Functional nucleic acid

Abstract

The present invention relates to functional nucleic acids that target FAN1 mRNA within the 5'-untranslated region (5'-UTR), in particular, functional nucleic acids that target an upstream open reading frame (uORF) and thereby increase expression of FAN1 protein. The invention also encompasses methods of enhancing FAN1 protein expression, and methods of treating or ameliorating diseases or disorders associated with FAN1, such as triplet expansion disorders, including those of the polyglutamine family of disorders, using the functional nucleic acids of the invention.

Description

[0001] FUNCTIONAL NUCLEIC ACID

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to functional nucleic acids that target FAN1 mRNA within the 5’-untranslated region (5’-UTR), in particular, functional nucleic acids that target an upstream open reading frame (uORF). The invention also encompasses methods of enhancing FAN1 protein expression, and methods of treating or ameliorating diseases or disorders associated with FAN1 , such as triplet expansion disorders, using the functional nucleic acids of the invention.

[0004] BACKGROUND OF THE INVENTION

[0005] Triplet, or trinucleotide, repeat disorders are a large group of human diseases that result from the expansion of repetitive trinucleotide sequences within the genome, which gives rise to a disease-specific tandem repeat tract. These diseases are typically neurological and vary in terms of the genomic location of the repeat tract, symptomology, and stage of development in which they occur.

[0006] Expansion of these triplet repeats ultimately gives rise to aberrant proteins, which can result in either gain- or loss of function mutations. The number of triplet repeats is typically associated with the age at onset (AAO) of disease, with a greater expansion of the repeat sequences corresponding to an earlier AAO.

[0007] One family of triplet repeat disorders is the polyglutamine (polyQ) disease family, which consists of a group of hereditary neurological diseases that are linked to the expansion of a triplet ‘CAG’ repeat. Further disorders are associated with: the expansion of ‘OGG’ repeats, such as fragile X-related disorders (FXDs); ‘CTG’ repeats, such as myotonic dystrophy type 1 ; ‘GAA’ repeats, such as Friedreich ataxia; ‘GCC’ repeats, such as FRAXE mental retardation; and ‘GOG’ repeats, such as oculopharyngeal muscular dystrophy.

[0008] The polyglutamine group comprises disorders that are amongst the most common inherited neurological diseases and includes a number of Spinocerebellar Ataxias (e.g., Type 1 (SCA1), Type 2 (SCA2), Type 3 (SCA3), 6 (SCA6), Type 7 (SCA7), and Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy X-linked 1 (SMAX1 / SBMA), and Huntington’s disease (HD). Huntington's disease (HD) is an autosomal dominant, inherited, degenerative neurological disease caused by an expanded CAG trinucleotide repeat in the huntingtin gene. HD causes a spectrum of cognitive, movement and psychiatric disorders, which are associated with variety of symptoms.

[0009] The onset of symptoms of HD often varies greatly between individuals. Both the CAG repeat length and genetic variation at other locations within the genome are known to affect age of disease onset. Indeed, genome-wide association studies (GWAS) have identified a number of single nucleotide polymorphisms (SNPs) that are associated with modulating the age of onset of HD symptoms.

[0010] Several of the identified SNPs identified map to chromosome 15 and are linked to the FAN1 gene. FAN1 encodes the protein FAN1 (FANCD2 / FANCI-associated nuclease 1), an enzyme possessing both endo- and exo-nuclease activity that is important in DNA interstrand cross-link repair.

[0011] Increased FAN1 expression has been shown in model systems to limit somatic CAG repeat expansion and is associated with delayed HD onset and progression, whilst FAN1 knockdown increases CAG repeat expansion (Goold R, et al., FAN1 modifies Huntington's disease progression by stabilizing the expanded HTT CAG repeat. Hum Mol Genet. 2019 Feb 15;28(4):650-661. doi: 10.1093 / hmg / ddy375. PMID: 30358836; PMCID: PMC6360275). FAN1 is thus implicated in modulating HD onset and progression; McAllister B, et al., Exome sequencing of individuals with Huntington's disease implicates FAN1 nuclease activity in slowing CAG expansion and disease onset. Nat Neurosci. 2022 Apr;25(4):446-457. doi: 10.1038 / S41593-022-01033-5. Epub 2022 Apr 4. PMID: 35379994; PMCID: PMC8986535).

[0012] Open reading frames (ORFs) that sit in the 5’IITR of an mRNA, upstream of the main start codon (so uORF), can repress translation of mRNAs to proteins. This feature of uORFs is conserved across species and if repressive uORFs can be identified they are a potential target for modulation of translation (Johnstone et al, Upstream ORFs are prevalent translational repressors in vertebrates EMBO J. 2016 Apr 1 ;35(7):706-23. doi: 10.15252 / embj.201592759. PMID: 26896445.

[0013] HD is associated with debilitating symptoms that worsen over an individual’s lifetime until their premature death. Despite being a well-known disease, a paucity of therapeutic interventions exist for the control of disease onset and progression. Further, there is a general lack of any disease-modifying interventions for both HD and triplet repeat diseases more widely.

[0014] The aim of the invention is to provide target specific functional nucleic acids that can function as disease-modifying agents in the treatment and prevention of triplet repeat diseases, especially HD.

[0015] SUMMARY OF THE INVENTION

[0016] The present inventors sought to develop functional nucleic acid molecules that upregulate FAN1 protein expression and thereby may function as disease-modifying agents for triplet repeat diseases, in particular HD.

[0017] FAN1 is implicated in HD, in the wider polyQ family of diseases, and further in triplet repeat disorders associated with the expansion of other motifs. As such, the present inventors sought to identify regulatory mechanisms that influence FAN1 expression (e.g., mechanisms that modulate translation of FAN1 from mRNA).

[0018] The present inventors identified a putative uORF in the 5’-UTR of FAN1. It is thought that uORFs regulate downstream ORFs within the same mRNA. To this end, the present inventors surprisingly found that interventions that disrupt translation of the uORF are capable of increasing the expression of FAN1 protein.

[0019] Put another way, said interventions relieve or overcome the repressive effect that the uORF usually exerts on the downstream FAN1 ORF. Hence, the present inventors have provided proof of concept that functional nucleic acid molecules that target a uORF in FAN1 may relieve repression on the FAN1 ORF and thereby promote increased production of FAN1 protein.

[0020] Such interventions may therefore act as disease-modulators in the triplet expansion disorders with which FAN1 is associated, in particular HD.

[0021] In a first aspect, provided herein is a functional nucleic acid molecule of 10 to 40 nucleotides in length, comprising one or more contiguous target-determining nucleotide sequences that are independently 5 or more nucleotides in length, wherein each target-determining nucleotide sequence is at least 80% complementary to a contiguous target nucleotide sequence within the 5’-UTR o Fan1.

[0022] In another aspect, provided herein is a conjugate comprising the functional nucleic acid molecule of the invention and one or more moieties covalently bound to said functional nucleic acid molecule.

[0023] In another aspect, provided herein is a pharmaceutically acceptable salt of the functional nucleic acid molecule of the invention, or the conjugate of the invention.

[0024] In another aspect, provided herein is a composition comprising the functional nucleic acid molecule of the invention, the conjugate of the invention, or the pharmaceutically acceptable salt of the invention, and a diluent, solvent, carrier, salt and / or adjuvant.

[0025] In another aspect, provided herein is a pharmaceutical composition comprising the functional nucleic acid molecule of the invention, the conjugate of the invention, or the pharmaceutically acceptable salt of the invention, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0026] In one aspect, there is provided a method for modulating Fan1 protein expression in a target cell, the method comprising the steps of exposing the cell to the functional nucleic acid molecule of the invention, the conjugate of the invention, the pharmaceutically acceptable salt of the invention, the composition of the invention, or the pharmaceutical composition of the invention.

[0027] In another aspect, there is provided a method of treating, preventing, or delaying the onset of a disease associated with FAN1 protein in a subject, comprising administering to the subject a therapeutically or prophylactically effective amount of the functional nucleic acid molecule of the invention, the conjugate of the invention, the pharmaceutically acceptable salt of the invention, the composition of the invention, or the pharmaceutical composition of the invention.

[0028] In another aspect, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in medicine. In another aspect, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in treating, preventing, or delaying the onset of a disease.

[0029] In another aspect, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a triplet repeat expansion disease.

[0030] In another aspect, there is provided use of the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for the preparation of a medicament for the treatment, prevention, or delay of a disease.

[0031] In another aspect, there is provided use of the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for the preparation of a medicament for the treatment, prevention, or delay of a triplet repeat expansion disease.

[0032] In some embodiments of the invention according to the foregoing methods and uses, the disease is a polyglutamine (polyQ) disease, wherein the disease is selected from the group consisting of: Huntington’s disease (HD), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), Spinocerebellar Ataxia Type 3 (SCA3),

[0033] Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7),

[0034] Spinocerebellar Ataxia Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy, X-linked 1 (SMAX1 / SBMA).

[0035] In one embodiment the disease is Huntington’s disease (HD).

[0036] BRIEF DESCRIPTION OF THE FIGURES

[0037] Figure 1 - A point mutation in the FAN1 uORF start codon increases downstream ORF expression

[0038] (A) Schematic representation of a dual luciferase reporter system used to investigate the effect of interventions targeting the uORF within the 5’-UTR of FANI . An NIuc luciferase reporter was inserted downstream of either: a wild-type 5’-UTR of FAN1 ; or, a 5’-UTR of FAN1 in which the start codon of a uORF had been mutated (ATG>ATC). Dual luciferase reporter plasmids according to (A) were transfected into HCT116 cells (B) or U2OS cells (C), and luciferase output measured at 24h post transfection. NIuc expression was used to normalise Flue expression. (D) In parallel, RNA was collected from transfected HCT116 cells. NIuc RNA levels were used to normalised Flue RNA levels. Data shown are the mean and SD; statistical comparison was carried out using Welch’s unpaired t-test. (E) Table of further FAN1 5’IITR sequences utilised in the reporter system shown in (A). (F) Dual luciferase reporter plasmids containing either the WT FAN1 5’IITR sequence, an ATG>ATC uORF start codon mutation or with the introduction of a consensus Kozak sequence were transfected into HCT116 (n=2), and luciferase output measured 24h later. 5’ UTR sequences shown in Figures 1A and 1 F are set out in SEQ ID NO: 219 to 221.

[0039] Figure 2 - A point mutation in the FAN1 uORF start codon increases FAN1 expression (A) Schematic representation of a FAN1-HiBiT reporter system used to investigate the effect of interventions targeting the uORF within the 5’-UTR of FANI . A C-terminally HiBiT-tagged FAN1 ORF was inserted downstream of either: a wild-type 5’-UTR of FAN1 ; or, a 5’-UTR of FAN1 in which the start codon of a uORF had been mutated (ATG>ATC). FAN1-HiBiT reporter plasmids according to (A) were transfected into HOT 116 cells and Hi BiT luciferase output was measured 24h (B) and 48h (C) post transfection. Data shown are the mean and SD; statistical comparison was carried out using Welch’s unpaired t-test. 5’ UTR sequences shown in Figure 2A are set out in SEQ ID NO: 219 and 220.

[0040] Figure 3 - screening of ASOs that target the uORF

[0041] (A) Schematic representation of 5’UTR of FAN 1-201 transcript showing location upstream and downstream of uORF start codon (diagonal lines) what was tiled with 1 nt step ASO library. ASOs utilised in screens were 18nt in length, fully 2’OMe, fully PS modified, + / - 3’ LNA addition to ensure equivalent predicted ASO affinity across library. (B) The ASO library was reverse transfected into HCT116 FAN1-HiBiT. 24h post-transfection, change in FAN1 was assessed via Hi BiT lytic assay (Promega) and expressed relative to a mock transfected control. Change in FAN1-HiBiT expression was categorised as follows: fold change (FC) > 1 = +; FC > 1.05 = ++, FC > 1.1 = +++. Screening strategy identified a hotspot upstream of the uORF where ASO binding results in FAN1 upregulation. (n=3).

[0042] Figure 4 - Optimisation of ASOs

[0043] Fully PS 2’OMe ASOs of varying lengths (18, 20, 22nt) were reverse transfected into a HCT116 FAN1-HiBiT line (30-100nM). After 24h, cell viability was assessed via Cell-Titre Fluor (CTF) assay (Promega) and changes in FAN1 assessed via HiBiT lytic assay (Promega). HiBiT RLU was normalised to CTF RFU and expressed relative to a mock transfected control. FAN1 gapmerwas used as a transfection control. (n=2-6). Figure 5 - Validation of ASOs in different cellular environments

[0044] (A) Cholesterol conjugated ASOs increase FAN1 expression in an iPSC cell line. 3’ cholesterol conjugated 2’0Me ASOs were gymnotically delivered to CAG127 FAN1-HiBiT iPSC cells in serum-free media. Media was replaced with full growth media 24h after delivery. 48h post-ASO addition, changes in FAN1 was assessed via HiBiT lytic assay and cell count was assessed via IncuCyte. HiBiT RLU was normalised to cell count and expressed relative to an untreated control. 3’ palmitate conjugated FAN1 gapmer and a 3’ cholesterol conjugated non-targeting ASO were used as controls (n=5). (B and C) ASO delivery into neurons results in upregulation of FAN1 protein. CAG109 striatal neurons (BrainXell) were dosed weekly with 5’IITR targeting ASO for 8 weeks. (B) FAN1 and TLIBB3 levels were assessed by western blotting. (C) FAN1 band intensity was normalised to TLIBB3 intensity and expressed relative to an untreated control (n= 1 )

[0045] DETAILED DESCRIPTION OF THE INVENTION

[0046] It is an object of the present invention to provide a functional nucleic acid molecule that acts to relieve post-transcriptional repression of FAN1 mRNA. It is a further object of the present invention to provide a functional nucleic acid molecule that acts to increase the amount of FAN1 protein in a system.

[0047] To this end, the inventors have devised functional nucleic acid molecules of 10 to 40 nucleotides in length that comprise one or more contiguous target-determining nucleotide sequences that are independently 5 or more nucleotides in length, wherein each targetdetermining nucleotide sequence is at least 80% complementary to a contiguous target nucleotide sequence within the 5’-UTR of Fan1.

[0048] Complementarity of the functional nucleic acid molecules of the invention to the 5’-UTR of FAN1 mRNA, in particular complementarity to a region at or near the start codon of a uORF, allows them to bind or anneal to said mRNA and thereby prevent post-transcriptional repression of FANI .

[0049] Targeting FAN1 mRNA may block or repress translation of the uORF and thereby increase the expression or translation of FAN1 protein. Functional nucleic acid molecules of the invention may therefore be utilised for targeted modulation of FAN1 protein expression, e.g., in diseases or disorders wherein FAN1 modulates disease.

[0050] FAN1 is implicated in modulating triplet expansion diseases of the polyglutamine family. Hence, the functional nucleic acid molecules of the invention may be utilised as diseasemodifying agents in polyglutamine disorders such as Huntington’s disease (HD), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), Spinocerebellar Ataxia Type 3 (SCA3), Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7), Spinocerebellar Ataxia Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy, X- linked 1 (SMAX1 / SBMA).

[0051] Functional Nucleic Acid Molecule

[0052] Provided herein is a functional nucleic acid molecule of 10 to 40 nucleotides in length, comprising one or more contiguous target-determining nucleotide sequences that are independently 5 or more nucleotides in length, wherein each target-determining nucleotide sequence is at least 80% complementary to a contiguous target nucleotide sequence within the 5’-UTR o Fan1.

[0053] A functional nucleic acid molecule according to the invention may also be defined by other terms in the art, depending upon structural and functional features of the specific functional nucleic acid. For example, the functional nucleic acid molecule may be considered to be an antisense oligonucleotide (ASO), long non-coding RNA (IncRNA), a steric-blocking oligonucleotide (SBO), or an anti-miRNA oligonucleotide (AMO).

[0054] In one embodiment, the functional nucleic acid molecule is an antisense oligonucleotide (ASO).

[0055] In one embodiment, the functional nucleic acid molecule is a long non-coding RNA (IncRNA).

[0056] In one embodiment, the functional nucleic acid molecule is a steric-blocking oligonucleotide (SBO). In one embodiment, the functional nucleic acid molecule is an anti-miRNA oligonucleotide (AMO).

[0057] By way of further example, the functional nucleic acid molecule may be a small activating RNA (saRNA), a small interfering RNA (siRNA), or a heteroduplex oligonucleotide (HDO).

[0058] In one embodiment, the functional nucleic acid molecule is a small activating RNA (saRNA).

[0059] In one embodiment, the functional nucleic acid molecule is a small interfering RNA (siRNA).

[0060] In one embodiment, the functional nucleic acid molecule is a heteroduplex oligonucleotide

[0061] (HDO).

[0062] The “functional nucleic acid molecule” referred to herein is a synthetic molecule of the invention. In particular, the term “functional nucleic acid molecule” describes a nucleic acid molecule (e.g. DNA, RNA, or a mixture, or synthetic analogue thereof) that is capable of relieving post-transcriptional repression of FAN1 expression.

[0063] It will be understood that terms such as “relieving post-transcriptional repression of FAN1 expression” may also be expressed in relation to other functional effects that are linked with this effect. For example, it could equally be said that the functional nucleic acid molecule of the invention increases the expression of FAN1 (i.e., by relieving said repression).

[0064] The term “functional RNA molecule” refers equally to instances wherein the functional nucleic acid molecule is formed from any combination of RNA and modified versions thereof; of DNA and modified versions thereof; of a mixture of RNA and DNA, and modified versions thereof; and of chemical analogues of nucleotides.

[0065] A functional nucleic acid molecule of the invention may be a DNA molecule that is transcribed into a functional RNA molecule according to the invention.

[0066] A functional nucleic acid molecule of the invention may be a DNA molecule that is transcribed into a functional RNA molecule according to the invention that is then further modified by chemical or enzymatic modification.

[0067] In one embodiment, the functional nucleic acid molecule is a single-stranded molecule. In one embodiment, the functional nucleic acid molecule is a double stranded molecule.

[0068] In one embodiment, the functional nucleic acid molecule comprises regions of single stranded and double stranded oligonucleotides and / or analogues thereof.

[0069] In relation to the foregoing, it will be understood that double stranded refers to complementary base pairing between two or more distinct molecules. Hence, a single stranded molecule (i.e. , single molecule) will be considered single stranded according to the foregoing even if said molecule forms double stranded secondary structures (e.g., stemloops).

[0070] In one embodiment, the functional nucleic acid molecule consists of DNA.

[0071] In one embodiment, the functional nucleic acid molecule comprises DNA.

[0072] A DNA molecule may not be functional in the same way that an RNA molecule is functional. For example, a functional DNA molecule may be functional in that it encodes a functional RNA molecule, wherein the RNA molecule is a functional nucleic acid molecule according to the invention.

[0073] In one embodiment, the functional nucleic acid molecule consists of RNA.

[0074] In one embodiment, the functional nucleic acid molecule comprises RNA.

[0075] In one embodiment, the functional nucleic acid molecule consists of modified RNA nucleotides.

