Improved methods and compositions for cloning de novo-synthesized polynucleotides

Enzymatic synthesis of polynucleotides integrated with a plasmid backbone on a surface addresses the inefficiencies of conventional methods, achieving faster, more accurate, and cost-effective cloning of long and complex polynucleotides by integrating the backbone with the synthesized polynucleotide and forming a plasmid template for host cell replication.

WO2025155732A1PCT designated stage expired Publication Date: 2025-07-24ANSA BIOTECHNOLOGIES INC
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/011896
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-16
Filing Date
2025-01-16
Publication Date
2025-07-24

AI Technical Summary

Technical Problem

Conventional methods for de novo synthesis and cloning of long and complex polynucleotides suffer from high error rates, time-consuming processes, and inefficiencies, particularly in amplifying and cloning GC-rich sequences, leading to significant challenges in achieving accurate and cost-effective cloning.

Method used

The method involves enzymatic synthesis of polynucleotides on a plasmid backbone attached to a surface, where the plasmid backbone is integrated with the synthesized polynucleotide, followed by release and circularization to form a plasmid template, which is then inserted into a host cell for replication, reducing errors and improving cloning efficiency.

Benefits of technology

This approach significantly reduces synthesis time, increases accuracy, and decreases costs by minimizing errors and eliminating the need for extensive characterization of clones, thereby enhancing the cloning process for long and complex polynucleotides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025011896_24072025_PF_FP_ABST
    Figure US2025011896_24072025_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed herein are methods and compositions for improved cloning of long and complex de novo template-independent synthesized polynucleotides. Methods include direct enzymatic synthesis of a synthetic polynucleotide on an oligonucleotide attached to a surface, in a way that allows a plasmid backbone sequence to be attached to one or both sides of the synthetic polynucleotide while remaining attached to a surface, followed by release and circularization. Both single-stranded and double-stranded circular plasmids can be generated by the methods described herein.
Need to check novelty before this filing date? Find Prior Art

Description

IMPROVED METHODS AND COMPOSITIONS FOR CLONING DE NO VO-SYNTHESIZED POLYNUCLEOTIDESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of US Provisional Application No. 63 / 621,439, filed January 16, 2024, the contents of which is incorporated by reference in its entirety.FIELD OF THE PRESENT DISCLOSURE

[0002] The present disclosure relates to methods, kits, and devices for de novo synthesis of long, complex polynucleotides and incorporation into a plasmid cloning backbone performed on a surface (i.e., solid support), and compositions generated therefrom.BACKGROUND

[0003] Synthetic biology is a key developing field necessary for advancing biological research and development of new therapeutics, among other industrial applications. The engineering of biological systems in synthetic biology often requires de novo synthesis of long and complex polynucleotide sequences that comprise complete functional units. However, this has been a particularly challenging problem using conventional polynucleotide synthesis and cloning / amplification techniques.

[0004] Known methods generating chemically- synthesized DNA fragments have very high sequence error rates. Approaches to this problem have included modification of DNA sequences to optimize for conventional DNA synthesis shortcomings, as well as development of various technologies to assemble short polynucleotide sequences. However, these approaches exhibit limitations, such as accommodating polynucleotides of less than 300 base pairs, requiring complex tagging and sequencing, relying on large sets of barcodes, involving intricate and time-consuming steps, or failing to synthesize diverse polynucleotide sequences. Furthermore, assembly, synthesis, and cloning of polynucleotides suffers from a high probability of errors.

[0005] More recently, enzymatic polynucleotide synthesis techniques have gained traction, showing promise for de novo synthesis of longer and more complex polynucleotides with lower error rates. However, after achieving high accuracy synthesis of a longer and more complex polynucleotide via enzymatic methods, the resulting de novo synthesized polynucleotide must be amplified or cloned with a correspondingly accurate fidelity. Currentin vitro methods of amplifying de novo synthesized long and complex DNA suffer from higher error rates or are time-consuming and difficult to perform with high accuracy, such as for sequences with repeat or GC-rich sequences.

[0006] What is needed, therefore, are improved methods for accurate cloning of long and complex de novo synthesized polynucleotides.SUMMARY

[0007] The inventors unexpectedly discovered that the methods described below can result in: reducing the amount of time it takes to synthesize and clone desired long and complex polynucleotides, increasing the accuracy of the resulting polynucleotides, and decreasing the cost of the synthesized polynucleotides. In particular, the inventors unexpectedly discovered that enzymatic de novo synthesis of a desired polynucleotide on a portion of a plasmid backbone sequence or by directly attaching the plasmid backbone sequence to the synthesized polynucleotide directly on a surface increases the accuracy of the resulting sequences and plasmids for cloning, and decreases the cost of synthesizing the polynucleotides.

[0008] Provided herein, according to some embodiments, is a method of preparing a plasmid template on a solid support, the method comprising: providing a solid support comprising a plurality of starter oligonucleotides attached to the surface of the solid support and comprising a free 3' end; performing a stepwise enzymatic template-free polynucleotide synthesis to generate a synthetic polynucleotide intended to comprise a predefined sequence for cloning at the free 3' end of each of the plurality of starter oligonucleotides, wherein; each of the plurality of starter oligonucleotides comprises at least a portion of a plasmid backbone, or the method further comprises attaching at least a portion of a plasmid backbone to the 3' end of the synthetic polynucleotide, or the method further comprises performing a stepwise enzymatic template-free polynucleotide synthesis to generate at least a portion of a plasmid backbone at the 3' end of the starter oligonucleotide or at the 3' end of the synthetic polynucleotide; and wherein the at least a portion of the plasmid backbone comprises a selectable marker; and releasing the plasmid template comprising the synthetic polynucleotide and the at least a portion of the plasmid backbone from the surface, wherein the released plasmid template is capable of being circularized to form a circular plasmid comprising the synthetic polynucleotide and the plasmid backbone.

[0009] In some embodiments, the method further comprises circularizing the released plasmid template to form a circular plasmid. In some embodiments, the method further comprises inserting the circular plasmid into a host cell suitable for plasmid replication. In some embodiments, the method further comprises inserting the released plasmid template into a host cell suitable for circularization of the plasmid template to form a circular plasmid and plasmid replication.

[0010] In some embodiments, each terminus of the released plasmid template is hybridized to regions on a complementary oligonucleotide. In some embodiments, the method further comprises circularizing the released plasmid template by ligating the 5' and 3' terminus to form a circular plasmid. In some embodiments, the method further comprises performing a template-dependent extension of the complementary oligonucleotide to form a doublestranded circular plasmid. In some embodiments, the method further comprises inserting the circular plasmid into a host suitable for plasmid replication.

[0011] In some embodiments, the region adjacent to the 5' or to the 3' terminus of the released plasmid template comprises a telomerase recognition sequence. In some embodiments, the method further comprises inserting the plasmid template into a host comprising telomerase activity and suitable for replicating a single-stranded circular plasmid. In some embodiments, the method further comprises circularizing the released plasmid template by exposing the released plasmid template to a telomerase to generate a hairpin loop at the 5' terminus or at the 3' terminus and to form a single-stranded circular plasmid. In some embodiments, the method further comprises inserting the single-stranded circular plasmid into a host cell suitable for plasmid replication.

[0012] In some embodiments, the plurality of oligonucleotides attached to the surface of the solid support each have only one free 3' end. In some embodiments, the synthetic polynucleotide has not been amplified or replicated before insertion into the host cell.

[0013] In some embodiments, the stepwise enzymatic template- free polynucleotide synthesis comprises stepwise coupling of a nucleotide comprising a protecting group to said free 3' end. In some embodiments, the coupling is catalyzed by a polymerase. In some embodiments, the polymerase is a template-independent polymerase. In some embodiments, the template-independent polymerase is Terminal deoxynucleotidyl Transferase (TdT), or a variant thereof. In some embodiments, the polymerase is an RNA polymerase.

[0014] In some embodiments, the polymerase is covalently linked to said nucleotide. In some embodiments, the protecting group comprises said polymerase covalently linked to said nucleotide. In some embodiments, the protecting group is a polymerase, and wherein thepolymerase is linked to the nucleotide via a cleavable linker. In some embodiments, a cycle of said stepwise enzymatic synthesis comprises cleaving the linker attaching said nucleotide to said polymerase. In some embodiments, the cleavable linker is bound to the alphaphosphate, sugar, or nucleobase of the nucleotide.

[0015] In some embodiments, the protecting group is a reversible terminator. In some embodiments, a cycle of said stepwise enzymatic synthesis comprises removing said reversible terminator from said nucleotide. In some embodiments, the protecting group is a 3'-O-blocking group. In some embodiments, the enzymatic synthesis further comprises removing said 3'-O-blocking group from said nucleotide to leave a free 3' hydroxyl group.

[0016] In some embodiments, the protecting group is a 2' or 3' modification of the nucleotide. In some embodiments, the 2' modification is selected from the group consisting of -H, -OH, -F, -OMe, -N3, -NH2, and -Ara. In some embodiments, the 3' modification is selected from the group consisting of: -H, -OH, -OCH2N3, -ONH2, -Oallyl and phosphate.

[0017] In some embodiments, the coupling comprises contacting said free 3' end with a solution comprising said nucleotide and said polymerase.

[0018] In some embodiments, the at least a portion of the plasmid backbone comprises an origin of replication. In some embodiments, the at least a portion of the plasmid backbone comprises a selectable marker.

[0019] In some embodiments, the starter oligonucleotides comprise a single- stranded region at the 3' end. In some embodiments, the starter oligonucleotide is hybridized to an oligonucleotide bound to the solid support.

[0020] Also provided herein, according to some embodiments, is a surface comprising a plurality of polynucleotides attached to the surface, each polynucleotide comprising a plasmid template comprising: at least a portion of a plasmid backbone comprising a selectable marker; and a synthetic polynucleotide synthesized by stepwise templateindependent enzymatic synthesis; wherein the plasmid template, when released form the surface is capable of forming a circularized plasmid comprising a plasmid backbone and the synthetic polynucleotide.BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The foregoing and other objects, features and advantages will be apparent from the following description of particular embodiments of the present disclosure, as illustrated in the accompanying drawings in which like reference characters refer to the same parts throughoutthe different views. The drawings are not necessarily to scale, emphasis instead placed upon illustrating the principles of various embodiments of the present disclosure.

[0022] FIG. 1 is a diagram of a plasmid backbone or portion of a plasmid backbone ligated to a starte oligonucleotide which is covalently attached to a solid support. The starter oligonucleotide comprises Uracil nucleotides for cleavage using a USER enzyme.

[0023] FIG. 2 is a diagram of the starter oligonucleotide and plasmid backbone attached to a solid support from FIG. 1, with a synthetic polynucleotide added to the 3' end of the plasmid backbone via stepwise enzymatic template-independent synthesis (top), and after cleavage of the plasmid template comprising the plasmid backbone and to release the plasmid template form the surface. As shown, the plasmid template comprises a polyT sequence and polyA sequence that are capable of hybridizing to form a circularized plasmid.

[0024] FIG. 3 is a diagram of steps for synthesizing a plasmid template on a surface, including i) attaching a double-stranded plasmid backbone to an enzymatically synthesized synthetic polynucleotide bound to a solid support to generate a plasmid template bound to the solid support, ii) cleavage to releasing the plasmid template, iii) an extension reaction to extend a strand of the double-stranded plasmid template, and iv) circularization of the double-stranded plasmid template to form a circularized double- stranded plasmid.

