Novel double-stranded RNA based on app RNA sequence, and use thereof

Abstract

Disclosed is a double-stranded RNA that has a first strand and a second strand complementary to the first strand. The first strand has: a main sequence which comprises 19-23 nucleotides and in which the nucleotide at the 5'-end is guanine (G) or cytosine (C); and an additional sequence which comprises 2-4 nucleotides and is added to the 3'-end side of the main sequence. The main sequence comprises a portion of a nucleotide sequence encoding an amyloid precursor protein, wherein the portion includes at least a portion of a nucleotide sequence encoding a signal peptide region of the amyloid precursor protein.

Description

Novel double-stranded RNA based on APP RNA sequence and its use

[0001] The present disclosure relates to double-stranded RNA, compositions containing the double-stranded RNA, and methods of using the same. Specifically, the present disclosure relates to double-stranded RNA used to suppress or inhibit tumor cell growth or metastasis, and compositions comprising the double-stranded RNA. This application claims priority to Japanese Patent Application No. 2024-008379, filed January 24, 2024, the entire contents of which are incorporated herein by reference.

[0002] Amyloid precursor protein (or amyloid β precursor protein, hereinafter also referred to as "APP") is a type of membrane protein expressed in many tissues. APP has a variety of functions, such as neuronal formation and signal transduction. APP may normally play an important role in the growth and repair of various cells.

[0003] However, APP is known to be involved in Alzheimer's disease dementia. APP is degraded by various secretases to produce amyloid β and other compounds. The accumulation of amyloid β is known to cause Alzheimer's disease and also promote cell proliferation and angiogenesis. Therefore, attempts have been made to control APP gene expression. For example, JP-A-2022-515193 discloses a double-stranded ribonucleic acid drug targeting the APP gene. In addition to the above, WO 2012 / 093732 discloses an antibody targeting the signal peptide region of APP.

[0004] APP has also been suggested to be involved in the proliferation and invasion of tumor cells. For example, APP is known to be overexpressed in breast cancer and prostate cancer.

[0005] JP 2022-515193 A International Publication No. 2012 / 093732

[0006] Meanwhile, there is a need to inhibit or treat the progression of intractable diseases such as cancer and Alzheimer's disease at an early stage. Therefore, there is a need for a technology that can more effectively inhibit the expression of the APP gene. The inventors focused on the signal peptide region of APP and conducted extensive research. Antibody drugs such as those disclosed in WO 2012 / 093732 are expensive and it is difficult to maintain consistent quality. On the other hand, nucleic acid drugs can be mass-produced by organic synthesis, making it easy to control the consistency of quality.

[0007] A main object of the present disclosure is to provide a technique for suppressing or inhibiting cell proliferation in which APP gene expression is involved.

[0008] The double-stranded RNA disclosed herein comprises a first strand and a second strand complementary to the first strand. The first strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence. Here, the main sequence is a part of a base sequence encoding an amyloid precursor protein, and includes at least a part of a base sequence encoding a signal peptide region of the amyloid precursor protein.

[0009] The double-stranded RNA can function as at least small interfering RNA (siRNA). That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). This effect is due to the suppression of at least the expression of amyloid precursor protein, thereby inhibiting the proliferation of cells in which APP is involved.

[0010] In one embodiment of the double-stranded RNA disclosed herein, the second strand has a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the complementary main sequence. Such double-stranded RNA can function favorably as an siRNA. This allows for more reliable inhibition of APP-mediated cell proliferation.

[0011] In one embodiment of the double-stranded RNA disclosed herein, at least three of the seven bases on the 3'-end of the main sequence are adenine (A) and / or uracil (U), thereby more fully suppressing APP expression and inhibiting APP-mediated cell proliferation.

[0012] In one embodiment of the double-stranded RNA disclosed herein, the base sequence comprising at least a portion of the base sequence encoding the signal peptide region of APP consists of any of the following base sequences: GCTGGAGGTACCCACTGAT (SEQ ID NO: 1); GCGCTGGAGGTACCCACTGAT (SEQ ID NO: 2); CCGGTTTGGCACTGCTCCT (SEQ ID NO: 11); GTTTGGCACTGCTCCTGCT (SEQ ID NO: 12); GGCGCTGGAGGTACCCACT (SEQ ID NO: 13); GGCGCTGGAGGTACCCACTGA (SEQ ID NO: 14); and CGCTGGAGGTACCCACTGA (SEQ ID NO: 15). Such double-stranded RNA more specifically suppresses the expression of amyloid precursor protein, thereby inhibiting the proliferation of cells with increased APP expression.

[0013] In one embodiment of the double-stranded RNA disclosed herein, the base sequence constituting the additional sequence is thymine-thymine (TT), which can improve the stability of the double-stranded RNA.

[0014] The present disclosure provides a composition capable of inhibiting the proliferation of at least one type of cell. One embodiment of the composition disclosed herein comprises a first strand and a second strand complementary to the first strand, the first strand having a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence. Here, the main sequence comprises a portion of a base sequence encoding an amyloid precursor protein, including double-stranded RNA containing at least a portion of a base sequence encoding the signal peptide region of the amyloid precursor protein. When supplied to cells, such a composition inhibits the proliferation of cells in which APP is involved, by suppressing the expression of at least amyloid precursor protein.

[0015] In one embodiment of the composition disclosed herein, the cell type whose proliferation is inhibited by the composition is tumor cells, thereby enabling more reliable inhibition of cell proliferation.

[0016] One embodiment of the composition disclosed herein comprises a peptide fragment having cell membrane permeability that allows a foreign substance to be introduced into the cytoplasm by passing through the cell membrane from the outside of the cell, thereby facilitating the introduction of double-stranded RNA into a target cell.

