Antigen-binding fragment of Anti-il-4rα antibody expressed in plant and use thereof
A plant-expressed ScFv of dupilumab addresses the limitations of systemic side effects and inefficient delivery by maintaining binding affinity and enhancing epithelial permeability, facilitating effective local treatment of type 2 inflammatory diseases.
Patent Information
- Application Number
- PCT/KR2025/001417
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-26
- Filing Date
- 2025-01-24
- Publication Date
- 2025-07-31
AI Technical Summary
Current treatments for type 2 inflammatory diseases like asthma and sinusitis using dupilumab are limited by the high molecular weight of the antibody, leading to systemic side effects and inefficient local delivery to epithelial tissues.
Development of a nucleic acid molecule for expressing a small antigen-binding fragment of the dupilumab antibody (ScFv) in plant cells, which maintains binding affinity to IL-4Rα and enhances epithelial cell permeability, allowing for local administration and reduced systemic side effects.
The plant-expressed ScFv achieves equivalent binding affinity to dupilumab while significantly increasing permeability to epithelial tissues, enabling effective local treatment of inflammatory diseases with reduced systemic immune activity.
Smart Images

Figure KR2025001417_31072025_PF_FP_ABST
Abstract
Description
Antigen-binding fragment of anti-IL-4Rα antibody expressed in plants and uses thereof The present invention relates to an antigen-binding fragment of an anti-IL-4Rα antibody expressed in a plant cell, specifically, ScFv of dupilomab, and a method for preventing or treating inflammatory and autoimmune diseases using the same. Plants offer several advantages as excellent expression platforms for the recombinant production of target proteins, including glycosylation patterns similar to those of mammalian cells, low production costs, low residual protein levels, and a reduced risk of viral infection in the host. However, the administration of plant-derived biopharmaceuticals also carries risks, such as acute allergic reactions due to plant-specific glycosylation. Meanwhile, type 2 inflammation, such as asthma, atopic dermatitis, and sinusitis, is caused by an abnormal immune response by specific immune cells and inflammatory cytokines such as IL-4 and IL-13. In particular, sinusitis, also called empyema, is a chronic inflammatory disease in which inflammation occurs in the paranasal sinuses, which are empty spaces around the nose in the facial bones, due to blockage of the natural openings connected to the nose, and purulent secretions accumulate, which makes the inflammation worse. Dupilumab is an IgG4 subclass antibody that directly binds to the interleukin-4 receptor alpha (IL-4Rα) subunit and inhibits both IL-4 and IL-13 signaling, demonstrating high clinical efficacy for various type 2 inflammatory diseases. Although dupilumab has also been shown to be effective in treating chronic sinusitis, direct topical administration to the affected area is impossible due to the high molecular weight of the antibody, and currently the drug can only be delivered in the form of injections such as subcutaneous injections. This is accompanied by various side effects such as injection site reactions or serum sickness-like reactions, and there are limitations in intensive drug delivery to the lesion area. Numerous papers and patents are referenced and cited throughout this specification. The disclosures of these cited papers and patents are incorporated herein by reference in their entirety to provide a clearer understanding of the state of the art and the scope of the invention. The present inventors have made extensive research efforts to develop a novel antibody therapeutic agent that maintains binding affinity for the IL-4 receptor while having significantly improved permeability to epithelial cells due to its small molecular weight, enabling efficient local administration to epithelial lesion sites such as nasal epithelial tissue. As a result, the present invention was completed by discovering that when an antigen-binding fragment of an anti-IL-4Rα antibody, specifically, the single-chain variable fragment (ScFv) of Dupilumab, a commercially available anti-IL-4Rα antibody, is expressed in plant cells, unlike general ScFvs known to have lower antigen binding affinity than full-length antibodies, it exhibits binding affinity equivalent to or higher than that of Dupilumab while significantly increasing epithelial cell permeability, enabling direct and intensive drug delivery to epithelial lesion tissue. Accordingly, the purpose of the present invention is to provide a nucleic acid molecule for expressing ScFv of dupilomab in plants. Another object of the present invention is to provide a plant-derived dupilomab ScFv recombinantly produced using the nucleic acid molecule of the present invention described above and a composition for preventing or treating various inflammatory / autoimmune diseases comprising the same as an active ingredient. Other objects and advantages of the present invention will become more apparent from the detailed description, claims and drawings below. According to one aspect of the present invention, the present invention provides a nucleic acid molecule for plant expression comprising: (1) A nucleic acid sequence encoding a heavy chain variable region including an HCDR1 region of the first sequence of the sequence listing, an HCDR2 region of the second sequence of the sequence listing, and an HCDR3 region of the third sequence of the sequence listing; (2) a nucleic acid sequence encoding a light chain variable region including the LCDR1 region of sequence 4, the LCDR2 region of sequence 5, and the LCDR3 region of sequence 6; and (3) A nucleic acid sequence encoding a linker sequence consisting of 12 to 24 consecutive amino acids connecting (1) and (2). The present inventors have made extensive research efforts to develop a novel antibody therapeutic agent that maintains binding affinity to the IL-4 receptor while having significantly improved permeability to epithelial cells due to its small molecular weight, allowing for efficient local administration to lesions composed of epithelial tissue. As a result, we have discovered that when an antigen-binding fragment of an anti-IL-4Rα antibody, specifically ScFv of dupilomab, a commercially available anti-IL-4Rα antibody, is expressed in plant cells, unlike general ScFvs known to have lower antigen binding affinity than full-length antibodies, it exhibits binding affinity equivalent to or higher than dupilomab while significantly increasing epithelial cell permeability, thereby enabling it to be used as an excellent pharmaceutical composition that can be locally administered to a lesion without systemic side effects and concentrate the pharmacological effect. The term “antibody” as used herein refers to a peptide that recognizes and specifically binds to a specific epitope of IL-4Rα, and includes not only a complete antibody form but also an antigen-binding fragment (antibody fragment) of a full-length antibody molecule. A complete antibody has