[0076] In one embodiment, the functional nucleic acid molecule comprises modified RNA nucleotides.

[0077] In one embodiment, the functional nucleic acid molecule consists of synthetic nucleotide analogues.

[0078] In one embodiment, the functional nucleic acid molecule comprises synthetic nucleotide analogues. In one embodiment, the functional nucleic acid molecule comprises or consists of morpholino nucleotides.

[0079] In a first aspect, provided herein is a functional nucleic acid molecule of 10 to 40 nucleotides in length, comprising one or more contiguous target-determining nucleotide sequences that are independently 5 or more nucleotides in length, wherein each target-determining nucleotide sequence is at least 80% complementary to a contiguous target nucleotide sequence within the 5’-UTR o Fan1.

[0080] The one or more contiguous target-determining nucleotide sequences may be selected independently from one another, where more than one contiguous target-determining nucleotide sequences is present. Features (e.g., length, composition and % complementarity) of any one contiguous target-determining nucleotide sequences can be selected entirely independently of any other one (i.e., all of the other) contiguous targetdetermining nucleotide sequences within the same functional nucleic acid molecule. As a result of the foregoing, there is no limitation imposed on any one contiguous nucleotide sequence by any other contiguous nucleotide sequence within the functional nucleic acid molecule.

[0081] Each of the one or more contiguous target-determining nucleotide sequences may target discontinuous sequences within the 5’-UTR of FAN1. That is, the functional nucleic acid molecule may bind to the target oligonucleotide at discrete target sites, wherein said target sites are not contiguous with one another. As such, the functional nucleic acid molecule may bind to the target oligonucleotide at more than one location and ‘loop out’ intervening regions of the functional nucleic acid molecule.

[0082] The contiguous target-determining nucleotide sequences may simultaneously bind FAN1 (i.e., at the same time) or may separately bind FAN1 (i.e., not at the same time).

[0083] A single functional nucleic acid molecule may bind to a single FAN1 mRNA. Alternatively, in embodiments where the functional nucleic acid contains more than one contiguous targetdetermining nucleotide sequences, a single functional nucleic acid molecule may bind to a more than one FAN1 mRNAs, e.g., wherein one contiguous target-determining nucleotide sequences may bind to one FAN1 mRNA molecule whilst a second contiguous targetdetermining nucleotide sequences may simultaneously bind to a second FAN1 mRNA molecule, either at the same target sequence or different target sequences. In another embodiment, there is provided a functional nucleic acid molecule of 10 to 40 nucleotides in length, comprising a contiguous target-determining nucleotide sequences that is 5 or more nucleotides in length, wherein the target-determining nucleotide sequence is at least 80% complementary to a contiguous target nucleotide sequence within the 5’-UTR of Fan1.

[0084] In one embodiment, there is provided a functional nucleic acid molecule of 10 to 35 nucleotides in length, comprising one or more contiguous target-determining nucleotide sequences independently consisting of 5 or more nucleotides in length, wherein each contiguous targetdetermining nucleotide sequences is at least 80% complementary to a contiguous nucleotide sequence within the 5’ UTR of FAN1.

[0085] In one embodiment, there is provided a functional nucleic acid molecule of 10 to 35 nucleotides in length, comprising a contiguous target-determining nucleotide sequences of 5 or more nucleotides in length, wherein the contiguous nucleotide sequence is at least 80% complementary to a contiguous target-determining nucleotide sequences within the 5’ UTR of FAN1.

[0086] In one embodiment, the functional nucleic acid molecule comprises two target-determining nucleotide sequences.

[0087] In one embodiment, the functional nucleic acid molecule comprises two or more contiguous target-determining nucleotide sequences, such as two contiguous target-determining nucleotide sequences, three contiguous target-determining nucleotide sequences, four contiguous target-determining nucleotide sequences, five contiguous target-determining nucleotide sequences, six contiguous target-determining nucleotide sequences, seven contiguous target-determining nucleotide sequences, eight contiguous target-determining nucleotide sequences, nine contiguous target-determining nucleotide sequences, ten contiguous target-determining nucleotide sequences, or more than ten contiguous targetdetermining nucleotide sequences.

[0088] In one embodiment the functional nucleic acid molecule consists of the one or more contiguous target-determining nucleotide sequences.

[0089] In one embodiment, the functional nucleic acid molecule is 10 to 40 nucleotides in length, such as 10 to 35, 10 to 30, 10 to 25, 10 to 20, or 10 to 15 nucleotides in length. In one embodiment, the functional nucleic acid molecule is more than 10 nucleotides in length, such as more than 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, or more than 39 nucleotides in length.

[0090] In one embodiment, the functional nucleic acid molecule is 10 nucleotides in length. In other embodiments, the function nucleic acid molecule is 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0091] In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently 5 to 40 nucleotides in length, such as 10 to 35, 10 to 30, 10 to 25, 10 to 20, or 10 to 15 nucleotides in length.

[0092] In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently more than 5 nucleotides in length, such as more than 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, or more than 39 nucleotides in length.

[0093] In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently 5 nucleotides in length. In other embodiments, the one or more contiguous nucleotide sequences are independently 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0094] In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently at least 80% complementary to a contiguous nucleotide sequence within the 5’ UTR of FAN1.

[0095] In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently at least 80% complementary, such as at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to a contiguous nucleotide sequence within the 5’ UTR of FAN1.

[0096] In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently at least 85% complementary to a contiguous nucleotide sequence within the 5’ UTR of FAN1. In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently at least 90% complementary to a contiguous nucleotide sequence within the 5’ UTR of FAN1.

[0097] In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently at least 95% complementary to a contiguous nucleotide sequence within the 5’ UTR of FAN1.

[0098] In one embodiment, the one or more contiguous target-determining nucleotide sequences are 100% complementary to a contiguous nucleotide sequence within the 5’ UTR of FAN1.

[0099] In one embodiment the functional nucleic acid molecule comprises one or more contiguous target-determining nucleotide sequences.

[0100] In another embodiment the functional nucleic acid molecule comprises or consists of one contiguous target-determining nucleotide sequences.

[0101] In another embodiment the functional nucleic acid molecule comprises or consists of two, three, four, five or more contiguous target-determining nucleotide sequences.

[0102] It will be understood that the functional nucleic acid molecule of the present invention may be a DNA or an RNA molecule, as such, sequences that are represented herein as being implicitly DNA (i.e. , by containing T rather than U) are to be understood as also representing a corresponding RNA molecule in which each T nucleotide in the sequence is replaced with a U nucleotide. Hence, sequences according to the invention may be either DNA sequences or RNA sequences. The representation of a sequence as either one or the other herein is enacted solely for simplicity and does not imply that a sequence is restricted to being a DNA or RNA sequence, unless expressly indicated in the text.

[0103] Reference to nucleotides or nucleosides herein may equally refer to ribo- or deoxyribo- nucleotides / nucleosides, and modified versions thereof.

[0104] With reference to target sequences, it will be readily understood by those skilled in the art what the substituent parts of such a molecule are. For example, in instances where the target molecule is an mRNA said nucleotides / nucleosides will be ribo- nucleotides / nucleosides, etc. Herein, polypeptide or polynucleotide sequences are said to be the same as or “identical” to other polypeptide or polynucleotide sequences, if they share 100% sequence identity.

[0105] Residues in sequences are numbered from left to right, i.e. from N- to C- terminus for polypeptides; from 5’ to 3’ terminus for polynucleotides. If closely related sequences are not identical they may be similar, i.e., they may possess a certain, quantifiable, degree of sequence identity, e.g., a sequence may have 50%, 60%, 70%, 80%, 90%, 95% or 99% sequence identity to another sequence. Unless a specific reference range is given, e.g., with respect to the nucleotide positions, any quoted sequence identity will be understood as being calculated across the residue range over which the two sequences are aligned. The aligned residue range may represent the entirety of one or more of the input sequences or a contiguous section of sequence of one or more of the input sequences, and is typically determined by standard tools known in the art, e.g., NCBI BLAST.

[0106] For the purposes of comparing two closely-related polynucleotide sequences, the “% sequence identity” between a first nucleotide sequence and a second nucleotide sequence may be calculated using NCBI BLAST, using standard settings for nucleotide sequences (BLASTN). For the purposes of comparing two closely-related polypeptide sequences, the “% sequence identity” between a first polypeptide sequence and a second polypeptide sequence may be calculated using NCBI BLAST, using standard settings for polypeptide sequences (BLASTP). A “difference” between sequences refers to an insertion, deletion or substitution of a single nucleotide in a position of the second sequence, compared to the first sequence. Insertions, deletions or substitutions in a second sequence which is otherwise identical (100% sequence identity) to a first sequence result in reduced % sequence identity.

[0107] “Complementarity” relates to the Watson-Crick base pairing principle that ‘A’ nucleotides will hydrogen bond with T (or ‘U’) nucleotides, and ‘G’ nucleotides with ‘C’ nucleotides to form double stranded structures that associate via said “complementary” nucleotides. Herein, a “complementary” sequence is a sequence closely related to another sequence such that such base pairing can occur. Complementary sequences may be 100% complementary such that they may base pair across their entire length, or they may be e.g., 99%, 90%, 80%, 70%, or 60% complementary etc., such that they base pair across portions of their sequence. Here, as is common in the art, a complementary sequence may also be called a “reverse complementary” sequence. The functional nucleic acid molecule comprises a sequence, which is sufficient in length to bind to the target (e.g., mRNA).

[0108] In one embodiment, the functional nucleic acid molecule comprises a contiguous targetdetermining nucleotide sequence comprising or consisting of a sequence selected from the group consisting of: SEQ ID NOs: 104 to 189 and 192 to 193.

[0109] In one embodiment, the functional nucleic acid molecule comprises a contiguous targetdetermining nucleotide sequence comprising or consisting of a sequence selected from the group consisting of: SEQ ID NOs: 108 to 126.

[0110] In one embodiment, the functional nucleic acid molecule comprises a contiguous targetdetermining nucleotide sequence comprising or consisting of a sequence selected from the group consisting of: SEQ ID NOs: 117, 192, and 193.

[0111] In one embodiment, the functional nucleic acid molecule comprises a contiguous targetdetermining nucleotide sequence comprising or consisting of a sequence with 80% sequence identity to a sequence selected from the group consisting of: SEQ ID NOs: 104 to 189 and 192 to 193.

[0112] In one embodiment, the functional nucleic acid molecule comprises a contiguous targetdetermining nucleotide sequence comprising or consisting of a sequence with 85% sequence identity to a sequence selected from the group consisting of: SEQ ID NOs: 104 to 189 and 192 to 193.

[0113] In one embodiment, the functional nucleic acid molecule comprises a contiguous targetdetermining nucleotide sequence comprising or consisting of a sequence with 90% sequence identity to a sequence selected from the group consisting of: SEQ ID NOs: 104 to 189 and 192 to 193.

[0114] In one embodiment, the functional nucleic acid molecule comprises a contiguous targetdetermining nucleotide sequence comprising or consisting of a sequence with 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NOs: 104 to 189 and 192 to 193.

[0115] In one embodiment, the target nucleotide sequence comprises a sequence as set forth in any one or more of SEQ ID NOs: 18 to 103 and 190 to 191. In one embodiment, the target nucleotide sequence consists of a sequence as set forth in any one or more of SEQ ID NOs: 18 to 103 and 190 to 191.

[0116] In one embodiment, the target nucleotide sequence comprises or consists of with at least 70% sequence identity with, such as 75% identity, 80% identity, 85% identity, 90% identity, 95% identity, 96% identity, 97% identity, 98% identity, 99% identity, or 100% identity to a sequence as set forth in any one or more of SEQ ID NOs: 18 to 103 and 190 to 191.

[0117] In one embodiment, the target nucleotide sequence comprises or consists of with at least 70% sequence identity with, such as 75% identity, 80% identity, 85% identity, 90% identity, 95% identity, 96% identity, 97% identity, 98% identity, 99% identity, or 100% identity to a sequence as set forth in any one or more of SEQ ID NOs: 31, 190, and / or 191.

[0118] In one embodiment, the functional nucleic acid molecule comprises or consists of a nucleotide sequence selected from the group consisting of: SEQ ID NO: 194 to SEQ ID NO: 199.

[0119] In one embodiment, the functional nucleic acid molecule comprises or consists of a nucleotide sequence selected from the group consisting of: SEQ ID NO: 194 to SEQ ID NO: 199, or a conjugate or modified version thereof.

[0120] In one embodiment, the functional nucleic acid molecule comprises or consists of a nucleotide sequence with at least 70% sequence identity, such as at least 75% identity, 80% identity, 85% identity, 90% identity, 95% identity, 96% identity, 97% identity, 98% identity, 99% identity, or 100% identity to a sequence as set forth in any one or more of SEQ ID NO: 194 to SEQ ID NO: 199.

[0121] In one embodiment, the functional nucleic acid molecule is selected from the group consisting of: ASO_1 to ASO_15 and ASO_17 to ASO_25.

[0122] In one embodiment, the functional nucleic acid molecule comprises or consists of a sequence selected from the group: SEQ ID NO: 194 to 217.

[0123] In a preferred embodiment, the functional nucleic acid molecule comprises or consists of a sequence selected from the group: SEQ ID NO: 194 to 199. In one embodiment, the functional nucleic acid molecule is an RNA comprising or consisting of the sequence: mU*mC*mU*mU*mC*mU*mU*mC*mC*mU*mG*mG*mG*mG*mC*mC*mA*mC

[0124] (SEQ ID NO: 194); wherein ‘m’ indicates a 2’0Me modified base and indicates a phosphorothioate (PS) internucleoside linkage.

[0125] In one embodiment, the functional nucleic acid molecule is an RNA comprising or consisting of the sequence: mU*mU*mU*mC*mU*mU*mC*mU*mU*mC*mC*mU*mG*mG*mG*mG*mC*mC*mA* mC (SEQ ID NO: 195); wherein ‘m’ indicates a 2’0Me modified base and indicates a phosphorothioate (PS) internucleoside linkage.

[0126] In one embodiment, the functional nucleic acid molecule is an RNA comprising or consisting of the sequence: mA*mA*mU*mU*mU*mC*mU*mU*mC*mU*mU*mC*mC*mU*mG*mG*mG*mG*mC* mC*mA*mC (SEQ ID NO: 196); wherein ‘m’ indicates a 2’0Me modified base and indicates a phosphorothioate (PS) internucleoside linkage.

[0127] In one embodiment, the functional nucleic acid molecule is an RNA comprising or consisting of the sequence: mU*mU*mU*mCmUmUmCmUmUmCmCmUmGmGmGmGmC*mC*mA*mC / 3CholT EG / (SEQ ID NO: 197) wherein ‘m’ indicates a 2’0Me modified base; indicates a phosphorothioate (PS) internucleoside linkage; and 73CholTEG / ’ indicates 3’ cholesterol conjugation, with TEG linker.

[0128] In one embodiment, the functional nucleic acid molecule is an RNA comprising or consisting of the sequence: mA*mA*mU*mUmUmCmUmUmCmUmUmCmCmUmGmGmGmGmC*mC*mA*mC / 3 CholTEG / (SEQ ID NO: 198) wherein ‘m’ indicates a 2’0Me modified base; indicates a phosphorothioate (PS) internucleoside linkage; and 73CholTEG / ’ indicates 3’ cholesterol conjugation, with TEG linker. In one embodiment, the functional nucleic acid molecule is an RNA comprising or consisting of the sequence: mU*mU*mU*mCmUmUmCmUmUmCmCmUmGmGmGmGmC*mC*mA*mC

[0129] (SEQ ID NO: 199); wherein ‘m’ indicates a 2’0Me modified base and indicates a phosphorothioate (PS) internucleoside linkage.

[0130] In one embodiment the functional nucleic acid molecule comprises a 5’-cap. A “5’-cap” refers to an altered nucleotide at the 5’-end of the molecule which provides stability, particularly by reducing or preventing degradation from exonucleases, and can promote translation. Most commonly, the 5’-cap may be a 7-methylguanylate cap (m7G), i.e. a guanine nucleotide connected to the RNA via a 5' to 5' triphosphate linkage and methylated on the 7 position.

[0131] In one embodiment the functional nucleic acid molecule of the invention increases the translation of the Fan 1 ORF.

[0132] In one embodiment the functional nucleic acid molecule of the invention increases the production of Fan1 protein.

[0133] Exemplary functional nucleic acid molecule sequences and their cognate target sequences are provided in Table 1 below. These sequences are not limiting; further suitable sequences may be determined by a person skilled in the art, e.g., based on complementarity to any of the FAN1 sequences disclosed herein.

[0134] Table 1 : Exemplary sequences

[0135]

[0136] Table 2: Exemplary antisense oligonucleotides

[0137]

[0138] Wherein ‘m’ indicates 2’0Me modified base; '+’ indicates locked nucleic acid (LNA) modified base; indicates a phosphorothioate (PS) internucleoside linkage ; and 73CholTEG / ’ indicates 3’ cholesterol conjugation, with TEG linker.

[0139] Unless otherwise stated, oligonucleotides retain the corresponding features of canonical nucleotides, e.g., phosphodiester internucleoside linkages.

[0140] FAN1

[0141] FAN1 encodes the protein FAN1 (FANCD2 / FANCI-associated nuclease 1), an enzyme possessing both endo- and exo-nuclease activity that is important in DNA interstrand crosslink repair.

[0142] Herein, FAN1 is used to refer to the gene (i.e. , DNA) and any other sequences encoding the sequence thereof (e.g., mRNAs). The protein is referred to as FAN1. Nevertheless, the context of reference to FAN1 will readily be understood by the skilled protein in order to determine the type of molecule being referred to. For example, in some instances it will be understood that FAN1 may refer simultaneously to e.g., FAN1 mRNA and FAN1 protein. The aforementioned naming convention is thus not intended to be in any way limiting.

[0143] The present invention concerns sequences within the 5’ UTR of FAN1. The person skilled in the art is able to discern what portion of a given FAN1 mRNA (or variant thereof) constitutes the 5’ UTR. In particular, the 5’ UTR may be considered to encompass all nucleotides upstream (i.e., 5’) of the start codon of the FAN1 ORF.