[0017] The present disclosure provides a method for inhibiting the proliferation of at least one type of cell. One aspect of the method disclosed herein comprises the steps of (1) preparing a composition disclosed herein and (2) supplying the composition to a target cell in vitro. This allows for the inhibition of APP-mediated cell proliferation.

[0018] In one embodiment of the method disclosed herein, the biological species of the cells is the same as the biological species containing APP, thereby making it possible to more reliably inhibit the proliferation of cells in which APP is involved.

[0019] 1 is a schematic diagram showing the human APP gene and its signal peptide region; 2 is a graph showing the cell viability of neuroblastoma cells in Samples 1 and 2 and a Comparative Example; 3 is a graph showing the cell viability of neuroblastoma cells at different addition amounts for Samples 1 and 2 and a Comparative Example; 4 is a graph showing the cell viability of neuroblastoma cells in Samples 3 to 7 and a Comparative Example.

[0020] <Definition of Terms> The technology disclosed herein is described in detail below. Matters other than those specifically mentioned in this specification (e.g., the structure of double-stranded RNA) that are necessary for implementing this technology (e.g., general matters such as methods for synthesizing polynucleotides, cell culture techniques, and constructs mainly composed of peptides or nucleic acids) can be understood as design matters of a person skilled in the art based on conventional technology in the fields of cell engineering, physiology, medicine, pharmacology, organic chemistry, biochemistry, genetic engineering, protein engineering, molecular biology, genetics, etc. The technology disclosed herein can be implemented based on the content disclosed in this specification and common general technical knowledge in the relevant field.

[0021] As used herein, the term "polynucleotide" refers to a polymer in which multiple (two or more) nucleotides are linked by phosphodiester bonds, and is not limited by the number of nucleotides. For example, a "polynucleotide" herein also encompasses those containing both deoxyribonucleotides and nucleotides. Furthermore, as used herein, the term "artificially designed polynucleotide" refers to a polynucleotide whose nucleotide chain (full length) does not exist alone in nature, but is artificially synthesized by chemical synthesis or biosynthesis (i.e., production based on genetic engineering).

[0022] As used herein, the terms "first strand" and "second strand" refer to one being a sense strand (or coding strand or passenger strand) and the other being an antisense strand (or template strand or non-coding strand or guide strand). That is, if the first strand is a sense strand, the second strand refers to an antisense strand. Also, if the second strand is a sense strand, the first strand refers to an antisense strand. The first strand and the second strand may be completely complementary to each other, or may be at least partially complementary. That is, they may be capable of hybridizing at least under physiological conditions.

[0023] In the present specification, unless the notation "5'" and "3'" is used, the left side of a base sequence always indicates the 5'-terminal side and the right side indicates the 3'-terminal side. Furthermore, in the present specification, the term "amino acid residue" includes the N-terminal amino acid and the C-terminal amino acid of a peptide chain, unless otherwise specified. Furthermore, in the amino acid sequences described in the present specification, the left side always indicates the N-terminal side and the right side indicates the C-terminal side.

[0024] As used herein, the term "tumor" is broadly interpreted and refers to tumors in general (typically malignant tumors), including carcinomas and sarcomas, as well as lesions of the blood or hematopoietic tissues (leukemia, lymphoma, etc.). Furthermore, "tumor cells" are synonymous with "cancer cells," and refer to cells that form such tumors, typically cells that have reached the stage of abnormal proliferation independent of surrounding normal tissues (so-called cancerous cells). Therefore, unless otherwise specified, any cell that is classified as a tumor cell (cancer cell) rather than a normal cell is referred to as a tumor cell, regardless of its origin or properties.

[0025] In this specification, when a numerical range is described as "A to B (where A and B are any numerical values)," it means "A or more and B or less," and also encompasses the meanings of "greater than A and less than B," "greater than A and B or less," and "greater than A and less than B."

[0026] <Amyloid precursor protein> In this specification, "amyloid precursor protein" is also referred to as amyloid β precursor protein or APP. However, this term is intended to encompass all synonyms, including naturally occurring amyloid precursor protein and its variants. The biological species from which the amyloid precursor protein is derived is not particularly limited. However, it is preferably the same as the animal species to which the double-stranded RNA or composition disclosed herein is to be delivered. For example, when delivering the double-stranded RNA or composition disclosed herein to human-derived cells, it is preferable to use a base sequence based on the base sequence of human amyloid precursor protein as the main sequence. Note that human-derived amyloid precursor protein is described as a preferred example. However, the present technology can also be applied to amyloid precursor proteins derived from biological species, including mammals other than humans and other animal species.

[0027] APP is known to be involved in Alzheimer's disease and various other diseases and disorders. It has also been suggested that APP is overexpressed in tumor cells. In addition to the aforementioned Alzheimer's disease, APP is also involved in Down's syndrome, amyloidosis, rheumatoid arthritis, neurodegenerative diseases, cancer, and other cancers. APP has also been suggested to be involved in cancers such as prostate cancer, breast cancer, colon cancer, thyroid cancer, lung cancer, nasopharyngeal cancer, gastrointestinal cancer, and leukemia. APP is also involved in inflammatory responses and cell death, as well as the proliferation, migration, and infiltration of abnormal cells associated with these diseases and disorders. Specifically, it has been suggested that APP expression is increased in cells associated with the above-mentioned diseases and disorders. In other words, the double-stranded RNA and compositions disclosed herein can act favorably on cells in which APP expression levels are increased due to the above-mentioned diseases and disorders, and inhibit their proliferation.

[0028] <Signal Peptide Region> The nucleotide sequence of APP can be obtained from international databases. For example, international databases include NCBI (National Center for Biotechnology Information), ENA (European Nucleotide Archive), DDBJ (DNA Data Bank of Japan), UniPlot, Ensembl, etc. Specifically, the nucleotide sequence of human APP is provided by NCBI under accession number NM_000484.4, etc. Information on the signal peptide region of APP can also be obtained from the above-mentioned international databases.

