RIPK3-induced cell death of malignant b cells

A combination therapy using RIPK3 agonists and MLKL/caspase inhibitors effectively induces apoptosis and necroptosis in malignant B cells, addressing resistance mechanisms and enhancing tumor control and immune response.

WO2025163184A1PCT designated stage Publication Date: 2025-08-07INST PASTEUR +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/052608
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-01
Filing Date
2025-01-31
Publication Date
2025-08-07

AI Technical Summary

Technical Problem

Existing cancer therapies face resistance mechanisms and challenges in effectively inducing cell death in malignant B cells, particularly due to alterations in cell death pathways and immune response interplay, with limited understanding of RIPK3 activation in hematological malignancies.

Method used

A combination therapy involving an agonist of Receptor-interacting serine/threonine-protein kinase 3 (RIPK3) with an agonist of mixed lineage kinase domain-like protein (MLKL) and/or a caspase inhibitor, such as type I interferon (IFN-β), to activate RIPK3 signaling pathway, promoting apoptosis and necroptosis in malignant B cells, enhancing tumor cell death and immune response.

Benefits of technology

The combination therapy effectively induces apoptosis and necroptosis in malignant B cells, reducing tumor burden in various anatomical sites, including blood, lymph nodes, and bone marrow, and enhances immune-mediated bystander tumor control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000067_0000
    Figure 00000067_0000
  • Figure 00000067_0001
    Figure 00000067_0001
  • Figure 00000068_0000
    Figure 00000068_0000
Patent Text Reader

Abstract

The invention relates to the field of cancer therapy, especially by inducing cell death of malignant B cells by activating RIPK3 signaling pathway in these cells. The invention thus involves activating RIPK3 signaling pathway in malignant B cells for treating a patient in need thereof. The activation of RIPK3 signaling pathway in malignant B cells has in particular been shown to be beneficial against tumor growth, in particular when combined with an agonist of MLKL (like type I IFN) and / or a caspase inhibitor that optimize direct tumor cell death and subsequent anti-tumor immune response.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] RIPK3-INDUCED CELL DEATH OF MALIGNANT B CELLS

[0002] FIELD OF THE INVENTION

[0003] The invention relates to the field of cancer therapy, especially by inducing cell death of malignant B cells by activating RIPK3 signaling pathway in these cells. The invention thus involves activating RIPK3 signaling pathway in malignant B cells for treating a patient in need thereof. The activation of RIPK3 signaling pathway in malignant B cells has in particular been shown to be beneficial against tumor growth, in particular when combined with a caspase inhibitor and / or an agent that promotes the expression or the activity of mixed lineage kinase domain-like protein (MLKL), like interferons. Activation of RIPK3 signaling pathway by administering one or several of these compounds enhances direct tumor cell death and the subsequent anti-tumor immune response.

[0004] BACKGROUND OF THE INVENTION

[0005] Cancer therapies aim at maximizing the eradication of tumor cells either by direct or indirect mechanisms. Strategies that directly induce tumor cells to die are broadly used but often faces resistance mechanisms.

[0006] One way of treating cancer is to gain control or possibly terminate the uncontrolled growth of cancer cells. Using the cell's own mechanism for death is a highly effective method. Apoptosis can be induced in cancer cells through intrinsic and extrinsic pathways, which converge on the regulation of caspasedependent proteolysis of thousands of cellular proteins, membrane blebbing and endonucleolytic cleavage of chromosomal DNA.

[0007] But tumor development is also intrinsically associated with alteration in cell death pathways with escape from apoptosis being considered a hallmark of cancer (1 ). Additional resistance mechanisms to cell death can accumulate due to the selective pressure imposed by successive treatment regimens, like chemotherapeutic regimens (2). Reprogramming cell death pathways is an interesting strategy to overcome these primary or acquired resistance mechanisms. For example, strategies that trigger necroptosis have been proposed to overcome resistance to apoptosis observed in some acute lymphoblastic leukaemia (3). Another key issue is the interplay between cell death and the immune response. In this respect, immunogenic forms of cell death, that may be associated with the robust induction of immune responses such as necroptosis, may endow the immune system with the ability to clear residual tumor cells (4-6).

[0008] Necroptosis is a regulated version of the necrotic cell death pathway. Necrosis is an unprogrammed form of cell death that results from a chemical or physical insult. Necroptosis does not follow the apoptotic signal transduction pathway and is characterized by loss of cell membrane integrity and a release of cellular components into the extracellular space. This release initiates an inflammatory response attracting leukocytes and promoting the induction of immune responses.

[0009] Necroptosis is triggered by the binding of TNF-a and Fas ligand to their respective cell surface receptors which also is observed within classic extrinsic apoptosis induction. Ligand binding to TNF family surface receptors triggers a signal transduction event leading to sequential phosphorylation (kinase activity based) of receptor interacting protein kinase 1 (RIPK1 ) and receptor interacting protein kinase 3 (RIPK3) to form a RIPK1 -RIPK3 heterodimer scaffold complex. RIPK1 - RIPK3 interactions promote the formation of a multimeric protein complex termed the necroptosome. Upon oligomerization, RIPK3 induces the phosphorylation of mixed lineage kinase domain-like protein (MLKL) promoting pore formation in the plasma membrane, disruption of osmotic homeostasis, membrane rupture and release of intracellular content in the extracellular milieu (7).

[0010] Among the various cell death players, RIPK3 represents an attractive target for cell death pathway reprogramming. Although RIPK3 is well known for its canonical function as necroptosis inducer (7), it was originally identified as an apoptosis inducer (8, 9). As previously mentioned, RIPK3 phosphorylates Mixed lineage kinase domain-like protein (MLKL), inducing its oligomerization and translocation to cellular membranes where it promotes pore formation and membrane disruption (10, 11 ). RIPK3 can also induces caspase 8 activation and apoptosis (12). RIPK3 can trigger necroptosis or apoptosis depending on its kinase activity (13, 14), local target availability (15) and / or the presence of post translational modifications (16)

[0011] RIPK3 is a serine / threonine-protein kinase. RIPK3 is the key component of the RIPK1 - RIPK3 - MLKL complex called the necrosome. Thus, RIPK3 is involved in the necroptosis of cells, but also in the induction of apoptosis. RIPK3 phosphorylates downstream signals involved either in necroptosis or in apoptosis. One canonical function of RIPK3 signaling pathway is to stimulate MLKL activation and to trigger necroptosis: activated RIPK3 forms a necrosisinducing complex and mediates phosphorylation of MLKL, promoting MLKL localization to the plasma membrane and execution of necroptosis characterized by calcium influx and plasma membrane damage. RIPK3 mediated phosphorylation and activation of MLKL promotes disruption of the nuclear envelope and leakage of cellular DNA into the cytosol. RIPK3 is also involved in apoptosis: apoptosis depends on RIPK1 , FADD (Fas-Associated protein with Death Domain) and CASP8 (caspase 8) but is independent of MLKL and RIPK3 kinase activity.

[0012] In models of solid tumor, RIPK3 activation has been shown to favour necroptotic cell death and inflammation leading to efficient anti-tumor immune responses (20, 21 ). Necroptosis is indeed considered a highly immunogenic cell death due to the release of intracellular mediators after membrane disruption and the active production of inflammatory cytokines within necroptotic corpses (4, 19). By contrast, the in vivo consequences of RIPK3 activation in haematological malignancies and in particular B cell tumors remain to be fully understood. Such understanding is in part limited by the technical difficulty in selectively engaging RIPK3 signaling pathway in tumor cells in vivo. Activatable RIPK3 molecule that uses FKBP domains has been used successfully to trigger necroptotic cell death in vitro (20, 23). Yet, it is unclear whether a similar approach can be applied in vivo.

[0013] The consequences of RIPK3 activation in liquid cancers in particular haematological cancers involving B cells malignancies has not been reported in the prior art but the inventors made the hypothesis that it would be interesting to determine whether reprogramming cell death pathway of malignant B cells could help promoting tumor cells clearance, including by way of immune response against tumor cells.

[0014] SUMMARY OF THE INVENTION

[0015] In a first embodiment, the invention relates to an agonist of Receptor-interacting serine / threonine-protein kinase 3 (RIPK3) for use in combination with an agonist of mixed lineage kinase domain-like protein (MLKL) and / or a caspase inhibitor for treating a patient suffering from a cancer with malignant B cells. The agonist of RIPK3 is a compound that promotes expression or phosphorylation or oligomerization or phosphorylation and oligomerization of RIPK3.

[0016] The invention relates to a combination therapy, especially as a composition or as a kit of compounds or as product labelling, comprising a Receptor-interacting serine / threonine-protein kinase 3 (RIPK3) agonist and (i) an agonist of mixed lineage kinase domain-like protein (MLKL) or (ii) a caspase inhibitor or (iii) an agonist of mixed lineage kinase domain-like protein (MLKL) and a caspase inhibitor.

[0017] In such embodiment the agonist of RIPK3 could be used to trigger tumor cell death.

[0018] The inventors have shown that the activation or the induction of RIPK3 signaling pathway, in particular the specific activation of RIPK3 signaling pathway, in malignant B cells, leads to B cell tumors apoptosis and subsequent macrophage engulfment. Thus, treating patient suffering from a cancer with malignant B cells by activating RIPK3 signaling pathway, in particular specifically activating RIPK3 signaling pathway, is likely to induce or enhance tumor cells death and promote tumor control. Activation of RIPK3 signaling pathway is achieved through the administration of an agonist of RIPK3, i.e. a compound that is either able to activate RIPK3, or to mimic RIPK3 biological action. An agonist of RIPK3 can be selected from an activator of RIPK3 (i.e., a molecule that activates RIPK3) or a RIPK3 protein or a functional equivalent thereof.

[0019] Furthermore, the inventors have shown that when RIPK3 signalling is activated (or induced or enhanced) in malignant B cells, apoptosis of malignant B cells is observed but not necroptosis, both in vitro and in vivo. The inventors have further demonstrated that activating RIPK3 in B cell tumors while simultaneously inhibiting caspase(s) can moderately favour necroptosis and shown that this phenomenon is considerably amplified by type I IFN, which increases the expression of MLKL. Exploiting these findings, the inventors have shown that combining small molecule mimetics of the second mitochondria derived activator of caspase (SMAC) protein20, with the pan caspase inhibitor emricasan, as well as IFN-|3 maximized RIPK3 induced necroptosis and antitumor immunity providing the most efficient strategy to control tumor B cell burden in vivo. Thus, reprogramming of RIPK3 activity in B cell malignancies represents an attractive therapeutic approach to effectively control B cell tumor burden.

[0020] In other words, the inventors have shown that when RIPK3 is activated in B cell tumors in the presence of a caspase inhibitor, a moderate level of necroptosis of malignant B cells is observed, thereby leading to a means for controlling tumor progression. The inventors have also shown that administering an agonist of mixed lineage kinase domain-like protein (MLKL) in combination with the agonist of RIPK3 leads to an improvement of the clinical condition associated with disease involving malignant B cells such as tumor B cells. An agonist of MLKL may be a molecule that promotes the expression or the activity of MLKL.

[0021] The invention is particularly adapted for use in a therapy of a disease involving malignant B cells.

[0022] In a particular embodiment, the invention relates to a combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprising an agonist of RIPK3 and a type I interferon (l-IFN) as the molecule that is an agonist of MLKL.

[0023] In another embodiment, the invention relates to a combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprising an agonist of a Receptor-interacting serine / threonine-protein kinase 3 (RIPK3) as defined here above, a caspase inhibitor, and an agonist of MLKL. This embodiment is particularly adapted for use in a combination therapy of a disease involving malignant B cells.

[0024] The inventors have observed that necroptosis of malignant B cell is promoted, in particular enhanced, as a dominant pathway triggered by RIPK3 when the latter is activated in the presence of a caspase inhibitor and an agonist of MLKL, such as l-IFN, both in vitro and in vivo. By increasing MLKL expression on malignant B cells, l-IFN potentializes the RIPK3-mediated necroptosis of malignant B cells. Further, it is shown that the addition of type l-IFN during RIPK3 activity promotes immune-mediated bystander tumor control, whereby the immune system eliminates residual tumor cells.

[0025] In a particular embodiment, it is provided a combination therapy, in particular a tri-therapy, wherein the compounds of the combination therapy may be provided as a composition (encompassing multiple compositions), as a kit of compounds or as a product labelling, comprising a SMAC mimetic, a caspase inhibitor, in particular a pan-caspase inhibitor or a caspase-8 inhibitor, and a type I interferon (l-IFN), in particular a caspase inhibitor and a l-IFN.

[0026] The results illustrating the present invention demonstrate the benefit of activating the RIPK3 signaling pathway in malignant B cells. In particular, it was shown by the inventors that combining a SMAC mimetic that engages RIPK3 signaling pathway, the caspase inhibitor emricasan, and IFN-|3 maximized RIPK3-induced necroptosis and provided an efficient strategy to control tumor B cell burden in vivo. It is accordingly shown that in vivo reprogramming RIKP3 activity in B cell malignancies represents an attractive therapeutic approach to effectively control B cell tumor burden.

[0027] In addition, the combination therapy provided as a tri-therapy line of treatment disclosed herein using an agonist of RIPK3, a caspase inhibitor and an agonist of MLKL according to the embodiments disclosed herein was shown to enable reduction of the tumor burden in various anatomical sites, including blood, lymph nodes and bone marrow. Hence the invention relates to the tri-therapy for use in controlling a tumor in a patient suffering from a cancer with malignant B cells wherein the control encompasses reducing the tumor burden at one or multiple anatomical sites including blood, lymph nodes and bone marrow sites.

[0028] The invention therefore relies on the experiments described herein and provides new means and tools for addressing the above-mentioned problems. In particular, the invention provides a relevant line of treatment against liquid cancers, in particular against liquid cancer with malignant B cells by activating RIPK3. The invention also relates to the provision of combination therapy, especially as compositions, in particular pharmaceutical compositions, as kits of compounds or as product labelling, comprising an agonist of RIPK3 and a caspase inhibitor, or an agonist of RIPK3 and an agonist of MLKL, or an agonist of RIPK3 and a caspase inhibitor and an agonist of MLKL.

[0029] The “combination therapy” as disclosed herein relates to a treatment modality involving a plurality of compounds to be administered to a patient in need thereof where these compounds (encompassing an agonist of RIPK3, and a caspase inhibitor or an agonist of MLKL or a caspase inhibitor and an agonist of MLKL, in particularly an IFN, more particularly a type I interferon (l-IFN)) are for use in the treatment of a patient as disclosed herein. Combination therapy accordingly is provided as a set of compounds to be administered according to a combination regimen designed to enable a synergistic effect, an additive effect of the compounds when administered to the patient or enable to increase the therapeutic index of the cancer therapy. Otherwise stated combination therapy also relates to the multiple compounds being made available either separately or as a composition (that may encompass multiple compositions of different therapeutic compounds), as a kit of compounds or as a product labelling. According to the invention, the order of citation of the therapeutical compounds in the present disclosure does not imply the order of their administration for the treatment.

[0030] Combination therapy when relating to the administration modality of the therapeutic compounds may involve simultaneous, separate, concomitant, or sequential administration in time or combinations of such regimes.

[0031] The invention also relates to an agonist of Receptor-interacting serine / threonine- protein kinase 3 (RIPK3) for use in treating a patient suffering from a cancer with malignant B cells as defined in the herein disclosed various embodiments, wherein the agonist of RIPK3 is for use with a caspase inhibitor and / or an agonist of MLKL, in particular a pan-caspase inhibitor or a caspace-8 inhibitor and a l-IFN according to the present disclosure, in a combination therapy as disclosed herein.

[0032] DETAILED DESCRIPTION OF THE INVENTION In a first embodiment of the invention, it is provided an agonist of Receptorinteracting serine / threonine-protein kinase 3 (RIPK3) for use in combination with an agonist of mixed lineage kinase domain-like protein (MLKL) and / or a caspase inhibitor for treating a patient suffering from a cancer with malignant B cells. The activation of RIPK3 signaling pathway leads to an increase of the apoptosis of malignant B cells, and an engulfment by macrophages in individuals suffering from a cancer with malignant B cells.

[0033] • Agonist of RIPK3

[0034] Human RIPK3 is a 518 amino acid protein which contains a kinase domain (22- 280 aa) at the N-terminus and a RHIM (RIP homotypic interaction motif, 424-469 aa) at the C-terminus, which are linked by an IMD (intermediate domain). RIPK3 protein may correspond to UNIPROT reference Q9Y572, in particular the canonical sequence referenced Q9Y572-1 . RIPK3 mRNA may correspond to the RefSeq No. NM_006871 . In a particular embodiment, the RIPK3 protein has the amino acid sequence set forth in SEQ ID No. 1 .

[0035] An agonist of RIPK3 is preferably a compound that promotes the expression, or the phosphorylation, or the oligomerization, or the phosphorylation and the oligomerization, of RIPK3.

[0036] Within the present disclosure, an agonist of RIPK3 may be considered as a substance (i.e., a compound or a molecule for example) that initiates, elicits, mimics or enhances the activity of the RIPK3 or a substance (i.e., a compound or a molecule for example) that initiates, elicits or enhances the activation of the RIPK3 signaling pathway.

