Gene delivery platform for multi-organ sequential targeting oral administration

Abstract

The present invention relates to a gene delivery platform for multi-organ sequential targeting oral administration, and to a gene delivery platform having a layer-by-layer chylomicron-mimicking self-assembly (lbl-CMSA), which is a lipid nanoparticle having a double-layer structure. A gene delivery platform for oral administration according to the present invention allows a second layer containing the outermost bile acid to exhibit high durability in the gastrointestinal tract even under various pH and enzyme actions, allows a gene drug encapsulated by an intestinal active target mechanism of bile acid to be primarily delivered to intestinal cells, and allows a first layer containing apolipoprotein to be delivered to lymphatic vessels through a chylomicron-mimicking pathway, thereby allowing the gene drug encapsulated therein to secondarily reach a target organ via a circulatory pathway in the body. Therefore, the gene delivery platform for oral administration of the present invention can be used as an effective oral administration formulation having increased bioavailability by loading, on the platform, a combination of gene therapeutic agents sequentially targeting the intestine and various organs.

Description

Gene delivery platform for multi-organ sequential targeted oral administration

[0001] The present invention relates to a gene delivery platform for multi-organ sequential target oral administration, and relates to a gene delivery platform having lbl-CMSA ((layer-by-layer chylomicrons-mimicking self-assembly), a lipid nanoparticle with a double-layer structure.

[0002] Gene therapy treats diseases by delivering therapeutic genes to target organs within the body, stimulating the expression of new proteins within the cells. Recently, numerous reports have documented the effective therapeutic effects of gene therapy on various diseases, including viral diseases and cancer. With the first gene therapy product commercialized in Europe, active research is underway in Korea. Indeed, several gene therapies have demonstrated excellent therapeutic effects in clinical trials, raising expectations for the development of gene therapies both domestically and globally. However, despite this attention, gene therapies rarely reach commercialization due to their lack of efficacy in early clinical trials. Key factors cited as contributing factors include safety and low gene delivery efficiency to target cells. Therefore, developing a gene delivery platform that safely delivers therapeutic genes to target cells and achieves high expression efficiency is essential for effective gene therapy.

[0003] Currently, viral gene delivery platforms with high delivery efficiency are being utilized. However, viral vectors such as retrovirus, adenovirus, and adeno-associated virus have many limitations in human application due to the complex manufacturing process, safety issues such as immunogenicity, infection potential, inflammation induction, non-specific DNA insertion, and limited nucleic acid size that can be accommodated. Therefore, non-viral gene delivery platforms are currently in the spotlight as an alternative to viral gene delivery platforms. Nonviral gene delivery platforms have the advantages of being able to be repeatedly administered with minimal immune responses, enabling specific delivery to specific cells, exhibiting excellent safety and storage stability, and being easy to mass-produce. Examples of these include cationic liposomes, such as N-[1-(2,3-dioleyloxy) propyl]-N,N,N-triethylammonium chloride (DOTMA), alkylammoniums, cationic cholesterol derivatives, and gramicidin. However, these too have disadvantages such as significantly high cytotoxicity due to poor biocompatibility and non-biodegradability, low blood stability, and low gene delivery efficiency.

[0004] Oral administration is the preferred route of administration in terms of patient compliance, and is particularly preferred for chronic diseases requiring long-term treatment, such as obesity or metabolic syndrome. Despite advances in drug formulations, a significant portion of orally administered drugs suffers from limited absorption or undergoes hepatic metabolism, reducing systemic bioavailability. In the field of oral gene delivery, the harsh environment of the gastrointestinal tract and the epithelial barrier formed by intestinal cells pose major barriers to the use of oral drugs. Specifically, the harsh environment of the gastrointestinal tract, comprised of enzymes, bile salts, low pH, and mucus, can degrade and destabilize genetic material used for gene delivery. Furthermore, the intestinal epithelial barrier restricts the absorption of large molecules, preventing nanoparticles or vectors containing genes from reaching target cells.

[0005] Although delivery vehicles such as nanoparticles and liposomes have been studied to enhance oral gene delivery, there is a continuing need for ideal carriers that can protect the drug from degradation and enhance cellular uptake.

[0006] Therefore, there is a need for a novel oral gene delivery platform that can deliver gene therapy orally with high patient compliance, exhibit stability even in the harsh environment of the gastrointestinal tract, and smoothly cross the epithelial barrier to achieve the desired effect in the target organ.

[0007] The present inventors were studying a novel oral gene delivery platform that is not only stable in the gastrointestinal environment when administered orally, but can also effectively deliver multiple gene drugs to be delivered sequentially to multiple organs. While studying this, they discovered that a gene delivery platform having a double-layer lipid nanoparticle, lbl-CMSA (layer-by-layer chylomicrons-mimicking self-assembly), can sequentially deliver target gene therapeutic agents to multiple organs, and completed the present invention.

[0008] Therefore, the purpose of the present invention is to provide a gene delivery platform for oral administration.

[0009] To achieve the above object, the present invention provides a gene delivery platform for oral administration, comprising: a) a first gene drug; b) a first layer comprising an apolipoprotein encapsulating a); c) a second intestinal-targeting gene drug loaded on the outside of b); and d) a second layer encapsulating b) and c) and comprising a bile acid.

[0010] The oral gene delivery platform according to the present invention has a second layer containing an outermost bile acid, which exhibits high durability in the gastrointestinal tract despite various pH and enzymatic actions, and allows the encapsulated gene drug to be primarily delivered to intestinal cells through the intestinal active targeting mechanism of the bile acid, and the first layer containing an apolipoprotein is delivered to the lymphatic vessel via the chylomicron-mimetic pathway, thereby allowing the encapsulated gene drug to secondarily reach the target organ through the body's circulation pathway. Therefore, the oral gene delivery platform of the present invention can be utilized as an effective oral administration formulation with enhanced bioavailability by loading a combination of gene therapeutic agents that sequentially target the intestine and various organs onto the platform.

[0011] Figure 1 is a schematic diagram of a process for manufacturing lbl-CMSA of the present invention (PBP: Prohibitin Binding Peptide, 9R: 9-mer arginine).

[0012] Figure 2a shows the average zeta size (d.nm) and zeta potential (mV) at each manufacturing step of lbl-CMSA, and Figure 2b shows TEM images of each step (scale bar = 100 nm).

[0013] Figure 3 shows the encapsulation efficiency (a) and drug loading efficiency (b) of the gene at each step (mean ± SD).

[0014] Figure 4 is a diagram showing the results of confirming the stability of lbl-CMSA (bilosome) in a harsh gastrointestinal environment. Figure 4a is a diagram showing the results of measuring the zeta average and zeta potential of lbl-CMSA (bilosome) at various pHs, and Figure 4b is a diagram showing the results of measuring the zeta average and zeta potential of lbl-CMSA (bilosome) and lbl-CMSA (liposome) without bile acid in the outermost layer, respectively. Figure 4c is a diagram showing the zeta average and zeta potential of lbl-CMSA (bilosome) and lbl-CMSA (liposome) in a FASSIF environment, and Figure 4d is a diagram showing the zeta average and zeta potential of lbl-CMSA (bilosome) and lbl-CMSA (liposome) in a FASSGF environment, respectively (mean ± SD).

[0015] Figure 5 shows the results of comparative evaluation of the release behavior of sh(FABP4 / 5) and siFABP2 over time under various pH conditions in lbl-CMSA (bilosome) and lbl-CMSA (liposome) (n=3).

[0016] Figure 6 shows the results of confirming the release behavior of sh(FABP4 / 5) and siFABP2 over time within FASSIF and FASSGF (n=3).

[0017] Figure 7a shows the results of flow cytometry analysis of fluorescence values ​​in Caco-2 cells after exposure of lbl-CMSA (bilosome) and lbl-CMSA (liposome) containing fluorescence-conjugated sh(FABP4 / 5)-Cy5.5 and siFABP2-FITC to various pH conditions and FASSIF and FASGGF conditions (n=3, mean±SD, ****P<0.0001).

[0018] Figure 7b is a schematic diagram of the transwell evaluation system of the present invention for evaluating the small intestinal cell permeability of lbl-CMSA (left) and a diagram showing the average fluorescence intensity in PBS collected from the lower chamber of the transwell (right).

[0019] Figure 8 is a diagram showing the results of measuring transepithelial / transendothelial electrical resistance (TEER) over time in caco-2 / HT29 cells treated with lbl-CMSA.

[0020] Figure 9a is a diagram showing the results of measuring the fluorescence values ​​of genetic materials transferred to cells by FACS after pre-treating Caco-2 / HT29 cells with antibodies targeting each receptor for 2 hours in order to identify receptors involved in uptake and then administering lbl-CMSA loaded with Cy5.5-sh(FABP4 / 5) and FITC-siFABP2.

[0021] Figure 9b shows confocal laser microscopy images of siFABP2 and sh(FABP4 / 5) in ASBT and lbl-CMSA (bilosomes) (yellow: anti-ABSST antibody, red: cell membrane, green: FITC-labeled sh(FABP4 / 5) and siFABP2, scale bar = 100 μm).

[0022] Figure 10 shows the results of in vitro analysis of the cellular uptake of lbl-CMSA (bilosome) in caco-2 / HT29 cell layers cultured with various inhibitors for 4 hours. The mean fluorescence intensity was determined 12 hours after treatment by flow cytometry (AM: amiloride, CPZ: chlorpromazine, β-CD: methyl-β-cyclodextrin).

[0023] Figure 11a shows a hybrid confocal laser microscopy image of caco-2 cells and their organelles (red) and the results of calculating the colocalization correlation between the delivered genetic material and organelles using the Pearson coefficient (scale bar = 100 μm).

[0024] Figure 11b is a schematic diagram showing the endocytosis mechanism of lbl-CMSA in intestinal cells.