a structure having two full-length light chains and two full-length heavy chains, each light chain being linked to a heavy chain by a disulfide bond. The heavy chain constant region is of the gamma (γ), mu (μ), alpha (α), delta (δ), and epsilon (ε) types, and has subclasses of gamma1 (γ1), gamma2 (γ2), gamma3 (γ3), gamma4 (γ4), alpha1 (α1), and alpha2 (α2). The light chain constant region is of the kappa (κ) and lambda (λ) types. The term “antigen-binding fragment of an antibody” as used herein means a fragment having significant antigen-antibody binding function within a full-length antibody molecule, and includes Fab, F(ab'), F(ab')2, Fv, and nanobody (or sybody). Among antibody fragments, Fab has a structure with variable regions of the light and heavy chains, constant regions of the light chain, and the first constant region (CH1) of the heavy chain, and has one antigen-binding site. Fab' differs from Fab in that it has a hinge region containing one or more cysteine residues at the C-terminus of the heavy chain CH1 domain. F(ab')2 antibodies are produced when the cysteine residues in the hinge region of Fab' form a disulfide bond. Fv is the smallest antibody fragment that has only a heavy chain variable region and a light chain variable region. A two-chain Fv (two-chain Fv) has a heavy chain variable region and a light chain variable region linked non-covalently, and a single-chain Fv (single-chain Fv, ScFv) has a heavy chain variable region and a light chain variable region linked covalently, usually through a peptide linker, or directly at the C-terminus, so that it can form a dimer-like structure like a two-chain Fv. More specifically, the antigen-binding fragment of the antibody used in the present invention is ScFv in which a heavy chain variable region and a light chain variable region are covalently linked via a linker sequence consisting of 12 to 20 consecutive amino acids. The term “heavy chain” as used herein refers to a full-length heavy chain and fragments thereof comprising a variable region domain VH comprising an amino acid sequence having sufficient variable region sequence to confer specificity for an antigen and three constant region domains CH1, CH2 and CH3. The term “light chain” as used herein refers to both full-length light chains and fragments thereof comprising a variable region domain VL and a constant region domain CL, which comprise an amino acid sequence having sufficient variable region sequence to confer specificity for an antigen. As used herein, the term “CDR (complementarity determining region)” refers to the amino acid sequence of the hypervariable region of the immunoglobulin heavy and light chains. The heavy chain (HCDR1, HCDR2, and HCDR3) and the light chain (LCDR1, LCDR2, and LCDR3) each contain three CDRs, which provide key contact residues for antibody binding to an antigen or epitope. The scope of the antibodies or antigen-binding fragments of the present invention includes variants having conservative amino acid substitutions in the CDR regions. In addition, the antibodies or antigen-binding fragments of the present invention may include variants of the amino acid sequences set forth in the attached sequence listing, as long as they can specifically recognize the IL-4 receptor. For example, additional changes may be made to the amino acid sequence of the antibody to further improve the binding affinity and / or other biological properties of the antibody. Such modifications include, for example, deletions, insertions, and / or substitutions of amino acid sequence residues of the antibody, and are made based on the relative similarity of the amino acid side chain substituents, such as hydrophobicity, hydrophilicity, charge, size, etc. Analysis of the size, shape, and type of amino acid side chain substituents reveals that arginine, lysine, and histidine are all positively charged residues; alanine, glycine, and serine have similar sizes; and phenylalanine, tryptophan, and tyrosine have similar shapes. Based on these considerations, arginine, lysine, and histidine; Alanine, glycine and serine; and phenylalanine, tryptophan and tyrosine can be considered biologically functional equivalents. Furthermore, amino acid substitutions in proteins that do not alter the overall activity of the molecule are well known in the art (H. Neurath et al., The Proteins, Academic Press, New York, 1979). The most common exchanges are between amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thr / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly. Considering the mutations having the above-described biological equivalent activity, the amino acid sequence constituting the antibody of the present invention is interpreted to also include a sequence showing substantial identity with the sequence described in the sequence listing. The substantial identity means a sequence showing at least 61% homology, in one specific example 70% homology, in another specific example 80% homology, and in yet another specific example 90% homology, when the sequence of the present invention and any other sequence are aligned to the greatest extent possible and the aligned sequences are analyzed using an algorithm commonly used in the art. Alignment methods and algorithms for sequence comparison are disclosed in Huang et al. Comp. Appl. BioSci. (1992) 8:155-65 and Pearson et al. Meth. Mol. Biol. (1994) 24:307-31, etc. The term “nucleic acid molecule” in this specification encompasses DNA (gDNA and cDNA) and RNA molecules, and nucleotides, which are the basic structural units of nucleic acid molecules, include not only natural nucleotides but also analogues in which sugar or base moieties are modified (Uhlman et al., Chemical Reviews (1990) 90: 543-584). The sequence of a nucleic acid molecule encoding a full-length antibody or a heavy chain or light chain variable region of the present invention may be modified, and the modifications include additions, deletions, or non-conservative or conservative substitutions of nucleotides. The nucleic acid molecule of the present invention is also interpreted to include a sequence that exhibits substantial identity to the nucleotide sequence of the present invention. The substantial identity refers to a nucleotide sequence that exhibits at least 80% homology, in one specific example at least 90% homology, and in another specific example at least 95% homology, when the nucleotide sequence of the present invention is aligned with any other sequence to the greatest extent possible and the aligned sequence is analyzed using an algorithm commonly used in the art. According to a specific embodiment of the present invention, the plant expression nucleic acid molecule of the present invention comprises a heavy chain variable region-encoding nucleic acid sequence comprising a nucleic acid sequence of sequence listing number 12 encoding a HCDR1 region; a nucleic acid sequence of sequence listing number 13 encoding a HCDR2 region; and a nucleic acid sequence of sequence listing number 14 encoding a HCDR3 region. According to a specific embodiment of the present invention, the plant expression nucleic acid molecule of