[0025] FIG. 4 shows the number of colonies required to have a 95% chance of identifying a clone with a sequence perfect synthetic polynucleotide for several different synthetic polynucleotides cloned by PCR or by the method of surface-attached plasmid template preparation described herein (“direct to plasmid”).DETAILED DESCRIPTION

[0026] The details of various embodiments of the present disclosure are set forth in the description below. Other features, objects, and advantages of the present disclosure will be apparent from the description and the drawings, and from the claims.Definitions

[0027] As may be used herein, the terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” “oligonucleotide,” and “polynucleotide” are used interchangeably and are intended to include, but are not limited to, a polymeric form of nucleotides covalently linked together that may have various lengths, either deoxyribonucleotides or ribonucleotides, or analogs, derivatives or modifications thereof. Polynucleotides useful in the methods of thedisclosure may comprise natural nucleic acid sequences and variants thereof, artificial nucleic acid sequences, or a combination of such sequences.

[0028] Examples of polynucleotides contemplated herein include single and double stranded DNA, single and double stranded RNA, and hybrid molecules having mixtures of single and double stranded DNA and RNA. The term “duplex” in the context of polynucleotides refers, in the usual and customary sense, to double strandedness.

[0029] As used herein, “plasmid” or “circular plasmid” or “circularized plasmid” refers to a circularized form of the plasmid template, i.e., a continuous circularized polynucleotide without a 5' or 3' end, and comprising a plasmid backbone and a synthetic polynucleotide. The circularized plasmid can be in the form of a single-stranded or a double- stranded circularized plasmid. For example, a single-stranded plasmid can refer to a double-stranded DNA covalently closed at both ends by hairpin loops. Such plasmids typically have at least one selectable marker encoded in the backbone to identify host cells successfully transfected with the plasmid.

[0030] As used herein, the term “vector” or “plasmid backbone” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. In the present specification, “plasmid backbone” and “vector” can be used interchangeably as the plasmid is the most commonly used form of vector. A vector may be in the form of a “plasmid backbone”, which in this context refers to a circular double stranded or singlestranded polynucleotide loop into which additional polynucleotide segments can be ligated.

[0031] As used herein, the term “plasmid template” refers to a linear double- stranded or single- stranded polynucleotide sequence that can be circularized (e.g., ligated) to form a circular double-stranded or single- stranded polynucleotide loop. A linear polynucleotide refers to a non-circular polynucleotide comprising at least one 5' or 3' end (e.g., a polynucleotide having blunt ends). In some embodiments, the 5' or 3' end may comprise one or more modifications. As described herein, in some embodiments, the plasmid template is a linear polynucleotide comprising two ends (e.g., a free 5' end and a free 3' end). In some embodiments, the plasmid template comprises an additional polynucleotide segment, such as a synthetic polynucleotide, attached to a plasmid backbone or to flanking portions of a plasmid backbone that, when circularized, form a plasmid comprising a complete plasmid backbone and the additional polynucleotide segment (e.g., a synthetic polynucleotide). In some embodiments, the plasmid backbone is attached to the 5' end or the 3' end of the synthetic polynucleotide to form the plasmid template. In some embodiments, the plasmidbackbone is divided into two portions, with one portion attached to the 5' end of the synthetic polynucleotide, and one portion attached to the 3' end of the synthetic polynucleotide.

[0032] As used herein, a “synthetic polynucleotide” refers to a de novo template free enzymatically synthesized polynucleotide intended to have a desired sequence and length. The enzymatic synthesis of the synthetic polynucleotide is performed on a starter oligonucleotide attached to a surface. As described, improved methods of cloning the synthetic polynucleotide are provided herein, which include attachment of a plasmid backbone sequence to the synthetic polynucleotide through ligation or synthesis, or include use of a starter oligonucleotide already including at least a portion of the plasmid backbone which the synthetic polynucleotide is synthesized on.

[0033] As used herein, the term “contacting” refers to the process of allowing at least two distinct species (e.g. chemical compounds including biomolecules or cells) to become sufficiently proximal to react, interact or physically touch.Improved cloning of long and complex synthetic polynucleotides

[0034] As an alternative to in vitro amplification, such as PCR, de novo synthesized DNA can be amplified by in vivo cloning. In vivo cloning has several advantages over PCR, which has limitations in the length of DNA fragments that can be efficiently amplified, whereas in vivo cloning can be used for cloning entire genes or even entire genomes. In addition, in vivo cloning is less susceptible to replication errors caused by any modified structures remaining on synthetic polynucleotides, which may remain after enzymatic synthesis. Traditional in vivo cloning involves preparing, isolating, and duplicating single nucleic acid molecules by inserting them into a circular DNA vector, placing the vector into living cells (e.g., E. coll), growing colonies from transformed cells, and subsequently expanding these clonal colonies for larger-scale production of the de novo synthesized DNA. The vectors, carrying the inserted nucleic acid molecules, are then isolated from the cells for downstream processes, such purification of the amplified polynucleotide of interest.

[0035] However, the in vivo cloning step has inherent time and cost inefficiencies that create bottlenecks and hinder development. For cloning of de novo synthesized polynucleotides, the synthetic polynucleotide pool for vector insertion typically includes a mixture of sequences due to inherent synthesis errors, especially for long and complex synthetic polynucleotides, which may suffer from a low proportion of sequence perfect polynucleotides as well as a low concentration of synthesized polynucleotides, which could result in a significant population of empty vectors. This necessitates rigorous and time-consuming characterization to confirm the presence of the desired sequence. To identify clones with the correct polynucleotide of interest, a large number of clones need to be selected for expansion and analysis. This number depends on the method used to generate the source polynucleotide, the length and complexity of the polynucleotide, and the amount of polynucleotide available. The preparation, selection, expansion, and analysis of clones involve substantial cost, effort, and time.

[0036] Provided herein are improved methods of preparation of vector plasmids with a desired de novo synthesized polynucleotide sequence to improve the efficiency of cloning process following long complex polynucleotide synthesis, ensuring a sufficiently high proportion of clones have vector plasmids with the correct synthetic polynucleotide sequence.

[0037] In some embodiments, provided herein is a method for preparing a plasmid template on a solid support, wherein the plasmid template comprises a synthetic polynucleotide and a plasmid backbone and the plasmid template is attached to a solid support. In some embodiments, the plasmid backbone in the plasmid template is intact and linked to the 5' or 3' end of the synthetic polynucleotide. In some embodiments, the plasmid backbone in the plasmid template is divided into two portions flanking the synthetic polynucleotide.

[0038] After preparation of the plasmid template attached to the surface, it can be released from the surface, and circularized to form a circular plasmid comprising the plasmid backbone and the synthetic polynucleotide. Circularization can be performed in vitro or in vivo (e.g., in a host cell). A circularized plasmid or a plasmid template can then be inserted into a host cell suitable for replication of the plasmid. Such a method of preparing the plasmid template while attached to the surface is advantageous in that it improves the accuracy of the pool of plasmids formed by the process, by removing empty vectors that can form when a plasmid backbone re-anneals to itself without including the appropriate synthetic polynucleotide insert if added in solution. This is particularly relevant for a long and complex polynucleotide synthesis, where the concentration and proportion of sequence perfect polynucleotides synthesized can both be low due to inherent synthesis errors.

[0039] As part of the method for preparing a plasmid template on a solid support, the synthetic polynucleotide is directly synthesized via stepwise enzymatic template-independent synthesis on a starter oligo attached to the solid support. The synthetic polynucleotide synthesized by this process is designed to have an intended sequence and length, by stepwise addition of the desired incoming nucleotide at each step of polynucleotide synthesis.

[0040] The plasmid backbone portion of the plasmid template can be added by enzymatic synthesis or by ligation. In some embodiments, the plasmid backbone or portion thereof is ligated to a starter oligo attached to a surface, and enzymatic synthesis of the synthetic polynucleotide is initiated at the 3' end of the plasmid backbone or portion thereof. In some embodiments, the plasmid backbone or portion thereof is enzymatically synthesized at the 3' end of a starter oligo attached to a surface, and enzymatic synthesis of the synthetic polynucleotide is initiated at the 3' end of the plasmid backbone or portion thereof. In some embodiments, the plasmid backbone or portion thereof is ligated to the 3' end of the synthetic polynucleotide attached to the surface. In some embodiments, the plasmid backbone or portion thereof is enzymatically synthesized starting at the 3' end of the synthetic polynucleotide attached to the surface.

[0041] In some embodiments, provided herein is a method of preparing a plasmid template on a solid support, the method comprising providing a solid support comprising a plurality of starter oligonucleotides attached to the surface of the solid support and comprising a free 3' end; performing a stepwise enzymatic template-free polynucleotide synthesis to generate a synthetic polynucleotide intended to comprise a predefined sequence for cloning at the free 3' end of each of the plurality of starter oligonucleotides, wherein each of the plurality of starter oligonucleotides comprises a plasmid backbone or at least a portion of a plasmid backbone comprising a selectable marker. In some embodiments, the method further comprises releasing the plasmid template comprising the synthetic polynucleotide and the at least a portion of the plasmid backbone from the surface, wherein the released plasmid template is capable of being circularized to form a circular plasmid comprising the synthetic polynucleotide and the plasmid backbone.

[0042] In some embodiments, provided herein is a method of preparing a plasmid template on a solid support, the method comprising providing a solid support comprising a plurality of starter oligonucleotides attached to the surface of the solid support and comprising a free 3' end; performing a stepwise enzymatic template-free polynucleotide synthesis to generate a synthetic polynucleotide intended to comprise a predefined sequence for cloning at the free 3' end of each of the plurality of starter oligonucleotides, attaching a plasmid backbone or at least a portion of a plasmid backbone comprising a selectable marker to the 3' end of the synthetic polynucleotide. In some embodiments, the method further comprises releasing the plasmid template comprising the synthetic polynucleotide and the at least a portion of the plasmid backbone from the surface, wherein the released plasmid template is capable ofbeing circularized to form a circular plasmid comprising the synthetic polynucleotide and the plasmid backbone.

[0043] In some embodiments, provided herein is a method of preparing a plasmid template on a solid support, the method comprising providing a solid support comprising a plurality of starter oligonucleotides attached to the surface of the solid support and comprising a free 3' end; performing a stepwise enzymatic template-free polynucleotide synthesis to generate a synthetic polynucleotide intended to comprise a predefined sequence for cloning at the free 3' end of each of the plurality of starter oligonucleotides; performing a stepwise enzymatic template-free polynucleotide synthesis to generate a plasmid backbone or at least a portion of a plasmid backbone comprising a selectable marker at the 3' end of the starter oligonucleotide or at the 3' end of the synthetic polynucleotide. In some embodiments, the method further comprises releasing the plasmid template comprising the synthetic polynucleotide and the at least a portion of the plasmid backbone from the surface, wherein the released plasmid template is capable of being circularized to form a circular plasmid comprising the synthetic polynucleotide and the plasmid backbone.

[0044] In some embodiments, the method further comprises circularizing the released plasmid template to form a circular plasmid. In some embodiments, the method further comprises inserting the circular plasmid into a host cell suitable for plasmid replication. In some embodiments, the method further comprises inserting the released plasmid template into a host cell suitable for circularization of the plasmid template to form a circular plasmid and plasmid replication.