[0037] An agonist of RIPK3 can activate RIPK3, or be RIPK3, or a functional equivalent thereof, or bind to the same target(s) as RIPK3, thereby initiating or pursuing a series of molecular events and physiological responses within the cell or organism similar to those observed when RIPK3 is activated. In other words, an agonist of RIPK3 may be a compound or a molecule that activates RIPK3 or mimics the action of endogenous, activated RIPK3, thereby modulating cellular functions associated with the RIPK3 signaling pathway.

[0038] An agonist of RIPK3 can thus be a substance that activates (in particular phosphorylates) RIPK3 (e.g., a substance that initiates, enhances or elicits the phosphorylation of RIPK3; phosphorylated RIPK3 being considered as the active form of the molecule for initiating the RIPK3 signaling pathway).

[0039] An agonist of RIPK3 may be a molecule, either natural or synthetic, that initiates, enhances or increases, the activation of RIPK3, in particular by interacting directly with RIPK3 (e.g., a molecule that directly binds to RIPK3 for example). Activation of RIPK3 can be detected by measuring the phosphorylation of RIPK3 in the absence and in the presence of the agonist of RIPK3. A molecule may be considered as an agonist of RIPK3 when the phosphorylation of RIPK3 is increased in the presence of the molecule as compared to a negative control. Activation of RIPK3 can be detected by measuring the oligomerisation of RIPK3 in the absence and in the presence of the agonist of RIPK3. A molecule may be considered as an agonist of RIPK3 when the oligomerisation of RIPK3 is increased in the presence of the molecule as compared to a negative control.

[0040] An agonist of RIPK3 may be a molecule, either natural or synthetic, that initiates, enhances or increases, the activity of RIPK3. In a particular embodiment, an agonist of RIPK3 is accordingly a molecule that initiates, enhances, or increases the kinase activity of RIPK3. In a particular embodiment, the activity of RIPK3 that is increased is the RIPK3-induced phosphorylation of MLKL. An agonist of RIPK3 is accordingly a molecule that increases the phosphorylation of MLKL. The activity of activated RIPK3 can be detected by measuring the phosphorylation of MLKL in the absence and in the presence of the agonist of RIPK3.

[0041] An agonist of RIPK3 can also be a substance that initiates, elicits, mimics or enhances the signalling pathway induced by activated (in particular phosphorylated) RIPK3. Such a substance can be RIPK3 protein itself, or a functional fragment of such a protein, or a functional variant of such a protein or a functional equivalent (a functional fragment and a functional variant corresponding to a polypeptide that is able to bind and activate at least one of the natural ligand(s) of endogenous RIPK3). Such a substance can also be a compound that is not structurally related to RIPK3 protein but that is a functional equivalent that elicits at least one similar biological effect as endogenous activated RIPK3, in particular on the phosphorylation of MLKL. An agonist of RIPK3 may be a molecule, either natural or synthetic, that is able to interact with one or several natural ligand(s) of endogenous RIPK3. Such a molecule is able to mimic at least one of the biological activities induced or elicited by activated RIPK3, in particular by activating the signaling pathway activated when endogenous RIPK3 is phosphorylated, for example by phosphorylating MLKL.

[0042] An agonist of RIPK3 as defined herein can also be a RIPK3 protein (e.g like a recombinant RIPK3 protein), or a functional equivalent thereof of such a protein. RIPK3 protein (e.g recombinant RIPK3 protein) and functional equivalent thereof share the same functional capabilities as endogenous RIPK3. RIPK3 protein (e.g recombinant RIPK3 protein) and functional equivalent thereof, when activated (e.g., phosphorylated) if needed, have the capability to initiate, in particular enhances or increases the RIPK3 signaling pathway. In particular, functional equivalent (e.g. functional fragment or functional variant) exerts at least one similar biological activity as compared to endogenous, activated, RIPK3, in particular the capability to initiate, in particular to enhance or to increase, the phosphorylation of MLKL.

[0043] Activation of RIPK3 signalling pathway or activated RIPK3 can be detected by measuring the phosphorylation of MLKL in the absence and in the presence of the agonist of RIPK3. A molecule may be considered as an agonist of RIPK3 when the phosphorylation of MLKL is increased in the presence of the agonist as compared to a negative control.

[0044] In a particular embodiment, an agonist of RIPK3 may be a molecule that promotes the expression of RIPK3.

[0045] Expression of RIPK3 can be determined by measuring the concentration of mRNA coding RIPK3. Such a measure can be performed by routine PCR techniques. A molecule that promotes the expression of RIPK3 is molecule that leads to an increase of the concentration of mRNA coding RIPK3 in cells in contact with the molecule.

[0046] Preferably, the agonist of RIPK3 is a molecule that promotes expression and / or phosphorylation and / or oligomerization of RIPK3, in particular in tumor cells, especially in malignant B cells. In an embodiment, the agonist of RIPK3 is an agent that promotes expression of the RIPK3 gene, in particular in tumor cells, especially in malignant B cells.

[0047] In an embodiment, the agonist of RIPK3 is an agent that promotes the phosphorylation of RIPK3, in particular in tumor cells, especially in malignant B cells.

[0048] In an embodiment, the agonist of RIPK3 is an agent that promotes oligomerization of RIPK3, in particular in tumor cells, especially in malignant B cells.

[0049] In an embodiment, the agonist of RIPK3 is an agent that promotes the phosphorylation and the oligomerization of RIPK3, in particular in tumor cells, especially in malignant B cells.

[0050] In an embodiment, an agonist of RIPK3 is an activator of RIPK3 (e.g., a molecule that is able to increase phosphorylation) or is a RIPK3 protein or a functional equivalent thereof, or is a molecule that increases the MLKL phosphorylation induced by activated RIPK3.

[0051] In an embodiment, an agonist of RIPK3 is a TNFR ligand that induces RIPK3- mediated phosphorylation of MLKL in malignant B cells. RIPK3 can be activated by stimulating TNF receptors (Tumor necrosis factor receptors). TNFR can be stimulated by TNF-a, FAS-Ligand, or TRAIL (tumor-necrosis-factor related apoptosis inducing ligand).

[0052] In a preferred embodiment, the agonist of RIPK3 is a SMAC mimetic. SMAC mimetics are small-molecule antagonists of inhibitor of apoptosis (lAPs). Several examples of SMAC mimetics are disclosed in Guan et al. (Inorg. Chem. Front, 2021 ;(8):7, 1788-1794). The basic element of SMAC-mimics is a Ala-Val-Pro-lle peptide. In an embodiment, the agonist of RIPK3 is a SMAC mimetic selected from the list consisting of the peptidomimetics BI891065, CUDC-427, DEBIO 1143, and LCL-161 ; the non-peptidomimetic antagonist ASTX660; and the three peptidomimetic dimeric SMAC-mimics APG-1387, birinapant, and AEG40826 / HGS1029.

[0053] In an embodiment, the agonist of RIPK3 is Necrolrl (Ref HY-148365 MedChem Express) or Necrolr2 (Ref HY-148366, MedChem Express), or derivatives thereof. Necrolrl and Necrolr2 are iridium (III) complexes that activate RIPK3 and mixed lineage kinase domain-like pseudokinase (MLKL), and regulate CDK4 expression.

[0054] In an embodiment, the agonist of RIPK3 enhances or restores RIPK3 expression in malignant B cells. Accordingly, the agonist of RIPK3 may be an hypomethylating agent such as decitabine, 5-azacytidine, RG108; a pan-HDAC inhibitor, such as SAHA; or a EZH2 inhibitor, such as EPZ6438. Such agents induce the re-expression of RIPK3 in tumor cells by demethylation of the CpG island in the RIPK3 gene.

[0055] In a preferred embodiment, the agonist of RIPK3 is a SMAC mimetic, in particular the agonist of RIPK3 is birinapant.

[0056] In an embodiment, the agonist of RIPK3 is RIPK3 protein or a functional equivalent thereof, in particular a recombinant RIPK3 protein or a recombinant functional equivalent thereof. In a preferred embodiment, the RIPK3 protein or recombinant protein thereof, is the RIPK3 protein corresponding to UNIPROT reference Q9Y572. In a preferred embodiment, the RIPK3 protein has the amino acid sequence set forth in SEQ ID No. 1. In a particular embodiment, the RIPK3 protein or functional equivalent has at least 70% identity, in particular at least 80% identity, more particularly at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% and even more particularly at least 99% identity, or share 100% identity, with the RIPK3 protein of SEQ ID No. 1.

[0057] The percentages of identity to which reference is made in the presentation of the present invention are determined on the basis of a global alignment of sequences to be compared, that is to say, on an alignment of sequences over their entire length, using for example the algorithm of Needleman and Wunsch 1970. This sequence comparison can be done for example using the needle software by using the parameter "Gap open" equal to 10.0, the parameter "Gap Extend" equal to 0.5, and a matrix "BLOSUM 62". Software such as needle is available on the website ebi.ac.uk worldwide, under the name "needle".

[0058] As used herein, a “functional equivalent” of RIPK3 protein is a polypeptide which is capable of phosphorylating MLKL, like wild type RIPK3 protein. The term “functional equivalent” includes fragments and variants of wild type RIPK3. The term “functional equivalent” thus includes any equivalent polypeptide of RIPK3 obtained by altering the amino acid sequence of wild type RIPK3, for example by one or more amino acid deletions, substitutions or additions such that the protein analogue (i.e. functional equivalent polypeptide) retains the ability to phosphorylate MLKL. Amino acid substitutions may be made, for example, by point mutation of the DNA encoding the amino acid sequence.

[0059] Functional equivalents of RIPK3 include but are not limited to polypeptides that bind to at least one ligand of RIPK3, in particular to RIPK1 , and comprise all or a portion of RIPK3 so as to form a polypeptide that is capable to phosphorylate MLKL.

[0060] A suitable form of these functional equivalents of RIPK3 comprises, for example, a mutated, in particular truncated form of the RIPK3 wild-type protein, in particular of SEQ ID No. 1. Particularly, the functional equivalent of RIPK3 consists of a polypeptide of an amino acid sequence having at least 70%, in particular at least 80% identity, more particularly at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% and even more particularly at least 99% identity with the RIPK3 corresponding protein over the entire length of the corresponding RIPK3 protein, in particular RIPK3 of SEQ ID No. 1. In a particular embodiment, the functional equivalent of RIPK3 comprises at least the RIP homotypic interaction motif (RHIM) present within RIPK3 wild type protein. The RHIM present within RIPK3 extends from amino acid residue 450 to amino acid residue 466 of RIPK3 of SEQ ID No. 1 .

[0061] In an embodiment of the invention, a fragment of RIPK3 comprises at least 300 contiguous amino acid residues within sequence SEQ ID No. 1 , in particular at least 400 contiguous amino acid residues within sequence SEQ ID No. 1 , more particularly at least 500 contiguous amino acid residues within sequence SEQ ID No. 1. In a particular embodiment the fragment of RIPK3 comprises at least the amino acids 1 to 323 of SEQ ID No. 1 that corresponds to the kinase domain of wild type RIPK3. In an embodiment of the invention, a fragment of RIPK3 comprises at least 300 contiguous amino acid residues within sequence SEQ ID No. 1 , in particular at least 400 contiguous amino acid residues within sequence SEQ ID No. 1 , more particularly at least 500 contiguous amino acid residues within sequence SEQ ID No. 1 , including the RIP homotypic interaction motif (RHIM) present within RIPK3 wild type protein.

[0062] In another embodiment, the agonist of RIPK3 is a polynucleotide (a nucleic acid molecule) comprising a sequence that encodes RIPK3 protein, or a functional equivalent thereof as defined here above. The polynucleotide can be a nucleic acid molecule, in particular a vector, like a plasmid, in particular an expression plasmid, more particularly a mammalian expression plasmid.

[0063] In an embodiment, the agonist of RIPK3 is a molecule that promotes phosphorylation of RIPK3 in malignant B cells.

[0064] In an embodiment, the agonist of RIPK3 is a molecule that promotes RIPK3 oligomerization in malignant B cells.

[0065] In an embodiment, the agonist of RIPK3 is a molecule that activates and / or enhances RIPK3 signaling pathway in malignant B cells.

[0066] In an embodiment, the agonist of RIPK3 is a molecule that promotes RIPK3- induced phosphorylation of mixed lineage kinase domain-like protein (MLKL) in malignant B cells.

[0067] In an embodiment, the agonist of RIPK3 is a TNFR1 ligand that induces RIPK3 phosphorylation in malignant B cells.

[0068] In an embodiment, the agonist of RIPK3 is a RIPK3 protein or a functional equivalent thereof.

[0069] In an embodiment, it is provided an effective amount of an agonist of RIPK3 for treating a patient suffering from a cancer with malignant B cells.

[0070] • Cancer with malignant B cells

[0071] The agonist of RIPK3 in combination with an agonist of mixed lineage kinase domain-like protein (MLKL) and / or a caspase inhibitor aims at treating patients suffering from a cancer with B-Cell Malignancies. In an embodiment, the patient suffers from a liquid cancer, in particular a liquid cancer with malignant B cells or with B cell tumors.

[0072] The term “cancer” has its general meaning in the art and refers to a group of diseases involving abnormal cell growth starting at an anatomical site of the body with the potential to invade or spread to other parts of the body. The term “cancer” further encompasses both primary and metastatic cancers. Cancers that may be treated by methods and combination therapy, in particular compositions, of the invention are cancers with malignant B cells or with B cell tumors.

[0073] As used herein, “treatment” or “treating” is an approach for obtaining beneficial or desired results. Beneficial or desired clinical results include, but are not limited to, one or more of the following: alleviating, preventing or abolishing one or more symptoms resulting from the disease, curing the disease, diminishing the extent of the disease, stabilizing the disease (e.g., preventing or delaying the worsening of the disease), preventing or delaying the spread of the disease, preventing or delaying the recurrence of the disease, delaying or slowing the progression of the disease, ameliorating the disease state, providing a remission (partial or total) of the disease, decreasing the dose of one or more other medications required to treat the disease, increasing the quality of life, and / or prolonging survival. In a particular embodiment, the treatment enables the reduction of the tumor burden or the spreading of the tumor in different anatomical sites including blood, lymph nodes and bone marrow. Accordingly, “treating a patient suffering from a cancer” according to the invention encompasses treating a cancer in a patient wherein the cancer is as disclosed herein.

[0074] B-cell malignancies arise from different stages of B-cell differentiation and constitute a heterogeneous group of cancers including B-cell lymphomas, B-cell leukaemia, and plasma cell dyscrasias. Cancers also designated tumors associated with malignant B cells include B-cell lymphomas, B-cell leukemia and plasma cell dyscrasias.

[0075] In an embodiment, the therapy, especially as a composition, as a kit of compounds or as a product labelling, of the invention is for treating a patient suffering from a B-cell lymphoma. The compositions or molecules disclosed herein may be used for treating patient suffering from B-cell lymphoma. The B- cell lymphomas are types of lymphoma affecting B cells. Lymphomas are sometime referred as “blood cancers” and often start in the lymph nodes.

[0076] B-cell lymphomas include Diffuse large B-cell lymphoma, primary mediastinal B- cell lymphoma, Follicular lymphoma, Chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), Mantle cell lymphoma (MCL), Marginal zone lymphomas, including Extranodal marginal zone B-cell lymphoma, mucosa- associated Lymphoid Tissue (MALT) lymphoma, Nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, Burkitt lymphoma, Lymphoplasmacytic lymphoma, Hairy cell leukemia, Primary central nervous system (CNS) lymphoma, Primary intraocular lymphoma.

[0077] In an embodiment, the agonist of RIPK3 of the invention is for treating a patient suffering from a B-cell leukemia. B-cell leukemia is any type of lymphoid leukemia which affect B cells. In a particular embodiment, the therapy, especially as a composition, as a kit of compounds or as a product labelling, of the invention is for treating a patient suffering from B-cell chronic lymphocytic leukemia, small lymphocytic lymphoma, Acute lymphoblastic leukemia, B-cell prolymphocytic leukemia, Precursor B lymphoblastic leukemia, or Hairy cell leukemia.

[0078] In an embodiment, the agonist of RIPK3 of the invention is for treating a patient suffering from Plasma cell dyscrasias, also termed plasma cell disorders and plasma cell proliferative diseases.

[0079] In a preferred embodiment, the agonist of RIPK3 is provided for treating a patient suffering from B-cell lymphomas, in particular Diffuse large B-cell lymphoma, primary mediastinal B-cell lymphoma, Follicular lymphoma, Chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), Mantle cell lymphoma (MCL), Marginal zone lymphomas, including Extranodal marginal zone B-cell lymphoma, mucosa-associated Lymphoid Tissue (MALT) lymphoma, Nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, Burkitt lymphoma, Primary intraocular lymphoma, Primary central nervous system (CNS) lymphoma, small lymphocytic lymphoma, Lymphoplasmacytic lymphoma; B-cell leukemia, in particular Hairy cell leukemia, B-cell chronic lymphocytic leukemia, Acute lymphoblastic leukemia, B-cell prolymphocytic leukemia, Precursor B lymphoblastic leukemia, or Hairy cell leukemia; or plasma cell dyscrasias.