[0029] APP consists of approximately 770 amino acid residues. APP is a type I membrane protein. From the N-terminus, APP is mainly composed of a signal peptide region, an extracellular region, an Aβ domain, and a cytoplasmic region. The extracellular region contains, from the N-terminus, an E1 domain (growth factor-like domain (GFLD) and copper-binding domain (CuBD)), an acidic domain (AcD), a serine protease inhibitor domain (KPI), and an E2 domain (central APP domain (CAPPD)). A portion of the Aβ domain is contained in the transmembrane region. The intracellular region contains an AID domain and an AICD domain. There are also several isoforms of APP. Figure 1 schematically shows the above-mentioned domains and the signal peptide region of human APP. It has been suggested that APP mutations may be involved in various diseases and disorders. Targeting the signal peptide region is expected to be useful for treating or preventing diseases and disorders related to human APP gene expression.

[0030] The amino acid sequence shown in SEQ ID NO: 3 consists of 17 amino acid residues and represents the amino acid sequence of the signal peptide of human APP, while the nucleotide sequence shown in SEQ ID NO: 4 consists of 51 bases and represents the nucleotide sequence of the signal peptide of human APP.

[0031] <Double-Stranded RNA> The double-stranded RNA of the present disclosure is a double-stranded RNA having a first strand and a second strand complementary to the first strand. Hereinafter, the first strand will be referred to as the sense strand and the second strand as the antisense strand, as will be described in detail. The sense strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence. Furthermore, the main sequence is a portion of the base sequence encoding APP, and includes at least a portion of the base sequence encoding the signal peptide region of APP.

[0032] The main sequence is typically composed of a polynucleotide, which is a polymer of ribonucleotides. In other words, the main sequence is composed of RNA. That is, the base sequence of the main sequence is typically represented by the four letters A (adenine), U (uracil), G (guanine), and C (cytosine), or the four letters a, u, g, and c. However, in the attached sequence listing, uracil may be represented by T (thymine).

[0033] The main sequence of the sense strand may be, for example, a base sequence containing a portion of the base sequence encoding the signal peptide region of APP. This allows the double-stranded RNA to function as an siRNA (small interfering RNA) targeting APP. Furthermore, since the base sequence of the signal peptide region of APP is located upstream of mRNA, the double-stranded RNA may be able to effectively suppress APP expression when functioning as an siRNA.

[0034] The double-stranded RNA disclosed herein can at least function as an siRNA. That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). RNAi is a gene silencing process in which short double-stranded RNAs such as siRNAs suppress gene expression in a sequence-specific manner. When siRNAs are introduced into cells, they form a complex with intracellular proteins called RISC (RNA-induced silencing complex). RISC binds to homologous sequences in mRNA transcribed from the target gene (here, the APP gene) and specifically cleaves the mRNA, thereby inhibiting translation.

[0035] The main sequence is preferably selected so as to include the signal peptide region of APP or a nucleotide sequence encoding the signal peptide region of APP, but one or more bases (e.g., two bases) may be substituted with other bases, deleted, and / or added (inserted) within the scope in which the effects of the present technology are exhibited.

[0036] The proportion of the APP signal peptide region or the nucleotide sequence encoding the APP signal peptide region in the main sequence is not particularly limited and, when the entire main sequence is taken as 100%, is preferably 5% or more, but may also be 10% or more, 15% or more, 90% or more, or 100% or more.

[0037] The 5' end of the main sequence is preferably guanine or cytosine. Because guanine and cytosine have stronger binding strength with complementary strands than adenine and uracil, the stability of the 5' end of the sense strand (i.e., the 3' end of the antisense strand) is increased. In other words, the stability of the 5' end of the antisense strand is relatively reduced. Although the details of the mechanism are unclear, RISC, an RNAi-related protein, tends to preferentially incorporate the strand with the more energetically unstable 5' end between the sense strand and the antisense strand. Therefore, by having guanine or cytosine at the 5' end of the main sequence, the antisense strand can be more easily incorporated into RISC, thereby more effectively inducing RNAi. This allows the double-stranded RNA to function favorably as siRNA.

[0038] Of the five bases on the 3'-end of the main sequence, adenine and / or uracil may be present in 40% or more, preferably 60% or more (i.e., 3 or more bases), 80% or more (i.e., 4 or more bases), or even 100% (i.e., 5 bases). Furthermore, of the seven bases on the 3'-end of the main sequence, adenine and / or uracil preferably is present in 3 or more bases (i.e., 40% or more). This makes the 5'-end of the antisense strand relatively less stable than the 3'-end. As a result, the antisense strand is more easily incorporated into RISC, allowing for more effective induction of RNAi.

[0039] The GC content of the entire main sequence (the total proportion of G and C in the entire base sequence constituting the main sequence) is not particularly limited, but may be, for example, 50% to 75%, preferably 55% to 70%, or may be 20% to 80%. The GC content is a parameter related to the binding strength between the antisense strand incorporated into RISC and RNA having the main sequence, the ease of cleavage of RNA, etc. The above GC content allows the RNAi effect to be efficiently exerted.

[0040] The main sequence can be selected from 19 to 23 bases from G or C of the gene encoding human APP. For example, the main sequence can be any of the following base sequences: GCUGGAGGUACCCACUGAU (SEQ ID NO: 9); GCGCUGGAGGUACCCACUGAU (SEQ ID NO: 10); CCGGUUUGGCACUGCUCCUCCU (SEQ ID NO: 26); GUUUGGCACUGCUCCUGCU (SEQ ID NO: 27); GGCGCUGGAGGUACCCACU (SEQ ID NO: 28); GGCGCUGGAGGUACCCACUGA (SEQ ID NO: 29); and CGCUGGAGGUACCCACUGA (SEQ ID NO: 30). The base sequences shown in SEQ ID NOs: 9 to 10 and SEQ ID NOs: 26 to 30 are all composed of RNA. Double-stranded RNAs having as their main sequence any of the nucleotide sequences shown in SEQ ID NOs: 9, 10, and 26 to 30 significantly suppress the proliferation of abnormally proliferating cells even at low concentrations, and can therefore avoid nonspecific inhibition of expression, nonspecific inhibition of cell proliferation, stress on cells, and the like.