[0025] Figure 12 is a diagram showing the results of flow cytometry analysis to confirm the delivery efficiency of lbl-CMSA after treatment with endocytosis inhibitors and transcytosis inhibitors in a transwell system.

[0026] Figure 13 shows the intracellular location of siFABP2 and sh(FABP4 / 5) labeled with FITC, which were traced using a confocal laser microscope after staining caco-2 cells with Golgi dye (a) and ER dye (b) (scale bar = 100 μm).

[0027] Figure 14 is a diagram showing the results of confirming the fluorescence signal and relative mRNA expression in intestinal cells and adipocytes after treating caco-2 / HT29 cells pretreated with various inhibitors with LPP and aLPP containing pDNA (pLuci) and GAPDH-targeting siRNA (siGAPDH).

[0028] Figures 15a and b are diagrams showing the results of measuring the fluorescence intensity of sh(FABP4 / 5) and siFABP2 in the feces of mice after oral administration of lbl-CMSA (bilosome) and lbl-CMSA (liposome) to mice.

[0029] Figures c and d of Figure 15 are diagrams showing the results of confirming drug delivery to the small intestine through fluorescence distribution 4 hours after oral administration of lbl-CMSA (bilosome) and lbl-CMSA (liposome) to mice.

[0030] Figures 15e and f are images showing cryopreserved block section imaging of the small intestine 4 hours after administration of the experimental substance.

[0031] Figure 16 is a diagram showing the results of confirming the delivery of genetic material to the mesenteric lymph nodes, inguinal lymph nodes, and small intestine after administration of lbl-CMSA with LPP (lbl-CMSA(LPP)) and lbl-CMSA with aLPP (lbl-CMSA-aLPP) using fluorescence images and measurements of their average fluorescence intensity.

[0032] Figure 17 shows the biodistribution of genetic materials analyzed by RT-qPCR and fluorescence images in the small intestine and visceral fat after oral administration of lbl-CMSA (a: sh(FABP4 / 5), b: siFABP2).

[0033] Figure 18 is a schematic diagram of the experimental process using a high-fat diet type 2 diabetic mouse model (a), a diagram showing the results of body weight change according to administration to each experimental group (b), blood sugar glucose level measurement (c), and free fatty acid measurement in feces (d).

[0034] Figure 19 is a diagram (a, b) showing the expression of genes related to fat digestion, absorption, and production according to administration of each experimental group through measurement of relative mRNA expression levels, and a diagram (c) showing the results of immunofluorescence staining of FABP2 and DGAT1 in the small intestine and immunofluorescence staining of FABP4, FABP5, and UCP1 in visceral fat tissue embedded in paraffin.

[0035] The present invention relates to an oral gene delivery platform comprising: a) a first gene drug; b) a first layer comprising an apolipoprotein encapsulating a); c) a second gut-targeting gene drug supported on the outside of b); and d) a second layer encapsulating b) and c) and comprising a bile acid.

[0036] Since the oral gene delivery platform of the present invention comprises a sequentially encapsulated double-layer structure, it may be referred to as a 'lbl-CMSA (layer-by-layer chylosome-mimicking self-assembly)' structure, and lbl-CMSA or lbl-CMSA (bilosome) may be used interchangeably herein as needed.

[0037] The above notation 'lbl-CMSA (bilosome)' is used to emphasize that the oral gene delivery platform of the present invention includes a second layer comprising bile acids.

[0038] The oral administration gene delivery platform of the present invention can be expressed in the form of lbl-CMSA (second gene drug-first gene drug) depending on the drug loading, and can be expressed as, for example, lbl-CMSA (siFABP2-sh(FABP4 / 5)).

[0039] In addition, in the oral administration gene delivery platform of the present invention, a composition comprising a) a first gene drug; and b) a first layer comprising an apolipoprotein encapsulating a) may be referred to as an apolipoprotein-coated lipopeptoplex (hereinafter, 'aLPP'). On the other hand, a comparative delivery system that encapsulates the first gene drug in a lipid layer that does not include an apolipoprotein is referred to as 'LPP'.

[0040] Hereinafter, each component of the oral administration gene delivery platform of the present invention will be described in more detail.

[0041] In the present invention, the gene delivery platform for oral administration comprises a second layer comprising aLPP and a second gene contained within the outer surface of the aLPP and the inner surface of the second layer. The second layer may be a layer comprising a bile acid, such as a bile acid molecule.

[0042] A bilosome is a vesicle that acts as a transport enhancing molecule to facilitate the transport of lipid molecules across the mucosa. The bilosome of the present invention comprises bile acids, including but not limited to cholic acid and chenodeoxycholic acid, conjugated products thereof with glycine or taurine (e.g., glycocholic acid and taurocholic acid), derivatives thereof including deoxycholic acid and ursodeoxycholic acid, and salts of each of these acids.

[0043] The above-mentioned billosomes may be incorporated with an amphiphilic substance that causes the billosomes to assume a negative charge. For example, a substance that helps to stabilize and effectively disperse the billosomes may be incorporated, and preferably, acidic substances such as higher alkanoic acids and alkenoic acids (e.g., palmitic acid, oleic acid), or other compounds containing an acidic group including a phosphate, for example, sulfate monoesters such as dialkyl phosphates (e.g., dicetyl phosphate or phosphatidic acid or phosphatidyl serine) and higher alkyl sulfates (e.g., cetyl sulfate) may be used.

[0044] Additionally, the bilosome component may be mixed with a suitable hydrophobic substance of high molecular weight capable of forming a bilayer (e.g., a steroid, e.g., a sterol (e.g., cholesterol)). In some embodiments, the presence of a steroid may aid in bilayer formation, upon which the physical properties of the bilosome depend.

[0045] Therefore, preferably, the second layer d) of the present invention may include bile acid, phospholipid, and cholesterol. The bile acid may be a bile salt such as sodium glycocholate (SGC), sodium taurocholate (STC), or sodium deoxycholate (SDC), and the phospholipid may be lecithin, lysolecithin, phosphatidylethanolamine, lysophosphatidylethanolamine, dioleoylphosphatidylethanolamine (DOPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), palmitoyloleoyl-phosphatidylethanolamine (POPE), palmitoyloleoylphosphatidylcholine (POPC), egg phosphatidylcholine (EPC), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG). It may be at least one selected from the group consisting of dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleiolphosphatidylglycerol (POPG), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, palmitoyloleoyl-phosphatidylethanolamine (POPE), 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), phosphatidylserine, phosphatidylinositol, sphingomyelin, cephalin, cardiolipin, phosphatidic acid, cerebroside, and dicetyl phosphate.

[0046] The second layer of the present invention may preferably include bile acid, distearoylphosphatidylcholine (DSPC), dipalmitoylphosphatidylcholine (DPPC), distearoyl-phosphoethanolamine (DSPE) and cholesterol, and in a preferred embodiment, may include DPPC: DSPC: DPPE: sodium deoxycholate = 1:1:0.2:1 (molar ratio).

[0047] The bile acid contained in the second layer of the present invention can target the apical sodium-dependent bile acid transporter (ASBT) of enterocytes. Specifically, the bile acid can bind to the ASBT receptor and promote the absorption of orally administered drugs into enterocytes.

[0048] In addition, the second layer of the oral gene delivery platform of the present invention is designed to be resistant to the harsh intestinal environment and to maintain stability in the intestinal environment during oral administration. The harsh intestinal environment includes the acidic and alkaline pH of the gastrointestinal tract and various enzymes that function in the gastrointestinal tract. In the present invention, the oral gene delivery platform of the present invention, which includes the second layer containing bile acids as the outermost layer, was confirmed to be able to maintain stability in FSSIF (Fasted State Simulated Intestinal Fluid), which mimics the physiological environment of the small intestine, including various pH conditions and bile acids, phospholipids, pancreatin, and other components; and FSSGF (Fasted State Simulated Gastric Fluid) environments, which include hydrochloric acid, enzymes such as pepsin, and other acidic enzyme conditions of the stomach.

[0049]

[0050] The second genetic drug of c) of the present invention may be characterized as a genetic drug targeting intestinal cells, which may be released into the cytoplasm by shedding the second layer of d) after intestinal cell absorption.

[0051] The oral gene delivery platform of the present invention, upon reaching the gastrointestinal environment after oral administration, has a second layer containing bile acids present at the outermost layer that targets ASBT of enterocytes, thereby incorporating into the endosomes of the enterocytes and effectively delivering the gene delivery platform into the interior of the enterocytes. After being absorbed by the enterocytes, the second layer is shed, and the second gene drug and aLPP contained within the oral gene delivery platform are released into the cytoplasm of the enterocytes.

[0052] Second-generation gene drugs released into the cytoplasm are drugs that target the intestines and can achieve the desired disease treatment, improvement, or relief effect by regulating gene expression in the intestines.

[0053] The gene drug targeting the intestine may be at least one selected from the group consisting of various gene therapeutic agents, nucleic acids such as siRNA, shRNA, antisense RNA, miRNA, and ribozymes that can act by targeting various targets present in the intestine. The second gene drug may be appropriately selected depending on the type of disease to be treated, for example, siFABP2 that suppresses intestinal fatty acid influx or siTACE that suppresses intestinal TNF-α-mediated inflammatory response may be selected for the treatment of obesity, diabetes, and steatohepatitis, and siMLCK1 that can suppress the penetration of harmful microorganisms and toxins that cause hepatotoxicity by restoring the intestinal epithelial cell barrier may be selected for the treatment of liver cirrhosis, but is not limited thereto.

[0054]

[0055] When the outermost second layer is shed during the process of incorporation into intestinal cells of the above oral administration gene delivery platform, aLPP is released together with the second gene drug.

[0056] The above aLPP refers to a nanocapsule comprising a) a first gene drug; and b) a first layer comprising an apolipoprotein encapsulating a), wherein the lipid layer comprising the apolipoprotein may comprise an apolipoprotein, a phospholipid, and cholesterol.