[0080] • Caspase inhibitor

[0081] According to an embodiment of the invention, it is provided an agonist of RIPK3 as defined above in combination with a caspase inhibitor, or such a caspase inhibitor is used in combination with an agonist of RIPK3. It is thus provided a combination therapy, in particular provided as a composition, a kit of compounds or as a product labelling, comprising an agonist of RIPK3 and a caspase inhibitor for treating a patient suffering from a cancer with malignant B cells. Such a combination therapy, especially as a composition, a kit of compounds or as a product labelling, allows to promote necroptosis of B cell tumors instead of apoptosis, leading to a new means for controlling cancer development. Necroptosis is associated with a more robust response of the immune system of the patient as compared to apoptosis.

[0082] Caspases play essential roles in modulating different biological processes including apoptosis, proliferation, and inflammation. Caspases are thus attractive targets for the treatment of several diseases including neurodegeneration, inflammation, metabolic disease, and cancer. These diseases may present a poor regulation of caspase-mediated cell death and inflammation. Caspases inhibitors have been identified and developed for modulating caspases activity with the aim for therapeutical use.

[0083] A caspase inhibitor may be a caspase 8 inhibitor (i.e. it inhibits the activity of caspase 8 and may or may not inhibit the activity of other caspases than caspase 8).

[0084] A caspase inhibitor may be a pan-caspase inhibitor (i.e. a compound that inhibits the activity of several different caspases, in particular a compound that inhibits the activity of caspase-8 and at least one other caspase). In an embodiment a pan-caspase inhibitor may inhibit the activity of all caspases.

[0085] A caspase inhibitor may be a natural caspase inhibitor or an artificial caspase inhibitor.

[0086] In an embodiment, a caspase inhibitor inhibits at least the activity of caspase 8, and can inhibit the activity of other caspase(s). A caspase inhibitor may be a viral caspase inhibitor or a cellular caspase inhibitor. A caspase inhibitor may be CrmA (issued from the cowpox virus), also known as interleukin 1 (3 (IL-1 (3) converting enzyme (ICE). CrmA efficiently inhibits caspases-1 , -8, -10, and reduces inflammation by preventing apoptosis and the production of IL-1 [3 and interferon y.

[0087] A caspase inhibitor may be p35, a baculovirus protein.

[0088] A caspase inhibitor may be an Inhibitor of apoptosis (IAP) protein, in particular Neuronal Apoptosis Inhibitory Protein (NAIP), X-linked inhibitor of apoptosis protein (XIAP), Cellular inhibitors of apoptosis proteins 1 (clAP1 ), Cellular inhibitors of apoptosis proteins 2 (clAP2), survivin, membrane-associated inhibitor of apoptosis protein (BRUCE), livin (ML-IAP, KIAP), or Inhibitor of apoptosis protein-related-like protein-2 (ILP-2). In particular, the caspase inhibitor isXlAP, clAP1 and clAP2.

[0089] A caspase inhibitor may be a peptide-based inhibitor, in particular selected from the group consisting of Ac-IETD-CHO, Ac-YVAD-CHO, Ac-DEVD-CMK, Z-VAD, Caspase-8 Inhibitor Z-IETD-FMK, Caspase-3 Inhibitor Z-DEVD-FMK, Z-VAD- FMK, Pan Caspase Inhibitor Z-YVAD-FMK, Boc-D-FMK, TRP-601 , and Q-VD- OPh. More particularly, the caspase inhibitor is Z-VAD-FMK (carbobenzoxy-valyl- alanyl-aspartyl-[O-methyl]-fluoromethylketone).

[0090] A caspase inhibitor may be a Peptidomimetic inhibitor, in particular selected from the group consisting of VX-765 (belnacasan), VRT-043198 (the active metabolite of VX-765), VX-740 (pralnacasan), IDN-6556 (emricasan, PF-034911390), VX- 166 ((S)-3-((S)-2-(3-((methoxycarbonyl)amino)-2-oxopyridin-1 (2H)- yl)butanamido)-4-oxo-5-(2,3,5,6-tetrafluorophenoxy)pentanoic acid), M826 (3- ((S)-2-(5-(tert-butyl)-3-(((4-methyl-1 ,2,5-oxadiazol-3-yl)methyl)amino)-2- oxopyrazin-1 (2H)-yl)butanamido)-5-(hexyl(methyl)amino)-4-oxopentanoic acid) and M867 (CAS No. : 680999-39-7).

[0091] A caspase inhibitor may be a non-peptidic compound, in particular selected from the group consisting of QPI-1007 (cosdosiran), NCX-1000, and isatin sulfonamides.

[0092] A caspase inhibitor may be an allosteric caspase inhibitor, in particular selected from the group consisting of FICA and DICA. In an embodiment of the invention, a caspase inhibitor is Emricasan (IDN code: IDN-6556, PF-03491390).

[0093] The combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprising the agonist of RIPK3 and the caspase inhibitor is provided for treating a patient suffering from a cancer with malignant B cells as disclosed here in.

[0094] • Agonist of MLKL (molecule that promotes the activity or expression of MLKL or MLKL protein)

[0095] In a third embodiment of the invention, it is provided a combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprising an agonist of RIPK3 and an agonist of mixed lineage kinase domainlike protein (MLKL). MLKL is also known under the name Mixed lineage kinase domain like pseudokinase. MLKL is a 471 -amino acid protein which contains a pseudokinase domain that is involved in TNF-induced necroptosis. MLKL protein may correspond to UNIPROT reference Q8NB16, in particular the canonical sequence referenced Q8NB16-1. In particular, MLKL protein may correspond to the protein with the amino acid sequence set forth in SEQ ID No. 2.

[0096] Within the present disclosure, an agonist of MLKL is considered as a substance (i.e., a compound or a molecule for example) that initiates, elicits, mimics or enhances the activity of MLKL or a substance (i.e., a compound or a molecule for example) that initiates, elicits or enhances the activation of MLKL. The agonist of MLKL can activate (in particular phosphorylate) MLKL, or be a MLKL protein or a functional equivalent thereof, or bind to the same ligand(s) as MLKL, thereby initiating or pursuing a series of molecular events and physiological responses within the cell or organism similar to those observed when MLKL is activated. In other words, an agonist of MLKL may be a compound or a molecule that activates MLKL or mimics the action of endogenous, activated MLKL, thereby modulating cellular functions associated with activated MLKL.

[0097] Increasing MLKL expression in malignant B cell enhances the sensitivity to engage robust necroptosis of malignant B cells. Necroptosis can thus be correlated with MLKL expression. In a particular embodiment, an agonist of MLKL is a molecule that promotes the expression or the activity of MLKL or directly interacts with MLKL. Such an agonist is a molecule that, when present, leads to an increase of the expression of the MLKL protein, and / or an increase of the activity of the MLKL protein.

[0098] Expression of MLKL can be determined by measuring the concentration of mRNA coding MLKL. Such a measure can be performed by routine PCR techniques. A molecule that promotes the expression of MLKL is molecule that leads to an increase of the concentration of mRNA coding MLKL in cells in contact with the molecule.

[0099] The activity of MLKL can be determined by measuring its phosphorylation by Western-Blot. A phosphorylated MLKL is considered activated while unphosphorylated MLKL is not considered activated. MLKL is activated following its phosphorylation by RIPK3, leading to homotrimerization, and localization to the plasma membrane. Activity of MLKL can be measured by analyzing membrane permeabilization.

[0100] In a particular embodiment, the agonist of MLKL is selected from the group consisting of:

[0101] - type I interferon (l-IFN); either alone or in combination with TNFa;

[0102] - Interferon gamma (also known as type II interferon), either alone or in combination with TNFa;

[0103] - MLKL protein, or a functional equivalent thereof; a nucleic acid molecule, in particular a vector or a plasmid, that encodes a MLKL protein, or a functional equivalent thereof;

[0104] - TAM kinases, in particular Tyro-3, Axl, or Mer. o Type-1 Interferons (l-IFN)

[0105] In a particular embodiment of the invention, it is provided a combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprising an agonist of RIPK3 and l-IFN (type I Interferon) for treating a patient suffering from a cancer with malignant B cells.

[0106] The type-1 interferons (IFN) are cytokines which play essential roles in inflammation, immunoregulation, tumor cells recognition, and T-cell responses. l-IFN can correspond to a protein encoded by one of the following genes IFNa encoded by IFNA1 , IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17 or IFNA21 ); IFNco by IFNW1 , IFNs by IFNE, IFNK by IFNK and IFNp by IFNB1 .

[0107] In the combination therapy, especially as a composition, as a kit of compounds or as a product labelling, of the invention, the type I interferon is preferentially selected from the group consisting of IFN-a, IFN-|3, IFN-K, IFN-CO, in particular IFN-a or IFN-|3. In a particular embodiment of the invention, l-IFN is a recombinant IFN, in particular a recombinant IFN-a or I FN-|3.

[0108] The l-IFN may also be selected from the group consisting of IFNa2a (Roferon-A, Roche), IFNa2b (Intron-A, Schering-Plough) and pegylated IFNa2b (Sylatron, Schering Corporation).

[0109] In a preferred embodiment, the l-IFN is selected from the group consisting of IFN- a or IFN-[3, in particular recombinant IFN-a or recombinant I FN-|3.

[0110] The combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprising the agonist of RIPK3 and l-IFN is provided for treating a patient suffering from a cancer with malignant B cells as disclosed here in.

[0111] In a particular embodiment, the type I interferon is administered in combination with TNFa. o Interferon gamma

[0112] In a particular embodiment of the invention, it is provided a combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprising an agonist of RIPK3 and interferon gamma (IFN-y) for treating a patient suffering from a cancer with malignant B cells.

[0113] Interferon gamma (IFN-y) is a dimerized soluble cytokine that is the only member of the type II class of interferons.

[0114] In a particular embodiment, the combination therapy, in particular the composition, comprises a recombinant interferon gamma.

[0115] In a particular embodiment, the Interferon gamma is administered in combination with TNFa. o MLKL protein, or functional equivalent thereof In a particular embodiment of the invention, it is provided a combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprising an agonist of RIPK3 and a MLKL protein or a functional equivalent thereof for treating a patient suffering from a cancer with malignant B cells.

[0116] The agonist of MLKL may be MLKL protein or a functional equivalent thereof, in particular a recombinant MLKL protein or a recombinant functional equivalent thereof. In a preferred embodiment, the MLKL protein or recombinant protein thereof, is the MLKL corresponding to UNIPROT reference Q8NB16. In a preferred embodiment, the MLKL protein has the amino acid sequence set forth in SEQ ID No. 2. In a particular embodiment, the MLKL protein or functional equivalent has at least 70% identity, in particular at least 80% identity, more particularly at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% and even more particularly at least 99% identity, or share 100% identity, with the MLKL protein of SEQ ID No. 2.

[0117] As used herein, a “functional equivalent” of MLKL is a polypeptide which is capable of being phosphorylated by RIPK3, like wild type MLKL protein. The term “functional equivalent” includes fragments and variants of MLKL. The term “functional equivalent” thus includes any equivalent of MLKL obtained by altering the amino acid sequence of wild type MLKL, for example by one or more amino acid deletions, substitutions or additions such that the protein analogue (i.e. functional equivalent polypeptide) retains the ability to phosphorylate MLKL. Amino acid substitutions may be made, for example, by point mutation of the DNA encoding the amino acid sequence.

[0118] Functional equivalents of MLKL include but are not limited to polypeptides that bind to at least one ligand of MLKL. The activation of MLKL can be measured by analysing its phosphorylation by Western-Blot. An activated MLKL is phosphorylated, while MLKL that is not phosphorylated is not considered as an activated MLKL.

[0119] A suitable form of these functional equivalents of MLKL, comprises, for example, a mutated, in particular truncated form of the MLKL wild-type protein, in particular of SEQ ID No. 2. Particularly, the functional equivalent of MLKL consists of an amino acid sequence having at least 70%, in particular at least 80% identity, more particularly at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% and even more particularly at least 99% identity with the wild type MLKL protein of SEQ ID No. 2.

[0120] In an embodiment of the invention, a fragment of MLKL has at least 300 contiguous amino acid residues within sequence SEQ ID No. 2, in particular at least 400 contiguous amino acid residues within sequence SEQ ID No. 2, more particularly at least 450 contiguous amino acid residues within sequence SEQ ID No. 2.

[0121] In another embodiment, the agonist of MLKL is a polynucleotide comprising a sequence that encodes MLKL protein, or a functional equivalent thereof as defined here above. The polynucleotide can be a nucleic acid molecule, in particular a vector, like a plasmid, in particular an expression plasmid, more particularly a mammalian expression plasmid. o TAM kinases (A receptor tyrosine kinase of the TAM family)

[0122] In a particular embodiment of the invention, it is provided a combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprising an agonist of RIPK3 and a TAM kinase (also known as a TAM receptor tyrosine kinase), in particular a TAM receptor tyrosine kinase selected from the group consisting of Tyro-3, Axl, and Mer.

[0123] Receptor tyrosine kinases (RTKs) are transmembrane proteins which transduce signals from the extracellular environment to the cytoplasm and nucleus. All RTKs, including Tyro-3, Axl, and Mer, contain an extracellular domain, a transmembrane domain, and a conserved intracellular kinase domain. The TAM family is distinguished from other RTKs by a conserved sequence, KW (l / L)A(l / L)ES, within the kinase domain and adhesion molecule-like domains in the extracellular region. Tyro-3, Axl, and Mer constitute the TAM family of receptor tyrosine kinases.

[0124] In an embodiment of the invention, it is provided a combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprising an agonist of RIPK3 and a polynucleotide that encodes at least one TAM receptor tyrosine kinase, in particular Tyro-3, Axl, and Mer.

[0125] • Combination therapy with at least 2 compounds

[0126] In an embodiment of the invention, it is provided a combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprising:

[0127] - An agonist of RIPK3 which is a compound that promotes expression and / or phosphorylation and / or oligomerization of RIPK3, in particular a compound that promotes the phosphorylation and the oligomerization of RIPK3, more particularly the agonist of RIPK3 is selected from the group consisting of SMAC mimetics, hypomethylating agents, pan-HDAC inhibitors, and EZH2 inhibitors; and

[0128] - A caspase inhibitor, in particular selected from the group consisting of Crma, p35 protein, Z-VAD, inhibitor of apoptosis proteins (IAP), caspase peptide-based inhibitors, caspase peptidomimetic inhibitors, caspase non- peptidic inhibitors, and allosteric caspase inhibitors, and

[0129] - An agonist of MLKL, in particular a type I Interferon, in particular selected from the group consisting of IFN-a, IFN-|3, IFN-K, IFN-CO, in particular IFN- a or IFN-[3, more particularly recombinant IFN-a or recombinant IFN-P; or IFN-y, in particular a recombinant IFN-y, either alone or in combination with TNFa; a MLKL protein or functional equivalent thereof; or a TAM receptor tyrosine kinase, in particular Tyro-3, Axl or Mer.

[0130] Such a combination therapy, especially as a composition, as a kit of compounds or as a product labelling, is particularly suitable for enhancing necroptosis of malignant B cells for controlling more efficiently tumor progression in vivo.

[0131] In a preferred embodiment, the combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprises an agonist of RIPK3 that is a SMAC mimetic.

[0132] In a preferred embodiment, the combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprises a caspase inhibitor that is emricasan. In a preferred embodiment, the combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprises an agonist of MLKL that is a l-IFN, especially IFN-|3.

[0133] In a preferred embodiment, the combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprises an agonist of RIPK3 that is a SMAC mimetic, and a caspase inhibitor that is emricasan.

[0134] In a preferred embodiment, the combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprises an agonist of RIPK3 that is a SMAC mimetic, and an agonist of MLKL that is a l-IFN, especially IFN- P.

[0135] In a preferred embodiment, the combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprises an agonist of RIPK3 that is a SMAC mimetic, and a caspase inhibitor that is emricasan, and an agonist of MLKL that is a l-IFN, especially IFN-|3.

[0136] In an embodiment of the invention, it is provided an agonist of RIPK3 in combination with at least one of a caspase inhibitor and an agonist of MLKL, in particular in combination with at least a caspase inhibitor and an agonist of MLKL, for treating a patient suffering from B-cell lymphomas, in particular Diffuse large B-cell lymphoma, primary mediastinal B-cell lymphoma, Follicular lymphoma, Chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), Mantle cell lymphoma (MCL), Marginal zone lymphomas, including Extranodal marginal zone B-cell lymphoma, mucosa-associated Lymphoid Tissue (MALT) lymphoma, Nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, Burkitt lymphoma, Primary intraocular lymphoma, Primary central nervous system (CNS) lymphoma, small lymphocytic lymphoma, Lymphoplasmacytic lymphoma; B-cell leukemia, in particular Hairy cell leukemia, B-cell chronic lymphocytic leukemia, Acute lymphoblastic leukemia, B-cell prolymphocytic leukemia, Precursor B lymphoblastic leukemia, or Hairy cell leukemia; or plasma cell dyscrasias.