[0041] The nucleotide sequence shown in SEQ ID NO: 1 is the nucleotide sequence from bases 51 to 69 of the nucleotide sequence encoding human APP (i.e., the sequence from the initiation codon to the termination codon). The nucleotide sequence shown in SEQ ID NO: 2 is the nucleotide sequence from bases 49 to 69 of the nucleotide sequence encoding human APP. The nucleotide sequences shown in SEQ ID NOs: 1 and 2 are nucleotide sequences containing a portion of the signal peptide region of human APP. The nucleotide sequence shown in SEQ ID NO: 11 (a DNA sequence corresponding to the RNA sequence shown in SEQ ID NO: 26) is the nucleotide sequence from bases 8 to 26 of the nucleotide sequence encoding human APP. The nucleotide sequence shown in SEQ ID NO: 12 (a DNA sequence corresponding to the RNA sequence shown in SEQ ID NO: 27) is the nucleotide sequence from bases 11 to 29 of the nucleotide sequence encoding human APP. The nucleotide sequence shown in SEQ ID NO: 13 (a DNA sequence corresponding to the RNA sequence shown in SEQ ID NO: 28) is the nucleotide sequence from bases 48 to 66 of the nucleotide sequence encoding human APP. The nucleotide sequence shown in SEQ ID NO: 14 (a DNA sequence corresponding to the RNA sequence shown in SEQ ID NO: 29) is the nucleotide sequence from bases 48 to 68 of the nucleotide sequence encoding human APP. The nucleotide sequence shown in SEQ ID NO: 15 (a DNA sequence corresponding to the RNA sequence shown in SEQ ID NO: 30) is the nucleotide sequence from bases 50 to 68 of the nucleotide sequence encoding human APP. The nucleotide sequences shown in SEQ ID NOs: 11 and 12 are the nucleotide sequences of parts of the signal peptide region of human APP. The nucleotide sequences shown in SEQ ID NOs: 13 to 15 are nucleotide sequences containing parts of the signal peptide region of human APP.

[0042] Double-stranded RNAs composed of the main sequences shown in SEQ ID NOs: 9 to 10 and SEQ ID NOs: 26 to 30 can suppress or inhibit the proliferation of at least one type of cell by supplying them to tumor cells (e.g., neuroblastoma, etc.). Typically, by supplying them to tumor cells, the proliferation of the tumor cells can be suppressed or inhibited. While APP is expressed at low levels in normal cells other than tumor cells, it is overexpressed in tumor cells. Therefore, even if the double-stranded RNA disclosed herein is supplied to normal cells, the amount of APP present in normal cells is relatively small, and therefore the double-stranded RNA is thought to have little effect.

[0043] <Additional Sequence> The sense strand of the double-stranded RNA disclosed herein may have an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the main sequence. Preferably, the additional sequence is added to the 3'-end of the main sequence. The addition of an additional sequence can more effectively induce RNAi.

[0044] The additional sequence is composed of a polynucleotide (dimer, trimer, or tetramer). The polynucleotide constituting the additional sequence may be composed of only ribonucleotides, only deoxynucleotides, or both ribonucleotides and deoxynucleotides. That is, the sense strand and the antisense strand may be entirely RNA, or may be chimeric polynucleotides of RNA and DNA. The additional sequence may also contain modified deoxyribonucleotides, modified ribonucleotides, other known nucleotide analogs, and the like.

[0045] The base sequence constituting the additional sequence is not particularly limited, but preferably contains at least one base of adenine, uracil, or thymine. From the viewpoint of improving the stability of the double-stranded RNA, the base sequence constituting the additional sequence is more preferably TT (thymine-thymine).

[0046] <Sense strand and antisense strand> The sense strand is composed of a base sequence of, for example, 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. In a preferred example, the sense strand is composed of 21 to 23 bases, consisting of a main sequence of 19 to 21 bases and an additional sequence of 2 bases. In such an example, RNAi can be effectively induced.

[0047] The antisense strand has a base sequence complementary to the main sequence of the sense strand. This allows the antisense strand to hybridize with the sense strand, forming a double-stranded structure. The base sequence of the antisense strand may also be partially complementary to the main sequence of the sense strand. That is, one or more bases (e.g., two bases) of the antisense strand may be substituted, deleted, and / or added (inserted) with other bases. As long as the sense strand and the antisense strand can hybridize at least under physiological conditions, they can function as siRNA. The complementary base sequence is typically composed of a ribonucleotide polymer (RNA).

[0048] In the double-stranded RNA of the present disclosure, the sense strand or antisense strand is typically composed of chemically unmodified ribonucleotides (RNA). However, the double-stranded RNA of the present disclosure may also contain DNA, chemically modified DNA or RNA, other known nucleotide analogs, etc., to the extent that the technology of the present disclosure is not significantly impaired. That is, one or more bases (e.g., two bases) in the sense strand or antisense strand may be substituted with chemically modified RNA (or DNA) such as methylated or pseudouridylated. Examples of chemically modified RNA include pseudouridine, N1-methylpseudouridine, 5-methylcytosine, or inosine. For example, one or more bases (e.g., two bases) of uridine in the double-stranded RNA of the present disclosure can be substituted with pseudouridine.