[0045] In some embodiments, each terminus of the released plasmid template is hybridized to regions on a complementary oligonucleotide. In some embodiments, the method further comprises circularizing the released plasmid template by ligating the 5' and 3' terminus to form a circular plasmid. In some embodiments, the method further comprises performing a template-dependent extension of the complementary oligonucleotide to form a doublestranded circular plasmid. In some embodiments, the method further comprises inserting the circular plasmid into a host suitable for plasmid replication.

[0046] In some embodiments, the region adjacent to the 5' or to the 3' terminus of the released plasmid template comprises a telomerase recognition sequence. In some embodiments, the method further comprises inserting the plasmid template into a host comprising telomerase activity and suitable for replicating a single-stranded circular plasmid. In some embodiments, the method further comprises circularizing the released plasmid template by exposing the released plasmid template to a telomerase to generate a hairpin loopat the 5' terminus or at the 3' terminus and to form a single-stranded circular plasmid. In some embodiments, the method further comprises inserting the single-stranded circular plasmid into a host cell suitable for plasmid replication.

[0047] In some embodiments, the plurality of oligonucleotides attached to the surface of the solid support each have only one free 3' end. In some embodiments, the synthetic polynucleotide has not been amplified or replicated before insertion into the host cell.

[0048] In some embodiments, after formation of circular plasmids, exonucleases (e.g., Exol, ExoIII and the like) will be added for the degradation of all but circularized plasmids. In some embodiments, exonuclease and mismatch cleavage endonucleases are used for the degradation of all but correctly circularized DNA, and for the elimination of errors incurred during oligonucleotide synthesis.Plasmid backbone

[0049] As described herein the plasmid backbone refers to a plasmid polynucleotide with components suitable for replication in a host cell that acts as a carrier for a synthetic polynucleotide for cloning the synthetic polynucleotide in a host cell. The plasmid backbone can include several components to facilitate host cell transfection, cloning, and selection of transfected colonies. A plasmid backbone may be in circular (plasmid) or linear form (plasmid template), and may be separated into two portions flanking a synthetic polynucleotide, that, when joined, form a complete plasmid backbone sequence.

[0050] A plasmid can have one or more restriction endonuclease recognition sites at which the sequences can be cut in a determinable fashion, and into which a nucleic acid fragment can be spliced in order to bring about its replication and cloning.

[0051] ‘ ‘Restriction sites,” “endonuclease recognition sites,” or “endonuclease cleavage sites” or “restriction enzyme binding domains” are locations on a nucleic acid that contain specific sequences of nucleotides that are recognized and cleaved by restriction enzymes and such restriction recognition sites can vary from 4 to 10 bases in length. Restriction sites can be palindromic, and depending on the type of restriction enzyme the restriction enzyme can cut the sequence between two nucleotides within the recognition site, or it can cut upstream or downstream from the recognition site, such that the endonuclease cleavage site is a specific distance away from an endonuclease recognition site. “Restriction enzyme” as described herein, refers to an enzyme that can cut nucleic acid at or near specific recognition nucleotide sequences known as restriction sites. Restriction enzymes are commonly classified into three types, which differ in their structure and whether they cut their nucleicacid substrate at their recognition site, or if the recognition and cleavage sites are separate from one another. To cut a nucleic acid, all restriction enzymes make two incisions, once through each sugar-phosphate backbone (i.e. each strand) of a double stranded nucleic acid sequence. There are over 3000 restriction enzymes, of which over 600 are commercially available. There are 5 types of restriction enzymes (Type I, II, III, IV, and V). Type II enzymes are homodimers, in which the recognition sites are usually undivided and palindromic and 4-8 nucleotides in length. They recognize and cleave DNA at the same site, and they do not use ATP or AdoMet for their activity and many require only Mg2+ as a cofactor. Without being limiting an endonuclease can include, for example, a CRISPR, a restriction endonuclease, a Type II restriction endonuclease and a Type IIS restriction endonuclease. In some alternatives, the endonuclease is a CRISPR, a restriction endonuclease, a Type II restriction endonuclease or a Type IIS restriction endonuclease.

[0052] In accordance with the methods described here, a plasmid may contain at least one selectable marker suitable for use in the identification of cells transformed with the plasmid. As used herein, a “selectable marker” refers to a phenotypic trait conferred on transformed cells that protects them from a selective agent in their environment, i.e., the growth media. Examples of selectable markers include, but are not limited to, antibiotic resistance markers (e.g., genes encoding resistance to kanamycin, ampicillin, chloramphenicol, gentamycin, or trimethoprim) and metabolic markers (e.g., amino acid synthesis genes or transfer RNA genes). As is appreciated in the art, the origin of replication can also be used as a selectable marker.

[0053] In some embodiments, the selectable marker is an antibiotic resistance gene. Examples of antibiotic resistance genes that can reside in a linear vector polynucleotide can include a kanamycin resistant gene, ampicillin resistant gene, tetracycline resistant gene, or chloramphenicol resistant gene, for example. In some embodiments, the selectable marker is a Zeocin™ resistance marker, a neomycin resistance marker, a puromycin resistance marker, a blasticidin resistance marker and a hygromycin resistance marker. In some embodiments, the selectable marker is a metabolic marker. Metabolic markers can include amino acid synthesis genes, for example genes for trp synthesis. In some alternatives, the polynucleotide further comprises a selectable marker. In embodiments, and without limitation, the selectable marker is HygR, NsrR, ZeoR, TetA, CmR, SpR, GmR, mFabl, TmR, neoR, or kanR.

[0054] In some embodiments, the selectable marker is a reporter marker. In some embodiments, a reporter marker is one of chloramphenicol- acetyl transferase (CAT), P- galactosyltransferase, horseradish peroxidase, luciferase, NanoLuc®, alkaline phosphatase,and fluorescent proteins. In some embodiments, the fluorescent protein is selected from the group consisting of Green Fluorescent Protein (GFP), Red Fluorescent Protein (RFP), mCherry, mRuby3, mtagBFP2 and mClover3.

[0055] A selectable marker can be used to eliminate target cells in which a plasmid vector has not been properly inserted or properly transfected. A selectable marker can be a positive selection marker reporter marker or negative selection marker. Positive selection markers permit the selection for cells in which the gene product of the marker is expressed. This generally comprises contacting cells with an appropriate agent that, but for the expression of the positive selection marker, kills or otherwise selects against the cells. For suitable positive and negative selection markers, see Table I in U.S. Pat. No. 5,464,764.

[0056] Plasmids will typically contain one or more region that renders it capable of replication in at least one cell type. Certain plasmid vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other plasmid vectors (e.g., non episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.Closed linear single-stranded plasmids

[0057] The present disclosure relates to processes for the production of circular doublestranded or single-stranded plasmid vectors comprising a synthetic polynucleotide from a plasmid template generated on a surface. Single- stranded plasmid vectors, also referred to in the art as closed linear DNA molecules, typically comprise covalently closed ends also described as hairpin loops, where base-pairing between complementary DNA strands is not present. The hairpin loops join the ends of complementary DNA strands. Structures of this type typically form at the telomeric ends of chromosomes in order to protect against loss or damage of chromosomal DNA by sequestering the terminal nucleotides in a closed structure.

[0058] In vivo cloning requires the incorporation of genetic material into a plasmid backbone and copying of the plasmid in a host cell. Some synthetic polynucleotides are difficult to clone in current vectors, such as circular double-stranded plasmids. Examples of difficult to clone polynucleotides include those having high AT-content, strong secondary structure, deleterious open reading frames, or cis-acting functions (e.g., transcriptional promoters or replication origins). For example, some synthetic polynucleotides can cause superhelical stress in circular plasmids and can generate secondary structures that aresubstrates for deletion, particularly in regions that contain numerous tandem or inverted repeats.

[0059] Single- stranded circular plasmid vectors can be derived from a bacteriophage (or its host cell). In some embodiments, the phage from which the single-stranded circular plasmid is derived is suitably selected from lambda, N15, KO2, PRD1 or PY54. The single-stranded circular plasmid may be modified to include deletion of structural genes or regulatory sequences, and / or introduction of one or more sequences such as promoter, operator or enhancer sequences, restriction sites, telomeres, sequences encoding selectable markers and / or transcriptional terminator sequences. Single- stranded circular plasmids provide several desirable features to the use of circular double- stranded plasmids for cloning. Singlestranded circular plasmids are not subject to the supercoiling found in circular doublestranded plasmids and can stably maintain inserts that have primary or secondary structures that are unstable when supercoiled. Single-stranded circular plasmids can also exhibit the ability to clone larger inserts using standard methods. For example, single- stranded circular plasmid cloning systems can stably clone a nucleic acid, such as DNA, in the range of 10 to over 100 kb, without the use of packaging systems required with cosmid cloning. Replication of single- stranded circular plasmids (e.g., linear vectors), can impart high fidelity replication of repeats, large palindromes, AT-rich DNA, and high repeats, for example a thymine rich region. The concept of using a single-stranded circular plasmid is described, for example, in WO 2007 / 087478 and in Godiska et al (Nucleic Acids Research (2010), vol. 38, no. 6), which refer to a single- stranded circular plasmid as a “linear vector”, and which are both hereby expressly incorporated by reference in their entireties.

[0060] In some embodiments, a single- stranded circular plasmid can include a left telomere, a right telomere and at least one selectable marker, and a synthetic polynucleotide between the left and right telomere. As used herein, a “telomere” refers to a polynucleotide or polypeptide structure on the end (or ends) of a linear DNA molecule that protects the termini of the DNA from recombination and / or exonucleolytic degradation. Suitable telomeres include covalently closed ends, sequences capable of binding terminal proteins (e.g., as in PRD1), and tracts of polynucleotide repeats (e.g., poly A, C, G, T or U tracts). Examples of telomeres useful in constructing the linear vectors of the present disclosure include those derived from bacteriophages lambda, N15, KO2, PRD1 and PY54, as well as from some linear chromosomes, e.g., those from Borrelia spp. and Agrobacterium tumefaciens.

[0061] Telomerase proteins (e.g., protelomerase proteins) are enzymes that are responsible for the generation of closed hairpin ends on a single-stranded circular DNA. The target sites of telomerases (telomerase recognition sequences) can be inverted repeats. Telomerase proteins can also process a target site, in which the target site can have dyad symmetrical DNA. Telomerases are a class of unique proteins that function to generate covalently closed hairpin ends in DNA. These linear DNA ends are arranged such that one strand turns around and becomes the complementary strand. In this manner, these single-stranded DNA molecules do not have free or open ends (i.e., they are a circular single-stranded plasmid), and are expected to be stable and not vulnerable to exonuclease degradations. Telomerase function and sites for binding of the telomerase are discussed in Godiska et al. (U.S.9029134; incorporated by reference in its entirety). The ability of a given polypeptide to catalyse the production of closed linear DNA from a template comprising a telomerase recognition sequence can be determined using any suitable assay described in the art.