[0057] The above phospholipids are lecithin, lysolecithin, phosphatidylethanolamine, lysophosphatidylethanolamine, dioleoylphosphatidylethanolamine (DOPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), palmitoyloleoyl-phosphatidylethanolamine (POPE), palmitoyloleoylphosphatidylcholine (POPC), egg phosphatidylcholine (EPC), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleiolphosphatidylglycerol (POPG), 16-O-monomethyl PE, 16-O-dimethyl It may be at least one selected from the group consisting of PE, 18-1-trans PE, palmitoyloleoyl-phosphatidylethanolamine (POPE), 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), phosphatidylserine, phosphatidylinositol, sphingomyelin, cephalin, cardiolipin, phosphatidic acid, cerebroside, and dicetylphosphate.

[0058] The lipid layer of the aLPP of the present invention may preferably include apolipoprotein, distearoylphosphatidylcholine (DSPC), dipalmitoylphosphatidylcholine (DPPC), distearoyl-phosphatidyl-ethanolamine (DSPE), and cholesterol, and as a preferred embodiment, may include apolipoprotein: DSPC: DPPC: DSPE: cholesterol = 0.01:1:1:0.2:1 (molar ratio).

[0059] The oral gene delivery platform of the present invention may be characterized by promoting chylomicron-mimetic transcytosis by configuring a first layer comprising the apolipoprotein of b) above. The apolipoprotein mimics chylomicrons to enable transcytosis using the Golgi apparatus, thereby enabling the first gene drug to circulate in the body by avoiding the first pass through the liver through lymph node absorption, thereby improving bioavailability.

[0060] The first layer, containing the apolipoprotein, is absorbed into the lymph nodes via transcytosis and then degraded by lipase, a lipid-degrading enzyme present in the body's circulatory system. This releases the first gene drug, encapsulated within the first gene drug and absorbed into the lymph nodes. Since the first gene drug can be effectively delivered into the body's circulatory system, target-specific treatment can be achieved by selecting a drug that targets cells necessary for disease treatment.

[0061] To achieve the above purpose, the first genetic drug may be delivered in a form conjugated to a gene delivery vehicle. The gene delivery vehicle may include, without limitation, any nucleic acid delivery vehicle known in the art capable of forming a complex with a nucleic acid structure, and may be at least one selected from the group consisting of cationic lipids, cationic polymers, cationic polypeptides, and cationic polysaccharides.

[0062] The cationic lipids include cholesterol, polyethylene glycol (PEG), N-[1-(2,3-dioleyloxy)propyl]-N,N,N-triethylammonium chloride (DOTMA), N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate (DOTAP), 3β-[N-N',N'-dimethylaminoethane)carbamoyl]cholesterol (DC-Chol), N-decyl-N,N-dimethyldecane-1-aminum bromide (DDAB), heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102), 4-(dimethylamino)-butanoic acid, (6Z, 9Z, 28Z, 31Z)-heptathriacontamin 6,9,28,31-tetraen-19-yl 4-(dimethylamino) butanoate (D-Lin-MC3-DMA), (4-hydroxybutyl)azanediyl]di(hexane-6,1-diyl) bis(2-hexyldecanoate) (ALC-0315), 3α-[N-(N',N'-dimethylaminoethane)carbamoyl] cholesterol hydrochloride (DC-Chol), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyl carbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-dilinoleoyl-3-dimethylaminopropane (DLin-DAP), 2,2-Dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleoyl-3-dimethylammonium propane (DODAP), bis-guanidinium-spermidine-cholesterol (BGTC), 1,1'-(2-(4-(2-((2-(bis(2-hydroxydecyl) amino) ethyl)(2-hydroxydecyl) amino) ethyl) piperazin-1-yl) ethylazanediyl) didodecan-2-ol (C12-200), Nt-butyl-N'-tetradecyl amino-propionamidine (diC14-amidine), N-(1,2-dimyristyl oxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N-(1-(2,3-dioleyl oxyl) propyl)-N-2-(sperminecarboxamide)ethyl)-N,N-dimethylammonium trifluoroacetate (DOSPA), aminopropyl-dimethyl-bis(dodecyloxy)-propanaminium bromide (GAP-DLRIE), or may be in the form of a liposome-based or lipid-based carrier such as a liposome, a phytosome, an ethosome, a lipid nanoparticle, a lipid-like nanoparticle, a lipid emulsion, a lipoplex, or a lipid micelle.

[0063] The cationic polymers are DEAE-dextran, poly-L-lysine (PLL), poly-L-ornithine (PLO), poly(amidoamine), PAMAM, poly-(propylenimine), PPI, polyacrylimide (PPI), polyethylenimine (PEI), branched PEI (BPEI), linear PEI (LPEI), polymethacrylic acid N,N-dimethylaminoethyl ester (PDMAEMA), poly(β-amino ester) (Poly(β-amino ester) (PBAE), branched PBAE, linear PBAE), poly(4-hydroxy-L-proline ester) ester (PHP), poly[α-(4-aminobutyl)-l-glycolic acid] (PAGA), poly(δ-valerolactone), PVL, Aminated PAHA (aminated poly(α-hydroxy acids)), polyphosphoester (PPE), polylactide (poly(lactic acid)), PLA, cationic polyactides (CPLAs), polycarbonates, polycarbonates generated from carbon dioxide (CPCHC), polyurethanes (PUs), conjugated polymers (CPs), HCPE-PEI, histone, gelatin, protamine, cyclodextrin or chitosan,The above polymer may be at least one selected from the group consisting of polymersomes, polymeric nanoparticles, dendrimers, nanospheres, polyplexes, and polymeric micelles.

[0064] The cationic polypeptides are selected from the group consisting of protamine, cell penetrating peptide (CPP), chimeric CPP, pH-dependent CPP, nucleoline, spermine, spermidine, poly-L-lysine (PLL), basic polypeptide, poly-arginine, transportan, MPG peptide, HIV (human immunodeficiency virus)-binding peptide, trans-activating transcriptional aCtivator (tat), HIV-1 tat (HIV), tat-derived peptide, Oligoarginine, penetratin family member, penetratin, Antennapedia-derived peptide, Drosophila Antennapedia peptide (pAntp), Islet-1 peptide (pIsl), antimicrobial-derived CPP, Buforin-2, bactenecin 7 peptide fragment 15-24 (Bac715-24), syncytin B (SynB), SynB(1), vascular endothelial cadherin derived cell penetrating peptide (pVEC), human calcitonin (hCT)-derived peptide,Consisting of sweet arrow peptide (SAP), model amphipathic peptide (MAP), KALA, PptG20, proline-rich peptide, Lologomere, Arginine-rich peptide, Calcitonin-peptide, Fibroblast growth factors (FGF), Lactoferrin, histone, VP22 peptide, Herpes simplex virus (HSV), VP22 (Herpes simplex), protein transduction domain (PTD), lysine-rich peptide, Pep-1, and L-oligomer There may be more than one type selected from the military.

[0065] The above cationic polysaccharide may be chitosan, glycol chitosan or a derivative thereof.

[0066] Therefore, for example, the gene carrier of the present invention may be at least one selected from the group consisting of chitosan, glycol chitosan, protamine, polylysine, polyarginine, polyamidoamine (PAMAM), polyethylenimine, polypropyleneimine, dextran, hyaluronic acid, albumin, high molecular weight polyethyleneimine (PEI), polyamine, and polyvinylamine, and in this case, the gene carrier may be in the form of a polyamidoamine (PAMAM) dendrimer, a polypropyleneimine (PPI) dendrimer, or a polylysine dendrimer.

[0067] In addition, when the gene delivery vehicle is poly-arginine, the poly-arginine may be R4 to R17, preferably R4 to R10, and may be used in a form combined with a first gene drug, which is a targeting sequence that targets specific cells. In a preferred embodiment, the poly-arginine may have a structure including ATS and R9 (arginine) peptides, and may have a structure in which arginine is combined with an adipocyte targeting sequence (ATS). In one embodiment of the present invention, shFABP4 / 5, which targets adipocytes, was used as the first gene drug, and an adipocyte-targeting non-viral gene delivery vehicle (PBP9R) was used together to target and deliver adipocytes. The sequence of the used PBP9R peptide, which includes nine arginines and a prohibitin-binding peptide KGGRAKD, is as follows: C-KGGRAKD-RRRRRRRRR-C (SEQ ID NO: 7).

[0068] The first gene drug of the present invention and the gene delivery system can form a mutual complex through electrical interaction, and the gene / delivery system complex formed in this way can specifically bind to target cells to enhance the therapeutic effect, and for example, can more specifically bind to macrophages in visceral fat that play an important role in the inflammatory response of obesity-induced metabolic syndrome to significantly increase the therapeutic effect of obesity or obesity-induced metabolic syndrome.

[0069] The first gene drug and the gene delivery vehicle can form a complex at a mass ratio of 1:2 to 5, and can preferably form a complex stably at a mass ratio of 1:3.

[0070] The first gene drug of the present invention can be selected without limitation as a gene drug that targets a specific cell for treating a target disease. For example, the gene drug can be at least one selected from the group consisting of nucleic acids capable of inhibiting a target gene, such as siRNA, shRNA, antisense RNA, miRNA, and ribozyme. The first gene drug can be appropriately selected depending on the type of disease to be treated, and for example, for the treatment of obesity, diabetes, and steatohepatitis, it can be shFABP4 / 5 that can improve lipid metabolism by inhibiting FABP in adipose tissue, shTACE that can inhibit TNF-alpha-mediated inflammatory response in adipose tissue, and pHO-1 that can suppress inflammation and promote brown adipocyte formation through HO-1 overexpression in adipose tissue. In this case, ATS9R can be selected as the gene delivery agent. Additionally, for the treatment of inflammatory diseases including, for example, rheumatism or inflammatory bowel disease, shTACE capable of suppressing TNF-alpha-mediated inflammatory responses can be selected and used together with a TKPR9R gene delivery system containing a TKPR sequence targeting macrophages.