[0049] In the double-stranded RNA of the present disclosure, the antisense strand may have a main sequence complementary to the sense strand and an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the complementary main sequence. From the viewpoint of improving the function as siRNA, the additional sequence may be added to the 3'-end of the complementary base sequence. In a preferred example, when the additional sequence of the sense strand is added to the 3'-end of the main sequence, the additional sequence of the antisense strand is added to the 3'-end of the complementary base sequence. The configuration of the additional sequence in the antisense strand may be the same as the configuration of the additional sequence in the sense strand described above. Typically, the base sequence of the additional sequence in the antisense strand is the same as the additional sequence in the sense strand to which it hybridizes, but it may also be a different base sequence.

[0050] The antisense strand is composed of, for example, a base sequence of 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. The antisense strand is composed of a base sequence of the same length as the sense strand, and all or part of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand. In a preferred example, the antisense strand is composed of a base sequence of the same length as the sense strand, and all of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand.

[0051] <Method for Producing Double-Stranded RNA> The sense strand and antisense strand constituting the double-stranded RNA disclosed herein can be produced according to a general chemical synthesis method. For example, they can be synthesized using a commercially available DNA / RNA automatic synthesizer. Alternatively, the sense strand and antisense strand may be synthesized in vitro or in vivo based on genetic engineering techniques. The synthesized sense strand and antisense strand are preferably purified, and can be purified, for example, by HPLC or the like.

[0052] The double-stranded RNA disclosed herein can be produced, for example, by annealing (hybridizing) a sense strand and an antisense strand. Annealing can be performed according to conventional methods. For example, annealing can be performed by mixing equal amounts of the sense strand and the antisense strand in a solvent, heating at 90°C for 1 to 5 minutes, and then cooling to 4°C to room temperature. Examples of such solvents that can be used include distilled water, pure water, ultrapure water, and buffers (e.g., HEPES-KOH buffer at pH 7.4, PBS, etc.). To prevent active RNase (RNA degrading enzyme) from being mixed into the solvent, solvents that have been treated with, for example, DEPC or autoclaved are preferably used.

[0053] <Composition> The composition disclosed herein contains the double-stranded RNA described above. In addition to the double-stranded RNA described above, the composition may contain various pharmaceutically acceptable carriers depending on the intended use. Preferred carriers include those commonly used in medicines as diluents, excipients, etc. The carriers vary depending on the intended use and form of the composition. Typical examples include water, physiological buffer solutions, various organic solvents, etc. The carrier may also be an aqueous solution of an appropriate concentration of alcohol (e.g., ethanol), glycerol, a non-drying oil such as olive oil, or liposomes. Examples of secondary components that may be contained in the pharmaceutical composition include various fillers, extenders, binders, humectants, surfactants, dyes, fragrances, etc. The composition may also contain carriers used in conventional drug delivery systems (DDS).

[0054] The form of the composition disclosed herein is not particularly limited. For example, typical composition forms include solutions, suspensions, emulsions, aerosols, foams, granules, powders, tablets, capsules, and ointments. Furthermore, for use in injections, etc., the composition can be made into a lyophilized product or granulated product that is dissolved in physiological saline or an appropriate buffer solution (e.g., PBS) immediately before use to prepare a medicinal solution. Furthermore, the process of preparing various forms of drugs (compositions) using double-stranded RNA (main component) and various carriers (secondary components) can be based on conventionally known methods. Since such formulation methods do not characterize the present disclosure, detailed explanations are omitted. For example, a detailed source of information regarding formulations is "Comprehensive Medicinal Chemistry," edited by Corwin Hansch, published by Pergamon Press (1990).

[0055] The compositions disclosed herein inhibit the proliferation of at least one type of cell. The cells whose proliferation is inhibited are cells in which APP expression is involved, such as tumor cells (e.g., neuroblastoma, breast cancer, lung cancer, lymphoma, prostate cancer, colon cancer, thyroid cancer, lung cancer, nasopharyngeal cancer, gastrointestinal cancer, etc.), liver cells, eye cells, brain cells, etc. Among these, the compositions disclosed herein preferably inhibit the proliferation of tumor cells. In other words, the double-stranded RNA and compositions disclosed herein can be preferably used as antitumor agents (anticancer agents) that suppress the proliferation of tumor cells.

[0056] One embodiment of the composition disclosed herein includes, in addition to the double-stranded RNA described above, a peptide fragment (cell-penetrating peptide, CPP) that has cell membrane permeability and can pass through the cell membrane from the outside of a cell to introduce a foreign substance into the cytoplasm. The peptide fragment is directly or indirectly linked to the double-stranded RNA of the present disclosure to construct a construct of the peptide fragment and double-stranded RNA. Generally, double-stranded RNA is negatively charged and therefore cannot pass through the cell membrane. However, for example, by directly or indirectly linking the double-stranded RNA disclosed herein to the N-terminus and / or C-terminus of the peptide fragment, the construct of the peptide fragment and the double-stranded RNA can be introduced into the cytoplasm. The number of amino acid residues in the peptide fragment is not limited as long as cell membrane permeability is not impaired.

[0057] When the peptide fragment and the double-stranded RNA are indirectly bound, for example, a linker is placed between the peptide fragment and the double-stranded RNA. The type of linker is not particularly limited. Typically, it is a peptidic linker, a non-peptidic linker, or the like. Furthermore, the method for binding the peptide fragment and the double-stranded RNA is not particularly limited, and can be carried out according to various conventionally known scientific techniques.