the present invention comprises a light chain variable region-encoding nucleic acid sequence comprising a nucleic acid sequence of sequence number 15 encoding an LCDR1 region; a nucleic acid sequence of sequence number 16 encoding an LCDR2 region; and a nucleic acid sequence of sequence number 17 encoding an LCDR3 region. According to a specific embodiment of the present invention, the nucleic acid sequence encoding the heavy chain variable region is the nucleic acid sequence of sequence number 18 of the sequence listing. According to a specific embodiment of the present invention, the nucleic acid sequence encoding the light chain variable region is the nucleic acid sequence of sequence number 19 of the sequence listing. As used herein, the term "linker" refers to a linker that physically connects two fusion partners (e.g., biological polymers such as peptides) through a covalent bond. The linker may be a non-peptide linker or a peptide linker, and in the case of a non-peptide, it may be a multi-functional ligand compound that has two or more active functional groups and acts as a linker between two or more molecules by binding to the molecules. However, the linker used in the present invention is a peptide linker composed of 12 to 24 consecutive amino acids that connects the heavy chain variable region and the light chain variable region at an appropriate spatial distance to form an ScFv having optimal binding affinity for the target antigen. According to a specific embodiment of the present invention, the linker comprises a flexible peptide linker represented by (GGGGS)n (n is an integer from 3 to 5). More specifically, n is an integer from 2 to 5, even more specifically an integer from 3 to 5, and most specifically 4. According to a specific embodiment of the present invention, the linker of the present invention may additionally include an EF sequence at both ends of the flexible peptide linker represented by (GGGGS)n. According to a specific embodiment of the present invention, the plant expression nucleic acid molecule of the present invention comprises a nucleic acid sequence of sequence number 20 encoding the above-described peptide linker. According to a specific embodiment of the present invention, the nucleic acid molecule additionally comprises a nucleic acid sequence encoding a HDEL (His-Asp-Glu-Leu) peptide or a KDEL (Lys-Asp-Glu-Leu) peptide. More specifically, the nucleic acid sequence encoding the HDEL or KDEL peptide can be linked to the 3' end of the nucleic acid sequence encoding the light chain variable region. In this case, the nucleic acid molecule of the present invention is linked in the order of heavy chain variable region - linker - light chain variable region - HDEL (or KDEL) in the 5' to 3' direction. According to a specific embodiment of the present invention, the plant expression nucleic acid molecule of the present invention described above is represented by the nucleic acid sequence of Sequence Listing No. 22. According to one aspect of the present invention, the nucleic acid molecule used in the present invention may be an mRNA molecule, and more specifically, may be an in vitrotranscribed (IVT) mRNA. When mRNA is used as the nucleic acid molecule of the present invention, various modifications may be made, such as changing the length of the poly(A) tail or substituting some adenine bases; modifying the 5'cap; applying one or more modified nucleosides, in order to improve the expression (translation) efficiency of the antibody or antigen-binding fragment of the present invention. Modified nucleosides that may be applied include, but are not limited to, N1-methylpseudouridine, pseudouridine, 2-thiouridine, 5-methyluridine, 5-methylcytidine, and 5-methoxyuridine, and any modified nucleoside known in the art to be capable of reducing the immunogenicity of the mRNA molecule may be applied. According to another embodiment of the present invention, the nucleic acid molecule used in the present invention may be a deoxyribonucleotide. In this case, the nucleic acid molecule of the present invention additionally includes an expression regulatory sequence that is operatively linked to a DNA sequence encoding an antigen-binding fragment of the above-mentioned antibody, specifically, ScFv, to form an RNA molecule in a plant cell. The term “operatively linked” as used herein refers to a functional linkage between an expression regulatory sequence of a nucleic acid (e.g., a promoter, a signal sequence, or an array of transcription regulatory element binding sites) and another nucleic acid sequence encoding a target protein, whereby the regulatory sequence regulates transcription and / or translation of the other nucleic acid sequence. Promoters suitable for the present invention may be any of those commonly used in the art for gene introduction into plants, including, for example, the SP6 promoter, the T7 promoter, the T3 promoter, the PM promoter, the ubiquitin promoter of maize, the cauliflower mosaic virus (CaMV) 35S promoter, the nopaline synthase (nos) promoter, the pigwort mosaic virus 35S promoter, the sugacrane bacilliform virus promoter, the commelina yellow mottle virus promoter, the photoinducible promoter of ribulose-1,5-bis-phosphate carboxylase small subunit (ssRUBISCO), the rice cytosolic triosephosphate isomerase (TPI) promoter, the adenine phosphoribosyltransferase (APRT) promoter of Arabidopsis, and the octopine synthase promoter. It is not limited. More specifically, the expression regulatory sequence of the present invention is selected from the group consisting of an SP6 promoter, a T7 promoter, a T3 promoter, a cauliflower mosaic virus (CaMV) 35S promoter, and a pigweed mosaic virus 35S promoter, and most specifically, a CaMV 35S promoter. According to a specific embodiment of the present invention, the poly A signal sequence that causes polyadenylation of the 3'-terminal suitable for the present invention may include Poly(A)(NOS 3' end) derived from the nopaline synthase gene of Agrobacterium tumefaciens (Bevan et al. Nucleic Acids Research, 11(2):369-385(1983)), Poly(A) derived from the octopine synthase gene of Agrobacterium tumefaciens, the 3'-terminal part of the protease inhibitor I or II gene of tomato or potato, CaMV 35S terminator and OCS terminator (octopine synthase terminator) sequence. According to another aspect of the present invention, the present invention provides a gene delivery vehicle comprising the nucleic acid molecule of claim 1. According to the present invention, the antibody of the present invention or an antigen-binding fragment thereof is obtained recombinantly in vitro by expressing a nucleic acid molecule encoding the antibody in a plant cell. As used herein, the term “express” means artificially introducing a gene using a gene vector to cause a target cell to express an exogenous gene or to increase the natural expression level of an endogenous gene, thereby making the gene replicable as an extrachromosomal element or by completion of chromosomal integration within the target cell. Accordingly, the term “expression” has the same meaning as “transformation,” “transfection,” or “transduction.” More specifically, as used herein, “express” means causing a target cell to artificially express an exogenous gene. As used herein, the term "gene carrier" refers to any means of transporting a gene into a cell. Gene transfer is synonymous with transduction of a gene into a cell, and gene transfer at the tissue level is synonymous with spread of a gene. Accordingly, the gene delivery system of the present invention may be described as a gene transduction system and a gene spread system. The gene delivery system of the present invention may be comprised in the form of an expression cassette, a polynucleotide structure containing all elements necessary for the autonomous expression of the gene to be introduced. The expression cassette typically includes a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the gene. The expression cassette may be in the form of an expression vector capable of self-replication. The recombinant vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are disclosed, for example, in Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (2001). The recombinant vector of the present invention may be fused with other sequences to facilitate the purification of antibodies expressed therefrom. Examples of such fusion sequences include glutathione S-transferase (Pharmacia, USA); maltose binding protein (NEB, USA); FLAG (IBI, USA); tag sequences such as 6x His (hexahistidine; Quiagen, USA), Pre-S1, and c-Myc; and leader sequences such as OmpA and PelB. Furthermore, since the protein expressed by the vector of the present invention is an antibody, the expressed antibody can be easily purified using a protein A column or the like without additional sequences for purification. Meanwhile, the recombinant vector of the present invention may include an antibiotic resistance gene commonly used in the art as a selection marker, for example, a resistance gene for ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin, and tetracycline. The vector expressing the antibody of the present invention can be either a vector system in which the light chain and the heavy chain are simultaneously expressed from a single vector, or a system in which the light chain and the heavy chain are each expressed from separate vectors. In the latter case, the two vectors are introduced into a host cell through co-transformation and targeted transformation. Co-transformation is a method in which vector DNA encoding the light chain and the heavy chain are simultaneously introduced into a host cell, and then cells expressing both the light chain and the heavy chain are selected. Targeted transformation is a method in which cells transformed with a vector containing a light chain (or heavy chain) are selected, and the selected cells expressing the light chain are transformed again with a vector containing a heavy chain (or light chain), thereby finally selecting cells expressing both the light chain and the heavy chain. The gene delivery system used in the present invention can be any gene delivery system used for conventional plant gene insertion, and includes, but is not limited to, Agrobacterium, cauliflower mosaic virus, gemini virus, tobacco mosaic virus, brome mosaic virus, liposomes, niosomes, and lipid nanoparticles. According to a specific embodiment of the present invention, the plant expression recombinant vector of the present invention is an Agrobacterium binary vector. In this specification, the term “binary vector” refers to a vector divided into two parts: a plasmid having LB (left border) and RB (right border), which are parts necessary for movement in a Ti (tumor inducible) plasmid, and a plasmid having a gene necessary for transferring a target nucleotide. Any Agrobacterium suitable for expression of the nucleic acid molecule of the present invention may be used as the Agrobacterium strain for plant transformation in the present invention, and in particular, Agrobacterium tumefaciens GV3101 may be commonly used. The production of the transformed plant cell and transformed plant of the present invention can be carried out according to a method generally known in the art (Methods of Enzymology, Vol. 153, (1987)), and the method of introducing the nucleic acid molecule of the present invention into Agrobacterium can be carried out through various methods known to those skilled in the art, for example, particle bombardment, electroporation, transfection, lithium acetate method, and heat shock method. According to another aspect of the present invention, the present invention provides a plant cell transformed with the gene vector described above. In this specification, the term “plant cell” includes not only mature plants but also plant tissues capable of developing into mature plants and cells isolated from plant seeds. Plants that are the subject of transformation in the present invention include food crops including rice, wheat, barley, corn, soybeans, potatoes, wheat, red beans, oats and sorghum; vegetable crops including Arabidopsis thaliana, cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion and carrot; specialty crops including ginseng, tobacco, cotton, sesame, sugarcane, sugar beet, perilla, peanut and rapeseed; fruit trees including apple trees, pear trees, jujube trees, peaches, kiwis, grapes, citrus fruits, persimmons, plums, apricots and bananas; and floriculture including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips. and forage crops including, but not limited to, ryegrass, red clover, orchardgrass, alpha alpha, tall fescue, and perennial ryegrass. More specifically, the plant to be transformed in the present invention is a dicotyledoneae plant, and most specifically, the plant is Nicotiana Benthamiana. According to another aspect of the present invention, the present invention provides an antibody or antigen-binding fragment thereof that specifically binds to IL-4 receptor alpha (IL-4Rα) encoded by the plant-expressing nucleic acid molecule of the present invention described above. Since the anti-IL-4Rα antibody and its antigen-binding fragment encoded by the nucleic acid molecule of the present invention have already been described above, their description is omitted to avoid excessive duplication. IL-4 is a cytokine that induces differentiation of non-activated helper T cells (naive T cells, Th0 cells) into Th2 cells, and is an important regulator of humoral and adaptive immunity that stimulates activated B cells and T cells or differentiates B cells into plasma cells. IL-4R is a receptor for IL-4, and by binding to its ligand, IL-4, it induces signal transduction related to the production of IgE antibodies. IL-4 receptors exist in two types of complexes, of which Type 1 receptor exists as a complex of γ chain (γc) and IL-4Rα and is specific for IL-4, and Type 2 receptor exists as a complex of IL-4Rα and IL-13Rα1 and is specific for both IL-4 and IL-13. According to the present invention, the antigen-binding fragment of the anti-IL-4Rα antibody encoded by the plant-expressing nucleic acid molecule of the present invention described above may be the single-chain variable fragment (ScFv) of dupilumab. Dupilumab is