[0071] That is, the oral gene delivery platform of the present invention can sequentially release a second gene drug capable of targeting intestinal cells and a first gene capable of being released through the body's circulation pathway and targeting target cells, and thus can be utilized for multi-organ targeting.

[0072] For example, as in one embodiment of the present invention, the first genetic drug may be delivered in a form linked to a fat cell-targeting non-viral gene delivery vehicle, and the intestine-targeting second genetic drug of c) may be at least one selected from the group consisting of siFABP2, siTACE, and siMLCK1. In a more specific embodiment of the present invention, the a) first genetic drug may be a base sequence that inhibits the expression of FABP4 or FABP5, and the second genetic drug may be a base sequence that inhibits the expression of FABP2, which may be a gene delivery platform for oral administration for the treatment of obesity or obesity-induced metabolic syndrome.

[0073] According to the above embodiment of the present invention, by inhibiting FABP2 through the second genetic drug, absorption of dietary lipids in the gastrointestinal tract is inhibited, and by specifically inhibiting the expression of FABP 4 / 5 expressed in fat cells through the first genetic drug, accumulation of lipids is inhibited, and the effect of improving insulin resistance and glucose resistance can be achieved.

[0074] Fatty acid binding proteins (FABPs) are transport proteins for fatty acids and other lipophilic substances such as eicosanoids and retinoids, and are involved in the transport of fatty acids between the intracellular and extracellular membranes. More than nine types of FABPs are known, and they are known to be highly expressed in tissues related to fat metabolism. In particular, FABP4 (A-FABP) and FABP5 (E-FABP) are known to be highly expressed in adipose / macrophage cells, and are highly associated with obesity as well as obesity-related metabolic diseases such as diabetes and arteriosclerosis.

[0075] In the present invention, a nucleic acid construct capable of suppressing the FABP4 and FABP5 genes expressed in adipocytes was used as the first genetic drug. Any nucleic acid construct capable of achieving the purpose of the present invention can be used without limitation. For example, a polynucleotide encoding an RNA interference (RNAi) molecule specific for the FABP4 and FABP5 target genes can be used without limitation. The RNA interference molecule comprises an effector sequence that is substantially complementary or completely complementary to the mRNA of FABP4 or FABP5 or a variant thereof, and through such complementarity, can form a specific binding to the mRNA of FABP4 or FABP5 under intracellular conditions.

[0076] The effector sequence of the present invention may be a short hairpin RNA (shRNA). An shRNA is an RNA sequence that forms a tight hairpin turn that can be used to silence gene expression through RNA interference. When the nucleic acid construct of the present invention is introduced into a target cell as a vector, the shRNA is expressed. The shRNA hairpin structure is cleaved by the cell into siRNA, which then binds to the RNA-induced silencing complex (RISC). This complex specifically binds and cleaves mRNA, and a substantially complementary siRNA sequence binds to the target miRNA, thereby inducing inhibition of mRNA expression.

[0077] The nucleic acid construct, which is the first genetic drug of the present invention, may include an effector complement sequence substantially complementary to the effector sequence. In the present invention, the effector sequence may be used interchangeably with the antisense sequence in the shRNA structure, and the effector complement sequence may be used interchangeably with the sense sequence in the shRNA structure. Accordingly, the effector complement sequence of the present invention may be a sequence that is completely complementary to the effector sequence, or may have 1 to 6 mismatches, and may be a variant thereof that has at least 85%, preferably 90%, or more sequence identity to the sequence that is completely complementary to the effector sequence.

[0078] In addition, since the nucleic acid structure of the present invention requires a mismatch at the very first nucleotide of the 5' end of the sense sequence due to the characteristics of the miR backbone-shRNA, the first sequence in the sequence of the FABP4 or FABP5 target gene adjacent to the 5' end of the polynucleotide represented by SEQ ID NO: 1 or 2 is changed to C if the nucleotide at that position is A or T, or to A if it is C or G. Through this, a form that includes one more base causing a mismatch at the 5' end of the polynucleotide represented by SEQ ID NO: 1 or 2 can be included in the nucleic acid structure. For example, when the target gene TAGGTAGGAGATAACAAGTAT represented by SEQ ID NO: 1 is included in the nucleic acid structure, it can be included in the nucleic acid structure in the form of the ATAGGTAGGAGATAACAAGTAT sequence causing a mismatch at the 5' end. That is, it can be included in the nucleic acid structure in the form of 5'-A or C-(polynucleotide encoding RNA interference (RNAi) molecule specific for FABP 4 target gene)-3'.

[0079] In addition, the nucleic acid structure of the present invention may additionally include a loop sequence located between the effector sequence and the complement sequence. 'TAGTGAAGCCACAGATGTA' (SEQ ID NO: 8) was used as the loop sequence, and shRNA was designed based on this in the sense-loop-antisense order.

[0080] The first genetic drug of the present invention may be in the form of a non-viral vector for delivering a heterologous polynucleotide to a target cell, and may be a vector, such as a plasmid, comprising a polynucleotide sequence encoding an RNA interference (RNAi) molecule specific for the FABP4 or FABP 5 target gene.

[0081] In the present invention, an interference molecule comprising an effector sequence of at least 15 adjacent nucleotides substantially complementary to at least one region of a polynucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2 is used. The effector sequence refers to a complementary antisense sequence that forms a specific binding to the mRNA of FABP4 or FABP5.

[0082] In a preferred embodiment of the present invention, a nucleic acid structure may be used, which comprises a sense RNA represented by SEQ ID NO. 3 and an antisense RNA represented by SEQ ID NO. 4 as siRNA sequences complementary to FABP4 represented by SEQ ID NO. 1 as a first genetic drug, an RNA interference molecule; and / or a sense RNA represented by SEQ ID NO. 5 and an antisense RNA represented by SEQ ID NO. 6 as siRNA sequences complementary to FABP5 represented by SEQ ID NO. 2.

[0083] Therefore, when the above-mentioned oral gene delivery platform is orally administered to an obese subject, it has an excellent effect in reducing body weight and suppressing lipid accumulation in the obese subject.

[0084] In the present invention, the obesity-induced metabolic disease may be at least one selected from the group consisting of type 2 diabetes, hyperlipidemia, non-alcoholic fatty liver disease, arteriosclerosis, and hypertension. These diseases are diseases caused by lipid accumulation, weight gain, insulin resistance, and glucose resistance induced by obesity, and can be improved and treated by the composition of the present invention, which has the effect of suppressing lipid accumulation, reducing weight, and improving insulin resistance and glucose resistance.

[0085]

[0086] The composition of the present invention can be prepared in various forms by mixing it with a pharmaceutically acceptable carrier. For example, for oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc.

[0087] Meanwhile, examples of carriers, excipients, and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxy benzoate, talc, magnesium stearate, or mineral oil. In addition, fillers, anticoagulants, lubricants, wetting agents, fragrances, preservatives, and the like may be additionally included.

[0088]

[0089] The numerical values ​​described herein should be interpreted as including the equivalent range unless otherwise specified.

[0090]

[0091] Hereinafter, preferred examples are presented to aid in understanding the present invention. However, the following examples are provided solely to facilitate a better understanding of the present invention, and the scope of the present invention is not limited by the examples.

[0092]

[0093] Example 1. Fabrication of a multi-cell-targeted oral gene nanoplatform - lbl-CMSA (layer-by-layer chylomicrons-mimicking self-assembly)

[0094] 1.1 Step-by-step lbl-CMSA manufacturing method

[0095] To prepare a double-layer lipid nanoparticle, lbl-CMSA (layer-by-layer chylomicrons-mimicking self-assembly), oligopeptoplexes were prepared by first condensing 10 μg of plasmid DNA (sh(FABP4 / 5)) with 30 μg of adipocyte-targeting peptide (9R-based oligopeptide, PBP9R) in distilled water for 30 min (plasma DNA: oligopeptide = 1:3 in weight ratio). The sequence of the used PBP9R peptide, which contains nine arginines and the prohibitin-binding peptide KGGRAKD, is as follows: C-KGGRAKD-RRRRRRRRR-C (SEQ ID NO: 7).

[0096] The target sequences of shFABP4 and shFABP5 used, and the sense and antisense sequences used to suppress the expression of FABP4 and FABP5 are as follows, and vectors were manufactured and encapsulated based on these. The sequence of the vector used is shown in SEQ ID NO: 9. 'TAGTGAAGCCACAGATGTA' (SEQ ID NO: 8) was used as the loop sequence, and shRNAs were designed based on this in the sense-loop-antisense order.

[0097] shFABP4FABP4 Target SequenceTAGGTAGGAGATAACAAGTAT (SEQ ID NO: 1)Sense Strand (5-3)TAGGTAGGAGATAACAAGTATUU (SEQ ID NO: 3)Antisense Strand (3-5)AUACUUGUUAUCUCCUACCUAUU (SEQ ID NO: 4)shFABP5FABP5 Target SequenceTAGGATCATCCCTTTGGTTAA (SEQ ID NO: 2)Sense Strand (5-3)TAGGATCATCCCTTTGGTTAAUU (SEQ ID NO: 5)Antisense Strand (3-5)UUAACCAAAGGGAUGAUCCUAUU (SEQ ID NO: 6)

[0098] To enable the delivery of therapeutic genes into the systemic circulation, encapsulation using apolipoproteins was performed using a chylomicron-mimicking strategy. To load the prepared oligopeptoplexes into the capsules, a thin lipid membrane layer containing apolipoproteins (apolipoprotein: DSPC: DPPC: DSPE: cholesterol = 0.01:1:1:0.2:1 (molar ratio)) was dispersed in a chloroform: methanol (2:1, volume ratio) solution and evaporated in a rotary evaporator at 50°C for 30 minutes. The mixture was placed in a fume hood overnight to allow the remaining organic solvent to evaporate. The lipid membrane was hydrated in distilled water and extruded through a PTPE membrane (pore size 0.4 μm), thereby preparing apolipoprotein-coated lipopeptoplexes (aLPPs) by coating the oligopeptoplexes with apolipoproteins.

