Shenzhen Tanmi Technology Co., Ltd.;

[0127] Test Example 2: Compounds 10, 25, 40, and 53 were used in the polymerization reaction solution for the above sequencing, and the excision reaction solution used was hypophosphorous acid excision reaction solution and THPP excision buffer of Shenzhen Tanmi Technology Co., Ltd.;

[0128] Comparative Example 1: Compounds 58, 59, 60, and 61 purchased from Shenzhen Tanmi Technology Co., Ltd. were used in the polymerization reaction solution for the above sequencing. Their structures are shown below. The excision reaction solution used THPP excision buffer from Shenzhen Tanmi Technology Co., Ltd.:

[0129] The phasing values, pre-phasing values ​​and Q30 reflecting the sequencing quality of the sequencing results of different samples No. 1-6 of Examples 1-2 and Comparative Example 1 were compared, and the results are shown in Table 1 below.

[0130] Table 1

[0131] Combined with the above table, it can be seen that the nucleotide derivatives used in Test Examples 1-2 were more thoroughly excised, with both phasing and pre-phasing values ​​lower than those in Comparative Example 1. The sequencing quality Q30 results for Test Examples 1-2 were significantly higher than those for Comparative Example 1, fully demonstrating that the nucleotide derivatives provided in this application provide higher sequencing accuracy.

[0132] The applicant declares that while the above-mentioned examples are used to illustrate the nucleotide derivatives and their applications, this application is not limited to these examples. This does not imply that the application must rely on these examples in order to be implemented. Persons skilled in the art should understand that any improvements to this application, equivalent substitutions for raw materials in the products of this application, addition of auxiliary ingredients, and selection of specific methods, etc., fall within the scope of protection and disclosure of this application.

[0133] The preferred embodiments of the present application are described in detail above. However, the present application is not limited to the specific details of the above embodiments. Within the technical concept of the present application, various simple modifications can be made to the technical solution of the present application, and these simple modifications all fall within the scope of protection of the present application.

[0134] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner unless there is any contradiction. In order to avoid unnecessary repetition, this application will not further describe various possible combinations.

Claims

1. A nucleotide derivative, the structure of which is shown in Formula I: Among them, R1 is selected from any one of the following structures: Base is a base selected from any one of adenine, guanine, cytosine, thymine or uracil; Linker is selected from substituted or unsubstituted C6-C15 hydrocarbon groups; and Dye is a fluorescent label selected from any one of AF532, IF700, Cy5, ROX, Cy3, Cy7, AF405, AF430, AF660, BODIPY 650X, AT590, AT550, AT565, AF680, AF700, AF750, AF594, AF546, AF568, AF350, AF488, AF514, AT532, AT390, AT425, AT465, AT488, AT495, AT514, AT520, AT565, AT590 or AT610.

2. The nucleotide derivative according to claim 1, wherein, The R1 is selected from any one of the following structures:

3. The nucleotide derivative according to claim 1 or 2, wherein, The substituent of the substitution is selected from any one of halogen, amino, carbonyl, oxo, amide, nitro, sulfonic acid group, sulfonyl group, hydroxyl group.

4. The nucleotide derivative according to claim 3, wherein The substituent of the substitution is selected from any one of amino, oxo, amide group.

5. The nucleotide derivative according to claim 4, wherein, The Linker is selected from C6-C15 hydrocarbon groups substituted with oxo and amide groups.

6. The nucleotide derivative according to claim 5, wherein, The Linker is selected from C10-C15 alkenyl groups substituted with oxo and amide groups.

7. The nucleotide derivative according to claim 1, wherein, The base is selected from any one of adenine, guanine, cytosine or thymine.

8. The nucleotide derivative according to claim 1, wherein The fluorescent label is selected from any one of AF532, IF700, Cy5 or ROX.

9. The nucleotide derivative according to claim 1, wherein, The nucleotide derivatives are selected from any one of the following structures:

10. Use of a nucleotide derivative according to any one of claims 1-9 in nucleic acid sequencing.

Citation Information

Patent Citations

  • Nucleotide derivative and gene sequencing method

    CN114574571A

  • Gene sequencing method

    CN114958995A

  • Nucleotide analogue and application thereof in sequencing

    CN116284185A

  • Nucleotide derivative and application thereof

    CN117924392A

  • Chemically Cleavable 3'-O-Allyl-DNTP-Allyl-Fluorophore Fluorescent Nucleotide Analogues and Related Methods

    US20090263791A1