DUPIXENT. ® It is a monoclonal antibody against IL-4Rα commercialized under the trade name, which inhibits signal transduction by blocking the binding of IL-4 and IL-4Rα in the type 1 IL-4 receptor or by blocking the dimerization reaction of IL-4α and the γ chain, and inhibits signal transduction by blocking the dimerization reaction of IL-4Rα and IL-13Rα1 in the type 2 IL-4 receptor. According to another aspect of the present invention, the present invention provides a composition for preventing or treating an inflammatory or autoimmune disease, comprising the antibody of the present invention or an antigen-binding fragment thereof as an active ingredient. According to another aspect of the present invention, the present invention provides a method for preventing or treating an inflammatory or autoimmune disease, comprising administering to a subject an antibody of the present invention or an antigen-binding fragment thereof as described above. The term “prevention” as used herein means inhibiting the occurrence of a disease or condition in a subject who has not been diagnosed as having the disease or condition but is susceptible to such disease or condition. As used herein, the term “treatment” means (a) suppressing the development of a disease, condition, or symptom; (b) alleviating a disease, condition, or symptom; or (c) eliminating a disease, condition, or symptom. When the composition of the present invention is administered to a subject, the antibody or antigen-binding fragment in the composition directly binds to IL-4Rα and inhibits IL-4 and IL-13 signaling, thereby suppressing, eliminating, or alleviating the progression of an excessive inflammatory response caused by them. Therefore, the composition of the present invention may be a composition for treating these diseases on its own, or may be administered together with other pharmacological ingredients and used as a therapeutic adjuvant for the diseases. Accordingly, the terms “treatment” or “therapeutic agent” as used herein include the meaning of “therapeutic adjuvant” or “therapeutic adjuvant.” As used herein, the term “administration” or “administer” refers to directly administering a therapeutically effective amount of the composition of the present invention to a subject so that the same amount is formed in the body of the subject. In the present invention, the term “therapeutically effective amount” means the content of a composition containing a pharmacological ingredient in the composition sufficient to provide a therapeutic or preventive effect to a subject to whom the pharmaceutical composition of the present invention is to be administered, and includes a “prophylactically effective amount”. The term “subject” as used herein includes, without limitation, a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, monkey, chimpanzee, baboon, or rhesus macaque. Specifically, the subject of the present invention is a human. In this specification, the term “inflammatory disease” is a general term for diseases whose main cause is an inflammatory response. In this specification, the term “autoimmune disease” is a general term for all diseases caused by excessive or unwanted immune responses, and specifically, it refers to a disease caused by a process in which the induction or continuous maintenance of self-tolerance is not performed normally, resulting in an immune response to self-antigens and damage to one’s own tissues. According to a specific embodiment of the present invention, the inflammatory or autoimmune disease is rhinitis, conjunctivitis, periodontitis, otitis media, pharyngitis, tonsillitis, pneumonia, gastric ulcer, gastritis, Crohn's disease, colitis, hemorrhoids, gout, ankylosing spondylitis, rheumatic fever, rheumatoid arthritis, polymyalgia rheumatica, lupus, fibromyalgia, psoriatic arthritis, osteoarthritis, periarthritis of the shoulder joint, tendinitis, tenosynovitis, peritendinitis, myositis, polymyositis, dermatomyositis, hepatitis, cystitis, nephritis, Sjogren's syndrome, multiple sclerosis, inflammatory bowel disease, asthma, type 1 diabetes, psoriasis, eczema, scleroderma, vitiligo, peripheral neuritis, uveitis, autoimmune cytopenia, autoimmune myocarditis, atopic dermatitis, primary cirrhosis, dry eye, Selected from the group consisting of Goodfeiter syndrome, autoimmune meningitis, Addison's disease, autoimmune parotitis, dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, celiac disease, Guillain-Barré syndrome, Hashimoto's disease, hemolytic anemia, myasthenia gravis, amyotrophic lateral sclerosis, pemphigus vulgaris, sarcoidosis, spondyloarthropathy, thyroiditis, vasculitis, myxedema, pernicious anemia, antiphospholipid syndrome, and graft-versus-host disease. According to a more specific embodiment of the present invention, the rhinitis is nasal polyps or sinusitis. The term “nasal polyp” in this specification refers to a pathological condition in which a grape-shaped benign edematous mucosa originating from the middle meatus (middle nasal passage) protrudes into the nasal cavity. In this specification, the term “sinusitis” refers to a chronic disease in which the natural openings called paranasal sinuses in the facial bones around the nose are blocked, causing secondary inflammation in the paranasal sinuses due to poor ventilation and excretion, and the inflammation worsens as purulent secretions accumulate. More specifically, the sinusitis is chronic sinusitis (CRS), and even more specifically, chronic sinusitis with nasal polyp (CRSwNP). According to a more specific embodiment of the present invention, the composition for preventing or treating an inflammatory or autoimmune disease of the present invention is a composition for nasal administration. The term “nasal administration” as used herein refers to a method of non-invasively administering a drug through the nasal cavity or the nasal mucosa. The antigen-binding fragment of the anti-IL-4Rα antibody, which is the pharmacological ingredient contained in the composition of the present invention, specifically, the ScFv of dupilomab, exhibits antigen-binding affinity equivalent to or higher than that of the full-length antibody while also exhibiting high permeability into epithelial cells. Therefore, by being locally administered to the nasal epithelial tissue, the pharmacological effect can be concentrated on the sinusitis lesion, thereby significantly improving the convenience of patient administration. The features and advantages of the present invention are summarized as follows: (a) The present invention provides an antigen-binding fragment of an anti-IL-4Rα antibody expressed in a plant cell and a composition for preventing or treating inflammatory or autoimmune diseases, comprising the antigen-binding fragment as an active ingredient. (b) The present invention expresses an antigen-binding fragment of an anti-IL-4Rα antibody, specifically, ScFv of dupilomab, in plant cells, thereby exhibiting binding affinity for IL-4Rα equivalent to or greater than dupilomab while exhibiting significantly increased epithelial cell permeability. (c) Accordingly, the antigen-binding fragment of the present invention