[0062] Protelomerase enzymes having telomerase activity have been described in bacteriophages. In some lysogenic bacteria, bacteriophages exist as extrachromosomal DNA comprising linear double strands with covalently closed ends. The replication of this DNA and the maintenance of the covalently closed ends (or telomeric ends) are dependent on the activity of the enzyme, protelomerase. An example of this catalytic activity is provided by the enzyme, TelN from the bacteriophage, N1 5 that infects Escherichia coli. TelN recognises a specific nucleotide sequence in the circular double stranded DNA. This sequence is a slightly imperfect inverted palindromic structure termed telRL comprising two halves, telR and telL, flanking a 22 base pair inverted perfect repeat (telO). Covalently closing at least one of a single- stranded plasmid template can be performed in vitro or in vivo using at least one pro telomerase.

[0063] In some embodiments, the plasmid backbone of the single- stranded plasmid or plasmid template comprises at least one protelomerase target sequence. After release from the surface, the single- stranded plasmid template is contacted with at least one protelomerase under conditions promoting production of closed linear DNA.

[0064] According to the present disclosure, single-stranded circular plasmids are generated by the action of protelomerase on single- stranded plasmid template comprising at least one protelomerase target sequence and released from a surface after preparation. A protelomerase target sequence is any DNA sequence whose presence in a DNA template allows for its conversion into a single- stranded circularized plasmid by the enzymatic activity ofpro telomerase. Protelomerase target sequences are described in PCT Publication W02010 / 086626, incorporated herein by reference.

[0065] In some embodiments, a synthetic polynucleotide is enzymatically synthesized on a surface and a backbone plasmid (or flanking portions of a backbone plasmid), that, when circularized, forms a single-stranded circular plasmid.

[0066] The cloning region of the single- stranded circular plasmid vector may include a restriction site, or may be a multiple cloning site (MCS) including more than one restriction site. One or more of the restriction sites are suitably unique restriction sites. Suitably, the cloning region may include a reporter stuffer region, e.g., the lacZa gene or a lethal gene. The reporter stuffer region may be flanked by restriction sites, or more suitably, MCSs, so that the entire reporter stuffer region may be replaced by one or more polynucleotides to be cloned. This configuration advantageously permits cloning of coding sequences which may be toxic to the cells, because strong promoters in or adjacent to the reporter region are eliminated, thus preventing transcription (and subsequent translation) of the toxic insert.Host cells

[0067] In further embodiments, the present disclosure provides host cells suitable for propagating the circular single- stranded plasmid vectors comprising the synthetic polynucleotide. A “host cell” is any cell that may be transformed with heterologous DNA, i.e., any cell that is a competent cell. In some embodiments, the host cell is an E. coli cell. Suitable strains of E. coli are known, e.g., DH10B cells or E. CLONI 10G cells (Lucigen, Middleton, Wis.). In some embodiments, host cells may be engineered to enhance transformation efficiency and / or maintenance of the circular single-stranded plasmid.

[0068] In some embodiments, a host cell comprises a coding sequence for a prokaryotic telomerase, which is referred to herein and, in the art, as “protelomerase” (or, alternatively, “telomere resolvase”), either on a conventional plasmid, or stably integrated into the host cell genome. A suitable protelomerase is the N15 protelomerase, referred to herein and in the art as “TelN.” Optionally, host cells may express protelomerase prior to transformation with the linear cloning vector.

[0069] In some embodiments, the host cell contains a coding sequence for a suitable polymerase for replication of the linear vector, either contained on a plasmid or stably integrated into the genome of the host cell. As an example, the coding sequence for the PRD1 polymerase (Bamford et al., Virology 183(2) :658-676 (1991), the disclosure of which isincorporated herein by reference) may suitably be introduced into host cells designed to replicate linear vectors derived from PRD1.Enzymatic Synthesis of Synthetic Polynucleotides

[0070] Conventional chemically synthesized DNA often contains sequence errors and is therefore unsuitable for generation of long and complex polynucleotide sequences. These errors can be introduced at several stages associated with preparing a de novo synthesized polynucleotide, such as during synthesis (including truncated products), during assembly, or during the cloning process. The methods described herein include improved enzymatic synthesis methods with lower error rates that can generate long and complex polynucleotides to reduce assembly steps, as well as a surface-based plasmid synthesis process to improve cloning efficiency and accuracy.

[0071] In some embodiments, provided herein is a method of enzymatic polynucleotide synthesis using an enzyme with template-independent polymerase activity to generate synthetic polynucleotides of desired length and sequence according to the embodiments described herein. In some embodiments, the steps for de novo enzymatic polynucleotide synthesis are performed by contacting a reaction surface comprising a bound synthesis initiator or starter oligonucleotide (which may also include previously added nucleotides) with an extension solution comprising a nucleotide of a specific identity and polymerase capable of adding the nucleotide to the starter oligonucleotide or extended version thereof.

[0072] In some embodiments, synthesis of a polynucleotide comprises adding blocked nucleotides stepwise to an oligonucleotide bound to the reaction surface on the element via the cycled steps of: addition of nucleotide comprising a blocking group (i.e., a blocked nucleotide) to a synthesis initiator or extended polynucleotide comprising previously added nucleotides, binding of the nucleotide to the end of the synthesis initiator or extended polynucleotide catalyzed by the polymerase, and removal of the blocking group from the nucleotide to allow addition of a subsequent nucleotide to the extended polynucleotide. These steps can be repeated until a desired polynucleotide sequence and length is synthesized.

[0073] The blocking group bound to the nucleotide (e.g., a polymerase or a reversible terminator) is a group capable of preventing addition of another nucleotide once the nucleotide has been added to the synthesis initiator or extended polynucleotide. After addition of the desired blocked nucleotide and removal of excess nucleotide during anextension cycle, the extended polynucleotide is immersed in a nucleotide deblocking solution capable of removing the blocking group from the nucleotide.

[0074] In some embodiments, the blocking group is the polymerase that catalyzes addition of the nucleotide to the surface-bound polynucleotide, wherein the polymerase is linked to the nucleotide (i.e., a nucleotide-polymerase conjugate). In this embodiment, the polymerase can sterically hinder addition of a subsequent nucleotide after addition of the blocked nucleotide to the polynucleotide. A monomer deblocking solution that removes the polymerase from the nucleotide can then be used to remove the blocking group, such as a linker cleavage solution.

[0075] In some embodiments, the present disclosure includes use of TdT with free nucleotides that have a 3' modification to enable single extensions. In some embodiments, the present disclosure also includes use of TdT with a tethered nucleotide (we call this polymerase-nucleotide conjugate). Linkage of the dNTP can occur via a tether to the nucleobase. In some embodiments, a nucleotide comprises an optionally substituted O-alkyl group. Additional tethered nucleotides can be found, e.g., in PCT Publication WO2017 / 223517 “Nucleic Acid Synthesis and Sequencing Using Tethered Nucleoside Triphosphates,” the entirety of which is incorporated by reference.

[0076] For RNA synthesis applications, tethered ribonucleoside triphosphates may be used. In these embodiments, a RNA specific nucleotidyl transferase, such as E. coli Poly(A) Polymerase (IUBMB EC 2.7.7.19) or Poly(U) Polymerase, among others, may be employed. The RNA nucleotidyl transferases can contain modifications, e.g., single point mutations, that influence the substrate specificity towards a specific rNTP (Lunde et al., Nucleic acids research 40.19 (2012): 9815-9824.). In some embodiments, a very short tether between an RNA nucleotidyl transferase and a ribonucleoside triphosphate may be used to induce a high effective concentration of the nucleoside triphosphate, thereby forcing incorporation of an rNTP that might not be the natural substrate of the nucleotidyl transferase.

[0077] In some embodiments, enzymatic template-independent synthesis of the synthetic polynucleotide (and / or portions of the plasmid backbone) using a nucleotide comprising a reversible terminator as a protecting group are performed, e.g., as set out in U.S. Pat. No. 8,808,989. A nucleotidyl transferase enzyme (e.g., terminal deoxynucleotidyl transferase) is used to incorporate nucleotide analogs having an unmodified 3' hydroxyl and a cleavable protecting group. Because of the protecting group, synthesis pauses with the addition of each new base, whereupon the protecting group is cleaved, leaving a polynucleotide that is essentially identical to a naturally occurring nucleotide (i.e., is recognized by the enzyme as asubstrate for further nucleotide addition). Thus, in certain examples, the disclosure includes methods in which oligonucleotides are produced by enzymatic reaction.

[0078] Nucleotide triphosphates (e.g., deoxynucleotide triphosphates) (NTPs) suitable for use with enzymatic oligonucleotide synthesis methods will have protecting groups that do not prevent the NTPs from being used by a nucleotidyl transferase as a substrate and can be efficiently removed to allow for addition to an oligonucleotide chain. Thus, in certain examples, the nucleotide addition occurs via enzymatic reaction. Further, in certain instances, all or part of the oligonucleotide synthesis reaction may be performed in aqueous solutions. In other instances, organic solvents will be used.

[0079] In some embodiments, the nucleotides analogs described herein comprise a reversible terminator group, such as such as an O-azidomethyl or O-NH2 group on the 3' position of the sugar or an (alpha-tertbutyl-2- nitrobenzyl)oxymethyl group on the 5 position of pyrimidines or the 7 position of 7- deazapurines (for an overview see, e.g. Chen et al., Genomics, Proteomics & Bioinformatics 2013 11: 34-40). In these embodiments, the nucleotide analog prevents or hinders further elongation once incorporated into a nucleic acid to achieve controlled termination of synthesis.

[0080] In any embodiment, the polymerase can be a template-independent polymerase, i.e., a terminal deoxynucleotidyl transferase or DNA nucleotidylexotransferase, which terms are used interchangeably to refer to an enzyme having activity 2.7.7.31 using the IUBMB nomenclature. A description of such enzymes can be found in Bollum, F J.

[0081] Any polymerase capable of extending a polynucleotide, incorporating a nucleotide into a polynucleotide, or incorporating a nucleotide analog into a polynucleotide is envisaged for use in the conjugates and methods described herein. In some embodiments, the polynucleotide is single stranded. In some embodiments, the polynucleotide is double stranded. In some embodiments, the polynucleotide is immobilized on a solid support.

[0082] Both the nucleotide addition and blocking group removal steps may be quenched by immersing the extended polynucleotide in an appropriate reaction quenching solution, such as EDTA. In addition, washing steps may be used between steps by immersing the extended polynucleotide in a wash buffer.

[0083] Preferably, the synthetic polynucleotide has a predefined sequence and length. As used herein, the term “predefined sequence” means that the sequence of the polynucleotide is known and chosen before synthesis or assembly of the polynucleotide.