[0099] To deliver therapeutic genes targeting intestinal cells, aLPP was encapsulated in a lipid membrane layer containing bile acids. Specifically, to prepare lbl-CMSA containing aLPP and intestine-targeting siRNA inside, a bile acid-based lipid membrane (DPPC: DSPC: DPPE: Sodium deoxycholate = 1:1:0.2:1 (molar ratio)) was dispersed in a chloroform: methanol (2:1, volume ratio) solution and evaporated in a rotary evaporator at 50°C for 30 min. siRNA was purchased from Thermo-fisher and used. s65828 was used for in vivo mouse experiments and s4971 for in vitro Caco-2 cell experiments.

[0100] After the bile acid-based lipid membrane layer (Bilosome layer) was prepared, siRNA and aLPP dissolved in PBS were used for hydrating the thin membrane layer at room temperature for 2 hours, and then extruded through a PTPE membrane (pore size 0.8 μm) to finally obtain lbl-CMSA. Each step of preparing lbl-CMSA of the present invention and the nanoparticle composition of each step are shown in Fig. 1.

[0101]

[0102] 1.2 Morphology and Characterization of Manufactured lbl-CMSA Nanoparticles

[0103] The particle size distribution and surface charge of the manufactured nanoparticles were determined by dynamic light scattering using a Zetasizer Nano ZS (Malvern Instruments). The morphological characteristics of the nanoparticles were confirmed using TEM (EM9120, Carl Zeiss Vision GmbH) at the Korea Basic Science Institute. The zeta size and zeta potential of lbl-CMSA at each manufacturing step are shown in Fig. 2a, and the TEM image of the manufactured particles is shown in Fig. 2b.

[0104]

[0105] 1.3 Measurement of gene encapsulation efficiency and drug loading efficiency

[0106] Oligopeptoplexes, aLPP, and lbl-CMSA prepared in each step of loading 10 μg of sh(FABP 4 / 5) and 10 μg of siFABP2 into lbl-CMSA as in Example 1.1 were centrifuged at 50,000 g for 30 minutes using an ultracentrifuge, and the supernatants were collected to quantitatively measure the remaining DNA and siRNA. Plasmid DNA was quantitatively measured using Taqman-based real-time PCR with specific primer sequences and probes, siRNA was detected according to the instructions of the siRNA quantitative measurement kit, and the synthesized siRNA was quantitatively measured using deoxythymine d(TT) as the 3' off-chain. The encapsulation efficiency and drug loading effect of the genes included in each step of forming the double layer were measured using the above methods. The formulas used to measure drug loading and encapsulation efficiency are as follows.

[0107]

[0108] [Formula 1]

[0109] Drug loading = Weight of therapeutic gene in NPs (μg) / Weight of lipidated NPs (μg) X 100%

[0110]

[0111] [Formula 2]

[0112] Encapsulation efficiency = Weight of therapeutic gene in NPs (mg) / Total therapeutic gene added during NP manufacturing process (mg) X 100%

[0113]

[0114] The encapsulation efficiency and drug loading ratio of siRNA and shRNA encapsulated in each layer were confirmed in the oligopeptoplex, aLPP, and lbl-CMSA stages, respectively, and are shown in Figures 3a and b.

[0115] As shown in a and b of Fig. 3, the encapsulation efficiency of sh (FABP4 / 5) at each stage was about 99.99% in the oligopeptide stage, about 92.27% in the aLPP stage, and about 89% in the final lbl-CMSA stage, and siFAB2 encapsulated outside the aLPP and inside the bilosome layer was loaded at about 84% in lbl-CMSA, confirming that continuous drug loading and encapsulation were properly performed.

[0116]

[0117] Example 2. Drug release effect of lbl-CMSA in a stomach-mimicking environment

[0118] In order to confirm the drug release kinetics of the manufactured lbl-CMSA and to confirm the effect of bile acids containing bile acids in the outermost shell, the lbl-CMSA of the present invention having bile acids was referred to as lbl-CMSA (bilosome), and lbl-CMSA (liposome) not containing bile acids was prepared and used in the experiment. Hereinafter, lbl-CMSA without a separate designation means lbl-CMSA (bilosome).

[0119] lbl-CMSA(liposome) is a delivery vehicle manufactured without including bile acids in the outermost layer, unlike lbl-CMSA(bilosome), and is a nanoparticle loaded with chylomicron-mimicking lipo-oligopeptoplexes and siFABP2 into lbl-CMSA(liposome), a core-shell liposome-based nanoparticle. 10 mg of lbl-CMSA(bilosome) and lbl-CMSA(liposome) were dispersed in PBS with 5 different pHs (pH2, 4, 7, and 8) at 37°C.

[0120]

[0121] 2.1 Stability verification under gastrointestinal simulating conditions including pH and enzyme conditions

[0122] Gastric fluid, containing bile acids, phospholipids, enzymes, and other lipid components, interferes with the delivery of orally administered lipid nanoparticles and causes low drug delivery efficiency. To confirm the stability of lbl-CMSA (bilosomes) in gastric fluid, we performed stability tests in Fasted State Simulated Intestinal Fluid (FSSIF, biolabelent), which mimics the physiological environment of the small intestine, including bile acids, phospholipids, pancreatin, and other components, and Fasted State Simulated Gastric Fluid (FSSGF, biolabelent), which contains hydrochloric acid, enzymes such as pepsin, and other acidic enzyme conditions of the stomach. 10 mg of lbl-CMSA were cultured in the target volume. At each time point, lbl-CMSA was collected by ultracentrifugation at 14,000 rpm for 20 minutes. In order to confirm the conformational stability of lbl-CMSA (bilosome) and lbl-CMSA (liposome) under various pH PBS buffer conditions simulating the gastrointestinal environment, the results of Z average value (d.nm) and Z potential (mV) were confirmed and are shown in Fig. 4a and b, respectively. In addition, the change in Z average over time in FASSIF (Fasted State Simulated Intestinal Fluid) solution (d) and the change in Z average over time in FASSGF (fasted state simulating gastric fluids) solution are shown in Fig. 4c and Fig. 4d, respectively.

[0123] As shown in Figs. 4a and 4b, lbl-CMSA (bilosome) maintained its particle size and zeta potential under various pH conditions, but lbl-CMSA (liposome) showed an increase in Z-average, a neutralization of zeta potential, and the formulation was destroyed. In addition, as can be seen in Figs. 4c and 4d, when incubated with gastrointestinal enzymes for 24 hours, lbl-CMSA (bilosome) was stable, maintaining a Z-average of 300 d.nm even in the presence of enzymes, but lbl-CMSA (liposome) was confirmed to rapidly collapse in shape after only 2 hours of incubation.

[0124]

[0125] 2.2 Determination of drug residue under gastrointestinal simulating conditions including pH and enzyme conditions

[0126] To evaluate gene release, specific primer sets for sh(FABP4 / 5) and siFABP2 were designed, and the residual genetic material remaining in lbl-CMSA (bilosomes) and lbl-CMSA (liposomes) was detected. To evaluate the therapeutic gene remaining inside the nanoparticles, pDNA and siRNA were isolated using the Blood & Tissue DNeasy kit. The isolated pDNA and siRNA were quantitatively measured using methods for drug loading and encapsulation efficiency. After incubating lbl-CMSAs under various pH and enzymatic digestion conditions, the residual amounts of siFABP2 and sh(FABP4 / 5) remaining in lbl-CMSA (bilosomes) were compared with those of lbl-CMSA (liposomes), and the results are shown in Fig. 5.

[0127] As shown in Fig. 5, all nanoparticles showed delayed gene release patterns for 24 hours at neutral pH, but lbl-CMSA (bilosome) released less than 30% of both shRNA and siRNA, whereas lbl-CMSA (liposome) released more than half of the genes. In addition, shRNA and siRNA of lbl-CMSA (liposome) were rapidly released by more than 80% after 4 hours of incubation under acidic pH conditions and after 24 hours of incubation under basic pH conditions. On the other hand, lbl-CMSA (bilosome) of the present invention did not show rapid drug release even under harsh acidic and basic conditions.

[0128]

[0129] Additionally, the results of evaluating the release behavior of sh(FABP4 / 5) and siFABP2 over time in FASSIF and FASSGF solution environments are shown in Fig. 6.

[0130] As shown in Fig. 6, lbl-CMSA (bilosome) containing bile acids in its outermost shell showed a pattern of slowly releasing both sh (FABP4 / 5) and siFABP2 compared to lbl-CMSA (liposome).

[0131] The above results demonstrate that siFABP2 and sh(FABP 4 / 5) encapsulated within the lbl-CMSA(bilosome) core-shell are protected from the gastrointestinal environment after harsh oral administration, including low pH and enzymatic degradation, and that bile acids present in the outermost layer of lbl-CMSA(bilosome) can play a role in protecting therapeutic agents in the gastrointestinal tract. This suggests that lbl-CMSA(bilosome) can be utilized as an oral drug delivery therapeutic carrier.

[0132]

[0133] Example 3. Confirmation of the small intestinal epithelial cell mucosal layer penetration activity of lbl-CMSA.