can be usefully utilized as an excellent anti-inflammatory pharmacological ingredient that minimizes systemic effects on immune activity by locally administering it to epithelial tissue, while concentrating the pharmacological effect on the lesion site and greatly improving the convenience of patient administration. Figure 1 is a diagram showing the establishment of a vector for expressing Dup-ScFv in Nicotiana benthamiana, showing a schematic diagram of the vector construct with or without an ER retention signal sequence (HDEL) inserted (Figure 1a) and the process of producing dup-ScFv in N. benthamiana leaves by the Agrobacterium-mediated infiltration method (Figure 1b), respectively. Figure 2 is a diagram showing the expression and purification results of Dup-ScFv in Nicotiana benthamiana, comparing the antibody expression yields of HDEL-tagged plant-dup-ScFv and HDEL-untagged plant-dup-ScFv (Figure 2a) and the purification results of dup-ScFv containing 6 x His-tagged HDEL (Figure 2b), respectively. Figure 3 shows the results of the binding affinity measurement of Dup-ScFv and dupilumab to IL-4Rα. Figure 3a is a schematic diagram of the binding process between dup-ScFv and dupilumab and target cells. Figure 3b shows the results of flow cytometry analysis measuring the binding between dup-ScFv and dupilumab and target cells. Figure 3c shows the EC of Dup-ScFv and dupilumab. 50 This figure shows the results of 7-point curve flow cytometry to measure the values. The data were fitted using Graph Pad Prism software. Figure 3d is a sensogram showing the results of surface plasmon resonance (SPR) analysis of Dup-ScFv and dupilumab. Figure 4 is a diagram showing the results of a reporter assay confirming that IL-4Rα signaling is inhibited, showing a schematic diagram of a reporter cell line tracing the IL-4 / IL-13 signaling cascade (Figure 4a) and the results of a reporter assay quantitatively measuring the IL-4 / IL-13 signaling blocking activity of dupilumab and Dup-ScFv (Figure 4b), respectively. Figure 5 shows the results of evaluating the paracellular permeability and IL-4 / IL-13 signal blocking activity of Dup-ScFv in human nasal epithelial cells. Figure 5a is a schematic diagram of an experiment to evaluate the paracellular permeability of Dup-ScFv and dupilumab, and Figures 5b and 5c are the results of Western blot measuring the amount of Dup-ScFv and dupilumab that passed through the micropore membrane in the culture medium (Figure 5b) and the result expressing the paracellular permeability as a percentage based on the intensity of each band of Dup-ScFv and dupilumab (Figure 5c), respectively. Figures 5d and 5e show the results of observing the changes in the expression of MUC5AC (Figure 5d) and CCL26 (Figure 5e) when Dup-ScFv and dupilumab were treated in HNECs stimulated with IL-4 and IL-13, respectively. Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention. Example Experimental method Construction of a dupilumab-scFv expression vector in N. benthamiana. The heavy and light chain sequence information of dupilumab were obtained from drugbank (https: / / go.drugbank.com / drugs / DB12159). The Fab region of the heavy chain and the Fab region of the light chain were connected with a 4 x G4S linker. Long-chain cDNA was synthesized by Bioneer (Daejeon, Korea), and a 6 x His-tag was ligated in front of the stop codon for purification. For ER localization, the signal sequence of AtBiP2 (Arabidopsis thalianaluminal binding protein) and the ER retention signal sequence HDEL were inserted at the N-terminus and C-terminus, respectively. Codon optimization was performed for the final amino acid sequence to increase expression efficiency in plants (Sequence Listing, Sequences 21 and 22). The codon-optimized Dup-ScFv DNA sequence was cloned into the pEarlyGate 100 binary vector (p35S:AtBiP2 ss-plant optimized scFvandp35S:AtBiP2 ss-plant optimized scFv-HDEL). The prepared construct was transformed into Agrobacterium tumefaciens GV3101 competent cells by freeze-thawing. The transformed Agrobacterium was cultured in YEB broth containing 50 μg / ml kanamycin and 50 μg / ml rifampicin at 28°C for 16 h. The Agrobacterium was resuspended in infiltration solution (10 mM MES, pH 5.7, 10 mM MgCl2, and 500 μM acetosyringone) and injected into N. Injected into the abaxial side of benthamiana leaves
[0017] . The injected leaves were collected 2-3 days after culture and used in the experiment. Purification of dupilumab-scFv from N. benthamiana N. benthamiana leaves injected with the infiltrating solution were ground with a mortar and pestle and ground under liquid nitrogen to extract proteins. The obtained powder was suspended in protein extraction buffer [1 x PBS, 300 mM NaCl, 10 mM imidazole, and protease inhibitor cocktail (Abbkine)] and incubated at 4°C for 1 h. The protein suspension was centrifuged at 15,000 rpm at 4°C for 20 min, and the supernatant was filtered through Mracloth to remove debris and loaded onto Ni-NTA agarose resin (Qiagen). The column was washed with wash buffer (1 x PBS, 300 mM NaCl, 20 mM imidazole), and scFv was eluted with elution buffer (1 x PBS, 300 mM NaCl, 300 mM imidazole). After elution, imidazole was removed by centrifugation using a Silde-A-Lyzer Dialysis Casette (Thermo Scientific) and an Amicon Ultra Centrifugal filter (Sigma-Aldrich), and Dup-ScFv was concentrated. The purified Dup-ScFv was stored at -80°C. cell HEK293T and HEK293 cell lines were purchased from the Korea Cell Line Bank. These cells were cultured in DMEM high-glucose medium (Gibco, 11995-065) supplemented with 10% FBS (Gibco, 26140-079) and penicillin / streptomycin (Gibco, 15140-122) at 37°C in an incubator with 5% CO2. IL-4Rα cell binding assay Human IL-4Rα-overexpressing HEK293T cells were seeded at 2 x 10 in PCR tubes with 100 μl PBS. 5Cells were seeded in a 10-well plate (cells / tube). Cells were collected, washed with PBS, and incubated with Dup-ScFv or dupilumab. Cells bound to Dup-ScFv were washed and incubated with 6 x His-tag monoclonal antibody (Thermo Fisher Scientific, MA1-21315). Cells were then washed and incubated with Alexa Fluor-647 AffiniPure goat anti-mouse IgG (H+L) (Jackson ImmunoReasearch, 115-605-003) and Alexa Fluor-647 AffiniPure goat anti-human IgG (H+L) (Jackson ImmunoReasearch, 109-605-003) for 15 min, respectively. EC was analyzed by flow cytometry (BD FACSLyric). 50 And binding affinity was measured, and the data were analyzed with Graph Pad Prism and FlowJo. Surface plasmon resonance (SPR) SPR was performed using iMSPR-ProX. Biotinylated IL-4Rα was immobilized on the sensor chip (A-Dex100, DCAV1100) at a gap-take level of 169.7 response units (RUs). Binding assays were performed at seven Dup-ScFv concentrations (1.56 nM, 3.125 nM, 6.25 nM, 12.5 nM, 25 nM, 50 nM, and 100 nM) at a flow rate of 100 μl / ml. The sensor chip was regenerated with a regeneration buffer (10 mM glycine-HCl, pH 1.5) at a flow rate of 100 μl / ml. The equilibrium dissociation rate constant (k a , k d , and k D ), a 1:1 dynamic coupling model was used. Measurement of IL-4Rα inhibition using STAT6 reporter assay Puromycin-resistant lentiviral system for measuring human STAT6 and blasticidin-resistant system for measuring pSTAT6-induced luciferase were purchased from Addgene (#81950 and #35554, respectively) and used for lentiviral transfection of HEK293 cell lines. 