[0084] Described in PCT Publication No. WO2017 / 223517, incorporated by reference in its entirety herein, is a typical process for the stepwise synthesis of a defined sequence usinga template-independent polymerase. A nucleic acid that serves as an initial substrate for elongation (i.e., "starter molecule") is incubated with a first polymerase-nucleotide conjugate. Once the nucleic acid has been elongated by the tethered nucleotide of a conjugate, no further elongations occur because the conjugates implement a termination mechanism. In the second step of the process, the linker is cleaved to release the polymerase and reverse the termination mechanism, thus enabling subsequent elongations. The elongation products are then exposed to the second conjugate, and these two steps are iterated to elongate the nucleic acid by a defined sequence. Also described in WO2017 / 223517 is a synthesis procedure using a conjugate comprising TdT and a photocleavable linker. As described above, other strategies are available for the attachment and cleavage of the linker.Surface / Solid Support

[0085] In some embodiments, the present disclosure provides a solid support (also referred to as a “surface” or “substrate”) having a functionalized surface with bound starter oligonucleotides for ligation of plasmid backbone components or for initiating synthesis of synthetic polynucleotides or plasmid backbone components. In some embodiments, the surface is functionalized to be capable of binding to starter oligonucleotide. For example, a starter oligonucleotide modified with a disulfide group can be covalently bound to a surface that has been modified with a thiol group (-SH). Other functional groups that are useful for binding oligonucleotides include amino groups (-NH2) and carboxyl groups (-COOH). In some embodiments, surfaces such as glass or silicon oxide can be functionalized with silanes such as aminopropyltrimethoxy silane (APTMS) and these can be used to covalently bind amine-modified oligonucleotides. In some embodiments, gold, silver, and titanium surfaces can be functionalized with thiol groups and can be used for immobilizing thiolated oligonucleotides to form a “self-assembled monolayers (SAM)”. In some embodiments, a functionalized surface is chemically or naturally charged like glass or silicon, where oligonucleotides can be adsorbed via electrostatic interactions. In some embodiments, surfaces such as glass or silicon oxide can be functionalized with silanes such as aminopropyltrimethoxy silane (APTMS) and these can be used to covalently bind amine- modified oligonucleotides.

[0086] A wide variety of substrates may be employed for creating synthesis surfaces / solid supports or elements for enzymatic synthesis of polynucleotides. Substrates may be a rigid material including, without limitation, glass; fused silica; silicon such as silicon dioxide or silicon nitride; metals such as gold or platinum; plastics such as polytetrafluoroethylene,polypropylene, polystyrene, polycarbonate, and any combination thereof. A rigid surface can be fabricated from a material selected from the group consisting of silicon, polystyrene, agarose, dextran, cellulosic polymers, polyacrylamides, polydimethylsiloxane (PDMS), and glass. Substrates may also comprise flexible materials, which is capable of being bent, folded or similarly manipulated without breakage. Exemplary flexible materials include, without limitation, nylon (unmodified nylon, modified nylon, clear nylon), nitrocellulose, polypropylene, polycarbonate, polyethylene, polyurethane, polystyrene, acetal, acrylic, acrylonitrile, butadiene styrene (ABS), polyester films such as polyethylene terephthalate, polymethyl methacrylate or other acrylics, polyvinyl chloride or other vinyl resin, transparent PVC foil, transparent foil for printers, Poly (methyl methacrylate) (PMMA), methacrylate copolymers, styrenic polymers, high refractive index polymers, fluorine-containing polymers, polyethersulfone, polyimides containing an alicyclic structure, rubber, fabric, metal foils, and any combination thereof.

[0087] Exemplary solid supports include, for example, slides, beads, chips, particles, strands, gels, sheets, tubing, spheres, containers, capillaries, pads, slices, films, plates, polymers, or a microfluidic device. Further, the solid supports may be biological, nonbiological, organic, inorganic, or combinations thereof. On supports that are substantially planar, the support may be physically separated into regions, for example, with trenches, grooves, wells, or chemical barriers (e.g., hydrophobic coatings, etc.). Supports may also comprise physically separated regions built into a surface, optionally spanning the entire width of the surface.Ligation / Annealing

[0088] In some embodiments, preparation of the plasmid template attached to the surface includes ligation of a plasmid backbone or a portion thereof to the starter oligonucleotide or to the 3' end of the synthetic polynucleotide. In some instances, the starter oligonucleotide and the plasmid backbone or portion thereof are at least partially complementary to each other to allow hybridization of the starter oligo to the plasmid backbone or portion thereof. In some instances, a plasmid backbone or portion thereof is capable is at least partially complementary to the sequence at the 3' end of the synthetic polynucleotide to allow hybridization of the synthetic polynucleotide to the plasmid backbone or portion thereof. A suitable enzyme for ligation can then be used to ligate the hybridized polynucleotide sequences. Hybridized polynucleotides can be joined via ligation, for example using a ligase, such as using phage T4 polynucleotide ligase.Release of plasmid template from surface

[0089] Once synthesis and / or assembly steps of the plasmid template bound to the surface have been completed, the resulting completed plasmid template is then cleaved from the solid support. By "cleavage" it is meant the breakage of the covalent backbone of a DNA molecule. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single- stranded cleavage and double- stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single- stranded cleavage events. DNA cleavage can result in the production of either blunt ends or staggered ends. In some embodiments, a complex including a guide RNA and a site- specific modifying enzyme is used for targeted doublestranded DNA cleavage. In some instances, oligonucleotides will be released from synthesis supports and then pooled as unbound nucleic acid molecules for subsequent purification, circularization, and / or transfection steps. In some embodiments, ligase is added to released plasmid templates to form a circularized plasmid.Cloning

[0090] The cloning methods of the present disclosure may be performed in vitro or in vivo. By in vitro and in vivo herein is meant cloning that is carried out outside of host cells (e.g., in cell-free systems, or in systems containing host cells in which the various cloning and recombination reaction(s) of the present disclosure take(s) place outside of the host cells) or inside of host cells (e.g., using recombination or other proteins expressed by host cells), respectively.

[0091] The terms "transfection", "transduction", "transfecting" or "transducing", “transformation” or “transforming” can be used interchangeably and are defined as a process of introducing a plasmid or plasmid template to a host cell. Exemplary non-viral transfection methods include calcium phosphate transfection, liposomal transfection, nucleofection, sonoporation, transfection through heat shock, magnetofection and electroporation.

[0092] As used herein, a "host" or “host cell” is any prokaryotic or eukaryotic organism that is a recipient of a replicable expression vector, cloning vector or any nucleic acid molecule. For examples of such hosts, see Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1982).

[0093] It is appreciated that multiplication of the host cell results in cloning of each of the polynucleotides. Verification of the identity and orientation of the cloned polynucleotides may be accomplished by standard methods, such as, e.g., restriction analysis or sequencing.Equivalents and Scope

[0094] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments in accordance with the present disclosure described herein. The scope of the present disclosure is not intended to be limited to the above Description, but rather is as set forth in the appended claims.

[0095] In the claims, articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The present disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The present disclosure includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.

[0096] It is also noted that the term “comprising” is intended to be open and permits but does not require the inclusion of additional elements or steps. When the term “comprising” is used herein, the term “consisting of’ is thus also encompassed and disclosed.

[0097] Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the present disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0098] All cited sources, for example, references, publications, databases, database entries, and art cited herein, are incorporated into this application by reference, even if not expressly stated in the citation. In case of conflicting statements of a cited source and the instant application, the statement in the instant application shall control.

[0099] Section and table headings are not intended to be limiting.EXAMPLES

[0100] Below are examples of specific embodiments for carrying out the present disclosure. The examples are offered for illustrative purposes only, and are not intended tolimit the scope of the present disclosure in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.

[0101] The practice of the present disclosure will employ, unless otherwise indicated, conventional methods of protein chemistry, biochemistry, recombinant DNA techniques and pharmacology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., T.E. Creighton, Proteins: Structures and Molecular Properties (W.H. Freeman and Company, 1993); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990); Carey and Sundberg Advanced Organic Chemistry 3rd Ed. (Plenum Press) Vols A and B(1992).Example 1 : Stepwise enzymatic template-independent synthesis of a synthetic polynucleotide using a plasmid backbone attached to a surface as a starter oligo

[0102] Described in this example is the generation of a plasmid template comprising a synthetic polynucleotide of desired length and sequence using a starter oligo attached to a surface that includes at least a portion of a plasmid backbone. This method generated a plasmid template that is capable of being circularized for replication in a host cell to generate several copies of the synthetic polynucleotide. Specifically, in this approach, a synthetic polynucleotide is directly synthesized at the end of a plasmid backbone polynucleotide attached to a surface, effectively using the plasmid backbone polynucleotide as the starter oligonucleotide for enzymatic synthesis of the synthetic polynucleotide.Preparation of plasmid backbone

[0103] First, a plasmid backbone with a special overhang, created by ligation of a fluorescent oligonucleotide to a digested vector, was prepared. The vector DNA (SEQ ID NO: 1) includes BstXI recognition sequences shown in bold and underlined.SEQ ID NO: 1: ACGCGTCGCGAGGCCATATGGGTTAACCCATGGCCAAGCTTGCATGCCATCCAA ATGGACACCCATATCCACTTTTGTGGCCTGCAGGTCGACTCTAGAGGATCCCGG GTACCGAGCTCGAATTCGGATATCCTCGAGACTAGTGGGCCCGTTTAAACACATG TGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGG AAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCC GCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCT CAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTT CAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA GACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGA GGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACA CTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAA AAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTT TTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATTTCAAAAGATCCTT TGATCTTTTCTACGTCAGTCCTGCTCCTCGGCCACGAAGTGCACGCAGTTGCCGG CCGGGTCGCGCAGGGCGAACTCCCGCCCCCACGGCTGCTCGCCGATCTCGGTCA TGGCCGGCCCGGAGGCGTCCCGGAAGTTCGTGGACACGACCTCCGACCACTCGG CGTACAGCTCGTCCAGGCCGCGCACCCACACCCAGGCCAGGGTGTTGTCCGGCA CCACCTGGTCCTGGACCGCGCTGATGAACAGGGTCACGTCGTCCCGGACCACAC CGGCGAAGTCGTCCTCCACGAAGTCCCGGGAGAACCCGAGCCGGTCGGTCCAGA ACTCGACCGCTCCGGCGACGTCGCGCGCGGTGAGCACCGGAACGGCACTGGTCA ACTTGGCCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGT CTCATGAGCGGATACATA

[0104] The vector DNA (5.2 mg) was added to a 50 ml tube. To the same tube, 5 ml 10X NEBuffer™ r3.1 (New England Biolabs, Ipswich, MA) was added, and the volume was adjusted to about 47 ml with pure water. To this solution, 1 ml of BstXI (R0113L, New England Biolabs, Ipswich, MA) was added and the volume adjusted to 50 ml using pure water. The reaction mixture was incubated overnight at 37°C.

[0105] The BstXI digestion reaction was split between two 50 ml tubes and 1.25 ml 10% SDS was added to each tube (0.5% final concentration). After mixing, the solutions were incubated at 80 °C for 10 min. After cooling, 12.5 ml of Buffer P3 (Qiagen, Louisville, KY) was added to each tube. The solutions were centrifuged at 20,000 g for 10 min to remove precipitated potassium dodecyl sulfate. The supernatants were combined and mixed with 300 ml of a 1 / 3 dilution of Buffer P3. The resulting solution was filtered (0.45 pm membrane filter). The filtrate was purified using a QIAGEN-tip 10000 from the QIAGEN Plasmid Giga Kit (Qiagen, Louisville, KY) by loading it onto the equilibrated column and following the rest of the standard purification protocol. The DNA pellet (4.45 mg) was dissolved in 3mlIDTE (pH 8) buffer. This purification step could be replaced by other purification protocols like phenol-chloroform extraction or agarose gel extraction, if desired.