[0134] The present invention confirmed that the lbl-CMSA containing bile acids in the outermost layer can be utilized as a drug delivery vehicle by protecting encapsulated therapeutic agents in the harsh gastrointestinal environment. To confirm that they can be delivered to the intestine after oral administration, their effects on small intestinal epithelial cells were additionally confirmed using fluorescently tagged lbl-CMSA (sh(FABP4 / 5)-Cy5.5 and siFABP2-FITC). Caco-2 cells and HT29 cells were purchased from ATCC, Virginia, USA, and high-equivalent DMEM was purchased from WelGENE, Seoul. Cell culture was performed in a medium containing 10% FBS and 1% penicillin-streptomycin (100 U ml-1). lbl-CMSA (bilosomes) and lbl-CMSA (liposomes) were treated with in vitro epithelial cell models under various environmental conditions and cultured for 4 hours. After exposing lbl-CMSA (liposome) and lbl-CMSA (bilosome) containing a fluorescence-coupled gene to various environments, they were recovered and delivered to caco-2 cells. The results of measuring the fluorescence values ​​are shown in Fig. 7a.

[0135] In addition, a Transwell assay system was prepared to analyze the transcytosis of genetic material by including Caco-2 cells and HT29 cells in the upper chamber and treating them with lbl-CMSA (liposomes) and lbl-CMSA (bilosomes). PBS in the lower chamber was used to check the change in fluorescence intensity in the lower chamber after treating with fluorescently labeled lbl-CMSA (liposomes) and lbl-CMSA (bilosomes). Caco-2 cells and HT29 cells were seeded at an initial ratio of Caco-2: HT29 = 9:1 on a Transwell® polycarbonate filter support (0.4 μm pore size, 12 mm diameter) at a density of 2.5 × 10 5Cells were cultured for at least 21 days before analysis, and the medium was replaced with fresh DMEM every 2 days. Before use, the TEER value (~400 Ω x cm2) was measured to confirm the formation of a monolayer.

[0136] The results of evaluating the intestinal cell permeability of lbl-CMSA using the TRANSWELL model seeded with Caco-2 / HT29 moolayer are shown in Fig. 7a.

[0137] As shown in Fig. 7a, the fluorescence values ​​delivered to caco-2 cells were measured, and the lbl-CMSA (liposome) showed low cell uptake in all pH environments and gastric fluid-simulating conditions, but the lbl-CMSA (bilosome) of the present invention showed remarkably superior cell delivery efficiency to both sh(FABP4 / 5) and siFABP2 even when cultured in a gastric fluid-simulating environment.

[0138] As shown in Fig. 7b, Caco-2 / HT29 cells formed Caco-2 / HT29 monolayers and mucosal layers after 21 days of culture in the transwell, and lbl-CMSA (liposomes) were captured therein. Therefore, no significant signal changes were observed in the experimental group in which lbl-CMSA (liposomes) was added to the upper chamber. On the other hand, the lbl-CMSA (bilosomes) of the present invention allowed the bile acid components contained in the outermost layer to pass through the mucosa by targeting various receptors in epithelial cells. After 12 hours of culture, the sh(FABP4 / 5)-Cy5.5 signal of lbl-CMSA (bilosomes) in the PBS in the lower chamber was upwardly expressed, and the siFABP2-FITC signal still maintained the basal level. These results indicate that lbl-CMSA (bilosome) has high gene delivery efficiency in a gastrointestinal mimicking environment, and that the internal sh(FABP4 / 5) encapsulated in apolipoprotein-coated lipopeptoplex (aLPP) passes through the enterocytes and is released, but the siRNA of lbl-CMSA (bilosome) remains inside.

[0139]

[0140] Example 4. Confirmation of the intestinal cell internalization mechanism of lbl-CMSA (bilosome)

[0141] 4.1 Confirmation of the cell delivery mechanism of lbl-CMSA

[0142] Experiments were conducted to confirm cellular internalization and chylomicron-mimetic transcytosis of lbl-CMSA. To analyze the enterocyte passage mechanism of aLLP, Caco-2 / HT29 cells were seeded in transwell plates, and the tight junction pore size of the Caco-2 / HT29 monolayer was set to 8 Å, which limits nanoparticle transport under steady-state conditions. Tight junction integrity was monitored to confirm that nanoparticles were transported via a paracellular transport mechanism. The EDTA-treated group was used as a control.

[0143] As shown in Figure 8, no opening of tight junctions was observed in any experimental group after 24 hours, indicating that aLPP moves through transcytosis rather than transcellular movement.

[0144]

[0145] 4.2 Identification of receptors and mechanisms involved in the transcytosis of lbl-CMSA

[0146] Dietary fats, such as triacylglycerol (TAG) and cholesterol esters, are absorbed by various receptors on small intestinal cells by conjugating with micellar bile acids. Assuming that the bile acids present in the outer layer of the lbl-CMSA of the present invention are absorbed into intestinal cells through receptors that mediate intracellular absorption, experiments were conducted to identify the receptors involved in absorption.

[0147] Experiments were conducted targeting SR-B1, which is involved in the selective uptake and transport of cholesterol as a target receptor, NPC1L1, which affects cholesterol homeostasis, CD36, which affects lipid transport and small intestinal cholesterol absorption as another scavenger receptor, and ASBT, which plays a role in bile acid absorption and transport. Caco-2 / HT29 cells were pretreated with antibodies specific for each receptor for 2 hours to block each receptor, and then lbl-CMSA (bilosome) loaded with Cy5.5-sh(FABP4 / 5) and FITC-siFABP2 was administered, and the fluorescence value was analyzed using FACs. lbl-CMSA (liposome) was used as a control group. The change in fluorescence intensity according to the blockade of each receptor and the confocal laser microscopy image of ASBT receptor 2 hours after treatment with lbl-CMSA (bilosome) are shown in Figure 9.

[0148] As shown in Figure 9a, lbl-CMSA (liposome) showed little cellular uptake of either siFABP2 or sh(FABP4 / 5), demonstrating that bile acids mediate mucosal penetration. Furthermore, in the experimental group where the ASBT receptor on enterocytes was inhibited, a marked decrease in siFABP2 and sh(FABP4 / 5) fluorescence signals was observed, unlike other receptors. This confirms that ASBT is a receptor that interacts with bile acids to mediate transcytosis.

[0149] As shown in Fig. 9b, the fact that lbl-CMSA (bilosome) is identified at a common location with ASBT in the confocal laser microscopy images of ASBT and lbl-CMSA (bilosome) indicates that lbl-CMSA (bilosome) targets ASBT receptors on intestinal cells.

[0150]

[0151] To further investigate the pathway of lbl-CMSA (bilosome) after ASBT targeting, we pretreated small intestinal epithelial cells with various inhibitors, and observed the changes in fluorescence intensity of sh(FABP4 / 5) and siFAB2 accordingly. The inhibitors used were amiloride, an inhibitor of macropinocytosis, chlorpromazine, an inhibitor of clathrin-mediated endocytosis, and methyl beta-cyclodextrin, an inhibitor of caveolae-mediated endocytosis. The results of evaluating the cellular uptake of lbl-CMSA in caco-2 / HT29 cell layers pretreated with each inhibitor for 4 h are shown in Figure 10. The mean fluorescence intensity was analyzed by flow cytometry after 12 h.

[0152] As shown in Fig. 10, a decrease in fluorescence signal due to decreased cellular uptake of sh(FABP4 / 5) and siFAB2 was observed only in the methyl beta-cyclodextrin (β-CD) and ASBT inhibitor (aASBT) treatment groups, indicating that the internalization of lbl-CMSA (bilosome) into small intestinal cells is dependent on ASBT and caveolae-mediated endocytosis.

[0153]

[0154] Through the above-described mechanism, we predicted that the shell of lbl-CMSA (bilosome) interacts with the endosomal membrane, and through their fusion, lbl-CMSA (bilosome) is incorporated into the endosome of the intestinal cell and then released into the cytoplasm. To confirm this, endosomes and lysosomes were stained, and their organelles and the organelles of the nanoparticles were identified. The colocalization correlation between Caco-2 cells and their organelles, and genetic material and organelles, calculated using the Pearson coefficient by confocal microscopy, is shown in Figure 11a.

[0155] As shown in Fig. 11a, sh(FABP4 / 5) and siFABP2 were initially identified in endosomes and then successfully released into late endosomes and lysosomes, confirming that exogenous genetic material inside the nanoparticles was digested and delivered, as schematically illustrated in Fig. 11b.

[0156]

[0157] Example 5. Mechanism of action of siFABP2 and aLPP in lbCMSA (bilosome)

[0158] Experiments were conducted to determine whether lbCMSA (bilosomes) could target intestinal cells during aLPP transcytosis and sequentially release siFABP2 into the cytoplasm to deliver therapeutic genes. The upper chamber of a transwell was coated with Caco-2 / HT29 cells, and the lower chamber was seeded with differentiated 3T3-L1 adipocytes. The medium in the lower chamber was also treated with lipoprotein lipase.

[0159] lbl-CMSA (bilosomes) was applied to Caco-2 / HT29 cells pretreated with various endocytosis and transcytosis inhibitors for 4 h. Caco-2 cells in the lower chamber were harvested after 4 h and analyzed by flow cytometry 24 h after treatment.

[0160] The flow cytometry results of lbl-CMSA after treatment with endocytosis and transcytosis inhibitors in a transwell system are shown in Figure 12.

[0161] As shown in Figure 12, amiloride, a macropinocytosis inhibitor, did not affect the uptake efficiency of lbl-CMSA (bilosomes). However, methyl beta-cyclodextrin, a caveolae-mediated endocytosis inhibitor, significantly downregulated the uptake of siFABP2 and pLuci.

[0162] Chlorpromazine, a clathrin-mediated endocytosis inhibitor, did not inhibit absorption, indicating that these pathways are not involved in the intestinal endothelial cell absorption pathway. Brefeldin A, a trans-Golgi function inhibitor, or monensin, a Golgi-ER trafficking inhibitor, disrupted the Golgi apparatus and inhibited vesicular tracking and exocytosis, resulting in the capture of siFABP2 and aLPP in caco-2-HT29 cells after 24 h.