[0144] Sequences of human FAN1 variants are set out below:

[0145] FAN1-201 ; ensembl_transcript_id: ENST00000362065 (SEQ ID NO: 1)

[0146] GATCTTGGGTGACAGGGCACCGAGGGAAGGAGGACGCGAGGGCAGCCAGGCCCTAG GGAGCAGGGAGAGTGGCTCGGGCTCAGTCGCGTGGCCCCAGGAAGAAGAAATTGTCG AGACGAATAACATGAGGTCATATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTA AAAGTAAACCATTGCTATCTTTCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCA GTTTTTCTAATACTCATGATGTCAGAAGGGAAACCTCCTGACAAAAAAAGGCCTCGTAG AAGCTTATCAATCAGCAAGAATAAGAAAAAAGCATCTAATTCTATTATTTCGTGTTTTAAC AATGCACCACCTGCTAAACTTGCCTGCCCCGTTTGCAGTAAAATGGTGCCTAGATATGA CTTAAACCGGCACCTTGATGAAATGTGTGCTAACAATGACTTCGTTCAAGTGGATCCAG GGCAGGTTGGCTTAATAAATTCAAATGTGTCTATGGTAGATTTAACCAGTGTTACCTTAG AAGATGTAACACCTAAGAAGTCACCACCACCAAAGACAAATTTAACCCCTGGCCAAAGT GATTCAGCAAAAAGGGAAGTAAAGCAGAAGATCAGTCCCTACTTTAAAAGTAATGATGT GGTGTGCAAAAATCAAGATGAGCTGAGAAATCGTAGTGTGAAAGTCATTTGTTTGGGAA GCCTAGCATCTAAATTGTCCAGAAAATACGTAAAGGCTAAAAAATCAATAGATAAGGATG AAGAATTTGCCGGTTCTAGTCCACAGAGTTCCAAATCCACAGTTGTTAAGAGCCTGATT GATAACTCTTCAGAAATTGAGGACGAGGATCAAATTTTGGAGAACAGTTCTCAAAAAGA AAACGTGTTTAAATGTGATTCTCTAAAGGAAGAGTGCATTCCTGAACATATGGTAAGAG GAAGTAAAATAATGGAAGCCGAAAGCCAAAAGGCTACCCGGGAATGTGAGAAATCAGC

[0147] CCTCACCCCTGGATTCTCAGATAATGCGATCATGTTATTCTCACCAGATTTCACTCTTAG

[0148] GAATACATTAAAGTCTACTTCAGAAGACAGTCTTGTAAAGCAAGAGTGTATCAAAGAAGT

[0149] GGTTGAAAAACGTGAGGCATGTCATTGTGAAGAAGTAAAAATGACTGTTGCTTCAGAAG

[0150] CTAAAATACAGCTGTCAGATTCAGAGGCAAAATCTCATAGTTCTGCAGATGATGCTTCT

[0151] GCATGGAGTAACATCCAAGAGGCTCCTCTGCAGGATGACAGTTGCTTAAACAATGATAT

[0152] CCCTCACAGCATTCCTTTGGAGCAGGGGTCAAGCTGCAATGGTCCTGGTCAAACAACC

[0153] GGTCATCCTTACTACCTTCGGAGTTTCCTTGTGGTGCTGAAAACCGTACTTGAGAATGA

[0154] AGATGATATGTTGCTCTTTGATGAGCAGGAGAAGGGAATTGTAACTAAATTTTATCAGTT

[0155] ATCAGCTACTGGTCAGAAGTTATATGTAAGGCTCTTTCAACGTAAATTAAGCTGGATTAA

[0156] GATGACCAAATTAGAGTATGAAGAGATTGCCTTAGACTTAACACCTGTGATTGAAGAATT

[0157] GACGAATGCAGGCTTTCTACAGACAGAATCTGAGTTGCAAGAACTCTCTGAAGTGCTTG

[0158] AACTCCTTTCTGCTCCTGAACTAAAATCCCTAGCCAAGACCTTCCACTTGGTGAATCCC

[0159] AATGGACAGAAACAGCAGCTGGTGGACGCCTTTCTCAAATTGGCCAAACAGCGTTCAG

[0160] TCTGCACTTGGGGCAAGAATAAGCCTGGAATTGGTGCAGTGATTTTAAAAAGAGCCAAA

[0161] GCCTTGGCTGGACAGTCAGTACGAATCTGTAAAGGCCCCAGGGCTGTGTTTTCCCGCA

[0162] TCTTGCTACTGTTTTCGTTGACCGACTCAATGGAAGATGAAGACGCCGCTTGTGGAGGT

[0163] CAGGGACAGCTTTCAACAGTCCTGTTGGTCAACCTCGGCCGAATGGAGTTTCCTAGTTA

[0164] CACCATCAATCGGAAAACCCACATCTTCCAAGACAGAGATGATCTTATCAGATATGCAG

[0165] CAGCCACGCACATGCTGAGTGACATTTCTTCCGCAATGGCCAATGGGAACTGGGAAGA

[0166] AGCTAAGGAGCTCGCTCAGTGTGCAAAAAGGGATTGGAACAGACTGAAAAACCACCCT

[0167] TCTCTGAGATGCCACGAAGATTTACCACTCTTCCTGCGGTGTTTCACTGTTGGGTGGAT

[0168] TTATACAAGGATTTTGTCTCGGTTTGTGGAAATACTGCAGAGACTTCACATGTATGAGGA

[0169] AGCCGTCAGAGAACTTGAAAGCCTTTTGTCTCAGAGAATTTATTGTCCTGACAGCAGAG

[0170] GCCGATGGTGGGATCGACTGGCCCTTAATTTACACCAGCACTTGAAGCGCCTGGAACC

[0171] GACTATCAAGTGCATCACAGAGGGGCTGGCGGATCCGGAAGTCAGAACGGGACACCG

[0172] CCTTTCACTGTATCAGCGAGCCGTGCGCCTGCGAGAGTCTCCGAGCTGTAAAAAGTTC

[0173] AAGCACCTCTTCCAGCAGCTCCCAGAAATGGCTGTGCAAGATGTGAAACACGTGACCA

[0174] TCACAGGCAGGCTGTGCCCACAGCGTGGGATGTGCAAGTCTGTGTTTGTGATGGAGGC

[0175] CGGGGAGGCCGCTGACCCCACCACGGTCCTGTGCTCTGTGGAGGAGCTGGCACTGGC

[0176] CCATTACAGACGCAGCGGTTTTGACCAGGGGATTCATGGCGAAGGGTCCACCTTCAGC

[0177] ACCCTGTATGGCCTCCTCCTGTGGGACATCATCTTCATGGATGGGATTCCGGATGTCTT

[0178] CAGAAACGCCTGTCAGGCATTCCCCCTGGACTTGTGCACAGACAGCTTCTTCACAAGC

[0179] AGACGCCCAGCCCTTGAGGCCAGGCTGCAGCTGATTCATGATGCCCCCGAGGAGAGC

[0180] CTGCGGGCCTGGGTGGCAGCCACGTGGCATGAGCAGGAAGGCAGAGTGGCTTCCCTT

[0181] GTCAGCTGGGATCGCTTCACGTCTCTTCAGCAAGCTCAGGATCTTGTCTCCTGCCTGG

[0182] GGGGCCCTGTGCTCAGTGGTGTGTGCAGGCACCTGGCTGCTGACTTTCGACACTGTC GAGGGGGCCTCCCCGACCTGGTGGTGTGGAACTCCCAGAGCCGTCACTTTAAGCTGG

[0183] TGGAAGTTAAAGGCCCCAATGATCGTCTTTCACATAAGCAGATGATCTGGCTGGCTGAA

[0184] CTGCAGAAGCTGGGGGCTGAAGTAGAAGTCTGCCATGTGGTTGCAGTTGGAGCTAAGA

[0185] GCCAAAGCCTTAGCTAAAAGATTCCCTACAGGAGAAAATGGAAATGAGGAGGAGAGAA

[0186] ACTCCGGTGTCCCCGAGGTGTCGGTGTGGTGAGGGCCGCTGGCGTTGAAGTACATCC

[0187] TGCTCTGGCCCAGCTCCCCATAGCAGGCCTCCAGGGGGCCACTGCGCTGTTGCCGCA

[0188] GCATCCTGCTCAGTACGTCGACTTCATCAGCCAGGAGGGAGAGCTTGTGAAAGGCTGT

[0189] GATGGAGCCACCCAGGCTGATCTGGGCCTCGGGAACCCAGCGGAAGTAGCACAGTTT

[0190] CCACAGTTTTATGTGTGTTCCAGAGACACGTGGCAGAATAACACCGTGCAGGTTGGCG

[0191] GGTTTGGAAAACCATTCTCTAAAATACTGCTCCGTATCACTGTTCTGGCTGTCGGTTTG

[0192] CTGAGCTGGATCTGGCTTTGGTTTTAATATCAATGAATTTCTCCTTGGAAGTAATTCTTG

[0193] GTCACTGATGATTCCATTCTTTAAGGCAGACGGCATTCCTCTTAGTGTGGAGCTGTAGC

[0194] TTTTCTATACAGAAGAGATTTTATTATGTTCCGGGGATTCCCTTTTTAGAAAGATTGAAG

[0195] GATGCAATGGCAAATATAAACTCAATACTATGAAAAATTAATGGAATTTCAGCCTCAAAG

[0196] AACATTTTCCTCCCTTCCTTTGTGTCCTTATTCTAATCCTCCTCCCCTGGAATTACACTTT

[0197] TTTATGTGTTGACTCTACCTAGGCTGTTACTATCAGCCTGAATGGGGGCGGGATGAGAG

[0198] TACCTCCTATCCACTAATTTGCTTAAGGATAAGTTCTAAGACGGGCTAGAAAAAACACTA

[0199] GACCTGGCCGATTCTATCAAGAACAATGGCAAACTGAACAGAGGCAGTCAGGAGGCCA

[0200] AATGTCTGATTCTTTGTTCTGTACCTTTCAGTAGTCTGCAAATTTTCTACCAAAAAAAATC

[0201] CCAAGAATTTATTTGGGAATTATTAAAAAGGCAAACAATGAATGTTATTAGGACAAGAAT

[0202] ATAGCAGTCAGGAGGCCATGACTACATCACAGCCAGGCGGCATTCCCTGCCACAGTGG

[0203] CGGCTTGAATCATCAAGAAATGGATAAATGGGGCTTTAGTAAATCAGGCTTGCAGGCTC

[0204] AAAGCTGCAATCTGCCCACTCTCAGGTACTGAGACTTTGTGGGCCTCAGACACCAGGA

[0205] AGAAAGCTGGGATACAGTCATTTGAGTTAAAAAGGGAATGACCCCTCAGAAACCCGCAT

[0206] TAGCAGTGTTACTCTTGGAAGTGCCTTTACTTTTAACGCTCTCTGTTCTGAAAAAGAGGT

[0207] GTTTGGTTACGTGTGAGCCAACATCACGTTTTGTTAGCTGTGATTTACCTTTGTCCGTTT

[0208] AAAAGACTTCACGGAGCCATTCTGTATACAAGGTGTGCTCTTTCCAATGTAGAAGGGGT

[0209] TATGGAAAAGGGTGCGATCCTTTGCTGTAAACTGGAGAGACCAGTCCCAAACAGAGGG

[0210] GAATTTTAAGCCCTTCTCATCACCCAATTGGATGTTTTTGCTTATAGCAAATTCCTGCAA

[0211] AATAAATAAATAAATATTTGCAAAACTAAA

[0212] The foregoing sequence is also described by the NCBI reference sequences: NM_014967, NM_001146094 and NM_001146096

[0213] FAN1-202; ensembl_transcript_id: ENST00000561594 (SEQ ID NO: 2)

[0214] CTGGGAATGCCTGGAAGCGCCGGCGCGCGGAGCCAGGAAGAAGAAATTGTCGAGACG

[0215] AATAACATGAGGTCATATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTAAAAGT AAACCATTGCTATCTTTCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCAGTTTT

[0216] TCTAATACTCATGATGTCAGAAGGGAAACCTCCTGACAAAAAAAGGCCTCGTAGAAGCT

[0217] TATCAATCAGCAAGAATAAGAAAAAAGCATCTAATTCTATTATTTCGTGTTTTAACAATGC

[0218] ACCACCTGCTAAACTTGCCTGCCCCGTTTGCAGTAAAATGGTGCCTAGATATGACTTAA

[0219] ACCGGCACCTTGATGAAATGTGTGCTAACAATGACTTCGTTCAAGTGGATCCAGGGCA

[0220] GGTTGGCTTAATAAATTCAAATGTGTCTATGGTAGATTTAACCAGTGTTACCTTAGAAGA

[0221] TGTAACACCTAAGAAGTCACCACCACCAAAGACAAATTTAACCCCTGGCCAAAGTGATT

[0222] CAGCAAAAAGGGAAGTAAAGCAGAAGATCAGTCCCTACTTTAAAAGTAATGATGTGGTG

[0223] TGCAAAAATCAAGATGAGCTGAGAAATCGTAGTGTGAAAGTCATTTGTTTGGGAAGCCT

[0224] AGCATCTAAATTGTCCAGAAAATACGTAAAGGCTAAAAAATCAATAGATAAGGATGAAGA

[0225] ATTTGCCGGTTCTAGTCCACAGAGTTCCAAATCCACAGTTGTTAAGAGCCTGATTGATA

[0226] ACTCTTCAGAAATTGAGGACGAGGATCAAATTTTGGAGAACAGTTCTCAAAAAGAAAAC

[0227] GTGTTTAAATGTGATTCTCTAAAGGAAGAGTGCATTCCTGAACATATGGTAAGAGGAAG

[0228] TAAAATAATGGAAGCCGAAAGCCAAAAGGCTACCCGGGAATGTGAGAAATCAGCCCTC

[0229] ACCCCTGGATTCTCAGATAATGCGATCATGTTATTCTCACCAGATTTCACTCTTAGGAAT

[0230] ACATTAAAGTCTACTTCAGAAGACAGTCTTGTAAAGCAAGAGTGTATCAAAGAAGTGGTT

[0231] GAAAAACGTGAGGCATGTCATTGTGAAGAAGTAAAAATGACTGTTGCTTCAGAAGCTAA

[0232] AATACAGCTGTCAGATTCAGAGGCAAAATCTCATAGTTCTGCAGATGATGCTTCTGCAT

[0233] GGAGTAACATCCAAGAGGCTCCTCTGCAGGATGACAGTTGCTTAAACAATGATATCCCT

[0234] CACAGCATTCCTTTGGAGCAGGGGTCAAGCTGCAATGGTCCTGGTCAAACAACCGGTC

[0235] ATCCTTACTACCTTCGGAGTTTCCTTGTGGTGCTGAAAACCGTACTTGAGAATGAAGAT

[0236] GATATGTTGCTCTTTGATGAGCAGGAGAAGGGAATTGTAACTAAATTTTATCAGTTATCA

[0237] GCTACTGGTCAGAAGTTATATGTAAGGCTCTTTCAACGTAAATTAAGCTGGATTAAGATG

[0238] ACCAAATTAGAGTATGAAGAGATTGCCTTAGACTTAACACCTGTGATTGAAGAATTGAC

[0239] GAATGCAGGCTTTCTACAGACAGAATCTGAGTTGCAAGAACTCTCTGAAGTGCTTGAAC

[0240] TCCTTTCTGCTCCTGAACTAAAATCCCTAGCCAAGACCTTCCACTTGGTGAATCCCAAT

[0241] GGACAGAAACAGCAGCTGGTGGACGCCTTTCTCAAATTGGCCAAACAGCGTTCAGTCT

[0242] GCACTTGGGGCAAGAATAAGCCTGGAATTGGTGCAGTGATTTTAAAAAGGTTTTGTTGG

[0243] CTATTGTTACAGTAAAAACATTTAAAATGTTGATAGCACATATTAACTTACAGTAGATTGT

[0244] ATACTTGATTGAACTGTAATTGTTTATTTCAGTTGTAGTTAGATTGAGAAGGCTGGAAAA

[0245] GCCTTAATTGCAATAGCCTGGATTCTTTCTTGGGTTATTATTCAAAATTTTTGTCGTAATA

[0246] CCGTACTAATTTCCAGGACCAAGAAAAATCGGAAGGCAATAGGCCTTTGGTAAATTGTA

[0247] GTATTTTATTTTCCGAGAAAAATACAGTTTTAAGTGATTCTTATGGGATTTTAAGGTAAAC

[0248] TATTTAGTCAAATTTTTATTTTAGTTTTTGTTTACTAAACAAAGTATAATCAGGCAGTCTTA

[0249] ATGTGCAAGTTTTCCTGAGTTTAAACGTAACAATTTACCAAAAACTGTGAGTGGCTTCTT

[0250] TTGTCCTTGAGAAGCCCTTGACCTGTTTCAGTTGAAAATTACAAAAACTTTTAGAATTGA

[0251] TTTCTTTTGCCCATGTTATTTATATAATCAAACTATATCAACTCTAGCCTGGGAATTCACT ACTGTGGAGTCGAGGATGAAATGAGAGGATGCTTTTGAAAACACTTTAACATGATGTTG TTATTTATTTTATATATTTGTTTTGTATATTTCAGTTGTTATGAGCCCATCCTTGTTGGGG

[0252] AGGTGCTATAAATACTAATCTTTAATGAAACATAGGTGTAATAAGGCAGACATTAAGAAA

[0253] AATATAAATACCAACACTTGAAAAAAGCTCGTGTTATAGATTTTTAAAAAGTACTTCAATA AATTACATACTTGTAATTAATTGACTTGAGAAGTATAGAATCCTCATCTGTGTGGTATGTT

[0254] AAATGTCTTCTAAGTCCTTTCTTTATCTAATTGTATTTCTTAAGTATTTGATGTTAACCTTA TATGTAACATTTTATAAGCAAGTAAACATTAAATTTAGCCACCCTCTGGCTGGG

[0255] The foregoing sequence is also described by the NCBI reference sequence: NM_001146095.