[0137] In a preferred embodiment, it is provided a combination therapy, especially as a composition, in particular a pharmaceutical composition, as a kit of compounds or as a product labelling, comprising an agonist of RIPK3 and a caspase inhibitor, for treating a patient suffering from B-cell lymphomas, in particular Diffuse large B-cell lymphoma, primary mediastinal B-cell lymphoma, Follicular lymphoma, Chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), Mantle cell lymphoma (MCL), Marginal zone lymphomas, including Extranodal marginal zone B-cell lymphoma, mucosa-associated Lymphoid Tissue (MALT) lymphoma, Nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, Burkitt lymphoma, Primary intraocular lymphoma, Primary central nervous system (CNS) lymphoma, small lymphocytic lymphoma, Lymphoplasmacytic lymphoma; B-cell leukemia, in particular Hairy cell leukemia, B-cell chronic lymphocytic leukemia, Acute lymphoblastic leukemia, B-cell prolymphocytic leukemia, Precursor B lymphoblastic leukemia, or Hairy cell leukemia; or plasma cell dyscrasias. The agonist of RIPK3 can be any agonist of RIPK3 disclosed herein, and the caspase inhibitor can be any caspase inhibitor disclosed herein. In a preferred embodiment, it is provided a combination therapy, especially as a composition, in particular a pharmaceutical composition, as a kit of compounds or as a product labelling, comprising an agonist of RIPK3 and an agonist of MLKL, for treating a patient suffering from B-cell lymphomas, in particular Diffuse large B-cell lymphoma, primary mediastinal B-cell lymphoma, Follicular lymphoma, Chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), Mantle cell lymphoma (MCL), Marginal zone lymphomas, including Extranodal marginal zone B-cell lymphoma, mucosa-associated Lymphoid Tissue (MALT) lymphoma, Nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, Burkitt lymphoma, Primary intraocular lymphoma, Primary central nervous system (CNS) lymphoma, small lymphocytic lymphoma, Lymphoplasmacytic lymphoma; B-cell leukemia, in particular Hairy cell leukemia, B-cell chronic lymphocytic leukemia, Acute lymphoblastic leukemia, B-cell prolymphocytic leukemia, Precursor B lymphoblastic leukemia, or Hairy cell leukemia; or plasma cell dyscrasias. The agonist of RIPK3 can be any agonist of RIPK3 disclosed herein, and the agonist of MLKL can be any agonist of MLKL disclosed herein.

[0138] In a preferred embodiment, it is provided a combination therapy, especially as a composition, in particular a pharmaceutical composition, as a kit of compounds or as a product labelling, comprising an agonist of RIPK3, a caspase inhibitor and an agonist of MLKL, for treating a patient suffering from B-cell lymphomas, in particular Diffuse large B-cell lymphoma, primary mediastinal B-cell lymphoma, Follicular lymphoma, Chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), Mantle cell lymphoma (MCL), Marginal zone lymphomas, including Extranodal marginal zone B-cell lymphoma, mucosa-associated Lymphoid Tissue (MALT) lymphoma, Nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, Burkitt lymphoma, Primary intraocular lymphoma, Primary central nervous system (CNS) lymphoma, small lymphocytic lymphoma, Lymphoplasmacytic lymphoma; B-cell leukemia, in particular Hairy cell leukemia, B-cell chronic lymphocytic leukemia, Acute lymphoblastic leukemia, B-cell prolymphocytic leukemia, Precursor B lymphoblastic leukemia, or Hairy cell leukemia; or plasma cell dyscrasias. The agonist of RIPK3 can be any agonist of RIPK3 disclosed herein, the caspase inhibitor can be any caspase inhibitor disclose herein, and the agonist of MLKL can be any agonist of MLKL disclosed herein.

[0139] An agonist of RIPK3 induce or enhances apoptosis of malignant B cells, thus, the agonist of RIPK3 may be provided for inducing or enhancing apoptosis of malignant B cells in vivo, in vitro or ex vivo.

[0140] In an embodiment of the invention, it is provided an agonist of RIPK3 for inducing or enhancing apoptosis of malignant B cells, for the treatment of a patient suffering from a cancer with malignant B cells, in particular a patient suffering from B-cell lymphomas, in particular Diffuse large B-cell lymphoma, primary mediastinal B-cell lymphoma, Follicular lymphoma, Chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), Mantle cell lymphoma (MCL), Marginal zone lymphomas, including Extranodal marginal zone B-cell lymphoma, mucosa-associated Lymphoid Tissue (MALT) lymphoma, Nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, Burkitt lymphoma, Primary intraocular lymphoma, Primary central nervous system (CNS) lymphoma, small lymphocytic lymphoma, Lymphoplasmacytic lymphoma; B-cell leukemia, in particular Hairy cell leukemia, B-cell chronic lymphocytic leukemia, Acute lymphoblastic leukemia, B-cell prolymphocytic leukemia, Precursor B lymphoblastic leukemia, or Hairy cell leukemia; or plasma cell dyscrasias.

[0141] In an embodiment, it is provided an agonist of RIPK3 for use in combination with a caspase inhibitor, for treating a patient suffering from a cancer with malignant B cells.

[0142] In an embodiment, it is provided an agonist of RIPK3 for use in combination with an agonist of MLKL, for treating a patient suffering from a cancer with malignant B cells.

[0143] In an embodiment, it is provided an agonist of RIPK3 for use in combination with a caspase inhibitor and an agonist of MLKL, for treating a patient suffering from a cancer with malignant B cells.

[0144] In a particular embodiment it is provided an agonist of RIPK3 for use for the treatment of cancer with malignant B cells in a patient as disclosed herein wherein the treatment comprises combined administration with a caspase inhibitor, and optionally an agonist of MLKL.

[0145] In a particular embodiment it is provided an agonist of RIPK3 as disclosed herein, for use for the treatment of cancer with malignant B cells in a patient as disclosed herein wherein the treatment comprises combined administration with an agonist of MLKL, and optionally a caspase inhibitor.

[0146] In a particular embodiment it is provided an agonist of RIPK3 as disclosed herein, for use for the treatment of cancer with malignant B cells in a patient as disclosed herein wherein the treatment comprises combined administration with an agonist of MLKL and a caspase inhibitor.

[0147] In a particular embodiment the agonist of RIPK3 is for use in combination therapy with an agonist of MLKL, and optionally a caspase inhibitor, for the treatment of cancer with malignant B cells in a patient, wherein the agonist of MLKL is selected among the group consisting of MLKL protein or a functional equivalent thereof, type I Interferon, in particular selected from the group consisting of IFN-a, I FN-|3, IFN-K, IFN-CO, in particular IFN-a or IFN-|3, more particularly recombinant IFN-a or recombinant IFN-|3; IFN-y, in particular recombinant IFN-y, either alone or in combination with TNFa; or interferon gamma, either alone or in combination with TNFa, or a TAM receptor tyrosine kinase, in particular Tyro-3, Axl or Mer; and the caspase inhibitor is an agent selected from the group consisting of Crma, p35 protein, Z-VAD, inhibitor of apoptosis proteins (IAP), caspase peptide-based inhibitors, caspase peptidomimetic inhibitors, caspase non-peptidic inhibitors, and allosteric caspase inhibitors, in particular wherein the agonist of RIPK3 is a SMAC mimetic, the caspase inhibitor is emricasan, and the type I interferon (I- IFN) is IFN-p.

[0148] In an embodiment, it is provided a caspase inhibitor for use in combination with an agonist of RIPK3, for treating a patient suffering from a cancer with malignant B cells.

[0149] In an embodiment, it is provided a caspase inhibitor for use in combination with an agonist of RIPK3 and an agonist MLKL for treating a patient suffering from a cancer with malignant B cells.

[0150] In an embodiment, it is provided an agonist of MLKL for use in combination with an agonist of RIPK3, for treating a patient suffering from a cancer with malignant B cells.

[0151] In an embodiment, it is provided an agonist of MLKL for use in combination with an agonist of RIPK3, and a caspase inhibitor, for treating a patient suffering from a cancer with malignant B cells.

[0152] Apoptosis can be measured in vivo or in vitro according to the material and method disclosed herein, and in the first example illustrating the invention. Particularly, apoptosis can be assessed by measuring the overall number of living malignant B cells in biological samples previously obtained from a patient suffering from a cancer with malignant B cells i) before administration of an agonist of RIPK3 and ii) after administration of an agonist of RIPK3. Measurement of apoptotic malignant B cells can be performed by measuring caspase-3 activity, for example using an anti-activated caspase 3 monoclonal antibody or according to the FRET method disclosed in the material and methods and in the first illustrative example of the invention. A higher caspase-3 activity is associated with the induction or the enhancement of apoptosis of malignant B cells.

[0153] In an embodiment of the invention, it is provided a combination therapy, especially as a composition, in particular as a pharmaceutical composition, as a kit of compounds or as a product labelling, comprising an agonist of RIPK3, and at least one of a caspase inhibitor and an agonist of MLKL, in particular comprising an agonist of RIPK3 and a caspase inhibitor, in particular an agonist of RIPK3 and an agonist of MLKL, more particularly an agonist of RIPK3, a caspase inhibitor and an agonist of MLKL, for inducing or enhancing necroptosis of malignant B cells.

[0154] In a particular embodiment, the combination therapy, especially as a composition, in particular as a pharmaceutical composition, as a kit of compounds or as a product labelling, comprising an agonist of RIPK3, and at least one of a caspase inhibitor and an agonist of MLKL, in particular comprising an agonist of RIPK3 and a caspase inhibitor, in particular an agonist of RIPK3 and an agonist of MLKL, more particularly an agonist of RIPK3, a caspase inhibitor and an agonist of MLKL, is provided for inducing or enhancing necroptosis of malignant B cells in vivo, in vitro or ex vivo.

[0155] Necroptosis can be measured in vivo or in vitro according to the material and methods disclosed herein, and in the fourth example illustrating the invention. Particularly, necroptosis can be assessed by measuring the overall number of living malignant B cells in biological samples previously obtained from a patient suffering from a cancer with malignant B cells i) before administration of the combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprising an agonist of RIPK3 combined with a caspase inhibitor, an agonist of MLKL, or both a caspase inhibitor and an agonist of MLKL, and ii) after administration of the combination therapy, especially as a pharmaceutical composition. Measurement of necroptotic malignant B cells ex vivo can be performed by membrane permeabilization in the absence of caspase 3 activity. A higher MLKL expression is associated with the induction or the enhancement of the necroptosis of malignant B cells.

[0156] At the cellular level, cell death by necroptosis is morphologically characterized by cell enlargement, intact nucleus, absence of bleeding and rapid uptake of vital dye as illustrated in Figure 6G. The present description also discloses a method for treating a patient suffering from a cancer with malignant B cells, the method comprising the administration of a therapeutic amount of an agonist of RIPK3.

[0157] In a particular embodiment, it is disclosed a method for treating a patient suffering from a cancer with malignant B cells and selected from the group consisting of B- cell lymphomas, in particular Diffuse large B-cell lymphoma, primary mediastinal B-cell lymphoma, Follicular lymphoma, Chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), Mantle cell lymphoma (MCL), Marginal zone lymphomas, including Extranodal marginal zone B-cell lymphoma, mucosa- associated Lymphoid Tissue (MALT) lymphoma, Nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, Burkitt lymphoma, Primary intraocular lymphoma, Primary central nervous system (CNS) lymphoma, small lymphocytic lymphoma, Lymphoplasmacytic lymphoma; B-cell leukemia, in particular Hairy cell leukemia, B-cell chronic lymphocytic leukemia, Acute lymphoblastic leukemia, B-cell prolymphocytic leukemia, Precursor B lymphoblastic leukemia, or Hairy cell leukemia; or plasma cell dyscrasias, the method comprising the administration of a therapeutic amount of an agonist of RIPK3 combined with the administration of an agonist of mixed lineage kinase domain-like protein (MLKL) and / or a caspase inhibitor.

[0158] In an embodiment, it is provided a method for treating a patient suffering from a cancer with malignant B cells, the method comprising the administration of a therapeutic amount of a combination therapy, especially as a composition, as a kit of compounds or as a product labelling, comprising: an agonist of RIPK3 and a caspase inhibitor, or an agonist of RIPK3 and an agonist of MLKL, or an agonist of RIPK3, a caspase inhibitor and an agonist of MLKL.

[0159] In a particular embodiment, such a combination therapy, especially as a composition, as a kit of compounds or as a product labelling, is administered for treating a patient suffering from a cancer with malignant B cells and selected from the group consisting of B-cell lymphomas, in particular Diffuse large B-cell lymphoma, primary mediastinal B-cell lymphoma, Follicular lymphoma, Chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), Mantle cell lymphoma (MCL), Marginal zone lymphomas, including Extranodal marginal zone B-cell lymphoma, mucosa-associated Lymphoid Tissue (MALT) lymphoma, Nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, Burkitt lymphoma, Primary intraocular lymphoma, Primary central nervous system (CNS) lymphoma, small lymphocytic lymphoma, Lymphoplasmacytic lymphoma; B-cell leukemia, in particular Hairy cell leukemia, B-cell chronic lymphocytic leukemia, Acute lymphoblastic leukemia, B-cell prolymphocytic leukemia, Precursor B lymphoblastic leukemia, or Hairy cell leukemia; or plasma cell dyscrasias

[0160] It is disclosed a use of an agonist of RIPK3 for inducing or enhancing apoptosis of malignant B cells.

[0161] In an embodiment, it is provided a use in combination of:

[0162] - An agonist of RIPK3 and a caspase inhibitor, or

[0163] - An agonist of RIPK3 and an agonist of MLKL, or

[0164] - An agonist of RIPK3, a caspase inhibitor and an agonist of MLKL for inducing or enhancing necroptosis of malignant B cells.

[0165] In an embodiment, it is provided a composition comprising at least two of:

[0166] - An agonist of RIPK3, and

[0167] - A caspase inhibitor, or

[0168] - An agonist of MLKL, for inducing or enhancing necroptosis of malignant B cells. In a preferred embodiment, the composition comprises at least an agonist of RIPK3, a caspase inhibitor and an agonist of MLKL, for inducing or enhancing necroptosis of malignant B cells.

[0169] Any agonist of RIPK3 or combination therapy, especially as a composition, as a kit of compounds or as a product labelling, disclosed herein may be provided as a pharmaceutical composition. Thus, the agonist of RIPK3 or the composition according to any embodiment disclosed herein, either alone or in combination with a further therapeutic agent, may comprise a pharmaceutical suitable vehicle, which are pharmaceutically acceptable for a formulation capable of being administered to a patient in need thereof. These formulations may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium, or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions.

[0170] The combination therapy, especially as a composition, as a kit of compounds or as a product labelling, of the invention may be administered as a therapeutic combination or composition, in particular as an anti-cancer combination therapy or composition, or may be added as a further therapeutic treatment to be administered to a patient previously, currently, or to be treated, with another agent, in particular another anti-cancer agent. The another anti-cancer agent may be selected from the list consisting of a tumor-targeting antibody, an anticheckpoint blocker or activator antibodies, a chemotherapeutic agent, in particular a cytotoxic agent with anti-proliferative, pro-apoptotic, cell cycle arresting and / or differentiation inducing effect, more particularly a cytotoxic agent selected from the group consisting of cytotoxic antibody, alkylating drugs, anthracyclines, antimetabolites, anti-microtubule agents, topoisomerase inhibitors, alkaloids, bleomycin, antineoplastic drugs, cyclophosphamide. A tumor-targeting antibody may be defined as a therapeutic monoclonal antibody that recognizes tumor-specific membrane proteins, blocks cell signalling, and induces tumor killing.

[0171] The chemotherapeutic agent may be a conventional cytotoxic agent, i.e. a compound that induces irreversible lethal lesions through interference with DNA replication, mitosis, etc. following exposure. These agents may have antiproliferative, pro-apoptotic, cell cycle arresting, and differentiation inducing effects. The combination may also further comprise additional therapeutic agents, not recited in the list, and / or component(s), like but not limited to pharmaceutical excipients or administration vehicles.

[0172] The features described here above and other features of the invention will be apparent when reading the examples and the figures, which illustrate the experiments conducted by the inventors, in complement to the features and definitions given in the present description. The following examples are offered by way of illustration. The examples are however not limitative with respect to the described invention.

[0173] LEGEND OF THE FIGURES

[0174] Figure 1. RIPK3 signaling pathway promotes apoptosis in B cell tumors in vitro and promote non-apoptotic cell death in NIH-3T3 cell line. (A) Schematic representation of oligomerizable RIPK3 construct. (B) Expression of activatable RIPK3 (actRIPK3) in retrovirally transduced pro B and Ep Myc tumor cells by flow cytometry using mCherry reporter. Numbers indicate mCherry geometric mean fluorescence intensity for each condition. (C) Western blot analysis in whole protein extracts showing the expression of activatable RIPK3 in retrovirally transduced pro B cells (77 kDa) and endogenous RIPK3 (53 kDa) in untransduced and transduced pro-B cells. (D) Kinetics of cell death in actRIPK3 pro B and actRIPK3 Ep Myc cells cultured with various doses of B / B dimerizer (B / B dim). (E) Representative plots showing activated caspase 3 (act Casp3) and Live Dead (LD) staining in actRIPK3 pro B and actRIPK3 Ep Myc with or without B / B dim. Numbers indicate the percentage of gated cells. (F) Quantification. Cells that are simple positive act Casp3+ or double positive act Casp3+ / LD+ are undergoing or have undergone apoptosis. Results in (D F) are representative of five independent experiments. Data are expressed as mean ± SEM (G) Time lapse images showing morphological changes in actRIPK3 pro B cells stimulated with B / B dim. Arrowheads indicate the blebbing of the plasma membrane. DAPI incorporation at later time point witness the loss of plasma membrane integrity. Scale bar, 10 pm. Data are representative of two independent experiments. (H and I) NIH-3T3 cells expressing the activable form of RIPK3 (actRIPK3-NIH-3T3) were cultured in the presence or absence of B / B dimerizer. Cells were harvested at the indicated time points and stained with an antibody specific for activated Caspase 3 and Lice Dead reagent. (H) Representative example of activated Caspase 3 / Live Dead staining. Numbers correspond to percentage of gated cells. (I) Quantification Representative of two independent experiments. Data are expressed as means + / - SEM. (J) Expression of cell-death-related proteins in actRIPK3-NIH-3T3 cells upon treatment with B / B dim at different time points. The molecular weight for each protein is indicated by arrows.