[0058] One embodiment of the composition disclosed herein comprises a peptide fragment and the double-stranded RNA of the present disclosure. However, the double-stranded RNA does not necessarily have to be bound to the N- or C-terminus of the peptide fragment. In such an embodiment, the double-stranded RNA and the peptide fragment may form a complex, for example, through electrical or molecular interaction. Such a complex is more easily introduced into eukaryotic cells, thereby enabling efficient introduction of the double-stranded RNA. Nucleic acids such as double-stranded RNA are typically negatively charged. Therefore, the peptide fragment used preferably has a high proportion of basic amino acids and is positively charged. Furthermore, the proportion of the peptide fragment in this case may be 5 to 100 times, preferably 40 to 60 times, the molar ratio of the double-stranded RNA.

[0059] <Method for producing the composition disclosed herein and use thereof> The present disclosure may provide a method for inhibiting the proliferation of at least one type of cell using the composition disclosed herein. The method disclosed herein includes the steps of preparing the composition disclosed herein and supplying the composition to a target cell.

[0060] In the preparation step, for example, as described above, the composition disclosed herein may be prepared by a conventionally known method.

[0061] In the supplying step, the composition disclosed herein is supplied to at least one type of cell (e.g., tumor cells, etc.) in vivo or ex vivo. The animal species of the supplied cells is not particularly limited and may be, for example, mammals, birds, amphibians, reptiles, fish, etc. Preferably, the animal species from which the APP that forms the main sequence of the double-stranded RNA contained in the composition is derived is the same as the animal species of the target cells. The type of target cells is also not particularly limited, but is preferably tumor cells, more preferably neuroblastoma. Note that, although cells other than tumor cells may be present at the destination of the composition, the composition may be supplied only to the target cells (i.e., tumor cells).

[0062] The method of administering the composition may be similar to methods conventionally used in animal treatments and is not particularly limited. The composition can be used in vivo in a manner and dosage appropriate for its form and purpose. For example, as a liquid formulation, it can be administered in a desired amount to the affected area (e.g., malignant tumor tissue, virus-infected tissue, inflammatory tissue, etc.) of a patient or animal (i.e., living body) by intravenous, intralymphatic, intramuscular, subcutaneous, intradermal, or intraperitoneal injection. Alternatively, a solid form such as a tablet, or a gel or aqueous jelly such as an ointment, can be administered directly to a specific tissue (e.g., an affected area such as a tissue or organ containing tumor cells, inflammatory cells, etc.). Alternatively, a solid form such as a tablet can be administered orally. For oral administration, encapsulation or application of a protective (coating) material is preferred to prevent degradation by digestive enzymes in the digestive tract.

[0063] The amount of the composition to be supplied in vivo is not particularly limited. For example, the lower limit of the amount of double-stranded RNA per kg of animal may be 0.01 mg or more, 0.05 mg or more, or 0.1 mg or more. The upper limit of the amount of double-stranded RNA per kg of animal may be, for example, 10 mg or less, 5 mg or less, or 1 mg or less. The amount of the composition to be supplied in vitro is not particularly limited. In the culture medium of the subject to be supplied, such as cells, the lower limit of the double-stranded RNA concentration may be, for example, 1 nM or more, 5 nM or more, or 10 nM or more. The upper limit of the double-stranded RNA concentration in such culture medium may be, for example, 10 μM or less, 5 μM or less, 2 μM or less, 1 μM or less, or 100 nM or less.

[0064] The compositions disclosed herein can be delivered to the interior of target cells by known transfection methods. Examples include chemical gene transfer methods using cationic molecules (e.g., commercially available transfection reagents), physical transfer methods such as microinjection and electroporation, and biological gene transfer methods using viruses. Alternatively, as described above, the compositions may be delivered to the interior of cells using cell membrane-permeable peptide fragments.

[0065] Below, several test examples relating to the technology disclosed herein will be described, but it is not intended that the technology disclosed herein be limited to those shown in these test examples.

[0066] <Preparation of double-stranded RNA> Polynucleotides having the base sequences shown in SEQ ID NOS: 5 to 8 and 16 to 25 were artificially synthesized. The base sequences of each polynucleotide are shown in Table 1. In each polynucleotide, the "TT" (additional sequence) at the 3' end is DNA, and the remaining sequence (main sequence) is composed of RNA. The obtained polynucleotides were annealed with a sense strand and an antisense strand having complementary sequences to prepare double-stranded RNAs used in Samples 1 and 2 and Samples 3 to 7 shown in Table 1. The double-stranded RNAs shown in Samples 1 and 2 and Samples 3 to 7 were each dissolved in PBS to a 2 mM RNA concentration to prepare an RNA solution.

[0067]

[0068] As shown in Table 1, the sense strand of the double-stranded RNA of Sample 1 is composed of a main sequence consisting of SEQ ID NO: 1 (a base sequence containing a portion of the base sequence encoding the signal peptide region of APP) and an additional sequence consisting of TT added to the 3'-end of the main sequence. Similarly, the sense strand of the double-stranded RNA of Samples 2 and 3-7 shown in Table 1 is composed of a main sequence consisting of SEQ ID NO: 2 and SEQ ID NOs: 11-15 (a base sequence containing a portion of the base sequence encoding the signal peptide region of APP) and an additional sequence consisting of TT added to the 3'-end of the main sequence. The antisense strand in each example is composed of a sequence complementary to the main sequence and an additional sequence consisting of TT added to the 3'-end of the sequence.

[0069] <Cell proliferation test of human neuroblastoma cells> Human neuroblastoma cells, the SK-N-SH strain, were used as tumor cells. SK-N-SH cells were pre-cultured in a culture medium containing 10% FBS (fetal bovine serum) + E-MEM (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 051-07615) + 1% MEM non-essential amino acid solution (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 139-15651). Note that 0.5% penicillin-streptomycin (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 168-23191) was added to the culture medium only during pre-culture, but was not added during the following culture and evaluation.