[0106] A fluorescently labelled oligonucleotide (SEQ ID NO: 2) (IDT, Coralville, IA), was attached to the BstXI-digested vector by ligation.SEQ ID NO: 2:GTGTTGTCCTCATAGTTATTTTT / ideoxyU / GTCCGA / iFluorT / CCGGCTTCGTCCTCTTTCTTTT

[0107] The vector was ligated at approximately 200 ng / pl to a 10X excess of the fluorescently labelled oligonucleotide. The ligation reaction was set up as shown in Table 1 and incubated overnight at room temperature.Table 1: Setup for ligation reaction for linking vector and oligo

[0108] A large SeaKem Gold (Lonza Biologies, Hayward, CA) agarose gel (1 1, 1.5%) with four large wells was prepared using IX TAE buffer (Teknova, Hollister, CA). The ligation reaction (5 ml) was mixed with 1 ml of Gel Loading Dye, Purple (6X, New England Biolabs, Ipswich, MA) and loaded onto the gel in four 1.5 ml portions. After electrophoresis at 300 V for 90 min, the ligation product could be visualized using a blue light transilluminator because of the fluorescent label SEQ ID NO: 2. Gel pieces containing the DNA bands were cut out and the DNA placed in SnakeSkin™ Dialysis Tubing (Thermo Fisher Scientific, Carlsbad, CA) containing 50 ml TAE buffer. The DNA was recovered by electroelution at 300 V for 1 h. The buffer was removed from the dialysis tubing and filtered using a 0.2 pm syringe filter.

[0109] The filtered solution was split between two 50 ml tubes. To each tube, 8.5 ml Buffer P3 (Qiagen, Louisville, KY) was added. The samples were mixed with 25 ml of a 1 / 4 dilution of Buffer P3 in water. Each DNA solution was applied to an equilibrated QIAGEN- tip 500 from the QIAGEN Plasmid Maxi Kit (Qiagen, Louisville, KY) and the rest of the standard purification protocol was followed. The DNA pellets were dissolved in 300 pl of IDTE buffer, pH 8.0.Ligation of plasmid backbone to surface-bound oligonucleotides

[0110] This plasmid backbone comprising the DNA vector and fluorescently labelled oligonucleotide was then covalently ligated to an oligonucleotide attached to a surface (FIG. 1). As shown in FIG. 1, plasmid backbone DNA containing a short complementary sequence of the covalently attached fluorescently labelled oligo (SEQ ID NO: 2) is annealed and ligated to a surface-bound oligonucleotide (SEQ ID NO: 3) that has been covalently attached to the solid support.

[0111] For this approach, a solid support with covalently attached oligonucleotide (SEQ ID NO: 3) (IDT, Coralville, IA) was used.SEQ ID NO: 3 / 5Phos / GAAAGAGGACGAAGCCGGTCGGACAAAAAA / ideoxyU / AACTATGAGGACAACAC / 3 AmMO /

[0112] The plasmid backbone was diluted to 50 nM in TPP8 buffer (20 mM Tris acetate, 50 mM potassium acetate, and 0.05% Tween 20, pH 8.0) containing 10 mM magnesium chloride. The solid support was incubated in this solution for 15 min to allow the overhang of the fluorescently labelled oligo (SEQ ID NO: 2) ligated to the vector (SEQ ID NO: 1) to anneal to the surface-bound oligonucleotide (SEQ ID NO: 3). The solid support was then washed extensively with TPP8 buffer to remove unhybridized plasmid backbone DNA. To confine DNA synthesis to only one strand of the plasmid, the 3' end of the plasmid closest to surface-bound oligonucleotide was ligated to the 5' phosphate of the surface-bound oligonucleotide. This leaves only the 3' CCAA overhang on the other end of the plasmid backbone available for extension by template-independent enzymatic synthesis, as shown in FIG. 1.Enzymatic synthesis of a synthetic polynucleotide at the 3 ' end of the plasmid backbone

[0113] A synthetic polynucleotide of an intended length and sequence was then synthesized onto the surface-bound plasmid backbone at the free 3' end. The synthetic polynucleotide ended in >4 T residues for use in ligation to form a circular plasmid (the selection of these residues is arbitrary, and the system could be designed differently).

[0114] DNA extension was initiated by contacting the plasmid-backbone-modified solid support with one of four TdT linker-nucleotide conjugates, depending on the first base of the sequence to be synthesized. The reaction was quenched with EDTA, followed by the enzymatic removal of TdT with Proteinase K. The extended plasmid or starter DNA was then washed with TPP8 buffer preparing it for the next synthesis cycle. This procedure wasrepeated, using the appropriate TdT linker-nucleotide conjugate for each cycle, until each base of the desired DNA sequence was added. Finally, a polyT sequence was synthesized to allow plasmid circularization later in the workflow.Removal of plasmid template from the solid support surface

[0115] Removal of DNA from the surface by USER® Enzyme was performed to remove the DNA template (plasmid backbone plus synthetic polynucleotide) from the surface. The removal method leaves overhangs that are capable of hybridizing and being ligated to each other to circularize the DNA template (FIG. 2), forming a circular plasmid. FIG. 2 depicts removal of the plasmid template containing the synthesized product (synthetic polynucleotide) from the surface using USER® Enzyme cleavage.

[0116] Specifically, the plasmid template containing the plasmid backbone and synthetic polynucleotide was enzymatically removed from the surface using USER® Enzyme (New England Biolabs, Ipswich, MA) by incubating the solid support in 25 pl of USER® Enzyme reaction solution (2.5 pl of USER® Enzyme plus 22.5 pl IDTE buffer, pH 8.0) for 90 min at 37 °C and then at 50 °C for 10 min. Since the plasmid backbone and the surface-bound oligo each contain two strategically placed dU residues, USER® Enzyme treatment cleaves both strands of the DNA, releasing the plasmid DNA with an AAAAAA overhang (FIG. 2), which is capable of hybridizing to the polyT overhang at the 3' end of the synthetic polynucleotide.Plasmid Template Circularization

[0117] To circularize the released plasmid template, the six 3' terminal T nucleotides of the synthesized DNA are annealed to the six 3' terminal A nucleotides on the complementary strand of the plasmid backbone oligo. The two ends of the strand are then ligated together using T4 DNA Ligase (M0202T, New England Biolabs, Ipswich, MA) as shown in Table 2 to form a circularized plasmid. The ligation reaction was incubated at 16°C for 1.5 to 3 h. Table 2: T4 DNA Ligase reaction setupTransformation

[0118] Circularize plasmids containing the plasmid backbone and synthetic polynucleotide were used to transform 50 pl of NEB® 10-beta Competent E. coli (High Efficiency, NewEngland Biolabs, Ipswich, MA) following the manufacturer’s protocol. After outgrowth at 37 °C for 60 min, 100 to 1000 pl were plated out on Lysogeny Broth (Lennox) agar (1.5%) plates containing 25 pg / ml Zeocin™ (Thermo Eisher Scientific, Carlsbad, CA).DNA sequencing

[0119] Lor DNA sequencing, the colonies were scraped from the agar plates and DNA was isolated using the NucleoSpin Plasmid (NoLid), Mini kit (Macherey-Nagel Inc, Allentown, PA). Plasmid DNA was digested using BamHI-HL or Kpnl (New England Biolabs, Ipswich, MA), enzymes that cut the plasmid once but chosen to not cut the synthesized sequences, according to the manufacturer’s protocol. The digested DNA was cleaned up using magnetic beads supplied with PacBio sequencing kits and the DNA was sequenced using a PacBio sequencer. DNA originating from different colonies could be distinguished by the synthesized unique molecular identifier (UMI) since each molecule resulting in a colony has a unique identifier. Lor each synthesized sequence, the percentage of perfect molecules was determined by dividing the number of UMIs associated with perfect sequences by the total number of UMIs counted. Lor comparison to PCR, the synthetic polynucleotide was amplified (rather than directly cloned) using the primers 5' TCC GAT CAG GCT TCG TCT TCG TCG ACG TGG TGG AATT 3' and 5' CGC TCA CTT TTC GTG GAA GC 3'. The PCR products were sequenced, and the percentage of perfect molecules calculated, using the same approach as for the plasmid DNA. Lor data analysis, replicates (of four) with fewer than 20 unique UMIs sequenced were left out of the calculation, leaving at least three replicates in all cases.Example 2 - De novo polynucleotide synthesis on a surface and plasmid backbone attachment to synthesized polynucleotide on the surface

[0120] In this example, a plasmid backbone was ligated to an enzymatically synthesized polynucleotide to clone the synthetic polynucleotide without PCR amplification. While this procedure could be carried out in solution, performing it while the synthetic polynucleotide is still attached to the surface has the advantage that excess vector (plasmid backbone) and ligation components (like polyethylene glycol), that could interfere with subsequent steps, can be easily washed off the surface (FIG. 3).

[0121] Direct cloning by on- solid support ligation of a plasmid backbone is depicted in FIG. 3, which shows i) A de novo enzymatically synthesized polynucleotide of an intended length and sequence comprising >4 T residues at the 3' end. This is ligated to a cloningvector with a >4 A overhang at one 3' end, covalently linking the vector to the Ansamer. ii) After extensive washing, the DNA is eluted from the surface using 20 mM sodium hydroxide, iii) Q5 DNA Polymerase is used to convert the Ansamer to double- stranded DNA. iv) NEBuilder® HiFi DNA Assembly is used to circularize the vector before transformation.Attachment of the starter oligonucleotide to the solid support

[0122] A starter oligonucleotide (SEQ ID NO: 4) (IDT, Coralville, IA) is annealed to a surface-bound oligonucleotide (SEQ ID NO: 5) (IDT, Coralville, IA) covalently attached to a surface of a solid support. The solid support was incubated in a 25 nM solution of the starter oligo (SEQ ID NO: 4) in TPP8 buffer containing 10 mM magnesium chloride for 15 min.The solid support was then washed extensively with TPP8 buffer to remove unbound starter oligo s.

[0123] The starter oligonucleotide has the following sequence: / 56-FAM / GTGTTGTCCTCATAGTTTGAACAAGTCCGATCAGGCTTCGTCCTCTTTCTTTT ( SEQ ID NO : 4 )

[0124] The surface-bound oligonucleotide has the following sequence: +G+G+ACGAAGCCTGAT+CGGACTTGTTCAAA+CTATGAGGACAA+C+A+C / 3AmMO / ( SEQ ID NO : 5 )

[0125] This selection of covalently attached oligonucleotide and starter is arbitrary, and any suitable combination could be used for this approach.DNA Synthesis

[0126] DNA extension was initiated by contacting the starter-oligo bound solid support with one of four TdT linker-nucleotide conjugates, depending on the first base of the sequence to be synthesized. The reaction was quenched with EDTA, followed by the enzymatic removal of TdT with Proteinase K. The extended plasmid or starter DNA was then washed with TPP8 buffer preparing it for the next synthesis cycle. This procedure was repeated, using the appropriate TdT linker-nucleotide conjugate for each cycle, until each base of the desired DNA sequence was added. Finally, a polyT sequence was synthesized to allow plasmid circularization later in the workflow.Plasmid Backbone Design

[0127] The plasmid backbone (SEQ ID NO: 6) was designed based on the starter oligo, in this case SEQ ID NO: 4. One end of the plasmid backbone is complementary to the thirty 5'terminal bases of SEQ ID NO: 4. If a different starter oligo were to be used, the plasmid backbone would be modified so that the terminal bases on the plasmid backbone are complementary to the 5' end of the starter. While 30 bases of homology are used in the current design, overlaps as short as 12 bp and as long as 450 bp would be suitable (NEB, Gibson 2009). The sequence of the plasmid backbone used here is given below. The region that is complementary to the thirty 5' terminal bases of the starter oligo is in bold and underlined.