[0175] Figure 2: RIPK3 signaling pathway promotes apoptosis in B cell malignancies in vivo and Tumor-associated macrophages rapidly recognize apoptotic B cell tumors. (A-B) Mice were injected with pro B cell tumors and treated with a single dose of B / B dim (or control vehicle) 5 days later. (A) Experimental scheme used for the induction of actRIPK3 in vivo. (B) Number of tumor cells in the blood and bone marrow (BM) of B / B dim treated mice versus control at 3 hours or 3 days post treatment. Absolute cell counts in the blood were calculated assuming a total blood volume of 2 mL. Representative of 2 independent experiments with n=3 mice per group in each experiment. Each dot represents one mouse. (C) Experimental setup of BM intravital two photon (2P) imaging performed in mice bearing tumors expressing actRIPK3 and FRET based caspase 3 reporter (DEVD) to visualize apoptosis in real time. (D) Time lapse images showing apoptotic events in tumor bearing mice (DEVD actRIPK3 pro B or DEVD actRIPK3 Ep Myc) receiving B / B dim or vehicle. Live tumor cells appear in magenta, apoptotic tumors (FRET negative) in blue. Scale bar, 20 pm. Data are representative of n>15 movies acquired in four independent mice. (E) Kinetics of appearance of FRETneg tumor before and after B / B dim or vehicle administration. Data were compiled from three independent mice for each condition. (F) Two photon images from the BM of mice bearing DEVD actRIPK3 pro B cell tumors showing rapid phagocytosis of tumor cells by F4 / 80+ macrophages, represented in green, upon apoptosis induction. Macrophages are visualized by intravenous injection of anti F4 / 80 antibody prior to B / B dim administration. Scale bar, 20 pm. Examples of individual cells (white arrowheads) undergoing apoptosis and subsequent phagocytosis are shown. Scale bar, 10 pm. Representative n> 20 movies acquired in four independent mice (G) Kinetics of FRET loss and phagocytosis in representative tumor cells following B / B dim administration in vivo. Each horizontal line represents a single cell. Fifty representative cells are shown. (H) Quantification of the timing of FRET loss relative to phagocytosis events. Data in (G) and (H) were compiled from 10 movies obtained from two independent mice. Unpaired t tests were used for statistical analysis in (B). Data are expressed as mean. ***P<0.001 ; **P<0.01. (I and J) Mice bearing DEVD-actRIPK3-Ep-Myc tumors were subjected to BM intravital imaging before and after B / B dim administration. Macrophages were visualized by intravenous injection of anti-F4 / 80 antibody prior to B / B dim administration. (I) Kinetics of FRET loss and phagocytosis in individual tumor cells following B / B dim administration. Each horizontal line represents a single cell. (I) Quantification of the timing of FRET loss relative to phagocytosis events (n= 50 cells analysed). Data were compiled from 9 movies from three independent mice.

[0176] Figure 3: RIPK3 activation in the presence of caspase inhibition triggers moderate level of necroptosis in B cell tumors. (A) Cell death induction in actRIPK3 pro B cells pretreated for 30 min with the pan caspase inhibitor zVAD fmk followed by B / B dim stimulation. (B-C) actRIPK3 pro B cells were cultured with B / B dim in the presence or absence of zVAD fmk. (B) Representative plots showing the double staining act Casp3 / LD in actRIPK3 pro B cells treated in vitro with the indicated conditions. Numbers represent the percentage of gated cells. (C) Quantification of cells with act Casp3 and / or LD staining in the indicated conditions. Results are representative of five independent experiments. Data are expressed as mean ± SEM. (D) Time lapse images showing morphological changes in actRIPK3 pro B cells stimulated with B / B dimerizer in the presence or absence of zVAD fmk. Scale bar, 10 pm. Data are representative of two independent experiments. A representative cell death in the absence or presence of zVAD-fmk is shown with white arrowheads. (E)Expression of cell-death-related proteins in actRIPK3 pro B cells upon treatment of with B / B dim alone or in combination with Z-VAD-fmk. The molecular weight for each protein is indicated by arrows. The lower band corresponds to phospho-MLKL. . (F) actRIPK3 pro B cells with genetic ablation of caspase 8 by CRISPR / Cas9 were cultured with B / B dim for 3h. Quantification of cells with act Casp3 and / or LD staining. Data are representative of two independent experiments. Data are expressed as mean ± SEM.

[0177] Figure 4: Reprogramming RIPK3-induced cell death in vivo. BM intravital two photon imaging was performed in mice bearing DEVD actRIPK3 Casp8- / - pro B cell tumors before and immediately after B / B dim administration. (A) Experimental setting and predicted fate for DEVD reporter fluorescence in cells undergoing necroptosis and subsequently phagocytosed. Necroptotic cells are not expected to lose FRET prior to phagocytosis but are expected to lose FRET in the acidic environment of phagocytic lysosomes due to a drop of YFP (but not CFP) fluorescence at low pH. (B) Time lapse images showing the in vivo fate of DEVD actRIPK3 Casp8- / - pro B cells upon B / B dim administration. Macrophages (shown in green) were labeled by injection of a fluorescent anti F4 / 80 antibody. Note that upon B / B dim administration, tumor cells undergo phagocytosis in the absence of caspase 3 activity and subsequently lose FRET after phagocytosis. Examples of individual cells (white arrowheads) undergoing phagocytosis are shown. Scale bar, 10 pm. Representative of n>15 movies obtained from three independent mice. (C D) Kinetics of FRET loss and phagocytosis in tumor cells expressing (C) or lacking (D) caspase 8. Each horizontal line represents a single cell. Fifty representative cells are shown for Casp8+ / + and Casp8- / - tumors. (E F) Quantification of the timing of FRET loss relative to the phagocytosis events for tumor cells expressing (E) or lacking (F) caspase 8. Results are compiled from 10 movies obtained from two independent mice for each condition. (G-H) Mice were injected with pro B cell tumors expressing or lacking caspase 8 and treated with a single dose of B / B dim or control vehicle 5 days later. (G) Experimental scheme. (H) Number of tumor cells in the blood of B / B dim treated mice versus control at 24 hours post treatment. Representative of 2 independent experiments with n=6 mice per group in each experiment. Each dot represents one mouse. Unpaired t tests were used for statistical analysis. ***P<0.001 .

[0178] Figure 5: Low expression of MLKL is a hallmark of B lineage cells. (A) Expression of Casp8, FADD, RIPK1 , RIPK3 and MLKL in whole cell extracts from pro B cell tumors by Western blot. Mouse embryonic fibroblasts (MEF) were used as a positive control. Data are representative of three independent experiments. (B) Protein quantification from (A) expressed as a fold change over MEF expression. Results are compiled from three independent experiments. (C) MLKL expression from bulk RNAseq (CCLE database) performed on nineteen human B cell lines originating from ALL, Burkitt lymphoma and DLBCL. THP 1 cells were used as positive control. (D) MLKL expression from bulk RNAseq (ImmGen database) in different stages of murine B cell development. Peritoneal macrophages and endothelial cells were used as positive controls. (E) tSNE representation of single cell RNAseq (1 OX Genomics public datasets) from frozen human BM mononuclear cells. B cell development stages are highlighted. (F) Violin plots of MLKL expression in various stages of human B cell development from (E). Myeloid cells were used as positive control. (G) MLKL protein expression assessed on murine splenic B cells, pro-B tumors and MEF. (H) Scheme summarizing the type and magnitude of cell death induced by RIPK3 signaling in pro B tumors in presence or absence of caspase inhibition and I FN- beta.

[0179] Figure 6: Manipulating RIPK3-induced cell death by type I IFNs in vitro. (A) Expression by Western blot of Casp8, FADD, RIPK1 , RIPK3 and MLKL in whole cell extracts from pro B cell tumors pretreated with type I or type II IFNs. Data are representative of two independent experiments. MEF cells were used as positive control. (B) Kinetics of cell death in actRIPK3 pro B cells treated or not with IFN P for 24 hours and cultured later with B / B dim in the presence or absence of zVAD fmk. (C) Representative plots showing the staining act Casp3 / LD in actRIPK3 pro B cells stimulated for 3 hours with B / B dim with or without zVAD fmk and IFN p pretreatment. Numbers indicate the percentage of gated cells. (D) Frequency of cells expressing act Casp3 and / or incorporating LD from (C). (E F) actRIPK3 pro B cells expressing or lacking MLKL were cultured with B / B dim with or without zVAD fmk and IFN p pretreatment. Cell death was assessed by flow cytometry. (E) Representative plots and (F) quantification. Results in (C F) are representative of three independent experiments. Data are expressed as mean ± SEM. (G) Time lapse images showing morphological changes in actRIPK3 pro B cells pretreated with IFN p and exposed to B / B dim with or without zVAD fmk. Scale bar, 10 pm. Data are representative of two independent experiments. (H) Scheme summarizing the type and magnitude of cell death induced by RIPK3 signaling pathway in pro B tumors in presence or absence of caspase inhibition and IFNp. Figure 7: RIPK3 activation promotes immune-mediated bystander tumor control in the presence of type I IFN. (A-D) Wild type (WT) or Rag2 I B6 mice bearing actRIPK3 pro B cell tumors were treated with a single dose of B / B dim (or vehicle) 5 days after tumor injection. (A B) Number of tumor cells in the blood, BM and spleen of WT (A) or Rag2 I (B) mice 24 hours after injection of B / B dim or control vehicle. Data are representative of two independent experiments. (C) Number of blood circulating tumor cells 10 days after treatment with B / B dim. Each dot corresponds to one mouse. (D) Frequency of survival. Data are compiled from two independent experiments with a total of 7 12 mice per group. (E F) WT mice were injected with a mix of 70% actRIPK3 pro B cells: 30% pro B cells. Four days later mice bearing tumors were treated with IFN [3 or PBS, 24 hours before B / B dim injection. (E) Experimental scheme. (F) Number of blood circulating tumor cells 10 days after treatment with B / B dim. Each dot corresponds to one mouse. Results are compiled from two independent experiments with a total of 9 mice per group (G H) WT or Rag2 I mice were injected with a mix of 70% actRIPK3 Casp8- / - pro B cells: 30% pro B cells and were treated with IFN [3 on day 4 prior the injection of B / B dim (day 5). (G) Experimental scheme. (H) Number of blood circulating tumor cells 10 days after treatment with B / B dim. Each dot corresponds to one mouse (n=4 5 mice per group). Unpaired t tests (A C) and two-way ANOVA with t test pairwise comparisons (F) were used for statistical analysis. Data are expressed as mean, n.s, non significant; *P<0.05; ***P<0.001.

[0180] Figure 8: A combination therapy to optimize RIPK3-induced cell death in B cell tumors in vivo. (A-D) Pro-B cells expressing or lacking endogenous RIPK3 pretreated (or not) with IFN-[3 were cultured in the presence or absence of SM BV6 and pan-caspase inhibitor emricasan (Emri). (A-B) Frequency of cell death without (A) or with (B) IFN-[3 pretreatment. (C) Representative plots showing act-Casp3 and LD staining. (D) Frequency of cells expressing act-Casp3 and / or incorporating LD dye. Data are expressed as mean ± SEM. (E-F) WT mice bearing pro-B tumors were treated with 3 doses of IFN-|3 and 3 doses of SM birinapant (Biri) with or without Emri. (E) Experimental design. (F) Frequency of tumor cells among CD45+ cells in the blood, lymph nodes (LNs) and BM 14 days after tumor inoculation. Each dot represents one mouse. Data are representative of three independent experiments with n=5 mice per group in each experiment. Two-way ANOVA with t-test pairwise comparisons were used for statistical analysis. Data are expressed as mean, n.s, non-significant; *P<0.05; **P<0.01 ; ***P<0.001. G-l) Deletion of Caspase 8, MLKL or RIPK3 in B tumor cells. Wjole protein extracts were analyzed by western blot to validate CRISPR-Cas9 gene editing (G) Caspase 8 deletion in actRIPK3-pro-B cells. (H) MLKL deletion in actRIPK3-pro-B cells. MLKL expression is shown in pre-treated or not with IFNb (I) Endogenous RIPK3 deletion in pro-B cells. (J) Survival of WT or Rag2- / - host harboring pro-B cell tumors and treated with a combination of birinapant, emricasan and IFNbeta. n=12-14 mice per group compiled from two independent experiments. (K-L) Induction of tumor-specific CD8+ T cell responses upon celldeath reprograming therapy. (L) H-2Kb-0VA tetramer staining was performed 14 day post pro-B-OVA cells injection in mice treated with the indicated drug combination (n=4 mice per group). Representative of two independent experiments. Two-way ANOVA with t test pairwise comparisons were used for statistical analysis. Data are expressed as mean, n.s, non-significant; *P<0.05; **P<0.01 ; ***P<0.001.

[0181] Figure 9: Low MLKL expression in ALL and DLBCL patient malignant B cells. (A)

[0182] UMAP and clustering of bone marrow cells from seven B-ALL patients. (B) MLKL expression in selected clusters from (A). Immature B cells mostly correspond to tumor B cells. (C) UMAP and clustering of cells isolated from four DLBCL patients. (D) MLKL expression in selected clusters from (C). Unpaired t-tests were used for statistical analysis, n.s, non-significant; *P<0.05.

[0183] Figure 10: RIPK3-mediated necroptosis is induced in pro-B tumor cells lacking caspase activity. Frequency of cell death in pro-B tumors pretreated or not with IFN-[3 and cultured with B / B dim and zVAD-fmk in the presence or absence of RIPK3 kinase activity inhibitor GSK’843. Representative of two independent experiments. Data are expressed as mean ± SEM. Unpaired t-tests were used for statistical analysis. ***P<0.001 . Figure 11 : IFN-b potentiates necroptosis in human B cell tumors treated with SMAC mimetics and caspase inhibitor. Frequency of cell death with or without hlFN-[3 pretreatment in human cell lines cultured in the presence of BV6 plus emricasan. Data are expressed as mean ± SEM. Results are representative of four independent experiments. Unpaired t-tests were used for statistical analysis. **P<0.01 ; ***P<0.001.

[0184] Figure 12: Differential effects of cell-death reprogramming therapy on B cell tumors and bystander immune cells. Mice bearing pro-B tumors were treated three times with the combination of birinapant, emricasan, IFN-|3 or with vehicle. (A) Representative dot plots showing the frequency of tumor B cells and different immune cell populations (endogenous B cells, T cells, neutrophils and monocytes) in the blood of treated and control mice. Numbers represent the percentage of gated cells (B) Frequency of immune populations depicted in (A) among hematopoietic cells. Data are expressed as mean ± SEM. Results are representative of two independent experiments.

[0185] EXAMPLES

[0186] MATERIAL AND METHODS

[0187] Mice

[0188] Male CD45.2 C57BL / 6J (B6) mice were purchased from Envigo. Male Rag2 I B6 mice were bred in our animal facility under specific pathogen free conditions. All mice used were 8-12 weeks old. All animal studies were approved by the Institut Pasteur Safety Committee in accordance with French and European guidelines (CETEA 2017-0038).

[0189] Cells and constructs

[0190] Immortalized pro B cell line was established by transducing bone marrow (BM) cells from wild type CD45.1 B6 mice with a retrovirus encoding viral Abelson Kinase (40). Lymphoma B cell line was isolated from male Ep-Myc mice that spontaneously develop Burkitt like lymphomas (41 ). These cell lines were retrovirally transduced with a pro death construct consisting in an activatable version of a full length murine RIPK3 chimeric protein based on a previously described model (21 ) (actRIPK3 pro B and actRIPK3 Ep-Myc cells). Briefly, murine RIPK3 sequence was cloned upstream of two copies of FKBP carrying the F36V mutation. This chimeric protein was cloned into pMSCVpuro retroviral vector containing T2A ribosome skipping sequences upstream of mCherry fluorescent protein. Transduced cells were selected for one week in 2 pg / ml of Puromycin and then sorted based on mCherry expression. Pro B and Ep-Myc cell lines expressing activatable RIPK3 construct were also retrovirally transduced to express a fluorescence resonance energy transfer (FRET) based reporter for caspase 3 / 7 activity [CFP(DEVD)YFP probe], named DEVD (22). Pro b cells were also retrovirally transduced to express chicken ovalbumin and sorted to generate a pro b ova cell line. Cells were cultured in RPMI 1640 medium GlutaMAX (Gibco) supplemented with 10% heat inactivated fetal bovine serum, penicillin (50 U ml— 1 ), streptomycin (50 pg ml— 1 ), 1 mM sodium pyruvate, 10 mM Hepes, and 50 pM 2 mercaptoethanol (Gibco) and maintained at 37°C and 5% CO2..