[0070] On day 1, the SK-N-SH cells that had adhered to the culture plate were washed with PBS, and then a 0.25% trypsin / EDTA solution was added and incubated at 37°C for 2 minutes. After this incubation, the above-mentioned culture medium was added to inactivate the trypsin. The cells were then precipitated by centrifugation at 150 x g for 5 minutes. After removing the supernatant resulting from centrifugation, the above-mentioned culture medium was added to the precipitate (cell pellet), and approximately 5 x 10 ４ A cell suspension of 5 × 10 cells / mL was prepared. One commercially available 96-well plate was prepared, and the cell suspension was added to each well at a concentration of 5 × 10 ３ The cells were seeded at 100 μL per well and incubated at 37°C, 5% CO ２ and incubated overnight under

[0071] (Sample 1) On the second day, 3 μL of RNA solution adjusted to 2 mM with PBS was mixed with 75 μL of Opti-MEM™ to prepare Solution A. Furthermore, 4.5 μL of Lipofectamine™ RNAiMAX was mixed with 75 μL of Opti-MEM™ to prepare Solution B. Next, equal amounts of Solution A and Solution B were mixed to prepare Solution C, which was then incubated at room temperature for 5 minutes. The prepared Solution C was added to wells where SK-N-SH cells had been cultured, at 11 μL / well (final concentration of double-stranded RNA: 4 μM). The mixture was then incubated at 37°C, 5% CO ２ The mixture was incubated under reduced pressure for 3 days.

[0072] Cell proliferation was evaluated using Cell Counting Kit-8 (CCK-8, Dojin Kagaku Kenkyusho). On day 5 (day 3 after siRNA addition), the 96-well plate in which SK-N-SH cells had been cultured was removed, 10 μL of CCK-8 was added to each well, and the cells were incubated at 37°C, 5% CO ２ The wells were incubated for 2 hours under a constant temperature. The absorbance at 450 nm was measured for each well. The absorbance was calculated as the average value of three wells. In addition, a blank well was prepared containing only the culture medium and CCK-8 reagent. The absorbance of Sample 1 minus the absorbance of the blank was used as the measured value for Sample 1.

[0073] (Sample 2, Samples 3 to 7) Samples 2 and 3 to 7 were prepared in the same manner as Sample 1, except that the double-stranded RNA in Sample 1 was replaced with the double-stranded RNA in Sample 2 and Samples 3 to 7 shown in Table 1.

[0074] Comparative Example In the comparative example, the procedure was the same as that of Sample 1, except that a PBS solution was used instead of the RNA solution in Sample 1. That is, in the comparative example, no double-stranded RNA was introduced.

[0075] Untreated wells were prepared in the same manner as Sample 1, except that the RNA solution and Lipofectamine™ RNAiMAX were not added. The cell viability in each test example is expressed as a percentage when the measured value for the untreated well was set at 100%, and is shown in Figure 2. Figure 2 shows the results of a test using the double-stranded RNA shown in Table 1, i.e., double-stranded RNA whose main sequence is a base sequence (SEQ ID NOs: 1 to 2) containing a portion of the base sequence encoding the APP signal peptide region, on neuroblastoma cells.

[0076] As shown in Figure 2, the cell viability of Samples 1 and 2 was reduced, and was significantly lower than that of the comparative example. From the above test results, it is believed that the double-stranded RNAs of Samples 1 and 2 have the function of inhibiting the proliferation of tumor cells (neuroblastoma cells). Furthermore, although not shown in detail, the sequences of Samples 1 and 2 are specific to the APP gene. Therefore, the double-stranded RNAs of Samples 1 and 2 can avoid off-target effects, do not affect other organs, and are therefore expected to be suitable for clinical application.

[0077] <Cell proliferation test of human neuroblastoma cells using low-concentration double-stranded RNA> Double-stranded RNA for Samples 1 and 2 shown in Table 1 was prepared. Each double-stranded RNA shown in Samples 1 and 2 was dissolved in PBS to a 2 mM RNA concentration to prepare an RNA solution. This was then further diluted 10-fold with PBS to prepare a low-concentration RNA solution with an RNA concentration of 200 μM. Except for using the low-concentration RNA solution, the test was performed in the same manner as the cell proliferation test of human neuroblastoma cells. That is, the final concentration of double-stranded RNA added to the wells in which SK-N-SH cells were cultured was adjusted to 0.4 μM. Note that the cell viability in each test example was expressed as a percentage, with the measured value for the untreated well being taken as 100%.

[0078] Figure 3 is a graph comparing cell viability when the final concentration of added double-stranded RNA was 4.0 μM and 0.4 μM. As shown in Figure 3, the cell viability of Samples 1 and 2 decreased. Furthermore, the cell viability of Samples 1 and 2 was significantly lower than that of the comparative example. This indicates that the double-stranded RNA of Samples 1 and 2 had the ability to inhibit the proliferation of tumor cells (neuroblastoma cells) even at low concentrations. Because the double-stranded RNA of Samples 1 and 2 had sufficient tumor cell proliferation inhibitory activity even at low concentrations, it can avoid nonspecific expression inhibition and nonspecific cell proliferation inhibition, making clinical applications highly promising. Furthermore, the double-stranded RNA of Samples 1 and 2 had the same or better cell inhibition activity even at one-tenth the concentration. The above tests were conducted on the same day.

[0079] Additionally, double-stranded RNA was prepared for each of Samples 3 to 7 shown in Table 1. Each of the double-stranded RNAs shown in Samples 3 to 7 was dissolved in PBS to a 2 mM RNA concentration to prepare an RNA solution. This was then further diluted 10-fold with PBS to prepare a low-concentration RNA solution with an RNA concentration of 200 μM. Tests were performed in the same manner as in the cell proliferation test for human neuroblastoma cells, except for the use of the low-concentration RNA solution. Specifically, in the tests for Samples 3 to 7, the final concentration of double-stranded RNA added to the wells containing SK-N-SH cells was adjusted to 0.4 μM. The cell viability in each test example was expressed as a percentage of the measured value for the untreated well, which was set at 100%. In the comparative examples, sterilized ultrapure water was used instead of the sample (no double-stranded RNA was added in the comparative examples).