[0256] FAN1-203; ensembl_transcript_id: ENST00000561607 (SEQ ID NO: 3)

[0257] GAGGTGCGAGGTGGCCGCGCGGGGATCTTGGGTGACAGGGCACCGAGGGAAGGAGG

[0258] ACGCGAGGGCAGCCAGGCCCTAGGGAGCAGGGAGAGTGGCTCGGGCTCAGTCGCGT GGCCCCAGGTGCGCGTCCCAGGAAGAAGAAATTGTCGAGACGAATAACATGAGGTCAT

[0259] ATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTAAAAGTAAACCATTGCTATCTT

[0260] TCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCAGTTTTTCTAATACTCATGATG

[0261] TCAGAAGGGAAACCTCCTGACAAAAAAAGGCCTCGTAGAAGCTTATCAATCAGCAAGAA

[0262] TAAGAAAAAAGCATCTAATTCTATTATTTCGTGTTTTAACAATGCACCACCTGCTAAACTT GCCTGCCCCGTTTGCAGTAAAATGGTGCCTAGATATGACTTAAACCGGCACCTTGATGA AATGTGTGCTAACAATGACTTCGTTCAAGTGGATCCAGGGCAGGTTGGCTTAATAAATT CAAATGTGTCTATGGTAGATTTAACCAGTGTTACCTTAGAAGATGTAACACCTAAGAAGT CACCACCACCAAAGACAAATTTAACCCCTGGCCAAAGTGATTCAGCAAAAAGGGAAGTA AAGCAGAAGATCAGTCCCTACTTTAAAAGTAATGATGTGGTGTGCAAAAATCAAGATGA GCTGAGAAATCGTAGTGTGAAAGTCATTTGTTTGGGAAGCCTAGCATCTAAATTGTCCA GAAAATACGTAAAGGCTAAAAAATCAATAGATAAGGATGAAGAATTTGCCGGTTCTAGT CCACAGAGTTCCAAATCCACAGTTGTTAAGAGCCTGATTGATAACTCTTCAGAAATTGA GGACGAGGATCAAATTTTGGAGAACAGTTCTCAAAAAGAAAACGTGTTTAAATGTGATT CTCTAAAGGAAGAGTGCATTCCTGAACATATGGTAAGAGGAAGTAAAATAATGGAAGCC GAAAGCCAAAAGGCTACCCGGGAATGTGAGAAATCAGCCCTCACCCCTGGATTCTCAG ATAATGCGATCATGTTATTCTCACCAGATTTCACTCTTAGGAATACATTAAAGTCTACTTC AGAAGACAGTCTTGTAAAGCAAGAGTGTATCAAAGAAGTGGTTGAAAAACGTGAGGCAT GTCATTGTGAAGAAGTAAAAATGACTGTTGCTTCAGAAGCTAAAATACAGCTGTCAGATT CAGAGGCAAAATCTCATAGTTCTGCAGATGATGCTTCTGCATGGAGTAACATCCAAGAG GCTCCTCTGCAGGATGACAGTTGCTTAAACAATGATATCCCTCACAGCATTCCTTTGGA GCAGGGGTCAAGCTGCAATGGTCCTGGTCAAACAACCGGTCATCCTTACTACCTTCGG AGTTTCCTTGTGGTGCTGAAAACCGTACTTGAGAATGAAGATGATATGTTGCTCTTTGAT GAGCAGGAGAAGGGAATTGTAACTAAATTTTATCAGTTATCAGCTACTGGTCAGAAGTT

[0263] ATATGTAAGGCTCTTTCAACGTAAATTAAGCTGGATTAAGATGACCAAATTAGAGTATGA

[0264] AGAGATTGCCTTAGACTTAACACCTGTGATTGAAGAATTGACGAATGCAGGCTTTCTAC

[0265] AGACAGAATCTGAGTTGCAAGAACTCTCTGAAGTGCTTGAACTCCTTTCTGCTCCTGAA

[0266] CTAAAATCCCTAGCCAAGACCTTCCACTTGGTGAATCCCAATGGACAGAAACAGCAGCT

[0267] GGTGGACGCCTTTCTCAAATTGGCCAAACAGCGTTCAGTCTGCACTTGGGGCAAGAAT

[0268] AAGCCTGGAATTGGTGCAGTGATTTTAAAAAGGTTTTGTTGGCTATTGTTACAGTAAAAA

[0269] CATTTAAAATGTTGATAGCACATATTAACTTACAGTAGATTGTATACTTGATTGAACTGTA

[0270] ATTGTTTATTTCAGTTGTAGTTAGATTGAGAAGGCTGGAAAAGCCTTAATTGCAATAGCC

[0271] TGGATTCTTTCTTGGGTTATTATTCAAAATTTTTGTCGTAATACCGTACTAATTTCCAGGA

[0272] CCAAGAAAAATCGGAAGGCAATAGGCCTTTGGTAAATTGTAGTATTTTATTTTCCGAGAA

[0273] AAATACAGTTTTAAGTGATTCTTATGGGATTTTAAGGTAAACTATTTAGTCAAATTTTTATT

[0274] TTAGTTTTTGTTTACTAAACAAAGTATAATCAGGCAGTCTTAATGTGCAAGTTTTCCTGAG

[0275] TTTAAACGTAACAATTTACCAAAAACTGTGAGTGGCTTCTTTTGTCCTTGAGAAGCCCTT

[0276] GACCTGTTTCAGTTGAAAATTACAAAAACTTTTAGAATTGATTTCTTTTGCCCATGTTATT

[0277] TATATAATCAAACTATATCAACTCTAGCCTGGGAATTCACTACTGTGGAGTCGAGGATGA

[0278] AATGAGAGGATGCTTTTGAAAACACTTTAACATGATGTTGTTATTTATTTTATATATTTGT

[0279] TTTGTATATTTCAGTTGTTATGAGCCCATCCTTGTTGGGGAGGTGCTATAAATACTAATC

[0280] TTTAATGAAACATAGGTGTAATAAGGCAGACATTAAGAAAAATATAAATACCAACACTTG

[0281] AAAAAAGCTCGTGTTATAGATTTTTAAAAAGTACTTCAATAAATTACATACTTGTAATTAA TTGACTTGA

[0282] FAN1-207; ensembl_transcript_id: ENST00000565466 (SEQ ID NO: 4)

[0283] AGGTGCGAGGTGGCCGCGCGGGGATCTTGGGTGACAGGGCACCGAGGGAAGGAGGA

[0284] CGCGAGGGCAGCCAGGCCCTAGGGAGCAGGGAGAGTGGCTCGGGCTCAGTCGCGTG

[0285] GCCCCAGGAAGAAGAAATTGTCGAGACGAATAACATGAGGTCATATAGAATCCCACTTT

[0286] TGGTGATTTCAAGTCAAGAAAGTAAAAGTAAACCATTGCTATCTTTCACCTTAAATATCC

[0287] TGTGTTTTATTGCTCAGAACATCCAGTTTTTCTAATACTCATGATGTCAGAAGGGAAACC

[0288] TCCTGACAAAAAAAGGCCTCGTAGAAGCTTATCAATCAGCAAGAATAAGAAAAAAGCAT

[0289] CTAATTCTATTATTTCGTGTTTTAACAATGCACCACCTGCTAAACTTGCCTGCCCCGTTT

[0290] GCAGTAAAATGGTGCCTAGATATGACTTAAACCGGCACCTTGATGAAATGTGTGCTAAC

[0291] AATGACTTCGTTCAAGTGGATCCAGGGCAGGTTGGCTTAATAAATTCAAATGTGTCTAT

[0292] GGTAGATTTAACCAGTGTTACCTTAGAAGATGTAACACCTAAGAAGTCACCACCACCAA

[0293] AGACAAATTTAACCCCTGGCCAAAGTGATTCAGCAAAAAGGGAAGTAAAGCAGAAGATC

[0294] AGTCCCTACTTTAAAAGTAATGATGTGGTGTGCAAAAATCAAGATGAGCTGAGAAATCG

[0295] TAGTGTGAAAGTCATTTGTTTGGGAAGCCTAGCATCTAAATTGTCCAGAAAATACGTAAA

[0296] GGCTAAAAAATCAATAGATAAGGATGAAGAATTTGCCGGTTCTAGTCCACAGAGTTCCA AATCCACAGTTGTTAAGAGCCTGATTGATAACTCTTCAGAAATTGAGGACGAGGATCAA

[0297] ATTTTGGAGAACAGTTCTCAAAAAGAAAACGTGTTTAAATGTGATTCTCTAAAGGAAGAG

[0298] TGCATTCCTGAACATATGGTAAGAGGAAGTAAAATAATGGAAGCCGAAAGCCAAAAGGC

[0299] TACCCGGGAATGTGAGAAATCAGCCCTCACCCCTGGATTCTCAGATAATGCGATCATGT

[0300] TATTCTCACCAGATTTCACTCTTAGGAATACATTAAAGTCTACTTCAGAAGACAGTCTTG

[0301] TAAAGCAAGAGTGTATCAAAGAAGTGGTTGAAAAACGTGAGGCATGTCATTGTGAAGAA

[0302] GTAAAAATGACTGTTGCTTCAGAAGCTAAAATACAGCTGTCAGATTCAGAGGCAAAATC

[0303] TCATAGTTCTGCAGATGATGCTTCTGCATGGAGTAACATCCAAGAGGCTCCTCTGCAGG

[0304] ATGACAGTTGCTTAAACAATGATATCCCTCACAGCATTCCTTTGGAGCAGGGGTCAAGC

[0305] TGCAATGGTCCTGGTCAAACAACCGGTCATCCTTACTACCTTCGGAGTTTCCTTGTGGT

[0306] GCTGAAAACCGTACTTGAGAATGAAGATGATATGTTGCTCTTTGATGAGCAGGAGAAGG

[0307] GAATTGTAACTAAATTTTATCAGTTATCAGCTACTGGTCAGAAGTTATATGTAAGGCTCT

[0308] TTCAACGTAAATTAAGCTGGATTAAGATGACCAAATTAGAGTATGAAGAGATTGCCTTAG

[0309] ACTTAACACCTGTGATTGAAGAATTGACGAATGCAGGCTTTCTACAGACAGAATCTGAG

[0310] TTGCAAGAACTCTCTGAAGTGCTTGAACTCCTTTCTGCTCCTGAACTAAAATCCCTAGCC

[0311] AAGACCTTCCACTTGGTGAATCCCAATGGACAGAAACAGCAGCTGGTGGACGCCTTTC

[0312] TCAAATTGGCCAAACAGCGTTCAGTCTGCACTTGGGGCAAGAATAAGCCTGGAATTGGT

[0313] GCAGTGATTTTAAAAAGGTTTTGTTGGCTATTGTTACAGTAAAAACATTTAAAATGTTGAT

[0314] AGCACATATTAACTTACAGTAGATTGTATACTTGATTGAACTGTAATTGTTTATTTCAGTT

[0315] GTAGTTAGATTGAGAAGGCTGGAAAAGCCTTAATTGCAATAGCCTGGATTCTTTCTTGG

[0316] GTTATTATTCAAAATTTTTGTCGTAATACCGTACTAATTTCCAGGACCAAGAAAAATCGG

[0317] AAGGCAATAGGCCTTTGGTAAATTGTAGTATTTTATTTTCCGAGAAAAATACAGTTTTAA

[0318] GTGATTCTTATGGGATTTTAAGGTAAACTATTTAGTCAAATTTTTATTTTAGTTTTTGTTTA

[0319] CTAAACAAAGTATAATCAGGCAGTCTTAATGTGCAAGTTTTCCTGAGTTTAAACGTAACA

[0320] ATTTACCAAAAACTGTGAGTGGCTTCTTTTGTCCTTGAGAAGCCCTTGAC

[0321] FAN1-215; ensembl_transcript_id: ENST00000656435 (SEQ ID NO: 5)

[0322] GGAAGCGCCGGCGCGCGGAGCCAGGAAGAAGAAATTGTCGAGACGAATAACATGAGG

[0323] TCATATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTAAAAGTAAACCATTGCTA

[0324] TCTTTCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCAGTTTTTCTAATACTCAT

[0325] GATGTCAGAAGGGAAACCTCCTGACAAAAAAAGGCCTCGTAGAAGCTTATCAATCAGCA

[0326] AGAATAAGAAAAAAGCATCTAATTCTATTATTTCGTGTTTTAACAATGCACCACCTGCTAA

[0327] ACTTGCCTGCCCCGTTTGCAGTAAAATGGTGCCTAGATATGACTTAAACCGGCACCTTG

[0328] ATGAAATGTGTGCTAACAATGACTTCGTTCAAGTGGATCCAGGGCAGGTTGGCTTAATA

[0329] AATTCAAATGTGTCTATGGTAGATTTAACCAGTGTTACCTTAGAAGATGTAACACCTAAG

[0330] AAGTCACCACCACCAAAGACAAATTTAACCCCTGGCCAAAGTGATTCAGCAAAAAGGGA

[0331] AGTAAAGCAGAAGATCAGTCCCTACTTTAAAAGTAATGATGTGGTGTGCAAAAATCAAG ATGAGCTGAGAAATCGTAGTGTGAAAGTCATTTGTTTGGGAAGCCTAGCATCTAAATTG

[0332] TCCAGAAAATACGTAAAGGCTAAAAAATCAATAGATAAGGATGAAGAATTTGCCGGTTCT

[0333] AGTCCACAGAGTTCCAAATCCACAGTTGTTAAGAGCCTGATTGATAACTCTTCAGAAATT

[0334] GAGGACGAGGATCAAATTTTGGAGAACAGTTCTCAAAAAGAAAACGTGTTTAAATGTGA

[0335] TTCTCTAAAGGAAGAGTGCATTCCTGAACATATGGTAAGAGGAAGTAAAATAATGGAAG

[0336] CCGAAAGCCAAAAGGCTACCCGGGAATGTGAGAAATCAGCCCTCACCCCTGGATTCTC

[0337] AGATAATGCGATCATGTTATTCTCACCAGATTTCACTCTTAGGAATACATTAAAGTCTAC

[0338] TTCAGAAGACAGTCTTGTAAAGCAAGAGTGTATCAAAGAAGTGGTTGAAAAACGTGAGG

[0339] CATGTCATTGTGAAGAAGTAAAAATGACTGTTGCTTCAGAAGCTAAAATACAGCTGTCA

[0340] GATTCAGAGGCAAAATCTCATAGTTCTGCAGATGATGCTTCTGCATGGAGTAACATCCA

[0341] AGAGGCTCCTCTGCAGGATGACAGTTGCTTAAACAATGATATCCCTCACAGCATTCCTT

[0342] TGGAGCAGGGGTCAAGCTGCAATGGTCCTGGTCAAACAACCGGTCATCCTTACTACCT

[0343] TCGGAGTTTCCTTGTGGTGCTGAAAACCGTACTTGAGAATGAAGATGATATGTTGCTCT

[0344] TTGATGAGCAGGAGAAGGGAATTGTAACTAAATTTTATCAGTTATCAGCTACTGGTCAG

[0345] AAGTTATATGTAAGGCTCTTTCAACGTAAATTAAGCTGGATTAAGATGACCAAATTAGAG

[0346] TATGAAGAGATTGCCTTAGACTTAACACCTGTGATTGAAGAATTGACGAATGCAGGCTT

[0347] TCTACAGACAGAATCTGAGTTGCAAGAACTCTCTGAAGTGCTTGAACTCCTTTCTGCTC

[0348] CTGAACTAAAATCCCTAGCCAAGACCTTCCACTTGGTGAATCCCAATGGACAGAAACAG

[0349] CAGCTGGTGGACGCCTTTCTCAAATTGGCCAAACAGCGTTCAGTCTGCACTTGGGGCA

[0350] AGAATAAGCCTGGAATTGGTGCAGTGATTTTAAAAAGAGCCAAAGCCTTGGCTGGACAG

[0351] TCAGTACGAATCTGTAAAGGCCCCAGGGCTGTGTTTTCCCGCATCTTGCTACTGTTTTC

[0352] GTTGACCGACTCAATGGAAGATGAAGACGCCGCTTGTGGAGGTCAGGGACAGCTTTCA

[0353] ACAGTCCTGTTGGTCAACCTCGGCCGAATGGAGTTTCCTAGTTACACCATCAATCGGAA

[0354] AACCCACATCTTCCAAGACAGAGATGATCTTATCAGATATGCAGCAGCCACGCACATGC

[0355] TGAGTGACATTTCTTCCGCAATGGCCAATGGGAACTGGGAAGAAGCTAAGGAGCTCGC

[0356] TCAGTGTGCAAAAAGGGATTGGAACAGACTGAAAAACCACCCTTCTCTGAGATGCCAC

[0357] GAAGATTTACCACTCTTCCTGCGGTGTTTCACTGTTGGGTGGATTTATACAAGGATTTTG

[0358] TCTCGGTTTGTGGAAATACTGCAGAGACTTCACATGTATGAGGAAGCCGTCAGAGAACT

[0359] TGAAAGCCTTTTGTCTCAGAGAATTTATTGTCCTGACAGCAGAGGCCGATGGTGGGATC

[0360] GACTGGCCCTTAATTTACACCAGCACTTGAAGCGCCTGGAACCGACTATCAAGTGCATC

[0361] ACAGAGGGGCTGGCGGATCCGGAAGTCAGAACGGGACACCGCCTTTCACTGTATCAG

[0362] CGAGCCGTGCGCCTGCGAGAGTCTCCGAGCTGTAAAAAGTTCAAGCACCTCTTCCAGC

[0363] AGCTCCCAGAAATGGCTGTGCAAGATGTGAAACACGTGACCATCACAGGCAGGCTGTG

[0364] CCCACAGCGTGGGATGTGCAAGTCTGTGTTTGTGATGGAGGCCGGGGAGGCCGCTGA

[0365] CCCCACCACGGTCCTGTGCTCTGTGGAGGAGCTGGCACTGGCCCATTACAGACGCAG

[0366] CGGTTTTGACCAGGGGATTCATGGCGAAGGGTCCACCTTCAGCACCCTGTATGGCCTC

[0367] CTCCTGTGGGACATCATCTTCATGGATGGGATTCCGGATGTCTTCAGAAACGCCTGTCA GGCATTCCCCCTGGACTTGTGCACAGACAGCTTCTTCACAAGCAGACGCCCAGCCCTT

[0368] GAGGCCAGGCTGCAGCTGATTCATGATGCCCCCGAGGAGAGCCTGCGGGCCTGGGTG

[0369] GCAGCCACGTGGCATGAGCAGGAAGGCAGAGTGGCTTCCCTTGTCAGCTGGGATCGC

[0370] TTCACGTCTCTTCAGCAAGCTCAGGATCTTGTCTCCTGCCTGGGGGGCCCTGTGCTCA

[0371] GTGGTGTGTGCAGGCACCTGGCTGCTGACTTTCGACACTGTCGAGGGGGCCTCCCCG

[0372] ACCTGGTGGTGTGGAACTCCCAGAGCCGTCACTTTAAGCTGGTGGAAGTTAAAGGCCC

[0373] CAATGATCGTCTTTCACATAAGCAGATGATCTGGCTGGCTGAACTGCAGAAGCTGGGG

[0374] GCTGAAGTAGAAGTCTGCCATGTGGTTGCAGTTGGAGCTAAGAGCCAAAGCCTTAGCT

[0375] AAAAGATTCCCTACAGGAGAAAATGGAAATGAGGAGGAGAGAAACTCCGGTGTCCCCG

[0376] AGGTGTCGGTGTGGTGAGGGCCGCTGGCGTTGAAGTACATCCTGCTCTGGCCCAGCT

[0377] CCCCATAGCAGGCCTCCAGGGGGCCACTGCGCTGTTGCCGCAGCATCCTGCTCAGTA

[0378] CGTCGACTTCATCAGCCAGGAGGGAGAGCTTGTGAAAGGCTGTGATGGAGCCACCCA

[0379] GGCTGATCTGGGCCTCGGGAACCCAGCGGAAGTAGCACAGTTTCCACAGTTTTATGTG

[0380] TGTTCCAGAGACACGTGGCAGAATAACACCGTGCAGGTTGGCGGGTTTGGAAAACCAT

[0381] TCTCTAAAATACTGCTCCGTATCACTGTTCTGGCTGTCGGTTTGCTGAGCTGGATCTGG

[0382] CTTTGGTTTTAATATCAATGAATTTCTCCTTGGAAGTAATTCTTGGTCACTGATGATTCCA

[0383] TTCTTTAAGGCAGACGGCATTCCTCTTAGTGTGGAGCTGTAGCTTTTCTATACAGAAGA

[0384] GATTTTATTATGTTCCGGGGATTCCCTTTTTAGAAAGATTGAAGGATGCAATGGCAAATA

[0385] TAAACTCAATACTATGAAAAATTAATGGAATTTCAGCCTCAAAGAACATTTTCCTCCCTTC

[0386] CTTTGTGTCCTTATTCTAATCCTCCTCCCCTGGAATTACACTTTTTTATGTGTTGACTCTA

[0387] CCTAGGCTGTTACTATCAGCCTGAATGGGGGCGGGATGAGAGTACCTCCTATCCACTA

[0388] ATTTGCTTAAGGATAAGTTCTAAGACGGGCTAGAAAAAACACTAGACCTGGCCGATTCT

[0389] ATCAAGAACAATGGCAAACTGAACAGAGGCAGTCAGGAGGCCAAATGTCTGATTCTTTG

[0390] TTCTGTACCTTTCAGTAGTCTGCAAATTTTCTACCAAAAAAAATCCCAAGAATTTATTTGG

[0391] GAATTATTAAAAAGGCAAACAATGAATGTTATTAGGACAAGAATATAGCAGTCAGGAGG

[0392] CCATGACTACATCACAGCCAGGCGGCATTCCCTGCCACAGTGGCGGCTTGAATCATCA

[0393] AGAAATGGATAAATGGGGCTTTAGTAAATCAGGCTTGCAGGCTCAAAGCTGCAATCTGC

[0394] CCACTCTCAGGTACTGAGACTTTGTGGGCCTCAGACACCAGGAAGAAAGCTGGGATAC

[0395] AGTCATTTGAGTTAAAAAGGGAATGACCCCTCAGAAACCCGCATTAGCAGTGTTACTCT

[0396] TGGAAGTGCCTTTACTTTTAACGCTCTCTGTTCTGAAAAAGAGGTGTTTGGTTACGTGTG

[0397] AGCCAACATCACGTTTTGTTAGCTGTGATTTACCTTTGTCCGTTTAAAAGACTTCACGGA

[0398] GCCATTCTGTATACAAGGTGTGCTCTTTCCAATGTAGAAGGGGTTATGGAAAAGGGTGC

[0399] GATCCTTTGCTGTAAACTGGAGAGACCAGTCCCAAACAGAGGGGAATTTTAAGCCCTTC

[0400] TCATCACCCAATTGGATGTTTTTGCTTATAGCAAATTCCTGCAAAATAAAT FAN1-216; ensembl_transcript_id: ENST00000657391 (SEQ ID NO: 6)