[0191] NIH-3T3 fibroblast cell line, expressing activatable RIPK3 construct; has been described previously (17). NIH 3T3 and mouse embryonic fibroblast (MEFs) were cultured in DMEM (Gibco) supplemented as described for RPMI. Human B cell lines: SUDHL4 (diffuse large B cell lymphoma, DLBCL), Ramos and Raji (Burkitt Lymphoma), purchased at ATCC, were cultured in supplemented RPMI as described above. All cell lines were routinely tested and determined to be free of Mycoplasma (Venor Gem Advance Mycoplasma Detection kit, Minerva Biolabs). CRISPR-Cas9 gene editing

[0192] Pro B cell line lacking endogenous RIPK3, caspase 8 or MLKL were generated by genome editing following direct delivery of CRISPR / Cas9 system as a ribonucleoprotein (RNP) complex (Integrated DNA Technologies (IDT)). The sequences of crRNA used to target RIPK3, caspase 8 or MLKL were: GCGGAGGGTTCAAGCTGTGT (SEQ ID No. 3), GTGGGATGTAGTCCAAGCAC (SEQ ID No. 4) and GCACACGGTTTCCTAGACGC (SEQ ID No. 5), respectively. Briefly, RIPK3 or caspase 8 or MLKL specific RNP complexes were generated by annealing an equimolar concentration of each specific oligo crRNA with the common tracrRNA using a slow slope reaching 23°C following by incubation at room temperature during 10 min with S.p. HiFi Cas9 Nuclease V3. One million pro B cells were resuspended in SF nucleofection solution (Lonza) with the corresponding RNP complex, transferred to nucleofection cuvette strips and electroporated using the DN 100 program (4D Nucleofector X Unit: Lonza). Transfected cells were further cultured for 48 72 hours in complete RPMI 1640 medium at 32°C in 5% CO2 to force genome editing (42) prior to resuspension in supplemented fresh medium. Effective RIPK3, caspase 8 and MLKL deletion was confirmed by western blotting.

[0193] Cell death stimulation in vitro

[0194] ActRIPK3 pro B and actRIPK3 Ep-Myc cells, stably transduced with activatable RIPK3 based pro death construct, were incubated in complete RPMI 1640 medium containing different concentrations of the chemical reagent B / B dimerizer (Takara) from 5 to 500 nM during 1 h, 3h or 6h. Dimerization of the FKBP fusion proteins in the presence of B / B dimerizer forces RIPK3 oligomerization, activation and cell death induction. RIPK3 induced cell death was also examined in cells pretreated for 30 min with the pan caspase inhibitor zVAD-fmk (50 pM, R&D systems) and later cultured in the presence of B / B dimerizer (500 nM). In some conditions, cells were pretreated for 24h with recombinant mouse IFN [3 (2.5ng / ml, BioLegend) before being cultured with B / B dimerizer in the presence or absence of zVAD fmk and RIPK3 kinase inhibitor GSK’843 (MedChemExpress, 5DM). Pro B cells expressing or lacking endogenous RIPK3 (RIPK3- / - pro B) were treated with BV6 (5 pM, HY 16701 , CliniSciences) to favor apoptosis induction or BV6 (5 %M) plus emricasan (5 DM, HY 10396, CliniSciences) for necroptosis induction during 16 hours. To examine the effect of IFN p in the magnitude of the induced cell deaths, pro B or RIPK3- / - pro B cells were cultured with IFN p (2.5 ng / ml) for 24h prior to the addition of BV6 or BV6 plus emricasan. SUDHL4, Ramos and Raji cells were cultured with recombinant human IFN-p (1 ng / ml, Peprotech)) for 24h before adding BV6 (5DM) plus emricasan (5 DM) during 16h.

[0195] Cell death stimulation in vivo

[0196] Male B6 mice were injected intravenously with 3x106 of DEVD actRIPK3 pro B or DEVD actRIPK3 Ep Myc cells. Tumors were first established in the BM and later disseminated in the blood, spleen and peripheral lymph nodes. Five days after tumor injection, when circulating tumor cells were detected, tumor bearing mice received a single dose of B / B dimerizer intravenously following manufacturer's recommendations (Takara). The stock solution of B / B dimerizer was prepared at 62.5 mg / ml in ethanol. Mice received 10mg / kg of B / B dimerizer prepared in an injection solution consisting of 4% of ethanol, 10% PEG-400, and 1.7% Tween in water. All injections were administered to mice within 30 min of dilution into the injection solution. Control vehicle mice received the same solution without B / B dimerizer. Tumor burden analyses were performed at 3h, 24h and at day 10 after treatment in the blood, bone marrow and spleen. When indicated, male b6 mice were injected intravenously with 3x106 of DEVD-ActRIPK3 pro-B lacking caspase 8. The number of tumor cells was measured in 60 pl of blood and the absolute number was calculated using counting beads assuming a total blood volume of 2 ml. Tibia bone marrow and spleen tumor count was measured in the whole organs and absolute count was calculated using counting beads. When indicated, Rag2- / - mice were challenged with DEVD actRIPK3 pro B cells and subjected to the same treatment schedule as immunocompetent mice. Mice were examined and killed in case of prostration, weakness, tousled hair or a weight loss >10%.

[0197] For the measure of the bystander effect, mice were inoculated with a mixture of 70% actRIPK3 pro B: 30% pro B tumor cells. Tumor bearing mice were treated with a single dose of IFN [3 (2 pg) or PBS intravenously at day 4 after tumor inoculation. One day after mice received B / B dimerizer (10 mg / kg) or vehicle intravenously. Tumor burden was evaluated in various organs at day 10 after B / B dimerizer injection.

[0198] To assess the antileukemic effect of SMAC mimetic (SM), mice bearing pro B tumors were treated with 2 mg / kg of birinapant in association with 1 mg / kg of emricasan and 2 ug of IFN-|3, all already used as single agent in clinical trials. Mice received three doses of I FN-|3 or PBS intravenously every two days starting at day 3 after tumor injection. Three doses of birinapant with or without emricasan were administered intraperitoneally every two days starting at day 4 after tumor inoculation. Tumor burden analyses were performed at day 14 after tumor injection and survival was monitored for up to 3 months. The induction of tumor specific T cell responses was measured by Kb-OVA tetramer staining at day 14 after inoculation of pro-B-OVA cells.

[0199] Cell preparation and flow cytometry

[0200] BM single cell suspensions were obtained from tibias, spleen and blood of tumor bearing mice and controls. For all staining protocols, cell suspensions were incubated with FcR blocking reagent before cell surface staining (anti-CD16 / 32 monoclonal antibody, clone 93, Biolegend). Stainings were performed with the following antibodies: CD19-Alexa-Fluor647 (clone 1 D3, BioLegend), CD45.1- BV421 (clone A20, BioLegend), CD45.2-FITC (clone 104, BioLegend). TCR[3 PC7 (clone H57 597, BioLegend), Ly6C BV785 (clone HK1.4, BioLegend), Ly6G BUV395 (clone 1A8, BD Bioscience), CD8 BV785 (clone 53 6.7, BioLegend) and CD44 BV421 (clone IM7, BioLegend). For identification of membrane permeabilized dead cells, Live Dead fixable viability dye eFluor780 (eBioscience) was used. For tetramer staining, cell suspensions were incubated for 1 h at 4°C with APC H2 Kb-OVA257 264 and PE H2 Kb-OVA257 264 tetramer (kindly provided by NIH tetramer core facility). For intracellular staining, viable, dying or dead tumor cells stained with the Live Dead dye were fixed and permeabilized using the Cytofix / Cytoperm kit (BD Biosciences) according with the manufacturer's recommendations and stained with Alexa Fluor647 anti cleaved caspase-3 monoclonal antibody (clone C92 605, BD Biosciences). Analyses were performed with an LSR Fortessa II (BD Biosciences) or CytoFLEX LX (Beckman Coulter) cytometers and analyzed using FlowJo software version 10.8.1 (BD Bioscience).

[0201] Immunoblot analysis

[0202] Cells were lysed in RIPA extraction buffer (Thermo Fisher Scientific) supplemented with a protease inhibitor cocktail (Thermo Fisher Scientific) at a concentration of 1 xi o6cells in 30 pL of buffer for 20 min on ice. Lysates were obtained by centrifugation at maximum velocity for 15 min at 4 °C. The pellet was discarded, and the supernatant was kept for further analysis. Protein concentration was measured using a BCA protein assay (Thermo Fisher Scientific). Equivalent micrograms of proteins were resuspended in 4x Laemmli sample buffer (Bio Rad) and separated using 4 15% Mini Protean® TGX Stain Free™ gels (Bio Rad), under reducing conditions. Proteins were then transferred on PVDF membranes (Bio Rad) using a semi dry system (Transblot Turbo Transfer System). After blocking with TBS 1 % POD (BM Chemiluminescence Western Blotting Substrate, Merck), membranes were incubated overnight at 4 °C with primary antibodies. After washing, membranes were incubated with HRP conjugated appropriate secondary antibody. Detection of bound antibodies were revealed using the Clarity Western ECL substrate (Bio Rad) and images were acquired with ImageQuant LAS 4000 Mini (GE Healthcare). Quantifications were done using Image Lab software (Bio Rad). Primary antibodies for western blot were anti mouse: RIPK3 (polyclonal, Novus Biologicals), RIPK1 (clone 38 / RIP, BD Biosciences), caspase 8 (clone 4927, Cell Signaling), cleaved caspase-8 (9429, Cell Signaling), caspase-3 (9662, Cell Signaling), FADD (clone 10L6M0, ThermoFischer), MLKL (clone 3H1 , Merck), phospho-MLKL (D6E3G, Cell Signaling) and [3-actin (clone 13E5, Cell Signaling). Secondary antibodies included HRP conjugated goat anti rabbit IgG (H + L), HRP conjugated goat anti mouse IgG (H + L) and HRP-conjugated goat anti-rat IgG (H + L) were all from Jackson.

[0203] Bulk RNAseq analysis of available mouse and human data.

[0204] MLKL expression data from sorted primary murine cells were obtained from the Immunological Genome Project (ImmGen, https: / / www.immgen.org) in the murine RNAseq section (http: / / rstats.immgen.org / Skyline / skyline.html). MLKL expression data from human cell lines were obtained from Cancer Cell Line Encyclopedia (CCLE, https: / / sites.broadinstitute.org / ccle). The expression of MLKL is depicted as normalized counts.

[0205] Single cell RNAseq of human BM mononuclear cells

[0206] Raw counts from two adult frozen BM mononuclear cell single cell RNAseq datasets were downloaded from 10x genomics website. https: / / www.10xqenomics.com / resources / datasets / frozen-bmm-cs-healthy- control-1 -1 -standard-1 -1 -0 https: / / www.10xqenomics.com / resources / datasets / frozen-bmm-cs-healthy- control-2-1 -standard-1 -1 -0

[0207] Raw counts from seven B cell acute lymphoblastic leukemia (B ALL) patients were downloaded from GEO (GSE134759) (26). Raw counts from four diffuse large B cell lymphoma (DLBC) patients were downloaded from GEO (GSE182436) (27).

[0208] The count matrix from each dataset was fed into Seurat (43) and analyzed independently with standard pipeline. “NormalizeData” function with default parameters was applied to normalize the expression level of genes in each single cell. The “ScaleData” function was used to scale and center gene expression matrices after regressing out heterogeneity associated with mitochondrial contamination. The two datasets were merged using canonical correlation analysis. To perform clustering, the dimensionality of the data was determined by calculating relevant principal components using the ElbowPlot function. The t SNE representation was used to visualize the single cell transcriptional profile in 2D space. Annotation of the clusters was performed using marker genes. The expression of MLKL, in given subsets, is depicted using Violin Plots showing ALRA imputed expression values.

[0209] ATACseq analysis of mouse primary cells

[0210] ATACseq analysis of MLKL locus was performed on public datasets (29). Bigwig files were downloaded from GEO (GSE 100738) and ATACseq profiles were visualized using Integrative Genomics Viewer (IGV) (44).

[0211] In vitro confocal imaging

[0212] In vitro live imaging was performed using an inverted microscope (Nikon. Ti2E) equipped with a Yokagawa CSU W1 spinning disk and 40X / 1 .15 water objective. Imaging was performed in the presence of DAP I at 37°C and 5% CO2.

[0213] Intravital two photon imaging

[0214] Mice bearing tumors were subjected to BM two photon intravital imaging before and after injection with B / B dimerizer, as previously described (45). Briefly, mice were anesthetized with a mixture of xylazine (Rompun; 10 mg / kg) and ketamine (Imalgene; 100 mg / kg). The scalp was removed, the skin was incised to expose the bone and a coverslip was fixed above the frontoparietal suture. During imaging, mice were supplied with oxygen, and temperature was maintained at 37°C using a heated pad. Two photon imaging was performed using an upright microscope (FVMPE RS, Olympus), a 25x / 1.05NA water dipping objective equipped with an objective heater and using FV31 S SW software (Olympus). An Insight DeepSee dual laser (Spectra Physics) tuned at 820 nm was used for excitation. Macrophages were visualized in vivo by intravenous injection of an Alexa Fluor594 conjugated anti-F4 / 80 mAb (Biolegends). The following filters were used: CFP (483 / 32), YFP (542 / 27), Alexa Fluor 594 (624 / 40). Time lapse sequences were created by scanning a 30 to 50 pm thick tissue volume using 5 pm Z steps and 60 sec intervals. Videos were processed and analyzed using Fiji software (Imaged 2.3.0). Figures and videos based on 2P microscopy are 2D maximum intensity projections of 3D datasets.

[0215] Statistical analyses

[0216] For each experiment, number of independent experiments, replicates and statistical tests used are indicated in the figure legends. All statistical tests were performed using Prism v.9.2.0 (GraphPad). Data are expressed as mean ± SEM. Paired, unpaired Student’s t-test or two-way ANOVA were used as indicated in individual figure legends. All statistical tests were two tailed with a significance level of 0.05. n.s, non significant; *P<0.05; **P<0.01 ; ***P<0.001.

[0217] RESULTS

[0218] Example 1 - RIPK3 activation induces apoptosis in B cell tumors

[0219] RIPK3 is a major hub in programmed cell death that has been widely studied in solid tumors. To dissect how RIPK3 signaling pathway may impact malignant B cells, we relied on an activatable RIPK3-2xFKBP chimeric protein (actRIPK3), upon aggregation with the B / B dimerizer reagent (20, 23) (Figure 1A). Indeed, RIPK3 oligomerization has been shown to force RIPK3 activation and induce cell death (23). This system offers the possibility to selectively activate RIPK3 signaling pathway with high temporal control. We introduced actRIPK3, coexpressed with mCherry in two distinct B cell tumor models, an Abl driven acute B cell leukemia cell line (pro B cells) and in a Myc driven B cell lymphoma (Ep- Myc) (Figure 1 B-C). Activation of RIPK3 by B / B dimerizer mediated oligomerization in vitro triggered rapid cell death in both B cells tumor models, with most cells dying within 6 hours (Figure 1 D).

[0220] To further characterize the cell death pathway(s) associated with RIPK3 activation, cells were examined for activated caspase 3 expression in the presence of the fixable Live Dead viability dye to assess membrane permeabilization. As shown in Figure 1 E, RIPK3 activation, upon addition of B / B dimerizer, resulted in robust caspase 3 activity, a hallmark of apoptosis, in virtually all tumor cells and this was true for both pro B and Ep-Myc tumors. Most tumor cells also incorporated the vital dye, which is expected at late stages of apoptotic cell death (Figure 1 E-F). To complement these observations, we analyzed the morphology of pro B cells upon RIPK3 activation using confocal microscopy. Consistent with our flow cytometric results, we observed rapid membrane blebbing, a morphological feature of cells undergoing apoptosis and, at later stages, membrane permeabilization as detected by DAPI incorporation (Figure 1 G). Overall, our results suggest that selective RIPK3 activation in B cell malignancies is characterized by rapid apoptosis with little evidence for non apoptotic cell death. Of note, RIPK3 activation in the NIH-3T3 fibroblast cell line transduced with activatable RIPK3 construct induced necroptosis characterized by membrane permeabilization in the absence of caspase 3 activity and induction of phospho-MLKL (Figure 1 H, 11 and 1 J). Our results with B cell tumors also contrast with previous observations made on solid tumors where necroptosis was the dominant cell death pathway triggered by forced RIPK3 activation (18).