[0128] A stretch of polyT used for ligation (annealing to the polyA overhang on complementary strand of the plasmid template) is also in bold and underlined.SEQ ID NO: 6TTTTTTTTTTTTCACTGCCCTGCAGGTCGACTCTAGAGGATCCCGGGTACCGAGCTCGAATTCGGATATCCTCGAGACTAGTGGGCCCGTTTAAACACATGTGTTTTTCCATAGGCTCCGCCCCCCTGAC GAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCA GGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACC TGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGT TCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTG CGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAG CAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGG TGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTAC CTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTT TTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCT ACGTCAGTCCTGCTCCTCGGCCACGAAGTGCACGCAGTTGCCGGCCGGGTCGCGCAGGGCGAACT CCCGCCCCCACGGCTGCTCGCCGATCTCGGTCATGGCCGGCCCGGAGGCGTCCCGGAAGTTCGTG GACACGACCTCCGACCACTCGGCGTACAGCTCGTCCAGGCCGCGCACCCACACCCAGGCCAGGGT GTTGTCCGGCACCACCTGGTCCTGGACCGCGCTGATGAACAGGGTCACGTCGTCCCGGACCACAC CGGCGAAGTCGTCCTCCACGAAGTCCCGGGAGAACCCGAGCCGGTCGGTCCAGAACTCGACCGCT CCGGCGACGTCGCGCGCGGTGAGCACCGGAACGGCACTGGTCAACTTGGCCATACTCTTCCTTTT TCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATAACGCGTCGCGAGG CCATATGGGTTAACCCATGGCCAAGCTTGCATGGTGTTGTCCTCATAGTTTGAACAAGTCCGAPlasmid. Backbone Preparation

[0129] The plasmid backbone is currently prepared by polymerase chain reaction (PCR). For this, a suitable template for PCR amplification is used. We currently use a template vector as a plasmid backbone (SEQ ID NO: 7) that had been digested by BsaI-HF®v2 and BstXI (restriction sites are indicated in bold and underlined). The undigested vector or any other digested version with suitable primer binding sites could also be used.SEQ ID NO: 7ACGCGTCGCGAGGCCATATGGGTTAACCCATGGCCAAGCTTGCATGGGTCTCACACTATCGGCCT ATCCACTTTTGTGGCCTGCAGGTCGACTCTAGAGGATCCCGGGTACCGAGCTCGAATTCGGATAT CCTCGAGACTAGTGGGCCCGTTTAAACACATGTGTTTTTCCATAGGCTCCGCCCCCCTGACGAGC ATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGTCAGTCCTGCTCCTCGGCCACGAAGTGCACGCAGTTGCCGGCCGGGTCGCGCAGGGCGAACTCCCGCCCCCACGGCTGCTCGCCGATCTCGGTCATGGCCGGCCCGGAGGCGTCCCGGAAGTTCGTGGACACGACCTCCGACCACTCGGCGTACAGCTCGTCCAGGCCGCGCACCCACACCCAGGCCAGGGTGTTGTCCGGCACCACCTGGTCCTGGACCGCGCTGATGAACAGGGTCACGTCGTCCCGGACCACACCGGCGAAGTCGTCCTCCACGAAGTCCCGGGAGAACCCGAGCCGGTCGGTCCAGAACTCGACCGCTCCGGCGACGTCGCGCGCGGTGAGCACCGGAACGGCACTGGTCAACTTGGCCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATAPrimer 1 (SEQ ID NO: 8)TTTTT / ideoxyU / TTTTT / ideoxyU / CACTGCCCTGCAGGTCGACTCTAGAGGAPrimer 2 (SEQ ID NO: 9)TCGGACTTGTTCAAACTATGAGGACAACACCATGCAAGCTTGGCCATGGG

[0130] The PCR setup is shown in Table 3.Table 3. PCR setup for cloning plasmid backbone preparation00131] Multiple reactions (lOOx) are set up at once, to prepare a large batch of plasmid backbone. The reaction solution is split into 50 pl reaction volumes in PCR tubes (96x). Thermocycling conditions were as follows:1 98 °C 30 seconds2 98 °C 10 seconds3 72 °C 60 seconds4 go to 2 for 34 cycles5 72 °C 10 min6 12 °C hold

[0132] After thermocycling, the reactions were pooled and 1 volume phenol-chloroform- isoamyl alcohol (Invitrogen 15593-031) was added. The mixture was vortexed vigorously for1 min and centrifuged at 16,000 g for 20 min. The upper aqueous phase was transferred to a new tube and 1 / 10 volume 50 pl 3 M sodium acetate, pH 5.2 was added. Two volumes ethanol were added. After centrifugation at 16,000 g for 20 min, the supernatant was discarded. The pellet was washed twice using two volumes 70% ethanol. The DNA pellet was air dried and dissolved in 0.3 volume of IDTE buffer, pH 8.0 (IDT, Coralville, IA). The DNA solution (1500 pl, 657 ng / pl) was treated with USER and Dpnl (both from New England Biolabs, Ipswich, MA) as shown in Table 4. The reaction was incubated at 37 °C for 48 h to ensure complete digestion, but a much shorter digestion would suffice and could be set up according to the manufacturer’s guidelines.Table 4: Dpnl and USER digestion of the PCR product

[0133] While further purification of the plasmid backbone is optional, it was purified by anion exchange chromatography as follows. After incubation, the reaction was split into two 1 ml portions and 50 pl 10% SDS (0.5% final) was added to each. The samples were heated to 80°C for 10 min. After cooling to room temperature, 0.5 ml (1 / 2 vol) buffer P3 (Qiagen, Louisville, KY) was added to each tube, and the samples centrifuged at 16,000 g for 10 min. Each supernatant was diluted using 20 ml of 30% Buffer P3 in water and filtered (0.45 pm membrane). The filtered samples were each purified using one QIAGEN-tip 500 from the QIAGEN Plasmid Maxi Kit (Qiagen, Louisville, KY) according to the manufacturer’s instructions, starting by loading the filtered solution onto the equilibrated column and following the normal protocol for washing, elution, and precipitation. This purification step is optional and could also be replaced by other purification protocols like phenol-chloroform extraction or agarose gel extraction, if desired.

[0134] The Dpnl digestion serves to remove template vector while the USER cleavage generates a 3' overhang consisting of 12 A bases, by excision of the dU bases introduced by Primer 1. Note that other configurations of Primer 1 would also work. Any number of the corresponding T bases could be replaced by dU, as long as the T at the 3' of the homopolymer is replaced by a U, allowing the entire A homopolymer on the complimentary strand to be exposed. The number of bases in the polyA overhang was arbitrarily chosen tobe 12, but overhangs of different lengths could also be used, as long as the duplex resulting from hybridization is a good substrate for the DNA ligase used (Quick ligase in this particular experiment). While the overhang could be as short as 4 bases, ligation would be inefficient, and the overhang should preferably be at least six to eight bases long.Solid Support-Bound Ligation Workflow

[0135] After enzymatic synthesis of the synthetic polynucleotide on the starter oligo, the solid support is stored in IX TPP8 (overnight) or IDT Duplex buffer containing 1 mM EDTA (long-term storage). Before cloning, the solid support is rinsed twice in 10 mM magnesium sulfate. Ligation reactions to ligate the plasmid backbone to the synthetic polynucleotide are set up according to Table 5. The final plasmid backbone concentration used for ligation is 65 nM (51 ng / pl), but this concentration could span a broad range from pg / pl to pg / pl values, depending on ligation conditions.Table 5: On- solid support ligation reaction setup

[0136] The rinsed solid support was placed in the ice-cold ligation solution in conical 384- well plates, on ice, and incubated for 5 min. Other plates could be used if the ligation reaction volume is scaled up sufficiently to cover the surface exposed during DNA synthesis, ensuring that all synthesized DNA is ligated. The plate containing the solid support is then incubated at room temperature for 3 h, although shorter or longer incubations could also be used, depending on the ligation system used and the manufacturer’s suggestions. After ligation, the solid support was washed 14 times in 60 pl (in wells of a 384-well plate) of a wash buffer containing 50 mM borate, pH 9.5, and 2 M sodium chloride. While other wash buffers could be used, this one was selected because the high pH and salt concentration should help wash off any nonspecifically bound DNA. Any other wash buffer with these properties could be used. To remove the salt, the solid support was subsequently washed four times in 50 pl IDTE buffer, pH 8.0. The solid support was then incubated in 25 pl (conical 384-well plate) of 20 mM sodium hydroxide solution for 15 min. Other plates could be used, as long as the volume is adjusted to cover the surface exposed during DNA synthesis. Similarly, incubation time could be longer or shorter, as long as elution of the DNA is confirmed (e.g., byfluorometry or capillary electrophoresis). At this stage DNA can be stored on ice or frozen until it is possible to proceed with the assembly reaction.Plasmid Template Circularization

[0137] The basic strategy involves two steps. First, the single-stranded part of the plasmid template (the synthetic polynucleotide) was converted to double- stranded DNA by a fill in reaction using a DNA polymerase. In the second step, the resulting double- stranded DNA was circularized using a strategy like Gibson assembly.

[0138] Single- stranded portions of plasmid template were filled in using Q5 DNA Polymerase (New England Biolabs, Ipswich, MA), although another DNA polymerase could be used for this step. If the buffer of an alternative polymerase, or the polymerase itself, is incompatible with the subsequent assembly step, an intermediate DNA purification step could be introduced.

[0139] The reannealed DNA solution was mixed with a 2X Q5 DNA Polymerase master mix as shown in Table 6. DNA samples (5 pl) were mixed with 5 pl 2X master mix (prepared from a 5X buffer) and incubated at 72 °C for 30 min and then place on ice until the assembly reactions were performed.Table 6: Setup of the Q5 DNA polymerase fill in reactions

[0140] For the circularization step, the NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA) was used. A master mix was set up as shown in Table 7 and 2 pl of the Q5 DNA Polymerase fill in product was combined with 8 pl of the master mix (Table 8), followed by incubation at 50 °C for 30 min.Table 7: Setup of the HiFi DNA Assembly master mix used for circularizationTable 8: Setup of the final assembly reaction

[0141] After the NEBuilder® HiFi DNA Assembly reaction was completed, DNA was stored on ice until DNA transformation into Escherichia coli. Assembly reactions (2 pl) were used to transform 50 pl of NEB® 10-beta Competent E. coli (High Efficiency, New England Biolabs, Ipswich, MA) following the manufacturer’s protocol. After outgrowth at 37 °C for 60 min (could be extended to 90 min), 100 to 1000 pl were plated out on Lysogeny Broth (Lennox) agar (1.5%) plates containing 25 pg / ml Zeocin™ (Thermo Fisher Scientific, Carlsbad, CA).DNA Sequencing

[0142] Colonies were scraped from the agar plates and sequenced for determination of the percentage of perfect sequences as described under Example 1.Results

[0143] The proportion of sequence-perfect molecules obtained via PCR amplification of synthetic polynucleotides was compared to direct cloning of synthetic polynucleotides (on- surface preparation of plasmid template, release, and circularization) (both approaches combined and averaged) for several synthetic polynucleotide sequences. The percentage of perfect molecules for PCR and the percentage of perfect clones (representing single molecules) for direct cloning are compared. The data plotted are averages and standard deviations calculated from four replicates, except in cases where one replicate was left out because fewer than 20 UMIs were counted.