[0401] GGAAGCGCCGGCGCGCGGAGCCAGGTGGGAGGAAGAAGAAATTGTCGAGACGAATAA

[0402] CATGAGGTCATATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTAAAAGTAAACC

[0403] ATTGCTATCTTTCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCAGTTTTTCTAA

[0404] TACTCATGATGTCAGAAGGGAAACCTCCTGACAAAAAAAGGCCTCGTAGAAGCTTATCA

[0405] ATCAGCAAGAATAAGAAAAAAGCATCTAATTCTATTATTTCGTGTTTTAACAATGCACCA

[0406] CCTGCTAAACTTGCCTGCCCCGTTTGCAGTAAAATGGTGCCTAGATATGACTTAAACCG

[0407] GCACCTTGATGAAATGTGTGCTAACAATGACTTCGTTCAAGTGGATCCAGGGCAGGTTG

[0408] GCTTAATAAATTCAAATGTGTCTATGGTAGATTTAACCAGTGTTACCTTAGAAGATGTAA

[0409] CACCTAAGAAGTCACCACCACCAAAGACAAATTTAACCCCTGGCCAAAGTGATTCAGCA

[0410] AAAAGGGAAGTAAAGCAGAAGATCAGTCCCTACTTTAAAAGTAATGATGTGGTGTGCAA

[0411] AAATCAAGATGAGCTGAGAAATCGTAGTGTGAAAGTCATTTGTTTGGGAAGCCTAGCAT

[0412] CTAAATTGTCCAGAAAATACGTAAAGGCTAAAAAATCAATAGATAAGGATGAAGAATTTG

[0413] CCGGTTCTAGTCCACAGAGTTCCAAATCCACAGTTGTTAAGAGCCTGATTGATAACTCT

[0414] TCAGAAATTGAGGACGAGGATCAAATTTTGGAGAACAGTTCTCAAAAAGAAAACGTGTT

[0415] TAAATGTGATTCTCTAAAGGAAGAGTGCATTCCTGAACATATGGTAAGAGGAAGTAAAAT

[0416] AATGGAAGCCGAAAGCCAAAAGGCTACCCGGGAATGTGAGAAATCAGCCCTCACCCCT

[0417] GGATTCTCAGATAATGCGATCATGTTATTCTCACCAGATTTCACTCTTAGGAATACATTA

[0418] AAGTCTACTTCAGAAGACAGTCTTGTAAAGCAAGAGTGTATCAAAGAAGTGGTTGAAAA

[0419] ACGTGAGGCATGTCATTGTGAAGAAGTAAAAATGACTGTTGCTTCAGAAGCTAAAATAC

[0420] AGCTGTCAGATTCAGAGGCAAAATCTCATAGTTCTGCAGATGATGCTTCTGCATGGAGT

[0421] AACATCCAAGAGGCTCCTCTGCAGGATGACAGTTGCTTAAACAATGATATCCCTCACAG

[0422] CATTCCTTTGGAGCAGGGGTCAAGCTGCAATGGTCCTGGTCAAACAACCGGTCATCCT

[0423] TACTACCTTCGGAGTTTCCTTGTGGTGCTGAAAACCGTACTTGAGAATGAAGATGATAT

[0424] GTTGCTCTTTGATGAGCAGGAGAAGGGAATTGTAACTAAATTTTATCAGTTATCAGCTAC

[0425] TGGTCAGAAGTTATATGTAAGGCTCTTTCAACGTAAATTAAGCTGGATTAAGATGACCAA

[0426] ATTAGAGTATGAAGAGATTGCCTTAGACTTAACACCTGTGATTGAAGAATTGACGAATG

[0427] CAGGCTTTCTACAGACAGAATCTGAGTTGCAAGAACTCTCTGAAGTGCTTGAACTCCTT

[0428] TCTGCTCCTGAACTAAAATCCCTAGCCAAGACCTTCCACTTGGTGAATCCCAATGGACA

[0429] GAAACAGCAGCTGGTGGACGCCTTTCTCAAATTGGCCAAACAGCGTTCAGTCTGCACTT

[0430] GGGGCAAGAATAAGCCTGGAATTGGTGCAGTGATTTTAAAAAGAGCCAAAGCCTTGGC

[0431] TGGACAGTCAGTACGAATCTGTAAAGGCCCCAGGGCTGTGTTTTCCCGCATCTTGCTAC

[0432] TGTTTTCGTTGACCGACTCAATGGAAGATGAAGACGCCGCTTGTGGAGGTCAGGGACA

[0433] GCTTTCAACAGTCCTGTTGGTCAACCTCGGCCGAATGGAGTTTCCTAGTTACACCATCA

[0434] ATCGGAAAACCCACATCTTCCAAGACAGAGATGATCTTATCAGATATGCAGCAGCCACG

[0435] CACATGCTGAGTGACATTTCTTCCGCAATGGCCAATGGGAACTGGGAAGAAGCTAAGG

[0436] AGCTCGCTCAGTGTGCAAAAAGGGATTGGAACAGACTGAAAAACCACCCTTCTCTGAG ATGCCACGAAGATTTACCACTCTTCCTGCGGTGTTTCACTGTTGGGTGGATTTATACAA

[0437] GGATTTTGTCTCGGTTTGTGGAAATACTGCAGAGACTTCACATGTATGAGGAAGCCGTC

[0438] AGAGAACTTGAAAGCCTTTTGTCTCAGAGAATTTATTGTCCTGACAGCAGAGGCCGATG

[0439] GTGGGATCGACTGGCCCTTAATTTACACCAGCACTTGAAGCGCCTGGAACCGACTATC

[0440] AAGTGCATCACAGAGGGGCTGGCGGATCCGGAAGTCAGAACGGGACACCGCCTTTCA

[0441] CTGTATCAGCGAGCCGTGCGCCTGCGAGAGTCTCCGAGCTGTAAAAAGTTCAAGCACC

[0442] TCTTCCAGCAGCTCCCAGAAATGGCTGTGCAAGATGTGAAACACGTGACCATCACAGG

[0443] CAGGCTGTGCCCACAGCGTGGGATGTGCAAGTCTGTGTTTGTGATGGAGGCCGGGGA

[0444] GGCCGCTGACCCCACCACGGTCCTGTGCTCTGTGGAGGAGCTGGCACTGGCCCATTA

[0445] CAGACGCAGCGGTTTTGACCAGGGGATTCATGGCGAAGGGTCCACCTTCAGCACCCTG

[0446] TATGGCCTCCTCCTGTGGGACATCATCTTCATGGATGGGATTCCGGATGTCTTCAGAAA

[0447] CGCCTGTCAGGCATTCCCCCTGGACTTGTGCACAGACAGCTTCTTCACAAGCAGACGC

[0448] CCAGCCCTTGAGGCCAGGCTGCAGCTGATTCATGATGCCCCCGAGGAGAGCCTGCGG

[0449] GCCTGGGTGGCAGCCACGTGGCATGAGCAGGAAGGCAGAGTGGCTTCCCTTGTCAGC

[0450] TGGGATCGCTTCACGTCTCTTCAGCAAGCTCAGGATCTTGTCTCCTGCCTGGGGGGCC

[0451] CTGTGCTCAGTGGTGTGTGCAGGCACCTGGCTGCTGACTTTCGACACTGTCGAGGGG

[0452] GCCTCCCCGACCTGGTGGTGTGGAACTCCCAGAGCCGTCACTTTAAGCTGGTGGAAGT

[0453] TAAAGGCCCCAATGATCGTCTTTCACATAAGCAGATGATCTGGCTGGCTGAACTGCAGA

[0454] AGCTGGGGGCTGAAGTAGAAGTCTGCCATGTGGTTGCAGTTGGAGCTAAGAGCCAAAG

[0455] CCTTAGCTAAAAGATTCCCTACAGGAGAAAATGGAAATGAGGAGGAGAGAAACTCCGG

[0456] TGTCCCCGAGGTGTCGGTGTGGTGAGGGCCGCTGGCGTTGAAGTACATCCTGCTCTG

[0457] GCCCAGCTCCCCATAGCAGGCCTCCAGGGGGCCACTGCGCTGTTGCCGCAGCATCCT

[0458] GCTCAGTACGTCGACTTCATCAGCCAGGAGGGAGAGCTTGTGAAAGGCTGTGATGGAG

[0459] CCACCCAGGCTGATCTGGGCCTCGGGAACCCAGCGGAAGTAGCACAGTTTCCACAGTT

[0460] TTATGTGTGTTCCAGAGACACGTGGCAGAATAACACCGTGCAGGTTGGCGGGTTTGGA

[0461] AAACCATTCTCTAAAATACTGCTCCGTATCACTGTTCTGGCTGTCGGTTTGCTGAGCTG

[0462] GATCTGGCTTTGGTTTTAATATCAATGAATTTCTCCTTGGAAGTAATTCTTGGTCACTGA

[0463] TGATTCCATTCTTTAAGGCAGACGGCATTCCTCTTAGTGTGGAGCTGTAGCTTTTCTATA

[0464] CAGAAGAGATTTTATTATGTTCCGGGGATTCCCTTTTTAGAAAGATTGAAGGATGCAATG

[0465] GCAAATATAAACTCAATACTATGAAAAATTAATGGAATTTCAGCCTCAAAGAACATTTTCC

[0466] TCCCTTCCTTTGTGTCCTTATTCTAATCCTCCTCCCCTGGAATTACACTTTTTTATGTGTT

[0467] GACTCTACCTAGGCTGTTACTATCAGCCTGAATGGGGGCGGGATGAGAGTACCTCCTA

[0468] TCCACTAATTTGCTTAAGGATAAGTTCTAAGACGGGCTAGAAAAAACACTAGACCTGGC

[0469] CGATTCTATCAAGAACAATGGCAAACTGAACAGAGGCAGTCAGGAGGCCAAATGTCTG

[0470] ATTCTTTGTTCTGTACCTTTCAGTAGTCTGCAAATTTTCTACCAAAAAAAATCCCAAGAAT

[0471] TTATTTGGGAATTATTAAAAAGGCAAACAATGAATGTTATTAGGACAAGAATATAGCAGT

[0472] CAGGAGGCCATGACTACATCACAGCCAGGCGGCATTCCCTGCCACAGTGGCGGCTTG AATCATCAAGAAATGGATAAATGGGGCTTTAGTAAATCAGGCTTGCAGGCTCAAAGCTG

[0473] CAATCTGCCCACTCTCAGGTACTGAGACTTTGTGGGCCTCAGACACCAGGAAGAAAGC

[0474] TGGGATACAGTCATTTGAGTTAAAAAGGGAATGACCCC

[0475] FAN1-217; ensembl_transcript_id: ENST00000658773 (SEQ ID NO: 7)

[0476] GGAAGCGCCGGCGCGCGGAGCCAGGTGGGAGGAAGAAGAAATTGTCGAGACGAATAA

[0477] CATGAGGTCATATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTAAAAGTAAACC

[0478] ATTGCTATCTTTCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCAGTTTTTCTAA

[0479] TACTCATGATGTCAGAAGGGAAACCTCCTGACAAAAAAAGGCCTCGTAGAAGCTTATCA

[0480] ATCAGCAAGAATAAGAAAAAAGCATCTAATTCTATTATTTCGTGTTTTAACAATGCACCA

[0481] CCTGCTAAACTTGCCTGCCCCGTTTGCAGTAAAATGGTGCCTAGATATGACTTAAACCG

[0482] GCACCTTGATGAAATGTGTGCTAACAATGACTTCGTTCAAGTGGATCCAGGGCAGGTTG

[0483] GCTTAATAAATTCAAATGTGTCTATGGTAGATTTAACCAGTGTTACCTTAGAAGATGTAA

[0484] CACCTAAGAAGTCACCACCACCAAAGACAAATTTAACCCCTGGCCAAAGTGATTCAGCA

[0485] AAAAGGGAAGTAAAGCAGAAGATCAGTCCCTACTTTAAAAGTAATGATGTGGTGTGCAA

[0486] AAATCAAGATGAGCTGAGAAATCGTAGTGTGAAAGTCATTTGTTTGGGAAGCCTAGCAT

[0487] CTAAATTGTCCAGAAAATACGTAAAGGCTAAAAAATCAATAGATAAGGATGAAGAATTTG

[0488] CCGGTTCTAGTCCACAGAGTTCCAAATCCACAGTTGTTAAGAGCCTGATTGATAACTCT

[0489] TCAGAAATTGAGGACGAGGATCAAATTTTGGAGAACAGTTCTCAAAAAGAAAACGTGTT

[0490] TAAATGTGATTCTCTAAAGGAAGAGTGCATTCCTGAACATATGGTAAGAGGAAGTAAAAT

[0491] AATGGAAGCCGAAAGCCAAAAGGCTACCCGGGAATGTGAGAAATCAGCCCTCACCCCT

[0492] GGATTCTCAGATAATGCGATCATGTTATTCTCACCAGATTTCACTCTTAGGAATACATTA

[0493] AAGTCTACTTCAGAAGACAGTCTTGTAAAGCAAGAGTGTATCAAAGAAGTGGTTGAAAA

[0494] ACGTGAGGCATGTCATTGTGAAGAAGTAAAAATGACTGTTGCTTCAGAAGCTAAAATAC

[0495] AGCTGTCAGATTCAGAGGCAAAATCTCATAGTTCTGCAGATGATGCTTCTGCATGGAGT

[0496] AACATCCAAGAGGCTCCTCTGCAGGATGACAGTTGCTTAAACAATGATATCCCTCACAG

[0497] CATTCCTTTGGAGCAGGGGTCAAGCTGCAATGGTCCTGGTCAAACAACCGGTCATCCT

[0498] TACTACCTTCGGAGTTTCCTTGTGGTGCTGAAAACCGTACTTGAGAATGAAGATGATAT

[0499] GTTGCTCTTTGATGAGCAGGAGAAGGGAATTGTAACTAAATTTTATCAGTTATCAGCTAC

[0500] TGGTCAGAAGTTATATGTAAGGCTCTTTCAACGTAAATTAAGCTGGATTAAGATGACCAA

[0501] ATTAGAGTATGAAGAGATTGCCTTAGACTTAACACCTGTGATTGAAGAATTGACGAATG

[0502] CAGGCTTTCTACAGACAGAATCTGAGTTGCAAGAACTCTCTGAAGTGCTTGAACTCCTT

[0503] TCTGCTCCTGAACTAAAATCCCTAGCCAAGACCTTCCACTTGGTGAATCCCAATGGACA

[0504] GAAACAGCAGCTGGTGGACGCCTTTCTCAAATTGGCCAAACAGCGTTCAGTCTGCACTT

[0505] GGGGCAAGAATAAGCCTGGAATTGGTGCAGTGATTTTAAAAAGGTTTTGTTGGCTATTG

[0506] TTACAGTAAAAACATTTAAAATGTTGATAGCACATATTAACTTACAGTAGATTGTATACTT

[0507] GATTGAACTGTAATTGTTTATTTCAGTTGTAGTTAGATTGAGAAGGCTGGAAAAGCCTTA ATTGCAATAGCCTGGATTCTTTCTTGGGTTATTATTCAAAATTTTTGTCGTAATACCGTAC

[0508] TAATTTCCAGGACCAAGAAAAATCGGAAGGCAATAGGCCTTTGGTAAATTGTAGTATTTT

[0509] ATTTTCCGAGAAAAATACAGTTTTAAGTGATTCTTATGGGATTTTAAGGTAAACTATTTAG

[0510] TCAAATTTTTATTTTAGTTTTTGTTTACTAAACAAAGTATAATCAGGCAGTCTTAATGTGC

[0511] AAGTTTTCCTGAGTTTA

[0512] FAN1-228; ensembl_transcript_id: ENST00000670849 (SEQ ID NO: 8)

[0513] AGGTGGGAGGTGCGAGGTGGCCGCGCGGGGATCTTGGGTGACAGGGCACCGAGGGA

[0514] AGGAGGACGCGAGGGCAGCCAGGCCCTAGGGAGCAGGGAGAGTGGCTCGGGCTCAG

[0515] TCGCGTGGCCCCAGGTGCGCGTCCCAGGAAGAAGAAATTGTCGAGACGAATAACATGA

[0516] GGTCATATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTAAAAGTAAACCATTGC

[0517] TATCTTTCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCAGTTTTTCTAATACTC

[0518] ATGATGTCAGAAGGGAAACCTCCTGACAAAAAAAGGCCTCGTAGAAGCTTATCAATCAG

[0519] CAAGAATAAGAAAAAAGCATCTAATTCTATTATTTCGTGTTTTAACAATGCACCACCTGC

[0520] TAAACTTGCCTGCCCCGTTTGCAGTAAAATGGTGCCTAGATATGACTTAAACCGGCACC

[0521] TTGATGAAATGTGTGCTAACAATGACTTCGTTCAAGTGGATCCAGGGCAGGTTGGCTTA

[0522] ATAAATTCAAATGTGTCTATGGTAGATTTAACCAGTGTTACCTTAGAAGATGTAACACCT

[0523] AAGAAGTCACCACCACCAAAGACAAATTTAACCCCTGGCCAAAGTGATTCAGCAAAAAG

[0524] GGAAGTAAAGCAGAAGATCAGTCCCTACTTTAAAAGTAATGATGTGGTGTGCAAAAATC

[0525] AAGATGAGCTGAGAAATCGTAGTGTGAAAGTCATTTGTTTGGGAAGCCTAGCATCTAAA

[0526] TTGTCCAGAAAATACGTAAAGGCTAAAAAATCAATAGATAAGGATGAAGAATTTGCCGG

[0527] TTCTAGTCCACAGAGTTCCAAATCCACAGTTGTTAAGAGCCTGATTGATAACTCTTCAGA

[0528] AATTGAGGACGAGGATCAAATTTTGGAGAACAGTTCTCAAAAAGAAAACGTGTTTAAAT

[0529] GTGATTCTCTAAAGGAAGAGTGCATTCCTGAACATATGGTAAGAGGAAGTAAAATAATG

[0530] GAAGCCGAAAGCCAAAAGGCTACCCGGGAATGTGAGAAATCAGCCCTCACCCCTGGAT

[0531] TCTCAGATAATGCGATCATGTTATTCTCACCAGATTTCACTCTTAGGAATACATTAAAGT

[0532] CTACTTCAGAAGACAGTCTTGTAAAGCAAGAGTGTATCAAAGAAGTGGTTGAAAAACGT

[0533] GAGGCATGTCATTGTGAAGAAGTAAAAATGACTGTTGCTTCAGAAGCTAAAATACAGCT

[0534] GTCAGATTCAGAGGCAAAATCTCATAGTTCTGCAGATGATGCTTCTGCATGGAGTAACA

[0535] TCCAAGAGGCTCCTCTGCAGGATGACAGTTGCTTAAACAATGATATCCCTCACAGCATT

[0536] CCTTTGGAGCAGGGGTCAAGCTGCAATGGTCCTGGTCAAACAACCGGTCATCCTTACT

[0537] ACCTTCGGAGTTTCCTTGTGGTGCTGAAAACCGTACTTGAGAATGAAGATGATATGTTG

[0538] CTCTTTGATGAGCAGGAGAAGGGAATTGTAACTAAATTTTATCAGTTATCAGCTACTGGT

[0539] CAGAAGTTATATGTAAGGCTCTTTCAACGTAAATTAAGCTGGATTAAGATGACCAAATTA

[0540] GAGTATGAAGAGATTGCCTTAGACTTAACACCTGTGATTGAAGAATTGACGAATGCAGG

[0541] CTTTCTACAGACAGAATCTGAGTTGCAAGAACTCTCTGAAGTGCTTGAACTCCTTTCTGC

[0542] TCCTGAACTAAAATCCCTAGCCAAGACCTTCCACTTGGTGAATCCCAATGGACAGAAAC AGCAGCTGGTGGACGCCTTTCTCAAATTGGCCAAACAGCGTTCAGTCTGCACTTGGGG

[0543] CAAGAATAAGCCTGGAATTGGTGCAGTGATTTTAAAAAGAGCCAAAGCCTTGGCTGGAC

[0544] AGTCAGTACGAATCTGTAAAGGCCCCAGGGCTGTGTTTTCCCGCATCTTGCTACTGTTT

[0545] TCGTTGACCGACTCAATGGAAGATGAAGACGCCGCTTGTGGAGGTCAGGGACAGCTTT

[0546] CAACAGTCCTGTTGGTCAACCTCGGCCGAATGGAGTTTCCTAGTTACACCATCAATCGG

[0547] AAAACCCACATCTTCCAAGACAGAGATGATCTTATCAGATATGCAGCAGCCACGCACAT

[0548] GCTGAGTGACATTTCTTCCGCAATGGCCAATGGGAACTGGGAAGAAGCTAAGGAGCTC

[0549] GCTCAGTGTGCAAAAAGGGATTGGAACAGACTGAAAAACCACCCTTCTCTGAGATGCC

[0550] ACGAAGATTTACCACTCTTCCTGCGGTGTTTCACTGTTGGGTGGATTTATACAAGGATTT

[0551] TGTCTCGGTTTGTGGAAATACTGCAGAGACTTCACATGTATGAGGAAGCCGTCAGAGAA

[0552] CTTGAAAGCCTTTTGTCTCAGAGAATTTATTGTCCTGACAGCAGAGGCCGATGGTGGGA

[0553] TCGACTGGCCCTTAATTTACACCAGCACTTGAAGCGCCTGGAACCGACTATCAAGTGCA

[0554] TCACAGAGGGGCTGGCGGATCCGGAAGTCAGAACGGGACACCGCCTTTCACTGTATCA

[0555] GCGAGCCGTGCGCCTGCGAGAGTCTCCGAGCTGTAAAAAGTTCAAGCACCTCTTCCAG

[0556] CAGCTCCCAGAAATGGCTGTGCAAGATGTGAAACACGTGACCATCACAGGCAGGCTGT

[0557] GCCCACAGCGTGGGATGTGCAAGTCTGTGTTTGTGATGGAGGCCGGGGAGGCCGCTG

[0558] ACCCCACCACGGTCCTGTGCTCTGTGGAGGAGCTGGCACTGGCCCATTACAGACGCA

[0559] GCGGTTTTGACCAGGGGATTCATGGCGAAGGGTCCACCTTCAGCACCCTGTATGGCCT

[0560] CCTCCTGTGGGACATCATCTTCATGGATGGGATTCCGGATGTCTTCAGAAACGCCTGTC

[0561] AGGCATTCCCCCTGGACTTGTGCACAGACAGCTTCTTCACAAGCAGACGCCCAGCCCT

[0562] TGAGGCCAGGCTGCAGCTGATTCATGATGCCCCCGAGGAGAGCCTGCGGGCCTGGGT

[0563] GGCAGCCACGTGGCATGAGCAGGAAGGCAGAGTGGCTTCCCTTGTCAGCTGGGATCG

[0564] CTTCACGTCTCTTCAGCAAGCTCAGGATCTTGTCTCCTGCCTGGGGGGCCCTGTGCTC

[0565] AGTGGTGTGTGCAGGCACCTGGCTGCTGACTTTCGACACTGTCGAGGGGGCCTCCCC

[0566] GACCTGGTGGTGTGGAACTCCCAGAGCCGTCACTTTAAGCTGGTGGAAGTTAAAGGCC

[0567] CCAATGATCGTCTTTCACATAAGCAGATGATCTGGCTGGCTGAACTGCAGAAGCTGGG

[0568] GGCTGAAGTAGAAGTCTGCCATGTGGTTGCAGTTGGAGCTAAGAGCCAAAGCCTTAGC

[0569] TAAAAGATTCCCTACAGGAGAAAATGGAAATGAGGAGGAGAGAAACTCCGGTGTCCCC

[0570] GAGGTGTCGGTGTGGTGAGGGCCGCTGGCGTTGAAGTACATCCTGCTCTGGCCCAGC

[0571] TCCCCATAGCAGGCCTCCAGGGGGCCACTGCGCTGTTGCCGCAGCATCCTGCTCAGT

[0572] ACGTCGACTTCATCAGCCAGGAGGGAGAGCTTGTGAAAGGCTGTGATGGAGCCACCCA

[0573] GGCTGATCTGGGCCTCGGGAACCCAGCGGAAGTAGCACAGTTTCCACAGTTTTATGTG

[0574] TGTTCCAGAGACACGTGGCAGAATAACACCGTGCAGGTTGGCGGGTTTGGAAAACCAT

[0575] TCTCTAAAATACTGCTCCGTATCACTGTTCTGGCTGTCGGTTTGCTGAGCTGGATCTGG

[0576] CTTTGGTTTTAATATCAATGAATTTCTCCTTGGAAGTAATTCTTGGTCACTGATGATTCCA

[0577] TTCTTTAAGGCAGACGGCATTCCTCTTAGTGTGGAGCTGTAGCTTTTCTATACAGAAGA

[0578] GATTTTATTATGTTCCGGGGATTCCCTTTTTAGAAAGATTGAAGGATGCAATGGCAAATA TAAACTCAATACTATGAAAAATTAATGGAATTTCAGCCTCAAAGAACATTTTCCTCCCTTC

[0579] CTTTGTGTCCTTATTCTAATCCTCCTCCCCTGGAATTACACTTTTTTATGTGTTGACTCTA

[0580] CCTAGGCTGTTACTATCAGCCTGAATGGGGGCGGGATGAGAGTACCTCCTATCCACTA

[0581] ATTTGCTTAAGGATAAGTTCTAAGACGGGCTAGAAAAAACACTAGACCTGGCCGATTCT

[0582] ATCAAGAACAATGGCAAACTGAACAGAGGCAGTCAGGAGGCCAAATGTCTGATTCTTTG

[0583] TTCTGTACCTTTCAGTAGTCTGCAAATTTTCTACCAAAAAAAATCCCAAGAATTTATTTGG

[0584] GAATTATTAAAAAGGCAAACAATGAATGTTATTAGGACAAGAATATAGCAGTCAGGAGG

[0585] CCATGACTACATCACAGCCAGGCGGCATTCCCTGCCACAGTGGCGGCTTGAATCATCA

[0586] AGAAATGGATAAATGGGGCTTTAGTAAATCAGGCTTGCAGGCTCAAAGCTGCAATCTGC

[0587] CCACTCTCAGGTACTGAGACTTTGTGGGCCTCAGACACCAGGAAGAAAGCTGGGATAC

[0588] AGTCATTTGAGTTAAAAAGGGAATGACCCCTCAGAAACCCGCATTAGCAGTGTTACTCT

[0589] TGGAAGTGCCTTTACTTTTAACGCTCTCTGTTCTGAAAAAGAGGTGTTTGGTTACGTGTG

[0590] AGCCAACATCACGTTTTGTTAGCTGTGATTTACCTTTGTCCGTTTAAAAGACTTCACGGA GCCATTCTGTATACA

[0591] The 5’-UTR sequences of human FAN1 variants are set out below.

[0592] FAN1-201 5’-UTR; ensembl_transcript_id: ENST00000362065 (SEQ ID NO: 9)

[0593] GATCTTGGGTGACAGGGCACCGAGGGAAGGAGGACGCGAGGGCAGCCAGGCCCTAG

[0594] GGAGCAGGGAGAGTGGCTCGGGCTCAGTCGCGTGGCCCCAGGAAGAAGAAATTGTCG

[0595] AGACGAATAACATGAGGTCATATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTA

[0596] AAAGTAAACCATTGCTATCTTTCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCA GTTTTTCTAATACTC

[0597] The foregoing sequence is also described by the NCBI reference sequences: NM_014967,

[0598] NM_001146094 and NM_001146096

[0599] FAN1-202 5’-UTR; ensembl_transcript_id: ENST00000561594 (SEQ ID NO: 10)

[0600] CTGGGAATGCCTGGAAGCGCCGGCGCGCGGAGCCAGGAAGAAGAAATTGTCGAGACG

[0601] AATAACATGAGGTCATATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTAAAAGT

[0602] AAACCATTGCTATCTTTCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCAGTTTT

[0603] TCTAATACTC

[0604] The foregoing sequence is also described by the NCBI reference sequence: NM_001146095. FAN1-203 5’-UTR; ensembl_transcript_id: ENST00000561607 (SEQ ID NO: 11)

[0605] GAGGTGCGAGGTGGCCGCGCGGGGATCTTGGGTGACAGGGCACCGAGGGAAGGAGG

[0606] ACGCGAGGGCAGCCAGGCCCTAGGGAGCAGGGAGAGTGGCTCGGGCTCAGTCGCGT

[0607] GGCCCCAGGTGCGCGTCCCAGGAAGAAGAAATTGTCGAGACGAATAACATGAGGTCAT

[0608] ATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTAAAAGTAAACCATTGCTATCTT

[0609] TCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCAGTTTTTCTAATACTC

[0610] FAN1-207 5’-UTR; ensembl_transcript_id: ENST00000565466 (SEQ ID NO: 12)

[0611] AGGTGCGAGGTGGCCGCGCGGGGATCTTGGGTGACAGGGCACCGAGGGAAGGAGGA

[0612] CGCGAGGGCAGCCAGGCCCTAGGGAGCAGGGAGAGTGGCTCGGGCTCAGTCGCGTG

[0613] GCCCCAGGAAGAAGAAATTGTCGAGACGAATAACATGAGGTCATATAGAATCCCACTTT

[0614] TGGTGATTTCAAGTCAAGAAAGTAAAAGTAAACCATTGCTATCTTTCACCTTAAATATCC

[0615] TGTGTTTTATTGCTCAGAACATCCAGTTTTTCTAATACTC

[0616] FAN1-215 5’-UTR; ensembl_transcript_id: ENST00000656435 (SEQ ID NO: 13)

[0617] GGAAGCGCCGGCGCGCGGAGCCAGGAAGAAGAAATTGTCGAGACGAATAACATGAGG

[0618] TCATATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTAAAAGTAAACCATTGCTA

[0619] TCTTTCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCAGTTTTTCTAATACTC

[0620] FAN1-216 5’-UTR; ensembl_transcript_id: ENST00000657391 (SEQ ID NO: 14)

[0621] GGAAGCGCCGGCGCGCGGAGCCAGGTGGGAGGAAGAAGAAATTGTCGAGACGAATAA

[0622] CATGAGGTCATATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTAAAAGTAAACC

[0623] ATTGCTATCTTTCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCAGTTTTTCTAA

[0624] TACTC

[0625] The foregoing sequence is identical to the 5’-UTR sequence of the transcript FAN 1-217.

[0626] Hence, in one embodiment, FAN1-216 and / or FAN1-217 comprise SEQ ID NO: 14.

[0627] FAN1-228 5’-UTR; ensembl_transcript_id: ENST00000670849 (SEQ ID NO: 15)

[0628] AGGTGGGAGGTGCGAGGTGGCCGCGCGGGGATCTTGGGTGACAGGGCACCGAGGGA

[0629] AGGAGGACGCGAGGGCAGCCAGGCCCTAGGGAGCAGGGAGAGTGGCTCGGGCTCAG

[0630] TCGCGTGGCCCCAGGTGCGCGTCCCAGGAAGAAGAAATTGTCGAGACGAATAACATGA

[0631] GGTCATATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTAAAAGTAAACCATTGC

[0632] TATCTTTCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCAGTTTTTCTAATACTC

[0633] In one embodiment, the 5’ UTR of FAN1 is as set forth in any one or more of SEQ ID NOs: 9 to 15. In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently at least 80% complementary, such as at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to any one or more of SEQ ID NOs: 9 to 15.

[0634] In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently at least 85% complementary to a contiguous nucleotide sequence within any one or more of SEQ ID NOs: 9 to 15.

[0635] In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently at least 90% complementary to a contiguous nucleotide sequence within any one or more of SEQ ID NOs: 9 to 15.

[0636] In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently at least 95% complementary to a contiguous nucleotide sequence within any one or more of SEQ ID NOs: 9 to 15.

[0637] In one embodiment, the one or more contiguous target-determining nucleotide sequences are 100% complementary to a contiguous nucleotide sequence within any one or more of SEQ ID NOs: 9 to 15.

[0638] In one embodiment, the target nucleotide sequence comprises: a) a non-uORF sequence; b) a uORF sequence; and / or c) a uORF sequence and a non-uORF sequence.

[0639] By non-uORF sequence, it is meant any sequence of the 5’-UTR that is not within the uORF, as defined herein.

[0640] In one embodiment, the target nucleotide sequence comprises a uORF sequence.

[0641] In one embodiment, the target nucleotide sequence consists of a uORF sequence. The target nucleotide sequence may be contiguous and comprise nucleotides that are both within and not within the uORF. In other words, the target nucleotide sequence may straddle a uORF boundary.

[0642] In one embodiment, the target nucleotide sequence does not comprise a uORF sequence.

[0643] In one embodiment, the target nucleotide sequence comprises or consists of a non-uORF sequence.

[0644] In one embodiment, the target nucleotide sequence comprises or consists of a that is 5’ of the uORF ATG.

[0645] In one embodiment, the target nucleotide sequence comprises or consists of the sequence in the region +50 / -50 relative to the uORF ATG.

[0646] In one embodiment, the target nucleotide sequence comprises or consists of the sequence in the region -46 / -11 relative to the uORF ATG.

[0647] FAN1 5’UTR region -46 / -11 relative to uORF (SEQ ID NO: 218)

[0648] CTCAGTCGCGTGGCCCCAGGAAGAAGAAATTGTCGA

[0649] In one embodiment, the target nucleotide sequence comprises a sequence in the region - 46 / -11 relative to the uORF ATG and has the sequence

[0650] CTCAGTCGCGTGGCCCCAGGAAGAAGAAATTGTCGA (SEQ ID NO: 218)

[0651] In one embodiment, the target nucleotide sequence comprises a sequence in the region CTCAGTCGCGTGGCCCCAGGAAGAAGAAATTGTCGA (SEQ ID NO: 218).

[0652] In one embodiment, the target nucleotide is a contiguous nucleotide sequence of at least 10 nucleotides in length within the sequence:

[0653] CTCAGTCGCGTGGCCCCAGGAAGAAGAAATTGTCGA (SEQ ID NO: 218).

[0654] In one embodiment, the target nucleotide sequence is near a uORF sequence.

[0655] In one embodiment, the target nucleotide sequence is, at its closest point, within 120 nucleotides of a uORF sequence, such as within 110 nucleotides, such as within 100 nucleotides, such as within 90 nucleotides, within 80 nucleotides, within 70 nucleotides, within 60 nucleotides, within 50 nucleotides, within 40 nucleotides, within 30 nucleotides, within 20 nucleotides, within 10 nucleotides, or within 5 nucleotides of a uORF sequence.

[0656] In one embodiment, the target nucleotide sequence is, at its closest point, 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 15 nucleotides, 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105, nucleotides, 110 nucleotides, 115 nucleotides, 120 nucleotides or 125 nucleotides upstream (5’) of a uORF start codon.

[0657] The sequence of a uORF within the 5’IITR of human FAN1 is set out below:

[0658] FAN1 uORF (SEQ ID NO: 16)

[0659] ATGAGGTCATATAGAATCCCACTTTTGGTGATTTCAAGTCAAGAAAGTAAAAGTAAACCA TTGCTATCTTTCACCTTAAATATCCTGTGTTTTATTGCTCAGAACATCCAGTTTTTCTAA

[0660] In one embodiment, the target sequence is a uORF sequence, wherein said uORF sequence is as set forth in SEQ ID NO: 16.

[0661] In one embodiment, the target sequence is a sequence as set forth in SEQ ID NO: 16, or a fragment or variant thereof.