[0221] Our results indicated that B tumor cells cultured in vitro underwent apoptosis upon RIPK3 activation. However, it remained essential to determine the fate of B cell tumors undergoing RIPK3 activation in vivo. Manipulating and monitoring selective cell death pathway in vivo is particularly challenging. We tested whether selective RIPK3 activation could be achieved in tumor-bearing mice treated with a single dose of B / B dimerizer (Figure 2A). We observed a significant decrease in tumor burden as early as 3 hours post injection and a complete elimination of tumor cells 3 days later both in the blood and in the bone marrow (BM) (Figure 2B). Our results indicated that B / B dimerizer mediated oligomerization could be performed efficiently in tumors developing in vivo, and that subsequent RIPK3 activation induced rapid and efficient tumor cell death. To track tumor cell fate in vivo upon RIPK3 activation, we transduced actRIPK3 bearing B cell tumors with a fluorescence resonance energy transfer (FRET) based reporter for caspase 3 activity (25). CFP(DEVD)YFP reporter can be used to monitor apoptosis in real time due to a loss of FRET resulting from the cleavage of DEVD peptide by activated caspase 3 (Figure 2C). Mice harboring pro B cell tumors expressing actRIPK3 and the caspase 3 reporter were subjected to intravital two-photon imaging of the BM. Prior to injection of the B / B dimerizer or upon injection of the control vehicle, we did not detect any apoptosis induction. By contrast, we observed a burst of apoptotic events between 30 and 60 min after B / B dimerizer injection with the vast majority of tumor cells becoming positive for the caspase 3 reporter (FRETneg) (Figure 2D-E). Similar results with slightly different kinetics were observed using mice bearing Ep-Myc B cell tumors suggesting that this may be a hallmark of malignant B cells (Figure 2D-E). Overall, our data indicated that RIPK3 activation in B cell tumors in vivo resulted in efficient and rapid cell death by apoptosis. To assess the fate of B cells undergoing apoptosis at the tumor site, we visualized tumor associated macrophages during RIPK3 activation in B cell tumors. As shown in Figure 2F-J, we observed that B tumor cells first activated caspase 3 / 7 (FRETneg) and were then rapidly engulfed by tumor associated macrophages. Macrophage mediated capture of apoptotic tumors was both very efficient (Figure 2F) and rapid, typically occurring in less than 15 min post caspase-3 activation (Figure 2H-J). In sum, our data demonstrate that selective activation of RIPK3 in two models of B cell malignancy leads to rapid cell apoptosis and subsequent macrophage mediated scavenging. Apoptosis may therefore represent the default cell death pathway triggered by RIPK3 activation in B cell tumors malignant B cells.

[0222] Example 2 - Redirecting the fate of RIPK3 activation from apoptosis to necroptosis in vivo

[0223] Because necroptosis is typically associated with stronger anti tumor immune responses as compared to apoptosis, we sought to promote necroptotic cell death in B cell tumors. RIPK3 mediated apoptosis has been shown to require caspase 8 activation (13, 15). Accordingly, RIPK3 oligomerization in the presence of the pan caspase inhibitor zVAD-fmk substantially reduced cell death induction in vitro (Figure 3A). A small but sizeable fraction of tumor cells (15-20%) underwent cell death despite efficient caspase inhibition, indicating that redirection to non apoptotic cell death was possible but relatively inefficient (Figure 3A-C). This non apoptotic cell death corresponded morphologically to necroptosis with cell enlargement, intact nucleus, absence of blebbing and uptake of the vital dye (Figure 3D). Western blot analyses confirmed that hallmarks of apoptosis (caspase 3 / 8 cleavage) were dominant upon B / B dimerizer treatment alone, while features of necroptosis (upregulation of phospho-MLKL in the absence of caspase cleavage) were detected upon B / B dimerizer plus zVAD (Figure 3E). We observed a similar , shift toward low levels of necroptosis, by generating Casp8- / - B cell tumors and treating the cells with the B / B dimerizer ( Figure 3F and Figure 8G).

[0224] We next evaluated the ability to trigger and monitor necroptosis in vivo and performed intravital imaging of the BM in mice with established actRIPK3 Casp8- / - pro B cell tumors. Tumors also expressed the CFP(DEVD)YFP reporter that can reveal both apoptotic events (due to the cleavage of the DEVD peptide) and cell digestion within phagocytes (due to the loss of YFP fluorescence at low pH) as we have detailed previously (23) (Figure 4A). Contrasting with what we observed with caspase 8 proficient tumors for which RIPK3 activation led to apoptosis (loss of FRET) followed by macrophage engulfment (Figure 2F-H, Figure 4C, E), RIPK3 activation in Casp8 - / - tumors led to rapid tumor engulfment without detectable apoptosis measured by FRET loss (Figure 4B,- 4D and 4F). However, change in reporter activity was seen after phagocytosis most likely reflecting loss of YFP fluorescence in the acidic phagosomal environment as reported previously (23) (Figure 4B, 4D and 4F). The distinct sequences of events observed in caspase 8 proficient and deficient tumors upon RIPK3 activation (Figure 2F-H, Figure 4B, 4D and 4F) are consistent with the induction of apoptotic and necroptotic cell death in vivo, respectively. Interestingly, both type of cell death triggered clearance by tumor associated macrophages within 10-20 min.

[0225] We next compared the extent of RIPK3-mediated induction of apoptosis or necroptosis in vivo by injecting the B / B dimerizer in mice bearing caspase 8 proficient or deficient actRIPK3-pro B-cell tumors, respectively. While RIPK3- mediated induction of apoptosis was highly efficient (>99% of circulating tumor elimination), RIPK3-mediated triggering of necroptosis only led to two-fold reduction in tumor load (Figure 4G-4H).

[0226] In sum, results provide a direct in vivo evidence that blockade of caspase activity may redirect RIPK3 activation towards necroptosis, in particular in a fraction of malignant B cells.

[0227] Example 3 - Low MLKL expression characterizes non-transformed and malignant B-lineage cells

[0228] To clarify the relatively low level of necroptosis observed in our B cell tumors upon caspase inhibition and RIPK3 activation, we examined the level of key molecules associated with cell death pathways (Figure 5A). When comparing to mouse embryonic fibroblasts (MEFs), pro B cell tumors expressed low levels of MLKL, and higher levels of Caspase 8 (Figure 5B). We next assessed whether poor MLKL expression was a shared feature of malignant B cells across species. First, we analyzed MLKL expression on human B cell tumors using bulk RNA sequencing data from the Cancer Cell line Encyclopedia. Most (16 / 19) analyzed B cell tumors demonstrated very low expression of MLKL as compared to the THP1 monocytic cell line known to express MLKL robustly (Figure 5C). . In addition, analyzing scRNA sequencing data from ALL and DLBCL patients (26, 27) confirmed the low levels of MLKL expression in patient malignant B cells (Figure 9A-D). Low MLKL expression was also a feature of non-transformed B- lineage cells as observed in bulk RNA sequencing of murine immature and mature B cells from the Immgen database (Figure 5D). Low expression of MLKL on mature (splenic) B cells was confirmed at the protein level (Figure 5G). Finally, analyzing single cell RNA sequencing data from human BM mononuclear cells (10X Genomics), we again observed low MLKL expression in developing B cells but not in CLPs (Figure 5E-F). To test whether the lack of MLKL protein expression in B cells was associated with low chromatin accessibility, we analyzed public ATACseq dataset (29). Low MLKL expression was indeed associated with reduced chromatin accessibility in a region that overlap with the transcription start site and exon 1 of MLKL in immature and mature murine B cells (Figure 5H). Conversely, CLP and monocyte / macrophages that expressed higher levels of MLKL protein showed evidence of high chromatin accessibility in these regions

[0229] Together, these data suggested that low expression of MLKL in B lineage cells observed in mice and humans may limit the ability of malignant B cells to engage RIPK3 mediated necroptosis.

[0230] Example 4 - Manipulating RIPK3 induced cell death in B tumor cells with type I IFN

[0231] Based on our observations, we hypothesized that increasing MLKL expression may favor necroptosis in B cell tumors. Interferons have been shown to upregulate MLKL expression in various cell lines (30-33). We noted a substantial increase in MLKL expression in pro B cell tumors upon treatment with either IFN-a, I FN-I3> and IFN-y with the highest effect being seen with I FN-I3> (Figure 6A). We therefore triggered RIPK3 activation in B tumor cells pretreated with I FN-I3> in the presence or absence of caspase inhibition. Tumor cell death triggered by RIPK3 activation was accelerated by IFN-I3> pretreatment (Figure 6B). Most importantly, in the presence of caspase inhibition, the addition of IFN-13. strongly promoted cell death with 80-90% of tumor cells dying upon RIPK3 activation (Figure 6B). We more closely examined the type of B cell tumor cell death in these various conditions. We observed that apoptosis was still the dominant pathway triggered by RIPK3 in the presence of IFN-f3> (Figure 6C-D). However, robust necroptosis was achieved by RIPK3 activation combined with I FN-f3> and caspase inhibition (Figure 6C-D). The generation of MLKL deficient B cell tumors confirmed that the cell death pathway promoted by the combined action of RIPK3, IFN-f3> and caspase blockade was completely MLKL-dependent (Figure 6E-F). Enhanced necroptosis in the presence of IFN-(3> and caspase inhibition was further supported by imaging (Figure 6G) and by inhibition of RIPK3 kinase activity (Figure 10).

[0232] As summarized in Figure 6H, RIPK3 activation in B cell malignancies can lead to distinct types and magnitudes of programmed cell death, dependent on MLKL expression level and caspase 8 activity, that can be regulated by type I IFN stimulation and chemical caspase inhibition, respectively. In particular, while apoptosis appeared to be the default pathway induced by RIPK3 in these tumors, we show that redirection of cell death toward the necroptotic pathway can be achieved in vitro by inhibiting caspases and that RIPK3-induced cell deaths could be maximized by the addition of type I IFN.

[0233] Example 5 - RIPK3 activation in the presence of type I IFN promotes bystander control of B cell tumor

[0234] Overall, our results suggest that tumor B cell fate upon RIPK3 activation could be modulated by caspase inhibition and / or type I IFN. Since therapies that aim to induce tumor cell death rarely achieve 100% of tumor elimination, the induction of an effective adaptive immune response is often essential to eliminate resistant cells. We therefore evaluated whether RIPK3 activation in B cell malignancies elicited an immune response against surviving tumor cells. To this end, immunocompetent (WT) or immunodeficient (Rag2 - / -) B6 mice with established act RIPK3 B cell tumors were treated with the B / B dimerizer (Figure 7A-D). After 24h, most (>99%) tumor cells were eliminated with a small residual population detected in the BM and in the spleen (Figure 7A-B). At later time points, circulating tumors remained undetectable in WT hosts and these animals exhibited long term protection, remaining tumor free for more than 3 months (Figure 7C-D). This was not the case in Rag2 - / - hosts. In this case, circulating tumors were detected on day 10 and the long-term protection was lost (Figure 7C-D). This suggests that the adaptive immune system can control residual tumors after massive RIPK3 induced tumor cell death dominated by apoptosis. We next asked whether the inducible death of only a fraction of tumor cells may confer enough immunity that would mediate bystander tumor elimination. To this end, mice were inoculated with a mixture of act RIPK3 expressing (70%) and WT (30%) pro B cells (Figure 7E). While treatment with the B / B dimerizer effectively eliminated act RIPK3 tumors at early time point, only 2 out of 9 mice were able to control B cell tumor in a bystander fashion (Figure 7F). By contrast, the administration of type I IFN in vivo conferred bystander tumor control in most (8 / 9) mice (Figure 7F). To test whether a similar benefit was observed when cells underwent necroptosis rather than apoptosis upon RIPK3 activation, we conducted similar experiment using a mixture of act RIPK3 Casp8 - / - (70%) and WT (30%) B cell tumors (Figure 7G). A majority of mice controlled tumors in a bystander fashion and this effect was abrogated when Rag2 - / - mice were used as recipients (Figure 7H). Altogether, our results indicated that in addition to boosting apoptosis and necroptosis upon RIPK3 activation, type I IFN promotes bystander tumor control by the immune system.

[0235] Example 6 - Exploiting RIKP3-associated cell death pathways to control B cell tumors

[0236] The selective manipulation of RIPK3 activity in vivo highlighted the likely benefit of combining RIPK3 activation with type I IFN and caspase inhibition for optimal anti-tumor immune activity against malignant B cells. We therefore sought to translate these results and establish a combination therapy to optimally target B cell tumors. We used SMAC mimetics (SM) that promote cell death by inducing degradation and direct inhibition of cellular inhibitor of apoptosis proteins (lAPs) (24). We found that in vitro treatment with the bivalent SM BV6 induced moderate levels of cell death (Figure 8A) in pro B cells that was dependent on RIPK3 (, Figure 8A and 81). We therefore decided to combine SM as an agonist of RIPK3 with IFN-f3> and emricasan (a clinical grade pan caspase inhibitor). Combining SM with emricasan or type I IFN increased the magnitude of tumor cell death and associating the 3 drugs allowed to reach maximal effects, killing the vast majority of tumor cells (Figure 8A-B). Again, the effects mediated by the combined treatment were largely dependent on RIPK3 (Figure 8A-B). As shown in Figure 8C-D, we validated that the association of SM, IFN-(3> and emricasan was the most efficient strategy to trigger robust necroptosis. We extended these observations to human cells by showing that the addition of IFN-D on human tumor B cell lines also boosted necroptosis induced by SMAC mimetics and caspase inhibition (Figure 11 ).

[0237] Translating our findings in vivo, mice bearing pro B cell tumors were treated with the bivalent SM birinapant (currently undergoing phase II clinical trial) alone or in combination with IFN-f3> and / or emricasan (Figure 8E). Treatment with SM alone had no detectable impact on tumor load (Figure 8F). Tumor control was somewhat improved by combining SM with either IFN-f3> or emricasan but only the tri-therapy substantially reduced tumor burden in different anatomical sites, including blood, lymph nodes and BM (Figure 8F). As shown in Figure 12A and 12B, the tri therapy appeared to spare non-malignant immune cells suggesting that malignant B cells are specifically sensitive to the cell death reprogramming tri therapy.

[0238] To assess the involvement of the immune system in the tumor control elicited by the tri therapy, we compared the survival of treated tumor-bearing WT or Rag2- / - hosts (Figure 8J). We found that the treatment cured two-third of the WT mice but none of the Rag2- / - mice, revealing a major role for the adaptive immune system in the therapeutic efficacy. To analyze T cell responses induced by the treatment, we used pro-B cell tumors expressing the OVA model antigen and analyzed antigen-specific CD8+ T cells using MHC-peptide tetramers. As shown in Figures 8K and 8L, the highest levels of tumor-specific T cells were achieved by the tri therapy as compared to any other drug combinations tested. Thus, the cell-death reprogramming strategy not only induced robust tumor cell death but also elicited a potent immune response, essential for tumor clearance.

[0239] In sum, our results highlight that RIPK3 is a central node for B cell tumor death and establish a therapeutic strategy relying on the combined action of RIPK3 activation, type I IFN and caspase inhibition to optimize tumor cell death and anti tumor immune responses.

[0240] DISCUSSION

[0241] In the present study, we examined the in vivo consequences of RIPK3 activation in B cell tumors and how its manipulation could promote potent anti-tumor immunity. Contrasting with what has been reported with other cell types (including fibroblast or solid tumors) 17, 18, 21 )), forced RIPK3 activation through FKBP based oligomerization triggered B tumor cell death almost exclusively via apoptosis. Reprograming RIPK3 activity toward necroptosis required caspase inhibition but may remain relatively inefficient due to the poor expression of MLKL in B lineage cells. The addition of type I IFN substantially improved the induction of necroptosis, most likely by upregulating MLKL expression in B cell tumors. We provide evidence that RIPK3 activation in the presence of type I IFN results in improved anti tumor immune responses and bystander tumor elimination. Based on these findings, we identify an optimal combination therapy aimed at activating RIPK3, blocking caspase and providing type I IFN that optimizes the control of B cell tumor burden, anti-tumor immune responses and tumor regression in vivo.

[0242] Dissecting the role of specific cell death pathways is challenging but can be facilitated by activatable molecule such as FKBP fusion proteins, that can be multimerized by the addition of cell permeant synthetic dimerizers. Activatable forms of RIPK3, caspase 8 or FADD have been generated to study the consequences of immunization with cells induced to die in vitro (6, 17). In models of B cell malignancies, we show here that it is possible to extend these approaches in vivo and effectively induce RIPK3 activation in well established tumors, with precise temporal control. The use of intravital microscopy offered the possibility to track the fate of tumor cells undergoing RIPK3 activity at the tumor site in real time. These experiments formally established that RIPK3 activation induces robust apoptosis in B cell tumors followed by rapid macrophage engulfment. In settings where caspase 8 is absent, tumor cells died by necroptosis and cells were rapidly engulfed by tumor associated macrophages. This is consistent with the fact that necroptotic cells expose phosphatidylserine after MLKL membrane translocation (34). Moreover, it has been shown that necroptotic cells continue to produce inflammatory cytokines several hours after membrane permeabilization, a feature that contributes to their inflammatory potential (19). Our in vivo imaging revealed that cells undergoing necroptosis may not persist as isolated necroptotic corpses for very long, especially in macrophage rich environments (such as tumors). Therefore, inflammation associated with cell death may not only depend on the type of cell death but also on the speed at which cellular corpses are cleared by macrophages.