[0163] To identify the location of each genetic messenger and cellular organelle, they were visualized. Confocal laser microscopy images of caco-2 cells stained with Golgi dye (top) and ER dye (bottom) are shown in Figure 13. Caco-2 cells were stained with BODIPY reagent to visualize the ER and Golgi bodies. FITC-labeled sh(FABP4 / 5) or siFABP2 were used to track their intracellular location.

[0164] As shown in Figure 13, sh(FABP4 / 5) within aLPP colocalized with the ER and Golgi after internalization. In contrast, siFABP2 dissociated from intracellular organelles and remained in the cytoplasm. Taken together, these results suggest that aLPP and siFABP2 dissociate after endosomal escape, and only aLPP is transported via the chylomicron-like pathway.

[0165]

[0166] After the siRNA of the lbl-CMSA (bilosome) of the present invention was effectively delivered to small intestinal cells, an experiment was conducted to confirm that it exhibited a target gene suppression effect and that this effect was specific to the target cells. GAPDH-targeting siRNA (siGAPDH) and luciferase mRNA expression pDNA (pLuci) were encapsulated within the lbl-CMSA (bilosome) of the present invention.

[0167] Additionally, to confirm whether chylomicron-mimetic transcytosis is performed by apolipoprotein after internalization, lipo-oligopeptoplexes (LPP) without apolipoprotein coating were synthesized and comparatively evaluated. Nanoparticles with lipo-oligopeptoplexes of the present invention are denoted as 'aLPP', and nanoparticles without a coating layer containing apolipoprotein are denoted as 'LPP' to distinguish them. Caco-2 / HT29 cells were pretreated with various inhibitors used above, and nanoparticles were treated for 24 hours. The results of confirming the relative mRNA expression level of GAPDH in the caco-2 / HT29 cell layer after treating inhibitor-treated caco-2 / HT29 upper chamber cells with aLPP and LPP are shown in Figure 14.

[0168] As shown in Figure 14, both experimental groups showed that siGAPDH was released into the cytoplasm of enterocytes after internalization, leading to a significant decrease in GAPDH mRNA in the Caco-2 cell layer. Furthermore, amiloride did not affect these results (Figure 14, top). However, the caveolae-dependent endocytosis inhibitor methyl-β-cyclodextrin treatment group suppressed siRNA expression, indicating that endocytosis was inhibited. On the other hand, chlorpromazine, a clathrin-mediated endocytosis inhibitor, did not affect uptake, indicating that clathrin-mediated vesicular tracking is not involved in Caco-2 cells. Furthermore, disruption of the Golgi apparatus by brefeldin A did not affect the efficiency of siGAPDH, suggesting that siGAPDH release occurs before lipo-oligopeptoplexes enter the ER / Golgi pathway.

[0169] In contrast, aLPP and LPP showed differences in luciferase expression patterns in the Caco-2 / HT29 cell layer and the underlying cell layer. In the Caco-2 / HT29 cell layer, aLPP did not express pLuci except when treated with transcytosis inhibitors such as brefeldin A and monensin, in which aLPP remained in the intestinal cells.

[0170] Consequently, aLPP remaining in the intestinal cells translocates to the nucleus after being released from the lipid shell and produces luciferase in the Caco-2 / HT29 cell layer. However, lipo-oligopeptoplex LPP without apolipoprotein coating expressed pLuci in the Caco-2 / HT29 cell layer, and this was the same even when treated with amiloride and chlorpromazine.

[0171] In summary, we can confirm that apolipoprotein-coated lipo-oligopeptoplexes (aLPP) significantly upregulate the efficiency of transcytosis through the ER / Golgi-mediated mechanism.

[0172] After aLPP passes through the enterocytes, lipoprotein lipase in the cell medium strips the apolipoprotein-coated lipid layer from the lipo-oligopeptoplexes, and cell-penetrating peptide-mediated gene delivery proceeds in the lower chamber. However, when the upper layer of Caco-2 cells was treated with methyl beta-cyclodextrin, an inhibitor of caveolae-dependent endocytosis, or brefeldin A, an inhibitor of trans-Golgi, the expression of the luciferase gene was significantly suppressed. This was because aLPP either failed to enter the enterocytes or was trapped in the enterocytes (Fig. 14, bottom).

[0173] LPP showed a marked decrease in luciferase expression level compared to aLPP of the present invention, indicating that LPP, i.e., the experimental group without the apolipoprotein coating layer, has a reduced transcytosis effect in intestinal cells, a reduced bioavailability, and a reduced off-target effect.

[0174]

[0175] Example 6. Confirmation of enhanced oral gene delivery bioavailability of lbl-CMSA using core-shell bilosomal structure and chylomicron-mimicking apolipoprotein coating strategy.

[0176] The bilosome layer of lbl-CMSA not only encapsulates and protects genetic material from the harsh gastrointestinal environment, but also allows targeting of intestinal cells via ASBT-bile acid-mediated endocytosis. To investigate the fate of genetic materials absorbed in the gastrointestinal tract, fluorescently labeled lbl-CMSA (bilosomes) and bile acid-free lbl-CMSA (liposomes) were orally administered to C57BL / 6 mice, and feces were collected at each time point. The collected feces were homogenized and analyzed with a spectrophotometer to identify fluorescent signals derived from unabsorbed or degraded nanoparticles. The results of fluorescent signal measurement, small intestine images, and fluorescent signal analysis of cryopreserved samples are shown in Figure 15.

[0177] As shown in Figures 15a and b, when lbl-CMSA (liposome) was administered, high fluorescence signals for sh(FABP 4 / 5) and siFABP2 were observed in the feces, whereas the lbl-CMSA (bilosome) of the present invention exhibited high absorption rates. This indicates that the bile acids present in the lipid layer can effectively protect the delivered genetic material from pH and digestive enzymes, and that the formulation of the present invention can be maintained until it reaches the ASBT receptor of enterocytes and safely delivered to the small intestine. However, liposome structures without a bile acid coating layer are easily destroyed, and the delivered drug is degraded in the GI tract, absorbed as a single nucleotide, or eliminated.

[0178] Furthermore, the images of the entire GI tract in Figs. 15 c and d confirm that sh(FABP 4 / 5) and siFABP2 are uniformly distributed within the small intestine of the mouse, demonstrating that lbl-CMSA (bilosome) is very well absorbed into enterocytes. Imaging of cryopreserved block sections of the small intestine after administration of the experimental substances in Figs. 15 e and f again demonstrates that lbl-CMSA (bilosome) signals are present in the small intestine, which is the target cell.

[0179]

[0180] After lbl-CMSA carrying siFABP2 and aLPP is taken up into enterocytes, aLPP is transported to lymph nodes via specialized cells called lacteals present in the villi of the small intestine. Apolipoprotein-coated aLPP was successfully released from enterocytes via the chylomicron-mimetic ER / Golgi pathway in vitro. Apolipoprotein not only promotes transcytosis but also allows aLPP to enter the lymphatic pathway, thereby avoiding the first-pass hepatic clearance, which degrades the drug.

[0181] To confirm the role of apolipoprotein, lbl-CMSA with apolipoprotein-coated aLPP and lbl-CMSA with apolipoprotein-free LPP were orally administered to mice, and their distribution in mesenteric lymph nodes and inguinal lymph was confirmed through fluorescence imaging. The fluorescence images of the mesenteric lymph nodes, inguinal lymph nodes, and small intestine, and the results of analysis of the average fluorescence intensity are shown in Fig. 16.

[0182] As shown in Fig. 16, siFABP2 signals (FITC) were clearly identified throughout the entire gastrointestinal tract 4 hours after administration, indicating that lbl-CMSA with aLPP successfully delivered the endogenous therapeutic gene into enterocytes. On the other hand, sh(FABP4 / 5) showed different fluorescence imaging expression patterns in the two experimental groups. Specifically, the lbl-CMSA experimental group with apolipoprotein-coated aLPP in the lymph nodes showed 5-fold stronger fluorescence signals in the mesenteric lymph nodes and 4.6-fold stronger fluorescence signals in the inguinal lymph nodes.

[0183]

[0184] It was also predicted that apolipoprotein-coated aLPP would prevent liver uptake. To confirm this, mesenteric lymph and liver were isolated from mice orally administered aLPP and LPP, and fluorescence in the small intestine and intestines was analyzed.

[0185] In the aLPP experimental group, sh(FABP4 / 5) showed a weaker fluorescent signal in the liver compared to the LPP experimental group, but a strong signal in the mesenteric lymph nodes. In contrast, LPP showed a stronger signal in the liver. This indicates that LPP hardly circulates in the blood and accumulates in the liver. Therefore, lbl-CMSA containing apolipoprotein-coated aLPP not only successfully targets small intestinal cells, but also mediates exocytosis for circulation to lymph nodes through apolipoprotein pre-coating, indicating that it can significantly increase the bioavailability of therapeutic genes.

[0186]

[0187] Example 7. Confirmation of long-term distribution in a high-fat diet mouse model

[0188] A high-fat diet-induced type 2 diabetes model was generated by feeding C57BL / 6 mice a 60% kcal high-fat diet for 12 weeks, and lbl-CMSA loaded with sh(FABP4 / 5)-FITC and siRNA-Cy5.5 was administered orally. The gastrointestinal tract, epididymal white adipose tissue (epiWAT), subcutaneous white adipose tissue (subWAT), and major organs were collected 0.2, 1, 4, 8, 24, and 48 h after lbl-CMSA administration, and the remaining sh(FABP4 / 5) and siFABP2 were analyzed by RT-PCR. For quantification, sh(FABP4 / 5) was analyzed using a column-based genomic DNA prep kit, and siFABP2 was analyzed using an RNA extraction kit.