[0662] In one embodiment, the target sequence is a sequence that has at least 80% identity, such as at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to a contiguous nucleotide sequence within SEQ ID NO: 16.

[0663] In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently at least 80% complementary, such as at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to a contiguous nucleotide sequence within SEQ ID NO: 16. In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently at least 85% complementary to a contiguous nucleotide sequence within SEQ ID NO: 16.

[0664] In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently at least 90% complementary to a contiguous nucleotide sequence within SEQ ID NO: 16.

[0665] In one embodiment, the one or more contiguous target-determining nucleotide sequences are independently at least 95% complementary to a contiguous nucleotide sequence within SEQ ID NO: 16.

[0666] In one embodiment, the one or more contiguous target-determining nucleotide sequences are 100% complementary to a contiguous nucleotide sequence within SEQ ID NO: 16.

[0667] The sequence of a uORF and flanking sequences within the 5’IITR of human FAN1 is set out below:

[0668] FAN1 uORF and flanking sequences (SEQ ID NO: 17)

[0669] AGGAGGACGCGAGGGCAGCCAGGCCCTAGGGAGCAGGGAGAGTGGCTCGGGCTCAG TCGCGTGGCCCCAGGAAGAAGAAATTGTCGAGACGAATAACATGAGGTCATATAGAAT CCCACTTTTGGTGATTTCAAGTCAAGAAAGTAAAAGTAAACCATTGCTATCTTTCACCTT AAATATCCTGTGTTTTATTGCTC

[0670] In each of SEQ ID NOs: 1 to 17, the uORF start codon is shown as bold and underlined.

[0671] In one embodiment, the target nucleotide sequence comprises all of (i.e. , the three nucleotides of) a start codon.

[0672] In one embodiment, the target nucleotide sequence comprises part of a start codon (i.e., fewer than three of the three nucleotides of the start codon).

[0673] In one embodiment, the start codon is not the start codon of the Fan 1 ORF.

[0674] According to the foregoing, in one embodiment, the start codon is a sequence at position 1 to 3 (inclusive) of SEQ ID NO: 16. In some embodiments the start codon is any one or more of the start codons identified in sequences SEQ ID NOs: 1 to 17 (e.g., the ATG in bold and underlined therein). In one embodiment, the target nucleotide sequence comprises all or part of a start codon, wherein said start codon is not the start codon of the Fan 1 ORF.

[0675] In one embodiment, the target nucleotide sequence comprises all or part of a start codon, wherein said start codon is the start codon of the FAN1 uORF, optionally wherein said start codon is a sequence at position 1 to 3 (inclusive) of SEQ ID NO: 16, or an equivalent start codon as found in any one or more of SEQ ID NOs: 1 to 17. .

[0676] The functional nucleic acid molecule of any of the preceding claims, wherein the target nucleotide sequence is a sequence as set forth in any one or more of SEQ ID NOs: 9 to 15. In particular, the target sequence may be a shorter sequence within any one or more of SEQ ID NOs: 9 to 15.

[0677] In one embodiment, the target nucleotide sequence comprises or consists of a sequence selected from the group consisting of: SEQ ID NOs: 9 to 15.

[0678] In one embodiment, the target nucleotide sequence comprises or consists of a sequence with 80% sequence identity to a sequence selected from the group consisting of: SEQ ID NOs: 9 to 15.

[0679] In one embodiment, the target nucleotide sequence comprises or consists of a sequence with 85% sequence identity to a sequence selected from the group consisting of: SEQ ID NOs: 9 to 15.

[0680] In one embodiment, the target nucleotide sequence comprises or consists of a sequence with 90% sequence identity to a sequence selected from the group consisting of: SEQ ID NOs: 9 to 15.

[0681] In one embodiment, the target nucleotide sequence comprises or consists of a sequence with 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NOs: 9 to 15.

[0682] In one embodiment, the target nucleotide sequence comprises or consists of a sequence as set forth in SEQ ID NO: 16. In one embodiment, the target nucleotide sequence comprises or consists of a sequence with 80% sequence identity to a sequence as set forth in SEQ ID NO: 16.

[0683] In one embodiment, the target nucleotide sequence comprises or consists of a sequence with 85% sequence identity to a sequence as set forth in SEQ ID NO: 16.

[0684] In one embodiment, the target nucleotide sequence comprises or consists of a sequence with 90% sequence identity to a sequence as set forth in SEQ ID NO: 16.

[0685] In one embodiment, the target nucleotide sequence comprises or consists of a sequence as set forth in SEQ ID NO: 17.

[0686] In one embodiment, the target nucleotide sequence comprises or consists of a sequence with 80% sequence identity to a sequence as set forth in SEQ ID NO: 17.

[0687] In one embodiment, the target nucleotide sequence comprises or consists of a sequence with 85% sequence identity to a sequence as set forth in SEQ ID NO: 17.

[0688] In one embodiment, the target nucleotide sequence comprises or consists of a sequence with 90% sequence identity to a sequence as set forth in SEQ ID NO: 17.

[0689] Chemical modifications

[0690] The functional nucleic acid molecules provided herein may comprise or consist of chemically modified substituents. That is, substituents that differ relative to the common naturally occurring DNA and RNA nucleotides.

[0691] Chemically modified functional nucleic acid molecules comprise one or more modifications as compared with a functional nucleic acid molecule consisting of common naturally occurring (i.e. , ‘unmodified’) DNA and RNA nucleotides. Said modified functional nucleic acid molecules comprise one or more modified nucleosides and / or, independently, one or more modified internucleoside linkage.

[0692] The term “modification” or "chemical modification" refers to a structural change in, or on, the most common, natural nucleotides: adenosine, guanosine, cytidine, thymidine, or uridine nucleotides. In particular, the chemical modifications described herein may be changes in or on a nucleobase (i.e. a chemical base modification), or in or on a sugar (i.e. a chemical sugar modification). The chemical modifications may be introduced co-transcriptionally (e.g. by substitution of one or more nucleotides with a modified nucleotide during synthesis), or post-transcriptionally (e.g. by the action of an enzyme), or via chemical (i.e. , not transcription-based) oligonucleotide synthesis.

[0693] Chemical modifications typically constitute chemical modifications of the nucleobase comprising the nucleoside, chemical modifications of the sugar moiety comprising the oligonucleotide and / or modified internucleoside linkages joining nucleosides (which themselves may be modified or unmodified).

[0694] In one embodiment, the functional nucleic acid molecule comprises DNA nucleotides, RNA nucleotides, modified DNA nucleotides, and / or modified RNA nucleotides. In one embodiment, the functional nucleic acid comprises DNA and / or RNA analogues.

[0695] In one embodiment, the functional nucleic acid molecule comprises DNA nucleosides, RNA nucleosides, modified DNA nucleosides, and / or modified RNA nucleosides.

[0696] It will be understood that a functional RNA molecule or a functional DNA molecule of the invention may refer to a functional RNA / DNA comprising only unmodified RNA / DNA nucleotides; a functional RNA / DNA comprising both modified and unmodified RNA / DNA nucleotides; and a functional RNA / DNA comprising all modified RNA / DNA nucleotides. Thus, reference to an RNA or DNA shall include reference to modified RNA / DNAs according to the invention.

[0697] In one embodiment, the functional nucleic acid molecule comprises one or more chemical modifications of the nucleobase comprising the nucleosides therein.

[0698] In one embodiment, the functional nucleic acid molecule comprises one or more chemical modifications of the sugar moiety comprising the nucleosides therein.

[0699] In one embodiment, the functional nucleic acid molecule comprises one or more chemical modifications of internucleoside linkages joining nucleosides.

[0700] In one embodiment, the functional nucleic acid molecule comprises one or more: modified nucleobases, modified sugar moieties, and / or modified internucleoside linkages. In one embodiment, the functional nucleic acid molecule comprises between 1 and 40 modified nucleosides.

[0701] In one embodiment, the functional nucleic acid molecule comprises one or more modified nucleosides.

[0702] In one embodiment, the functional nucleic acid molecule comprises no modified nucleosides.

[0703] In one embodiment, the functional nucleic acid molecule comprises one or more modified nucleosides such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 modified nucleosides.

[0704] In one embodiment, the functional nucleic acid molecule comprises modified nucleosides wherein at least 5%, such as at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the nucleosides are modified nucleosides.

[0705] Chemical modifications are known in the art, for example as described in The RNA Modification Database provided by The RNA Institute (https: / / mods.rna.albany.edu / mods / ).

[0706] Exemplary chemical modifications are described in detail elsewhere, including but not limited to, WO 2023 / 092057, WO 2023 / 064707, and WO 2023 / 023550, which are incorporated herein by reference.

[0707] Modified nucleobases

[0708] In one embodiment, the chemical modification is a chemical base modification, i.e. , a modification of the nucleobase moiety. The chemical base modification may be selected from a modification of an adenine, cytosine and / or uracil nucleobase.

[0709] In one embodiment, the modified nucleobase is modified by alkylation, such as methylation, and / or isomerisation.

[0710] In some embodiments, the modified nucleobase refers to a nucleosides that is modified to lack a nucleobase. Hence, in some embodiments the modified nucleoside is an abasic nucleoside. The modified nucleobases can be selected from the group consisting of: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines.

[0711] The modified nucleobases can be selected from the group consisting of: 2- aminopropyladenine, 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyl adenine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-propynyl uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6- azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5 - trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F- adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3 -deazaguanine, 3 - deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N- benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases.

[0712] Further modified nucleobases include tricyclic pyrimidines, such as 1 ,3-diazaphenoxazine-2- one, 1 ,3-diazaphenothiazine-2-one and 9-(2 -aminoethoxy)-1 , 3 -diazaphenoxazine-2 -one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.

[0713] Additional nucleobases that may be known to those skilled in the art.

[0714] In a further embodiment, the chemical base modification is selected from the group consisting of: Pseudouridine (^P), N1 -Methylpseudouridine (Nl m^P), 5-Methylcytidine (m5C) and N6-Methyladenosine (m6A). In a further embodiment, the chemical base modification is selected from the group consisting of: Pseudouridine, N1 -Methylpseudouridine and N6- Methyladenosine.

[0715] Modified sugar moieties

[0716] In one embodiment, the chemical modification is a chemical sugar modification, i.e. , a modification of the sugar moiety. Modified sugar moieties comprise a modified ribose ring structure as compared with the ribose sugar (i.e., deoxy and non-deoxy) as found in unmodified or naturally occurring DNA or RNA. Sugars may be modified, for example, by replacement with a hexose ring (HNA), or a bicyclic ring, wherein said bicyclic ring may have a bridge between the C2 and C4 carbons on the ribose ring forming a locked nucleic acid (LNA).

[0717] Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen or the 2’-OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2’, 3’, 4’ or 5’ positions.

[0718] In some embodiments the modified sugar moiety is a non-bicyclic modified sugar moiety.

[0719] In some embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety.

[0720] In further embodiments, the modified sugar moiety is a sugar surrogate (i.e. , a non-sugar) or a non-ribose sugar, which may optionally comprise one or more substitutions as described for other types of modified sugar moieties.

[0721] In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 3’, 4’, and / or 5’ positions. Examples of 2’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-OCHs (“OMe” or “O-methyl”), and 2'- O(CH2)2OCH3 (“MOE” or “O-methoxyethyl”), and 2’-O-N-alkyl acetamide, e.g., 2’-O-N- methyl acetamide (“NMA”), 2’-O-N-dimethyl acetamide, 2’-O-N-ethyl acetamide, or 2’-O-N- propyl acetamide.

[0722] It will be understood that modified sugar moieties may be further defined by the isomeric configuration in relation to a specific modification. Hence, isomeric variants of modified sugar moieties may also be used within the functional nucleic acid molecules described herein.

[0723] In one embodiment, the modification is a chemical sugar modification is a 2’ modification.

[0724] A 2’ sugar modification results in a nucleoside in which a substituent other than H or -OH is present at the 2’ position (i.e., 2’ substituted). These 2’ modified sugars include 2’ linked biradicle capable of forming a bridge between the 2’ carbon and a second carbon in the ribose ring, thereby forming a LNA (2’ - 4’ biradicle bridged). In some embodiments the 2’ sugar modification is independently selected from the group consisting of: 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-alkoxy-RNA, 2’-O-methoxyethyl-RNA (MOE), 2’-amino-DNA, 2’-Fluoro-RNA, and 2’-F-ANA nucleoside.

[0725] In a preferred embodiment, the chemical sugar modification a 2'-O-Methyl (2-OMe) modification.

[0726] In a further embodiment, the chemical sugar modification is 2'-O-Methyladenosine (Am).

[0727] In a further embodiment, the chemical sugar modification is 2’-deoxy sugar.

[0728] In a further embodiment, the chemical sugar modification is 2’-Methoxyethyl sugar (2’-MOE).

[0729] In a further embodiment, the chemical sugar modification is 2’-Fluoride modification (2’-F).

[0730] In a further embodiment, the modified nucleoside is a bicyclic sugar moiety.

[0731] In one embodiment, the modified nucleoside is a locked nucleic acid (LNA).

[0732] In one embodiment, the modified nucleoside is a 2’-O-ethyl (cET) nucleotide.

[0733] Modified internucleoside linkages

[0734] The functional nucleic acid molecule of the invention may comprise one or more modified internucleoside linkages.

[0735] By modified internucleoside linkage it will be understood that the internucleoside linkage is a linkage other than a phosphodiester linkages, which functions analogously thereto to covalently couple two nucleosides.

[0736] Modified internucleoside linkages may confer on the functional nucleic acid molecules advantageous properties such as increased resistance to nucleases. Such properties may be employed to improve, for example, the in vitro or in vivo half-life of the functional nucleic acid molecule. In one embodiment, the modified internucleoside linkage is an analogue of a phosphodiester linkage.

[0737] In one embodiment, the modified internucleoside linkage is a phosphonoacetate (PACE) linkage.

[0738] In one embodiment, the modified internucleoside linkage is a phosphoramidite linkage.

[0739] In one embodiment, the modified internucleoside linkage is a phosphorothioate linkage or a variant or derivative thereof.

[0740] In one embodiment, the modified internucleoside linkage is a diphosphorothioate linkage.

[0741] In one embodiment, the modified internucleoside linkage is a alkyl-, aryl- or heteroaryl- phosphorothioate linkage.

[0742] In one embodiment, the modified internucleoside linkage is a methyl-phosphorothioate linkage.

[0743] In one embodiment, the modified internucleoside linkage is a boranophosphate linkage.

[0744] In one embodiment, the modified internucleoside linkage is a phospohonate linkage or a variant or derivative thereof.

[0745] In one embodiment, the modified internucleoside linkage is a alkyl-, aryl- or heteroaryl- phospohonate linkage.

[0746] In one embodiment, the modified internucleoside linkage is a methyl-phospohonate linkage.

[0747] In one embodiment, the modified internucleoside linkage is a phosphoryl guanidine linkage.

[0748] In one embodiment, each internucleoside linkage in the functional nucleic acid is independently selected from the group consisting of: a phosphodiester linkage; a phosphonoacetate (PACE) linkage; a phosphoramidite linkage; a phosphorothioate linkage; a diphosphorothioate linkage; an alkyl-phosphorothioate linkage; an aryl-phosphorothioate linkage; a heteroaryl-phosphorothioate linkage; a boranophosphate linkage; a phospohonate linkage; an alkyl-phospohonate linkage; an aryl-phospohonate linkage; a heteroaryl- phospohonate linkage; a methyl-phospohonate linkage; and a phosphoryl guanidine linkage, and / or variants or derivatives thereof.

[0749] In one embodiment, the modified internucleoside linkage is independently selected from the group consisting of: a phosphodiester linkage; a phosphonoacetate (PACE) linkage; a phosphoramidite linkage; a phosphorothioate linkage; a diphosphorothioate linkage; an alkyl- phosphorothioate linkage; an aryl-phosphorothioate linkage; a heteroaryl-phosphorothioate linkage; a boranophosphate linkage; a phospohonate linkage; an alkyl-phospohonate linkage; an aryl-phospohonate linkage; a heteroaryl-phospohonate linkage; a methyl-phospohonate linkage; and a phosphoryl guanidine linkage, and / or variants or derivatives thereof.

[0750] In one embodiment, the functional nucleic acid molecule comprises one or more modified internucleoside linkages.

[0751] In one embodiment, the functional nucleic acid molecule comprises between 1 and 39 modified internucleoside linkages.

[0752] In one embodiment, the functional nucleic acid molecule comprises no modified internucleoside linkages.

[0753] In another embodiment, the functional nucleic acid molecule comprises one or more modified internucleoside linkages, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, or 39 modified internucleoside linkages.

[0754] In one embodiment, the functional nucleic acid molecule comprises modified internucleoside linkages wherein at least 5%, such as at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the internucleoside linkages are modified internucleoside linkages.

[0755] It will be understood that any suitable internucleoside linkage known to the person skilled in the art may be selected for use in the functional nucleic acid molecule of the invention. Internuceoside linkages described herein are for example only and are not intended to be limiting. It will also be understood that the choice of any given internucleoside linkage will be independent of the choice of any other internucleoside linkage, i.e., between any other pair of consecutive nucleosides.

[0756] Nucleotide and nucleic acid analogues

[0757] Nucleotide and nucleic acid analogues are compounds that are structurally and / or functionally analogous to naturally occurring (or ‘unmodified’) RNA and DNA.

[0758] In one embodiment the functional nucleic acid molecule comprises or consists of nucleotide analogues.

[0759] Nucleotide analogues may comprise nucleoside analogues wherein the sugar moiety is replaced with a non-sugar moiety, for example a peptide nucleic acids (PNA), or a morpholino nucleic acids, thereby providing structural analogy with an unmodified nucleoside but not comprising a modified sugar, perse.

[0760] In one embodiment the nucleotide analogue is independently selected from any one or more of a peptide nucleic acid (PNA) nucleotide, a morpholino nucleotide, a locked nucleic acid (LNA) nucleotide, a glycol nucleic acid (GNA) nucleotide, a threose nucleic acid (TNA) nucleotide, and / or a hexitol nucleic acid (HNA) nucleotide.

[0761] In one embodiment the nucleotide analogue is a morpholino nucleotide.

[0762] In one embodiment, the functional nucleic acid molecule comprises one or more nucleotide analogues.

[0763] In one embodiment, the functional nucleic acid molecule comprises between 1 and 40 nucleotide analogues.

[0764] In one embodiment, the functional nucleic acid molecule comprises no nucleotide analogues, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotide analogues.

[0765] In one embodiment, the functional nucleic acid molecule comprises nucleotide analogues linkages wherein at least 5%, such as at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the nucleotides are nucleotide analogues.

[0766] Conjugates and linkers

[0767] In one aspect, there is provided a conjugate comprising the functional nucleic acid molecule of the invention and one or more moieties covalently bound to said functional nucleic acid molecule.

[0768] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is a non-nucleotide based moiety.

[0769] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is a polypeptide or polypeptide analogue.

[0770] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is a polypeptide or protein or a region (e.g., one or more domains), domain or fragment thereof.