[0243] Our results suggest that strategies aimed at promoting necroptosis in solid tumors (5, 18) may need to be adjusted for B cell malignancies in which apoptosis is the prevalent pathway activated by RIPK3. Low expression of MLKL in B- lineage cells combined with robust expression of inhibitors of necroptosis (i.e caspase 8) likely restrain necroptotic cell death in B cell malignancies. Notably, low MLKL expression in B cells could be reversed by IFNs, possibly through modification of chromatin accessibility Of particular interest is the benefit offered by the addition of type I IFNs. Interestingly, treatment of B cell lymphoma and multiple myeloma with type I IFNs has been considered for several decades and provided therapeutic benefit in preclinical models and in patients. A response rate of 15% has been reported in multiple myeloma patients treated with type I IFNs as a monotherapy yet the underlying mechanisms remained controversial (35). Our results may provide a mechanistic basis for the beneficial effects provided by type I IFNs for these malignancies. Type I IFNs increased the magnitude of cell death by necroptosis and the capacity of the host to mount an efficient immune response allowing to clear tumor cells spared by the therapy. These beneficial effects on anti tumor immunity might result from interferon-a / p receptor (IFNAR) signaling on tumor cells leading to enhanced immunogenicity of dying cells and from direct signaling on immune effectors and antigen presenting cells.

[0244] We show that these effects are particularly interesting in settings that favor RIPK3 activity. Our results demonstrate that the cytotoxic activity of SMAC mimetics in B cell tumors is strictly dependent on RIPK3. The development of SMAC mimetics represents an attractive approach to engage tumor cell death pathways. Yet, the clinical use of SM as monotherapy has yielded limited results, highlighting the need for combined treatments (36). Previous in vitro studies have reported the benefit of combining SMAC mimetics with type II IFN (37) to promote necroptosis or with IFN-a to enhance apoptosis in renal cell carcinoma (38). In models of acute myeloid leukemia, SMAC mimetics synergized with caspase inhibition in vitro. In the context of B cell tumors, both type I IFN and caspase inhibition were critical for the therapeutic benefit of SMAC mimetics. Such a cell deathreprogramming therapy targeting RIPK3 may be particularly suited for patients primarily refractory to or relapsing after standard chemotherapy regimen as these treatments are mostly RIPK1 independent (3).). Finally, drug activity profiling may help identify patients that would be most likely to benefit from SM based therapy as suggested in patient derived samples of acute lymphoid leukemia (3).

[0245] Guided by the findings made with the activatable RIPK3, we provide in vivo evidence that a combined therapy including type I IFNs, the SMAC mimetics birinapant and the caspase inhibitor emricasan promotes effective control of B cell tumors in vivo, encouraging further clinical investigations. This therapy elicited a strong T cell responses and promoted clearance of B cell tumors in most treated mice. The fact that this therapy was not effective in Rag2- / - mice highlight the importance of the immune response to eliminate tumor cells that were not directly killed by the drug combination. As illustrated here, strategies that optimize the type and magnitude of cancer cell death while boosting the associated immune response represent an attractive avenue to treat B cell malignancies.

[0246] REFERENCES

[0247] 1. Hanahan, D. & Weinberg, R. A. The hallmarks of cancer. Cell 100, 57-70 (2000).

[0248] 2. Fulda, S. Tumor resistance to apoptosis. Int J Cancer 124, 511 -515 (2009).

[0249] 3. McComb, S. et al. Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med 8, 339ra370 (2016).

[0250] 4. Yatim, N., Cullen, S. & Albert, M. L. Dying cells actively regulate adaptive immune responses. Nat Rev Immunol 17, 262-275 (2017).

[0251] 5. Messmer, M. N., Snyder, A. G. & Oberst, A. Comparing the effects of different cell death programs in tumor progression and immunotherapy. Cell Death Differ 26, 115-129 (2019).

[0252] 6. Aaes, T. L. et al. Vaccination with Necroptotic Cancer Cells Induces Efficient Anti-tumor Immunity. Cell Rep 15, 274-287 (2016).

[0253] 7. Tummers, B. & Green, D. R. Mechanisms of TNF-independent RIPK3- mediated cell death. Biochem J 479, 2049-2062 (2022).

[0254] 8. Yu, P. W. et al. Identification of RIP3, a RIP-like kinase that activates apoptosis and NFkappaB. Curr Biol 9, 539-542 (1999).

[0255] 9. Sun, X. et al. RIP3, a novel apoptosis-inducing kinase. J Biol Chem 274, 16871 -16875 (1999).

[0256] 10. He, S. et al. Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha. Cell 137, 1100-1111 (2009).

[0257] 11. Wang, H. et al. Mixed lineage kinase domain-like protein MLKL causes necrotic membrane disruption upon phosphorylation by RIP3. Mol Cell 54, 133- 146 (2014).

[0258] 12. Weinlich, R., Oberst, A., Beere, H. M. & Green, D. R. Necroptosis in development, inflammation and disease. Nature reviews. Molecular cell biology 18, 127-136 (2017).

[0259] 13. Mandal, P. et al. RIP3 induces apoptosis independent of pronecrotic kinase activity. Mol Cell 56, 481 -495 (2014).

[0260] 14. Newton, K. et al. Activity of protein kinase RIPK3 determines whether cells die by necroptosis or apoptosis. Science 343, 1357-1360 (2014).

[0261] 15. Cook, W. D. et al. RIPK1 - and RIPK3-induced cell death mode is determined by target availability. Cell Death Differ 21 , 1600-1612 (2014).

[0262] 16. Lawlor, K. E. et al. RIPK3 promotes cell death and NLRP3 inflammasome activation in the absence of MLKL. Nat Commun 6, 6282 (2015).

[0263] 17. Yatim, N. et al. RIPK1 and NF-kappaB signaling in dying cells determines cross-priming of CD8(+) T cells. Science 350, 328-334 (2015).

[0264] 18. Snyder, A. G. et al. Intratumoral activation of the necroptotic pathway components RIPK1 and RIPK3 potentiates antitumor immunity. Sci Immunol 4 (2019).

[0265] 19. Orozco, S. L. et al. RIPK3 Activation Leads to Cytokine Synthesis that Continues after Loss of Cell Membrane Integrity. Cell Rep 28, 2275-2287 e2275 (2019).

[0266] 20. Fulda, S. Smac mimetics as IAP antagonists. Semin Cell Dev Biol 39, 132- 138 (2015). 21. Orozco, S. et al. RIPK1 both positively and negatively regulates RIPK3 oligomerization and necroptosis. Cell Death Differ 21 , 1511-1521 (2014).

[0267] 22. Breart, B., Lemaitre, F., Celli, S. & Bousso, P. Two-photon imaging of intratumoral CD8 T cell cytotoxic activity during adoptive T cell therapy in mice. J. Clin. Invest. 118, 1390-1397 (2008).

[0268] 23. Grandjean, C. L., Garcia, Z., Lemaitre, F., Breart, B. & Bousso, P. Imaging the mechanisms of anti-CD20 therapy in vivo uncovers spatiotemporal bottlenecks in antibody-dependent phagocytosis. Sci Adv 7 (2021 ).

[0269] 24. Barretina, J. et al. The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature 483, 603-607 (2012).

[0270] 25. Chen, J. et al. RIP3 dependent NLRP3 inflammasome activation is implicated in acute lung injury in mice. J Transl Med 16, 233 (2018).

[0271] 26. Witkowski, M. T. et al. Extensive Remodeling of the Immune Microenvironment in B Cell Acute Lymphoblastic Leukemia. Cancer Cell 37, 867- 882 e812 (2020).

[0272] 27. Steen, C. B. et al. The landscape of tumor cell states and ecosystems in diffuse large B cell lymphoma. Cancer Cell 39, 1422-1437 e1410 (2021 ).

[0273] 28. Heng, T. S., Painter, M. W. & Immunological Genome Project, C. The Immunological Genome Project: networks of gene expression in immune cells. Nat Immunol 9, 1091 -1094 (2008).

[0274] 29. Yoshida, H. et al. The cis-Regulatory Atlas of the Mouse Immune System. Cell 176, 897-912 e820 (2019).

[0275] 30. Knuth, A. K. et al. Interferons Transcriptionally Up-Regulate MLKL Expression in Cancer Cells. Neoplasia 21 , 74-81 (2019).

[0276] 31. Sarhan, J. et al. Constitutive interferon signaling maintains critical threshold of MLKL expression to license necroptosis. Cell Death Differ 26, 332- 347 (2019).

[0277] 32. Dillon, C. P. et al. RIPK1 blocks early postnatal lethality mediated by caspase-8 and RIPK3. Cell 157, 1189-1202 (2014).

[0278] 33. Thapa, R. J. et al. Interferon-induced RIP1 / RIP3-mediated necrosis requires PKR and is licensed by FADD and caspases. Proc Natl Acad Sci U S A 110, E3109-3118 (2013).

[0279] 34. Chen, J., Kuroki, S., Someda, M. & Yonehara, S. Interferon-gamma induces the cell surface exposure of phosphatidylserine by activating the protein MLKL in the absence of caspase-8 activity. J Biol Chem 294, 11994-12006 (2019).

[0280] 35. Grander, D. How does interferon-alpha exert its antitumour activity in multiple myeloma? Acta Oncol 39, 801-805 (2000).

[0281] 36. Morrish, E., Brumatti, G. & Silke, J. Future Therapeutic Directions for Smac-Mimetics. Cells 9 (2020).

[0282] 37. Cekay, M. J. et al. Smac mimetics and type II interferon synergistically induce necroptosis in various cancer cell lines. Cancer Lett 410, 228-237 (2017).

[0283] 38. Reiter, M., Eckhardt, I., Haferkamp, A. & Fulda, S. Smac mimetic sensitizes renal cell carcinoma cells to interferon-alpha-induced apoptosis. Cancer Lett 375, 1 -8 (2016).

[0284] 39. Brumatti, G. et al. The caspase-8 inhibitor emricasan combines with the SMAC mimetic birinapant to induce necroptosis and treat acute myeloid leukemia. Sci Transl Med 8, 339ra369 (2016). 40. Lenden Hasse, H. et al. Generation and CRISPR / Cas9 editing of transformed progenitor B cells as a pseudo-physiological system to study DNA repair gene function in V(D)J recombination. J Immunol Methods 451 , 71 -77 (2017). 41. Harris, A. W. et al. The E mu-myc transgenic mouse. A model for high- incidence spontaneous lymphoma and leukemia of early B cells. The Journal of experimental medicine 167, 353-371 (1988).

[0285] 42. Doyon, Y. et al. Transient cold shock enhances zinc-finger nuclease- mediated gene disruption. Nat Methods 7, 459-460 (2010). 43. Satija, R., Farrell, J. A., Gennert, D., Schier, A. F. & Regev, A. Spatial reconstruction of single-cell gene expression data. Nature biotechnology 33, 495- 502 (2015).

[0286] 44. Robinson, J. T. et al. Integrative genomics viewer. Nature biotechnology 29, 24-26 (2011 ). 45. Cazaux, M. et al. Single-cell imaging of CAR T cell activity in vivo reveals extensive functional and anatomical heterogeneity. J Exp Med (2019).

Claims

CLAIMS1. An agonist of Receptor-interacting serine / threonine-protein kinase 3 (RIPK3) for use in a combination therapy with an agonist of mixed lineage kinase domain-like protein (MLKL) and / or a caspase inhibitor for treating a patient suffering from a cancer with malignant B cells, the agonist of RIPK3 being a compound that promotes the expression, or the phosphorylation, or the oligomerization, or the phosphorylation and the oligomerization, of RIPK3.

2. The agonist of RIPK3 for use according to claim 1 , wherein the agonist of RIPK3 is a molecule that promotes phosphorylation of RIPK3 in malignant B cells and / or is a molecule that promotes RIPK3 oligomerization in malignant B cells..

3. The agonist of RIPK3 for use according to claim 1 or 2, wherein the agonist of RIPK3 promotes RIPK3 oligomerization.

4. The agonist of RIPK3 for use according to any one of claims 1 to 3, wherein the agonist of RIPK3 is selected from the group consisting of SMAC mimetics, hypomethylating agents, pan-HDAC inhibitors,, a polynucleotide comprising a sequence that encodes RIPK3 protein or a functional equivalent thereof, and EZH2 inhibitors.

5. The agonist of RIPK3 for use according to any one of claims 1 to 4, wherein the agonist of RIPK3 is a SMAC mimetic, in particular birinapant.

6. The agonist of RIPK3 for use according to any one of claims 1 to 5, wherein the agonist of MLKL is selected from the group consisting of (i) type-l interferon (l-IFN), in particular selected from the group consisting of IFN-a, IFN-p, IFN-K, IFN-CO, in particular IFN-a, or IFN-|3, more particularly recombinant IFN-a or recombinant IFN-p, Interferon gamma (IFN-y), in particular recombinant IFN-y, either alone or in combination with TNFa; (ii) a TAM receptor tyrosine kinase, in particular Tyro-3, Axl or Mer, MLKL protein, a functional equivalent thereof and (iii) a polynucleotide comprising a sequence that encodes MLKL protein or a functional equivalent thereof.

7. The agonist of RIPK3 for use according to claim 6, wherein the agonist of MLKL is a type I interferon (l-IFN), in particular IFN-|3.

8. The agonist of RIPK3 for use according to any one of claims 1 to 7, wherein the caspase inhibitor is selected from the group consisting of Crma, p35 protein, Z-VAD, inhibitor of apoptosis proteins (IAP), caspase peptide-based inhibitors, caspase peptidomimetic inhibitors, caspase non- peptidic inhibitors, and allosteric caspase inhibitors.

9. The agonist of RIPK3 for use according to claim 8, wherein the caspase inhibitor is a caspase-8 inhibitor, in particular emricasan.

10. The agonist of RIPK3 for use according to any one of claims 1 to 9, wherein the agonist of RIPK3 is birinapant, and when present the caspase inhibitor is emricasan, and the agonist of MLKL is a type I interferon (I- IFN), in particular IFN-|3.

11. A combination therapy, in particular provided as a composition or as a kit of compounds or as a product labelling, comprising:- an agonist of RIPK3 as defined in any one of claims 1 to 5; and- an agonist of MLKL as defined in claim 6 or 7; and / or- a caspase inhibitor as defined in claim 8 or 9.

12. The combination therapy according to claim 11 which comprises the agonist of RIPK3, the agonist of MLKL and the caspase inhibitor.

13. The combination therapy according to claim 11 or 12, wherein the agonist of RIPK3 is a SMAC mimetic, in particular birinapant.

14. The combination therapy according to any one of claims 11 to 13, wherein the agonist of MLKL is a type-l interferon (l-IFN), in particular IFN-|3.

15. The combination therapy according to any one of claims 11 to 14, wherein the caspase inhibitor is a caspase-8 inhibitor.

16. The combination therapy according to any one of claims 11 to 15, wherein the agonist of RIPK3 is a birinapant, the caspase inhibitor is emricasan, and the agonist of MLKL is I FN-|3.

17. The combination therapy according to any one of claims 11 to 16, further comprising a pharmaceutical suitable excipient and / or vehicle.

18. The combination therapy according to any one of claims 11 to 17, for use in treating a patient suffering from a cancer with malignant B cells.

19. The agonist of RIPK3 for use according to any one of claims 1 to 10 or the combination therapy for use according to claim 18, for treating a patient suffering from B-cell lymphomas, in particular Diffuse large B-cell lymphoma, primary mediastinal B-cell lymphoma, Follicular lymphoma, Chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), Mantle cell lymphoma (MCL), Marginal zone lymphomas, including Extranodal marginal zone B-cell lymphoma, mucosa-associated Lymphoid Tissue (MALT) lymphoma, Nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, Burkitt lymphoma, Primary intraocular lymphoma, Primary central nervous system (CNS) lymphoma, small lymphocytic lymphoma, Lymphoplasmacytic lymphoma; B-cell leukemia, in particular Hairy cell leukemia, B-cell chronic lymphocytic leukemia, Acute lymphoblastic leukemia, B-cell prolymphocytic leukemia, Precursor B lymphoblastic leukemia, or Hairy cell leukemia; or plasma cell dyscrasias.

20. The combination therapy, in particular the composition or the kit of compounds or the product labelling, according to any one of claims 11 to 18, for use in initiating or enhancing necroptosis of B cells, in particular of malignant B cells, in a patient in need thereof.

21. The combination therapy for the use according to claim 20, wherein the patient suffers from B-cell lymphomas, in particular Diffuse large B-cell lymphoma, primary mediastinal B-cell lymphoma, Follicular lymphoma, Chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), Mantle cell lymphoma (MCL), Marginal zone lymphomas, including Extranodal marginal zone B-cell lymphoma, mucosa-associated Lymphoid Tissue (MALT) lymphoma, Nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma, Burkitt lymphoma, Primary intraocular lymphoma, Primary central nervous system (CNS) lymphoma, small lymphocytic lymphoma, Lymphoplasmacytic lymphoma; B-cell leukemia, in particular Hairy cell leukemia, B-cell chronic lymphocytic leukemia,Acute lymphoblastic leukemia, B-cell prolymphocytic leukemia, Precursor B lymphoblastic leukemia, or Hairy cell leukemia; or plasma cell dyscrasias.

Citation Information

Patent Citations

  • Therapeutic IAP antagonists for treating proliferative disorders

    WO2016097773A1

  • Combination therapies for modulation of histone methyl modifying enzymes

    WO2017018975A1