[0144] The data from this comparison was used to generate FIG. 4, which is a comparison of PCR to direct cloning (both approaches combined and averaged) for a selection of sequences, based on the number of colonies that would need to be picked for a 95% chance of picking a perfect clone based on the proportion of sequence-perfect synthetic polynucleotides in a host cell transformation mixture.

[0145] These data evidence that the methodologies described in detail herein are capable of generating a higher proportion of perfect clones for amplifying synthesized polynucleotides, thus increasing the efficiency of preparing a de novo synthesized sequence for downstream usage.Example 3 - Linear Plasmids

[0146] In this approach, a plasmid template to generate a single- stranded circular plasmid comprising a synthetic polynucleotide for cloning will be prepared while attached to a surface (direct plasmid synthesis).

[0147] Typically, bacterial plasmids are composed of circular double stranded DNA. However, some plasmids suitable for cloning synthetic polynucleotide sequences exist as single stranded plasmids that comprise a single polynucleotide, typically with at least two hairpins and a complementary region. Examples of these are provide in PCT Publication W02010 / 086626 and US Patent Publication US 9,765,343, incorporated herein by reference. Such single-stranded plasmids can be prepared by first preparing a linear double-stranded template plasmid (which may already have a hairpin at one end), and then enzymatically joining at least one 5' and 3' end to form a hairpin. This can be performed at one or both ends of the linear template plasmid.

[0148] For example, a template plasmid that is composed of linear double stranded DNA can have both ends sealed by a four-base tetraloop telomere structure. To construct this telomere, a 56 base pair double- stranded DNA sequence motif at each end is treated with the enzyme TelN, which cuts the DNA at the center of the motif and leaves covalently closed telomeric ends. The linear double- stranded plasmid template can also already be prepared with a hairpin at one end, so that only one site remains to be covalently closed to form the single- stranded circular plasmid.

[0149] Prior methods to replicate synthetic polynucleotide in a single-stranded linear plasmid have been performed in solution, and include inserting a desired polynucleotide sequence to be cloned in a single-stranded plasmid backbone. However, these methods generally require prior amplification of the synthetic polynucleotide to provide enough to generate a significant number of assembled single- stranded plasmids including the synthetic polynucleotide. Here, we describe a method to prepare single-stranded plasmids comprising a synthetic polynucleotide by performing de novo enzymatic synthesis of the synthetic polynucleotide in combination with ligation or synthesis of the single- stranded plasmid template directly on a surface.

[0150] As describe in Examples 1 and 2, a surface comprising surface-bound starter oligonucleotides will be prepared. The surface-bound starter oligonucleotides will comprise a portion of a plasmid backbone. This portion of the plasmid backbone can contain a telomerase recognition site. Stepwise de novo template-independent enzymatic synthesis of asynthetic polynucleotide will then be performed starting at the 3' end of the portion of the plasmid backbone.

[0151] In addition or as an alternative, another portion of the plasmid backbone will be ligated to the synthetic polynucleotide. This portion of the plasmid backbone can contain a telomerase recognition site.

[0152] Alternatively, any portion of the plasmid backbone can be enzymatically synthesized on a surface-bound starter oligonucleotide along with the synthetic polynucleotide.

[0153] After completion of synthesis and / or ligation steps to form a single-stranded plasmid template attached to the surface, the plasmid template will then be released from the surface to generate a released single-stranded plasmid template comprising a synthetic polynucleotide and plasmid backbone comprising at least one telomerase recognition site. The released single- stranded plasmid template can be circularized by exposure to a telomerase to generate a hairpin connecting one or more 5' or 3' ends of the plasmid template to form a circularized single- stranded plasmid.

[0154] The single-stranded plasmid template can be exposed to a telomerase in vitro, or can be directly inserted into a host cell comprising telomerase activity. If performed in vitro, the circularized single-stranded plasmid will then be inserted into a host cell suitable for cloning the single- stranded plasmid comprising the synthetic polynucleotide.

[0155] As in Examples 1 and 2, performing direct synthesis of the single-stranded plasmid template on a surface, followed by subsequent, release of the plasmid template, circularization, and propagation in a host cell, will result in a higher proportion of host cells comprising plasmids with sequence perfect synthetic polynucleotides, improving the cost and efficiency of synthetic polynucleotide cloning.OTHER EMBODIMENTS

[0156] It is to be understood that the words which have been used are words of description rather than limitation, and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the present disclosure in its broader aspects.

[0157] While the present disclosure has been described at some length and with some particularity with respect to the several described embodiments, it is not intended that it should be limited to any such particulars or embodiments or any particular embodiment, but it is to be construed with references to the appended claims so as to provide the broadestpossible interpretation of such claims in view of the prior art and, therefore, to effectively encompass the intended scope of the present disclosure.

[0158] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, section headings, the materials, methods, and examples are illustrative only and not intended to be limiting.

Claims

CLAIMS1. A method of preparing a plasmid template on a solid support, the method comprising providing a solid support comprising a plurality of starter oligonucleotides attached to the surface of the solid support and comprising a free 3' end; performing a stepwise enzymatic template-free polynucleotide synthesis to generate a synthetic polynucleotide intended to comprise a predefined sequence for cloning at the free 3' end of each of the plurality of starter oligonucleotides, wherein; each of the plurality of starter oligonucleotides comprises at least a portion of a plasmid backbone, or the method further comprises attaching at least a portion of a plasmid backbone to the 3' end of the synthetic polynucleotide, or the method further comprises performing a stepwise enzymatic template-free polynucleotide synthesis to generate at least a portion of a plasmid backbone at the 3' end of the starter oligonucleotide or at the 3' end of the synthetic polynucleotide; and wherein the at least a portion of the plasmid backbone comprises a selectable marker; and releasing the plasmid template comprising the synthetic polynucleotide and the at least a portion of the plasmid backbone from the surface, wherein the released plasmid template is capable of being circularized to form a circular plasmid comprising the synthetic polynucleotide and the plasmid backbone.

2. The method of claim 1, further comprising circularizing the released plasmid template to form a circular plasmid.

3. The method of claim 2, further comprising inserting the circular plasmid into a host cell suitable for plasmid replication.

4. The method of claim 1, further comprising inserting the released plasmid template into a host cell suitable for circularization of the plasmid template to form a circular plasmid and plasmid replication.

5. The method of claim 1, wherein each terminus of the released plasmid template is hybridized to regions on a complementary oligonucleotide.

6. The method of claim 5, further comprising circularizing the released plasmid template by ligating the 5' and 3' terminus to form a circular plasmid.

7. The method of claim 5 or 6, further comprising performing a template-dependent extension of the complementary oligonucleotide to form a double- stranded circular plasmid.

8. The method any one of claims 5-7, further comprising inserting the circular plasmid into a host suitable for plasmid replication.

9. The method of claim 1, wherein the region adjacent to the 5' or to the 3' terminus of the released plasmid template comprises a telomerase recognition sequence.

10. The method of claim 9, further comprising inserting the plasmid template into a host comprising telomerase activity and suitable for replicating a single-stranded circular plasmid.

11. The method of claim 9, further comprising circularizing the released plasmid template by exposing the released plasmid template to a telomerase to generate a hairpin loop at the 5' terminus or at the 3' terminus and to form a single-stranded circular plasmid.

12. The method of claim 11, further comprising inserting the single-stranded circular plasmid into a host cell suitable for plasmid replication.

13. The method of any one of claims 1-12, wherein the plurality of oligonucleotides attached to the surface of the solid support each have only one free 3' end.

14. The method of any one of above claims, wherein the synthetic polynucleotide has not been amplified or replicated before insertion into the host cell.

15. The method of any one of the above claims, wherein said stepwise enzymatic template-free polynucleotide synthesis comprises stepwise coupling of a nucleotide comprising a protecting group to said free 3' end.

16. The method of claim 15, wherein said coupling is catalyzed by a polymerase.

17. The method of claim 16, wherein said polymerase is a template-independent polymerase.

18. The method of claim 17, wherein said template-independent polymerase is Terminal deoxynucleotidyl Transferase (TdT), or a variant thereof.

19. The method of claim 16, wherein said polymerase is an RNA polymerase.

20. The method of any one of claims 16-19, wherein said polymerase is covalently linked to said nucleotide.

21. The method of claim 20, wherein said protecting group comprises said polymerase covalently linked to said nucleotide.

22. The method of any one of claims 16-19, wherein said protecting group is a polymerase, and wherein the polymerase is linked to the nucleotide via a cleavable linker.

23. The method of claim 22, wherein a cycle of said stepwise enzymatic synthesis comprises cleaving the linker attaching said nucleotide to said polymerase.

24. The method of claim 22 or 23, wherein the cleavable linker is bound to the alpha-phosphate, sugar, or nucleobase of the nucleotide.

25. The method of claim 15 or 16, wherein the protecting group is a reversible terminator.

26. The method of claim 25, wherein a cycle of said stepwise enzymatic synthesis comprises removing said reversible terminator from said nucleotide.

27. The method of claim 26, wherein said protecting group is a 3'-O-blocking group.

28. The method of claim 27, wherein said enzymatic synthesis further comprises removing said 3'-O-blocking group from said nucleotide to leave a free 3' hydroxyl group.

29. The method of claim 26, wherein the protecting group is a 2' or 3' modification of the nucleotide.

30. The method of claim 29, wherein the 2' modification is selected from the group consisting of -H, -OH, -F, -OMe, -N3, -NH2, and -Ara.

31. The method of claim 29, wherein the 3' modification is selected from the group consisting of: -H, -OH, -OCH2N3, -ONH2, -Oallyl and phosphate.

32. The method of any one of claims 16-31, wherein said coupling comprises contacting said free 3' end with a solution comprising said nucleotide and said polymerase.

33. The method of any of the above claims, wherein the at least a portion of the plasmid backbone comprises an origin of replication.

34. The method of any of the above claims, wherein the at least a portion of the plasmid backbone comprises a selectable marker.

35. The method of any of the above claims, wherein the starter oligonucleotides comprise a single- stranded region at the 3' end.

36. The method of any of the above claims, wherein the starter oligonucleotide is hybridized to an oligonucleotide bound to the solid support.

37. A surface comprising a plurality of polynucleotides attached to the surface, each polynucleotide comprising a plasmid template comprising: at least a portion of a plasmid backbone comprising a selectable marker; and a synthetic polynucleotide synthesized by stepwise template-independent enzymatic synthesis; wherein the plasmid template, when released form the surface is capable of forming a circularized plasmid comprising a plasmid backbone and the synthetic polynucleotide.

Citation Information

Patent Citations

  • Methods for generating pools of variants of a DNA template

    US11274295B2

  • Compositions and methods for template-free geometric enzymatic nucleic acid synthesis

    US20210087600A1

  • Method of DNA synthesis

    US20220127667A1

  • Vectors for gene delivery that persist within cells

    WO2019246544A2

  • METHODS FOR RAPID cDNA PRODUCTION AND CLONING

    WO2021037368A1