[0080] Figure 4 shows the cell viability of human neuroblastoma cells after 3 days of transfection with the double-stranded RNAs shown in Samples 3 to 7. The double-stranded RNAs of Samples 3 to 7 were able to inhibit tumor cell (neuroblastoma cell) proliferation even at low concentrations. Therefore, nonspecific inhibition of expression and nonspecific inhibition of cell proliferation can be avoided, and clinical application is highly anticipated. Note that the tests using the double-stranded RNAs shown in Samples 3 to 7 were conducted independently on a different day from the tests using the double-stranded RNAs shown in Samples 1 and 2 above.

[0081] While specific examples of the technology disclosed herein have been described in detail above, these are merely examples and do not limit the scope of the claims. The technology described in the claims includes various modifications and alterations of the specific examples exemplified above.

[0082] In the technology disclosed herein, each component and each process mentioned herein may be omitted or combined as appropriate, unless a particular problem arises. This specification also includes the disclosures described in the following sections.

[0083] Item 1: A double-stranded RNA having a first strand and a second strand complementary to the first strand, wherein the first strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence, wherein the main sequence is a part of a base sequence encoding an amyloid precursor protein and includes at least a part of a base sequence encoding a signal peptide region of the amyloid precursor protein.

[0084] Item 2: The double-stranded RNA according to Item 1, wherein the second strand is composed of a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the complementary main sequence.

[0085] Item 3: The double-stranded RNA according to Item 1 or 2, wherein at least three of the seven bases on the 3'-terminal side of the main sequence are adenine (A) and / or uracil (U).

[0086] Item 4: The double-stranded RNA according to any one of Items 1 to 3, wherein the base sequence comprising at least a part of the base sequence encoding the signal peptide region of the amyloid precursor protein consists of any one of the following base sequences: GCTGGAGGTACCCACTGAT (SEQ ID NO: 1); GCGCTGGAGGTACCCACTGAT (SEQ ID NO: 2); CCGGTTTGGCACTGCTCCT (SEQ ID NO: 11); GTTTGGCACTGCTCCTGCT (SEQ ID NO: 12); GGCGCTGGAGGTACCCACT (SEQ ID NO: 13); GGCGCTGGAGGTACCCACTGA (SEQ ID NO: 14); and CGCTGGAGGTACCCACTGA (SEQ ID NO: 15).

[0087] Item 5: The double-stranded RNA according to any one of Items 1 to 4, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).

[0088] Item 6: A composition that inhibits the proliferation of at least one type of cell, comprising the double-stranded RNA of any one of Items 1 to 5.

[0089] Item 7: The composition of Item 6, wherein the cells are tumor cells.

[0090] Item 8: The composition according to Item 6 or 7, wherein the composition comprises a peptide fragment having cell membrane permeability that can pass through the cell membrane from the outside of the cell and introduce a foreign substance into the cytoplasm.

[0091] Item 9: A method for suppressing the proliferation of at least one type of cell, comprising: preparing the composition according to any one of Items 6 to 8; and supplying the composition to the cell in vitro or in vivo.

[0092] Item 10: The method according to Item 9, wherein the biological species of the cells is the same as the biological species in which the amyloid precursor protein is contained.

[0093] As described above, the double-stranded RNA disclosed herein can inhibit (or suppress) cell proliferation, and therefore, by using the double-stranded RNA, a composition (e.g., an anti-tumor agent) that inhibits the proliferation of at least one type of cell (e.g., tumor cell) can be provided.

Claims

1. A double-stranded RNA having a first strand and a second strand complementary to the first strand, wherein the first strand has a main sequence consisting of 19 to 23 bases with a guanine (G) or cytosine (C) at the 5'-terminal base, and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence, wherein the main sequence is a part of a base sequence encoding an amyloid precursor protein and includes at least a part of a base sequence encoding a signal peptide region of the amyloid precursor protein, the double-stranded RNA.

2. The double-stranded RNA according to claim 1, wherein the second strand has a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the complementary main sequence.

3. The double-stranded RNA according to claim 1, wherein at least 3 bases out of the 7 bases on the 3'-terminal side of the main sequence are adenine (A) and / or uracil (U).

4. The double-stranded RNA according to claim 1, wherein the base sequence including at least a part of the base sequence encoding the signal peptide region of the amyloid precursor protein consists of any one of the following base sequences: GCTGGAGGTACCCCACTGAT (SEQ ID NO: 1); GCGCTGGAGGTACCCCACTGAT (SEQ ID NO: 2); CCGGTTTGGCCACTGCCTCCT (SEQ ID NO: 11); GTTTGGCCACTGCCTCCTCT (SEQ ID NO: 12); GGCGCTGGAGGTACCCCACT (SEQ ID NO: 13); GGCGCTGGAGGTACCCCACTGA (SEQ ID NO: 14); and CGCTGGAGGTACCCCACTGA (SEQ ID NO: 15).

5. The double-stranded RNA according to claim 1, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).

6. A composition for inhibiting the proliferation of at least one kind of cell, comprising the double-stranded RNA according to any one of claims 1 to 5.

7. The composition according to claim 6, wherein the cell is a tumor cell.

8. The composition according to claim 7, comprising a peptide fragment having cell membrane permeability capable of introducing a foreign substance into the cytoplasm through the cell membrane from the outside of the cell.

9. A method for suppressing the proliferation of at least one type of cell, the method comprising: a preparation step of preparing the composition according to claim 8; and a step of supplying the composition to the cell in vitro.

10. The method according to claim 9, wherein the cell species is the same as the species containing the amyloid precursor protein.

Images