5 x 10 4 Reporter cells were seeded in each well of a white 96-well plate and cultured with Dup-ScFv or dupilumab in DMEM at 37°C, 5% CO2 for 1 hour. IL-4 (Enzynomics, C008) / IL-13 (Enzynomics, C009) were then added to each well and cultured for 24 hours at 37°C, 5% CO2. After removing the medium, the cells were resuspended, washed with PBS, and lysed with 20 μl lysis buffer (Promega, E153A). Luciferase substrate (Promega, E1501) was added, and SpectraMax ® Random luminescence units were measured using an M5 luminometer (Molecular Devices). Intercellular permeability analysis Fully differentiated human nasal epithelial cells (HNECs) were used in the experiment. 50 μg / mL Dup-ScFv and 100 μg / mL dupilumab were co-treated on the apical side of HNECs in 100 μL medium, and 20 ng / μL IL-4 / IL-13 was treated on the basolateral side. Western blotting was performed after 48 h of incubation at 37°C and 5% CO2. Mouse anti-Histag monoclonal antibody (Invitrogen, MA1-21315) was used as the primary antibody against Dup-ScFv. Goat anti-mouse IgG-HRP (Jackson Immunoresearch, 115-034-003) and goat anti-human IgG-HRP (Jackson Immunoresearch, 109-035-003) were used as secondary antibodies against Dup-ScFv and dupilumab, respectively. qPCR analysis of inflammatory marker genes in HNEC mRNA was extracted from HNEC using Trizol (Favorgen, FATRR001). Chloroform (Sigma, C2432) was then added to perform phase separation of the extract. The upper liquid phase was collected, and mRNA was precipitated using isopropanol. Reverse transcription was performed on the isolated mRNA using the SuperiorScript III reverse transcriptase kit (Enzynomics, RT006). For quantitative PCR, a QuantStudio 3 real-time PCR instrument (Applied Biosystems) and AccuPower®2X Greenstar qPCR master mix (Bioneer, K-6251) were used. The primer sequences used are summarized in Table 2 below. Primer sequence FWATGGCTCGCTCGTTTGG (SEQ ID NO: 23) RV1 GTGGTGATGGTGATGATGTG (SEQ ID NO: 24) RV2 TCAAAGTTCGTCGTGGTGG (SEQ ID NO: 25) Statistical analysis Statistical analysis was performed using the independent-samples Student's t-test using GraphPad Prism 8 software. Data are expressed as mean ± standard deviation, and statistical significance was considered when *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001. Nonlinear regression curves were fitted using log vs. response and a three-parameter function, Dup-ScFv. Experimental results Establishment of a vector for expressing Dup-ScFv in Nicotiana benthamiana We designed a vector construct for transient expression of Dup-ScFv in N. benthamiana (Fig. 1a). The heavy and light chain nucleic acid sequences of dupilumab were codon-optimized for efficient antibody production in plants. Permanent expression was driven by the cauliflower mosaic virus-derived 35S promoter. To promote antibody expression in the endoplasmic reticulum (ER), a signal peptide derived from AtBiP2 (Arabidopsis thaliana luminal binding protein) and an ER retention signal sequence, HDEL, were inserted into the construct. Expression and purification of Dup-ScFv in Nicotiana benthamiana HDEL-tagged Dup-ScFv antibodies accumulated at higher levels than non-HDEL-tagged Dup-ScFv antibodies (Fig. 2a). According to the standard curve of the histidine control, the yield of plant-Dup-ScFv containing HDEL was 18.9 to 20.2 μg / g fresh leaf weight, whereas the yield of plant-Dup-ScFv without HDEL-tagged was 1.3 to 1.8 μg / g. Leaves injected with HDEL-tagged Dup-ScFv showed an expression level approximately 11.2-fold higher than that of non-HDEL-tagged Dup-ScFv. Considering the expression levels of antibodies, additional experiments were conducted with plant-Dup-ScFv containing HDEL. Antibody weight / total body weightDup-ScFv with HDEL (3 weeks old) 20.2 μg / gDup-ScFv with HDEL (5 weeks old) 18.9 μg / gDup-ScFv without HDEL (3 weeks old) 1.8 μg / gDup-ScFv without HDEL (5 weeks old) 1.3 μg / g Meanwhile, Dup-ScFv containing 6 x histidine-tagged HDEL was expressed from plants and successfully purified using Ni-NTA resin (Fig. 2b). According to the standard curve of nanobodies (histidine control), Dup-ScFv antibody produced from tobacco accounted for 104.56 ng of 18.6 μg of total soluble protein, accounting for 0.56% of the total protein. Binding affinity of Dup-ScFv and dupilumab to IL-4Rα KD values and EC of Dup-ScFv and dupilumab for IL-4Rα-expressing cells 50 The values were measured individually, and the results are summarized in Table 4 below. Dup-ScFvDupilumabEC 50 (nM)17.271.02K D (M)4.76E-101.33E-10 To measure the binding affinity of Dup-ScFv and dupilumab to target cells using flow cytometry, Dup-ScFv and dupilumab were treated with IL-4Rα-overexpressing HEK293T cells, respectively, followed by the addition of Alexa-647-labeled secondary antibodies. Untreated cells and cells treated with only secondary antibodies were used as controls. As a result, both Dup-ScFv and dupilumab showed very high binding affinity to IL-4Rα-overexpressing target cells (Fig. 3b). In addition, the EC of Dup-ScFv and dupilumab 50 A 7-point curve flow cytometry analysis was performed to measure the EC of Dup-ScFv. 50 The EC of dupilumab was 17.27 nM 50were 1.02 nM, respectively (Fig. 3c). Surface plasmon resonance (SPR) analysis of Dup-ScFv and dupilumab using immobilized IL-4Rα showed that while the general scFv conformational modification showed a 150- to 100-fold lower binding affinity decrease, Dup-ScFv (KD = 4.76E-10) showed a relatively similar binding affinity, which was about 3.5-fold lower than that of dupilumab (KD = 1.33E-10) (Fig. 3d). Reporter assay To determine whether IL-4Rα signaling is inhibited by Dup-ScFv and dupilumab, reporter assays were performed using HEK293 cell lines stably expressing human STAT6 and pSTAT6-induced luciferase. Results showed that both dupilumab and Dup-ScFv dose-dependently blocked IL-4 / IL-13 signaling (Fig. 4b). Transcellular permeability and IL-4 / IL-13 signaling blocking activity of Dup-ScFv in human nasal epithelial cells To evaluate the paracellular permeability of Dup-ScFv and dupilumab, Dup-ScFv and dupilumab were added to the upper part of 100 μL medium containing human nasal epithelial cells (HNECs), and IL-4 / IL-13 was treated underneath the micropore membrane (Fig. 5a). As a result, the amount of Dup-ScFv and dupilumab in the culture medium was measured by Western blotting, confirming that Dup-ScFv exhibited permeability through HNECs (Fig. 5b). The intensity of each band of Dup-ScFv and dupilumab was measured, and the result of expressing the paracellular permeability as a percentage showed that Dup-ScFv showed significantly higher permeability than dupilumab (Fig. 5c). In addition, when Dup-ScFv and dupilumab were treated in HNEC treated with IL-4 and IL-13, which induce inflammation, the expression of MUC5AC and CCL26, which had been increased, was observed to decrease again (Figures 5d-5e). While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.