[0189] As shown in Fig. 17, sh(FABP4 / 5) was initially highest in the gastrointestinal tract, and accumulated in epiWAT and subWAT after entering the systemic circulation, showing the highest concentration accumulation in epiWAT. On the other hand, siFABP2 was most abundant in the gastrointestinal tract at all time points, and no distribution was observed in other organs. In addition, according to in vivo imaging, Cy5.5-labeled sh(FABP4 / 5) and FITC-labeled siFABP2 showed similar distribution patterns for 1 hour, but the signals changed after 4 hours. After 4 hours, sh(FABP4 / 5) was most abundant in epiWAT, and showed the highest expression at 24 hours. On the other hand, siFABP2 was located in the gastrointestinal tract. Therefore, it was confirmed that siFABP2 of the lbl-CMSA of the present invention targets the gastrointestinal tract, and sh(FABP4 / 5) contained in aLPP can effectively target epiWAT.

[0190]

[0191] Example 8. Confirmation of anti-obesity and insulin resistance improvement effects in a high-fat diet-induced type 2 diabetic mouse model.

[0192] To confirm the therapeutic effect of FABP2 / 4 / 5 inhibition loaded into lbl-CMSA, a high-fat diet-induced type 2 diabetes mouse model was created by feeding 6-week-old C57BL / 6J mice a 60 kcal% high-fat diet for 12 weeks. These mice were orally administered 0.5 mg / kg sh(FABP4 / 5) in the lbl-CMSA formulation every other day for 6 weeks. Afterwards, body weight changes and insulin resistance experiments due to drug administration were performed. After further observation for 4 weeks, the mice were sacrificed at week 11 for in vitro analysis. The insulin tolerance test was performed by measuring the initial blood glucose level (Accu-Chek Active model GC kit (Roche Diagnostics GmbH, USA)) after a 6-hour fast. Insulin (0.75 units / kg) was injected intraperitoneally, and blood samples were collected and measured at 0, 30, 60, 90, and 120 minutes after injection for the insulin tolerance test. As a control group, lbl-CMSA (siFABP2) loaded with only siFABP2 and lbl-CMSA (sh(FABP4 / 5)) loaded with only sh(FABP4 / 5) were administered in the same manner. The feces of each experimental group were collected daily, stirred in PBS, and free fatty acids were detected in the feces using a fatty acid detection kit. The experimental process using a high-fat diet type 2 diabetic mouse model and the measured body weight changes, insulin resistance, and free fatty acids in the feces are shown in Figure 18.

[0193] As shown in Fig. 18b, the lbl-CMSA(siFABP2) or lbl-CMSA(sh(FABP4 / 5)) treatment groups showed a 25.89% and 31.94% decrease in body weight, respectively, but the lbl-CMSA(siFABP2-sh(FABP4 / 5)) group, which is the lbl-CMSA treatment group of the present invention in which all FABP2 / 4 / 5 are loaded, showed a 36.61% decrease in body weight over 10 weeks. In addition, as shown in Fig. 18c, the lbl-CMSA(siFABP2-sh(FABP4 / 5)) administration group showed the best insulin resistance improvement effect.

[0194] As shown in Fig. 18d, the analysis of free fatty acids in the feces collected from mice showed that the lbl-CMSA (siFABP2-sh (FABP4 / 5)) and lbl-CMSA (siFABP2) administration groups changed the intestinal environment by blocking the delivery of fatty acids into the body by downregulating FABP2. Although the diets of all groups were constant, the AUC values ​​were almost 1.5 times higher at week 10, resulting in high fatty acids in the feces of these experimental groups. In other words, it was confirmed that siFABP2 effectively blocks fat absorption in the body by blocking the delivery of fatty acids in the small intestine.

[0195]

[0196] To confirm the gene silencing effect of FABP in small intestinal cells and adipocytes, we isolated each organ and analyzed the relative gene expression levels. Enterocytes, the absorptive cells of the small intestine, play an essential role in the digestion and absorption of dietary fat. The proteins used in the experiment are involved in lipid metabolism and transport within small intestinal cells. Specifically, FBAP2 is involved in the intracellular transport of fatty acids, DGAT1 packages dietary fat into TAGs, and ATGL and MGL initiate the degradation of TAGs. FABP4 and FABP5 play important roles in lipogenesis and are associated with the expression of key brown fat genes, particularly UCP1, PRDM16, PPARγ, and PGC1α. UCP1 is a key protein in brown adipogenesis, and PPARγ is a key transcription factor that promotes adipogenesis and brown adipocyte differentiation. PRDM16 is a key co-regulatory transcription factor that determines the fate of brown adipocytes. PPARγ and PRDM16 jointly activate the expression of brown adipogenic genes. FABP4 and FABP5 may indirectly influence UCP1 expression by regulating PPARγ.

[0197] Therefore, the expression of the above genes, which play a crucial role in fat digestion, absorption, and production, was confirmed in the small intestine and visceral adipose tissue. Specifically, the relative mRNA expression of FABP2, DGAT1, ATGL, and MGL was measured in the small intestine, and the relative mRNA expression levels of FABP4, FABP5, brown adipogenesis markers (PRDM16, PPARγ, and PGC1α), and mitochondrial biogenesis marker (UCP1) were measured in visceral adipose tissue. In addition, immunofluorescence staining of FABP2 and DGAT1 was performed in the small intestine, and immunofluorescence staining of FABP4, FABP5, and UCP1 was performed in visceral adipose tissue embedded in paraffin. The results are shown in Figure 19.

[0198] As shown in Figures 19a and b, the lbl-CMSA(siFABP2) and lbl-CMSA(siFABP2-sh(FABP4 / 5)) administration groups induced similar levels of downregulation of lipid metabolism-related genes, indicating that FABP2 inhibition affects the fatty acid absorption mechanism.

[0199] In Fig. 19c, the lbl-CMSA (sh(FABP4 / 5)) and lbl-CMSA (siFABP2-shFABP4 / 5)) administration groups significantly upregulated brown fat producers, indicating that inhibition of FABP4 and FABP5 alters lipid metabolism and differentiates adipocytes into an energy-expending phenotype.

[0200]

[0201] In summary, the present invention confirmed that the second layer of lbl-CMSA containing bile acids exhibits high durability in the gastrointestinal tract under various pH conditions and enzymatic reactions, and successfully protects the encapsulated genetic material. In addition, lbl-CMSA targets ASBT of enterocytes and is delivered to enterocytes through endocytosis. The shell composed of the second layer of lbl-CMSA fuses with the small intestinal cell membrane, releasing the encapsulated siRNA and cLOP into the cytoplasm, and it was confirmed that the released siRNA down-regulates the mRNA level of the target gene in enterocytes. The siFABP2 used in the present invention effectively blocked fat absorption in the body by down-regulating FABP2 and blocking the delivery of fatty acids in the small intestine.

[0202] Additionally, lbl-CMSA contains sh(FABP4 / 5) (aLPP structure) coated with apolipoproteins at its innermost layer. lbl-CMSA containing an apolipoprotein coating layer exhibits high transcytosis efficiency and can target mesenteric lymph nodes. Specifically, apolipoproteins interact with the ER / Golgi apparatus to transport aLPP through lymphatics via the chylomicron-mimetic pathway, thereby avoiding the first-pass hepatic transport and releasing aLPP into the body's circulation. Subsequently, the therapeutic agent contained within is released by lipoprotein-degrading enzymes present in blood vessels, allowing target genes to be modulated.

[0203] This demonstrates that lbl-CMSA can be utilized as an oral gene therapy delivery platform with enhanced bioavailability, as it can sequentially target and deliver encapsulated genetic therapeutic agents into intestinal cells and systemic circulation.

Claims

1. a) First gene drug; b) a first layer comprising an apolipoprotein encapsulating the above a); c) a second long-term targeting gene drug carried externally in the above b); and d) An oral gene delivery platform comprising a second layer encapsulating the above b) and c) and including a bile acid.

2. An oral administration gene delivery platform according to claim 1, wherein the second layer of d) comprises bile acid, phospholipid, and cholesterol.

3. In the first paragraph, the second layer of d) is a gene delivery platform for oral administration that targets ASBT (apical sodium-dependent bile acid transporter) of intestinal cells.

4. The oral administration gene delivery platform of paragraph 1 is an oral administration gene delivery platform that is resistant to the intestinal environment.

5. In the first paragraph, the second intestinal targeting gene drug of c) is released into the cytoplasm after the second layer of d) is shed after intestinal cell absorption, a gene delivery platform for oral administration.

6. In the first paragraph, the first layer including the apolipoprotein of b) includes an apolipoprotein, a phospholipid, and cholesterol, a gene delivery platform for oral administration.

7. In the first paragraph, the first layer including the apolipoprotein of b) promotes chylomicron-mimetic transcytosis, a gene delivery platform for oral administration.

8. In the first paragraph, the first layer containing the apolipoprotein b) is degraded by lipase after passing through the lymph node, a gene delivery platform for oral administration.

9. An oral gene delivery platform according to claim 1, wherein the first gene drug is absorbed into the lymph nodes.

10. A gene delivery platform for oral administration, wherein the first gene drug is delivered in a form bound to a gene delivery vehicle.

11. In the first paragraph, the oral gene delivery platform is for multiple organ sequential targeting.

12. An oral gene delivery platform according to claim 1, wherein the first gene drug is linked to a non-viral gene delivery system targeting fat cells.

13. In the first paragraph, the second gene drug targeting c) is at least one selected from the group consisting of siFABP2, siTACE, and siMLCK1, a gene delivery platform for oral administration.

14. In paragraph 12, the first genetic drug is a base sequence that suppresses the expression of FABP4 or FABP5, and the second genetic drug is a base sequence that suppresses the expression of FABP2, a gene delivery platform for treating obesity or obesity-induced metabolic syndrome, and for oral administration.

15. In claim 14, the obesity-induced metabolic syndrome is at least one selected from the group consisting of type 2 diabetes, hyperlipidemia, non-alcoholic fatty liver disease, arteriosclerosis, and hypertension, a gene delivery platform for oral administration.

Images