Claims
1. A nucleic acid molecule for plant expression comprising: (1) A nucleic acid sequence encoding a heavy chain variable region including an HCDR1 region of the first sequence of the sequence listing, an HCDR2 region of the second sequence of the sequence listing, and an HCDR3 region of the third sequence of the sequence listing; (2) a nucleic acid sequence encoding a light chain variable region including the LCDR1 region of sequence 4, the LCDR2 region of sequence 5, and the LCDR3 region of sequence 6; and (3) A nucleic acid sequence encoding a linker sequence consisting of 12 to 24 consecutive amino acids connecting (1) and (2).
2. A nucleic acid molecule according to claim 1, characterized in that the nucleic acid molecule additionally comprises a nucleic acid sequence encoding a HDEL (His-Asp-Glu-Leu) peptide or a KDEL (Lys-Asp-Glu-Leu) peptide.
3. A nucleic acid molecule according to claim 1, wherein the linker comprises a flexible peptide linker represented by (GGGGS)n (n is an integer from 3 to 5).
4. A nucleic acid molecule according to claim 1, characterized in that the nucleic acid molecule is a deoxyribonucleotide.
5. A nucleic acid molecule according to claim 4, characterized in that the nucleic acid molecule additionally comprises an expression regulatory sequence selected from the group consisting of an SP6 promoter, a T7 promoter, a T3 promoter, a cauliflower mosaic virus (CaMV) 35S promoter, and a pigweed mosaic virus 35S promoter.
6. A nucleic acid molecule characterized in that the nucleic acid sequence encoding the heavy chain variable region in paragraph 1 is a nucleic acid sequence of sequence number 18.
7. A nucleic acid molecule characterized in that the nucleic acid sequence encoding the light chain variable region in paragraph 1 is a nucleic acid sequence of sequence number 19.
8. A nucleic acid molecule according to claim 1, characterized in that the nucleic acid molecule for plant expression is a nucleic acid sequence of sequence number 22.
9. A gene delivery system comprising the nucleic acid molecule of paragraph 1.
10. A plant cell transformed with the gene vector of paragraph 9.
11. An antibody or antigen-binding fragment thereof that specifically binds to IL-4 receptor alpha (IL-4Rα) encoded by the plant-expressing nucleic acid molecule of claim 1.
12. A composition for preventing or treating inflammatory or autoimmune diseases, comprising the antibody or antigen-binding fragment thereof of Article 11 as an active ingredient.
13. In the 12th paragraph, the inflammatory or autoimmune disease is rhinitis, conjunctivitis, periodontitis, otitis media, pharyngitis, tonsillitis, pneumonia, gastric ulcer, gastritis, Crohn's disease, colitis, hemorrhoids, gout, ankylosing spondylitis, rheumatic fever, rheumatoid arthritis, polymyalgia rheumatica, lupus, fibromyalgia, psoriatic arthritis, osteoarthritis, periarthritis of the shoulder joint, tendinitis, tenosynovitis, peritendinitis, myositis, polymyositis, dermatomyositis, hepatitis, cystitis, nephritis, Sjogren's syndrome, multiple sclerosis, inflammatory bowel disease, asthma, type 1 diabetes, psoriasis, eczema, scleroderma, vitiligo, peripheral neuritis, uveitis, autoimmune cytopenia, autoimmune myocarditis, atopic dermatitis, primary liver cirrhosis, A composition characterized in that it is selected from the group consisting of dry eye syndrome, Goodfeiter syndrome, autoimmune meningitis, Addison's disease, autoimmune parotitis, dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, celiac disease, Guillain-Barré syndrome, Hashimoto's disease, hemolytic anemia, myasthenia gravis, amyotrophic lateral sclerosis, pemphigus vulgaris, sarcoidosis, spondyloarthropathy, thyroiditis, vasculitis, myxedema, pernicious anemia, antiphospholipid syndrome, and graft-versus-host disease.
14. A composition according to claim 13, wherein the rhinitis is nasal polyps or sinusitis.
15. A composition according to claim 14, characterized in that the sinusitis is chronic sinusitis (CRS).
16. A composition according to claim 15, wherein the chronic sinusitis is chronic sinusitis with nasal polyp (CRS with nasal polyp, CRSwNP).
17. A composition according to claim 12, characterized in that the composition is a composition for nasal administration.
Citation Information
Patent Citations
IL-4Ralpha antibody and application thereof
CN110105451A
Methods for treating digitally-identified il-4 / il-13 related disorders
EP3992974A1
Method for controlling selectivity when producing para-aminophenol and 4,4'-oxydianiline using nitrobenzene
KR1020250041364A
Methods for treating chronic spontaneous urticaria by administering an il-4r antagonist
US20230146317A1