[0771] Suitable polypeptides and proteins may be selected from any known source and may, for example, include: viral proteins such as viral envelope / capsid proteins; toxins; and cellular receptors.

[0772] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is an antibody, an scFv, a nanobody, an antibody-based moiety, or a fragment of any of the foregoing.

[0773] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is a ligand or receptor, or fragment thereof, capable of binding a corresponding receptor or ligand. In a preferred embodiment, the ligand and / or receptor are a cell-surface ligand / receptors.

[0774] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is a carbohydrate moiety, such as an N-acetyl glucosamine moiety.

[0775] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is a lipid moiety. In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is a cholesterol moiety or derivative thereof.

[0776] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is cholesterol.

[0777] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is cholesterol moiety and a TEG linker.

[0778] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule comprises the formula (I) or a derivative thereof: Formula

[0779] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is a fatty acid.

[0780] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is palmitic acid (PLA).

[0781] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is a lipophilic moiety.

[0782] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is a small molecule, such as a small heterocyclic molecule.

[0783] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is a small molecule, such as a small heterocyclic molecule.

[0784] Any combination or one or more of the foregoing one or more moieties covalently bound to said functional nucleic acid molecule may be independently selected. Further, said one or more moieties covalently bound to said functional nucleic acid molecule may be covalently bound to the functional nucleic acid molecule at any suitable position within the molecule.

[0785] The one or more moieties covalently bound to said functional nucleic acid molecule may confer favorable properties on the functional nucleic acid molecule. Such moieties may, for example: improve bioavailability, increase stability, improve cellular targeting, and / or improve cellular uptake.

[0786] In a particularly preferred embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule will facilitate or improve delivery across the blood brain barrier.

[0787] In one embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is an oligonucleotide or analogue thereof.

[0788] In a preferred embodiment, the one or more moieties covalently bound to said functional nucleic acid molecule is a functional nucleic acid molecule according to the invention. Hence, functional nucleic acid molecules according to the invention may be conjugated together, with or without the use of intervening linkers. In such cases, the aforementioned moieties may also be considered linkers if used to interspace two or more functional nucleic acid molecules of the invention.

[0789] In one embodiment, the functional nucleic acid molecule comprises a linker. It will be understood that a linker may be used independently of a moiety covalently bound to said functional nucleic acid molecule as discussed above.

[0790] A linker may be any moiety that serves to link, such as covalently link, two or more distinct moieties (e.g., functional nucleic acid molecules and moieties covalently bound to said functional nucleic acid molecule as discussed above).

[0791] Advantageously, linkers may be cleavable, such as by enzymes, in order to facilitate temporal and / or spatial control of moieties attached to the functional nucleic acid molecule. For example, such a moiety may be joined to a functional nucleic acid molecule via a cleavable linker, which, upon contact with a cellular protease may be cleaved to liberate the functional nucleic acid molecule from the linked moiety.

[0792] In one embodiment, the linker is an oligonucleotide or analogue thereof. It will be understood that a functional nucleic acid molecule of the invention may be represented by both a basic sequence, or just ‘sequence’, which utilises standard IUB / IUPAC nucleic acid codes to represent the nucleobase sequence (e.g., A, T / ll, G, C etc.) and / or a code in which chemical modifications of the constituent components are detailed. If a functional nucleic acid molecule of the invention is represented herein by a basic sequence, this permits any chemical modification of the constituent components, as detailed herein.

[0793] DNA molecules and vectors

[0794] According to a further aspect of the invention, there is provided a DNA molecule encoding a functional nucleic acid molecule of the invention.

[0795] According to a further aspect of the invention, there is provided an expression vector comprising said DNA molecule.

[0796] Exemplary expression vectors are known in the art and may include, for example, plasmid vectors, viral vectors (for example adenovirus, adeno-associated virus, retrovirus or lentivirus vectors), phage vectors, cosmid vectors and the like. The choice of expression vector may be dependent upon the type of host cell to be used and the purpose of use. In particular, and without limitation, the following plasmids have been used for expression of functional nucleic acid molecule:

[0797] Mammalian expression plasmids:

[0798] - pCDNA3.1 (-) pDUAL-eGFPA (modified from peGFP-C2)

[0799] Viral vectors: pAAV (an Adeno-Associated Virus vector) rcLV -TetOne-Puro (a 3rdgeneration Lentivirus vector) pLPCX-link (a 3rdgeneration Retrovirus vector)

[0800] In one embodiment the mammalian expression plasmid is pCDNA3.1 (-).

[0801] In another embodiment the mammalian expression plasmid is pDUAL-eGFPA. Plasmids of the invention may comprise any one of more features selected from the list comprising: a CMV promoter, a H1 promoter, and / or a BGH poly(A) terminator.

[0802] In one embodiment the viral vector is pAAV.

[0803] In one embodiment the viral vector is rcLV -TetOne-Puro.

[0804] In one embodiment the viral vector is pLPCX-link.

[0805] Vectors of the invention may comprise any one of more features selected from the list comprising: a CAG promoter, a CMV enhancer, SV40 late poly(A) terminator, a LTR-TREt (Tre-Tight) promoter, and / or a BGH poly(A) terminator.

[0806] It should be noted that any promoter may be used in the vector. Since the activity of the functional nucleic acid molecules of the invention is independent of the promoter it is envisaged that these will work just as well as those exemplified above.

[0807] Compositions

[0808] The present invention also relates to compositions comprising the functional nucleic acid molecule, the DNA molecule, the conjugate or the expression vector according to the invention.

[0809] The composition may comprise components which enable delivery of said functional nucleic acid molecule by viral vectors (AAV, lentivirus and the like) and non-viral vectors (nanoparticles, lipid particles and the like). Alternatively, the functional nucleic acid molecule of the invention may be administered as naked or unpackaged DNA and or RNA.

[0810] The composition may comprise components that are known in the art to aid the stability of the nucleic acid molecule, e.g., salts (such as those providing Mg2+ions).

[0811] The functional nucleic acid molecule may be administered as part of a composition, for example a composition comprising a suitable carrier. In certain embodiments, the carrier is selected based upon its ability to facilitate the transfection of a target cell with one or more functional nucleic acid molecules. Therefore, according to a further aspect of the invention, there is provided a composition comprising the functional nucleic acid molecule, the DNA molecule, the conjugate or the expression vector as described herein.

[0812] In one embodiment, there is provided a pharmaceutical composition comprising at least one functional nucleic acid molecule, at least one DNA molecule, at least one conjugate or at least one expression vector according to the present invention.

[0813] Suitably, a pharmaceutical composition may comprise at least one functional nucleic acid molecule, at least one DNA molecule, at least one conjugate or at least one expression vector according to the present invention with a suitable pharmaceutical excipient, diluent, carrier, and / or salt.

[0814] The suitable pharmaceutical excipient, diluent, carrier, and / or salt may depend on the intended route of administration and standard pharmaceutical practice.

[0815] A suitable carrier may include any of the standard pharmaceutical carriers, vehicles, diluents or excipients known in the art and which are generally intended for use in facilitating the delivery of nucleic acids, such as RNA. Liposomes, exosomes, lipidic particles or nanoparticles are examples of suitable carriers that may be used for the delivery of RNA. In a preferred embodiment, the carrier or vehicle delivers its contents to the target cell such that the functional nucleic acid molecule is delivered to the appropriate subcellular compartment, such as the cytoplasm.

[0816] In one aspect, provided herein is a pharmaceutically acceptable salt of the functional nucleic acid molecule of the invention, or the conjugate of the invention.

[0817] Such salts are known to those skilled in the art.

[0818] Methods, methods of treatment and medical uses

[0819] Functional nucleic acids of the invention, which are capable of increasing the expression of FAN1 can be used for therapeutic and non-therapeutic purposes.

[0820] In one aspect, there is provided an in vitro, in vivo, or ex vivo method for modulating FAN1 protein expression in a target cell, the method comprising the steps of exposing the cell to the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, the composition, or the pharmaceutical composition of the invention.

[0821] In one aspect, there is provided an in vivo method for modulating FAN1 protein expression in a target cell, the method comprising the steps of administering to the cell a therapeutically effective amount of the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, the composition, or the pharmaceutical composition of the invention.

[0822] In a further aspect, there is provided a method of treating, preventing, or delaying the onset of a disease in a subject, the method comprising administering to the subject a therapeutically or prophylactically effective amount of the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, the composition, or the pharmaceutical composition of the invention.

[0823] In a further aspect, there is provided a method of treating, preventing, or delaying the onset of a disease associated with FAN1 protein in a subject, the method comprising administering to the subject a therapeutically or prophylactically effective amount of the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, the composition, or the pharmaceutical composition of the invention.

[0824] In one embodiment, the disease associated with FAN1 is a disease associated with a deficiency of FAN1.

[0825] In another embodiment, the disease associated with FAN1 is a disease that can be ameliorated by increasing the amount of FAN1 is a system (e.g., cell).

[0826] In a further aspect, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in medicine or therapy.

[0827] In one embodiment, the use is prophylactic or curative.

[0828] In one embodiment, the use is prophylactic.

[0829] In one embodiment, the use is curative. The methods and uses herein are applicable to the treatment, prevention, or delay of onset of a disease associated with the expansion of disease-associated polynucleotide tracts.

[0830] In one embodiment, the disease is a triplet repeat disorder.

[0831] In one embodiment, the disease is a disease associated with or caused by CAG triplet repeat expansion, CGG triplet repeat expansion, CTG triplet repeat expansion, GAA triplet repeat expansion, GCC triplet repeat expansion, or GCG triplet repeat expansion.

[0832] In one embodiment, the disease is a CAG, CGG, CTG, GAA, GCC, or GCG triplet repeat disorder.

[0833] In one embodiment, the disease is a CGG repeat disorder.

[0834] In one embodiment, the disease is a polyglutamine (polyQ) disease.

[0835] In a further embodiment, the disease is selected from the group consisting of: Huntington’s disease (HD), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), Spinocerebellar Ataxia Type 3 (SCA3), Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7), Spinocerebellar Ataxia Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy, X- linked 1 (SMAX1 / SBMA).

[0836] In a preferred embodiment, the disease is Huntington’s disease (HD).

[0837] In one embodiment, the disease is a CGG repeat disorder.

[0838] In one embodiment, the CGG repeat disorder is a fragile X-related disorder (FXD).

[0839] In one embodiment, the disease is a CTG repeat disorder.

[0840] In one embodiment, the CTG repeat disorder is myotonic dystrophy type 1.

[0841] In one embodiment, the disease is a GAA repeat disorder.

[0842] In one embodiment, the GAA repeat disorder is Friedreich ataxia. In one embodiment, the disease is a GCC repeat disorder.

[0843] In one embodiment, the GCC repeat disorder is FRAXE mental retardation.

[0844] In one embodiment, the disease is a GCG repeat disorder.

[0845] In one embodiment, the GCG repeat disorder is oculopharyngeal muscular dystrophy.

[0846] In an aspect, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a triplet repeat disorder.

[0847] In one embodiment, the triplet repeat disorder is a CAG, CGG, CTG, GAA, GCC, or GCG triplet repeat disorder.

[0848] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a CAG repeat disorder.

[0849] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a polyglutamine (polyQ) disease.

[0850] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a disease selected from the group consisting of: Huntington’s disease (HD), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), SpinocerebellarAtaxia Type 3 (SCA3), Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7), Spinocerebellar Ataxia Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy, X- linked 1 (SMAX1 / SBMA).

[0851] In a preferred embodiment, the disease is Huntington’s disease (HD).

[0852] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a CGG repeat disorder. In one embodiment, the CGG repeat disorder is a fragile X-related disorder (FXD).

[0853] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a CTG repeat disorder.

[0854] In one embodiment, the CTG repeat disorder is myotonic dystrophy type 1.

[0855] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a GAA repeat disorder.

[0856] In one embodiment, the GAA repeat disorder is Friedreich ataxia.

[0857] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a GCC repeat disorder.

[0858] In one embodiment, the GCC repeat disorder is FRAXE mental retardation.

[0859] In one embodiment, there is provided the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for use in the treatment, prevention, or delay of onset of a GCG repeat disorder.

[0860] In one embodiment, the GCG repeat disorder is oculopharyngeal muscular dystrophy.

[0861] In an aspect, there is provided use of the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for the preparation of a medicament.

[0862] In an aspect, there is provided use of the functional nucleic acid molecule, the conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the invention for the preparation of a medicament for the treatment, prevention, or delay of a triplet repeat disorder.

[0863] In one embodiment, the medicament is for the treatment, prevention, or delay of a CAG triplet repeat disorder. In one embodiment, the medicament is for the treatment, prevention, or delay of a polyglutamine disease (polyQ).

[0864] In one embodiment, the medicament is for the treatment, prevention, or delay of a disease selected from the group consisting of: Huntington’s disease (HD), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), Spinocerebellar Ataxia Type 3 (SCA3), Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7), Spinocerebellar Ataxia Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy, X-linked 1 (SMAX1 / SBMA).

[0865] In one embodiment, the medicament is for the treatment, prevention, or delay of Huntington’s disease (HD).

[0866] In one embodiment, the medicament is for the treatment, prevention, or delay of a CGG repeat disorder.

[0867] In one embodiment, the CGG repeat disorder is a fragile X-related disorder (FXD).

[0868] In one embodiment, the medicament is for the treatment, prevention, or delay of a CTG repeat disorder.

[0869] In one embodiment, the CTG repeat disorder is myotonic dystrophy type 1.

[0870] In one embodiment, the medicament is for the treatment, prevention, or delay of a GAA repeat disorder.

[0871] In one embodiment, the GAA repeat disorder is Friedreich ataxia.

[0872] In one embodiment, the medicament is for the treatment, prevention, or delay of a GCC repeat disorder.

[0873] In one embodiment, the GCC repeat disorder is FRAXE mental retardation.

[0874] In one embodiment, the medicament is for the treatment, prevention, or delay of a GCG repeat disorder. In one embodiment, the GCG repeat disorder is oculopharyngeal muscular dystrophy.

[0875] In all of the foregoing methods and uses the action of the functional nucleic acid may be considered disease modifying.

[0876] Further, in each of the foregoing aspects, a DNA or vector encoding the functional nucleic acid molecule of the invention may also be utilised, either in combination with any other component or in isolation.

[0877] Methods of the invention can be performed in vitro, ex vivo or in vivo.

[0878] The methods described herein may comprise transfecting into a cell the functional nucleic acid molecule, DNA molecule, expression vector, composition or pharmaceutical composition as defined herein. The functional nucleic acid molecule, DNA molecule, expression vector, composition or pharmaceutical composition may be administered to target cells using methods known in the art and include, for example, microinjection, lipofection, electroporation, using calcium phosphate, self-infection by the vector or viral transduction.

[0879] The functional nucleic acid molecules, DNA molecules, compositions and / or pharmaceutical compositions can be used as medicaments, preferably for triplet repeat expansion diseases / disorders, for example polyglutamine (polyQ) diseases.

[0880] It will be understood that, since these disorders are hereditary, prevention refers to the prevention of triplet expansion and any pathological consequences associated therewith. That is, rather than prevention of the disease outright.

[0881] Further prevention may also encompass modulation of the age at onset of disease (AAO).

[0882] It will be understood that the functional nucleic acid molecule of the invention ultimately finds use in increasing the level of FAN1 protein. Said increase in FAN1 is preferably within a cell, such as the cell of a subject.

[0883] In preferable embodiments, the subject is a human subject.

[0884] In yet further preferable embodiments, the subject is a human subject with a hereditary triplet repeat disorder. In one embodiment, the disease or disorder is a neurological disease or disorder.

[0885] In one embodiment, the disease or disorder is Huntington’s disease (HD).

[0886] In one embodiment, the disease or disorder is Spinocerebellar Ataxia Type 1 (SCA1).

[0887] In one embodiment, the disease or disorder is Spinocerebellar Ataxia Type 2 (SCA2).

[0888] In one embodiment, the disease or disorder is Spinocerebellar Ataxia Type 3 (SCA3). Spinocerebellar Ataxia Type 3 is also known as Machado-Joseph disease (MJD).

[0889] In one embodiment, the disease or disorder is Spinocerebellar Ataxia Type 6 (SCA6).

[0890] In one embodiment, the disease or disorder is Spinocerebellar Ataxia Type 7 (SCA7).

[0891] In one embodiment, the disease or disorder is Spinocerebellar Ataxia Type 17 (SCA17).

[0892] In one embodiment, the disease or disorder is dentatorubral pallidoluysian atrophy (DRPLA).

[0893] In one embodiment, the disease or disorder is and spinal and bulbar muscular atrophy, X- linked 1 (SMAX1 / SBMA).

[0894] Herein instances of the plural form of words should be taken to cover also the singular form of the word and vice versa, unless the context clearly dictates otherwise.

[0895] The invention will now be illustrated with reference to the following non-limiting examples.

[0896] EXAMPLES

[0897] Example 1 - A point mutation in the FAN1 uORF start codon increases downstream ORF expression

[0898] The present inventors sought to investigate whether the putative uORF identified within the FAN1 5’-UTR is a regulatory element that is capable of modulating the expression of downstream ORFs. To this end, dual-luciferase assays were performed utilising a reporter construct (Figure 1A) in which either a wild-type FAN1 5’-UTR or modified version of the FAN1 5’-UTR was placed upstream of a luciferase reporter gene (Figures 1A and E). Modified FAN1 5’-UTR sequences comprised a single point mutation (ATG to ATC) in the FAN1 5’-UTR that resulted in the deletion of the start codon of a uORF, or the introduction of a consensus Kozak sequence (Figures 1E and F).

[0899] The dual luciferase reporter plasmids according to (Figure 1A) were transfected into either HCT116 cells (n=4; Figure 1 B; or n=2 Figure 1F) or LI2OS cells (n= 2; Figure 1C). 24h postseeding into 96 well plates, 100 ng of each plasmid was transfected per well using either Transit-2020 (Mirus Bio) or FuGENE HD (Promega) transfection reagents respectively. 24h post-transfection, luminescence output was assessed using the Nano-Gio Dual-Luciferase Reporter Assay System (Promega). In both cell types tested, deletion of the uORF start codon resulted in a significant (~4 fold) increase in the amount of the NIuc reporter protein produced from the ORF downstream of the modified FAN1 5’-UTR, as compared with the wild-type 5’-UTR (Figures 1B and 1C).

[0900] To control for the possibility that variations in protein expression were a result of differing RNA quantities, RNA was collected in parallel from HCT116 cells (n=2; Figure 1 D). RNA was extracted using the RNeasy Mini kit (Qiagen), DNase treated (TURBO DNA-free kit, Invitrogen), reverse transcribed (iScript cDNA synthesis kit, Bio-Rad) and the levels of Flue and NIuc RNA levels assessed by qPCR. NIuc RNA levels were normalised to Flue RNA levels, and these ratios compared to the WT construct. These data indicate that the levels of RNA remained roughly consistent between the two groups, indicating that the increase in NIuc protein expression could not be accounted for based on differences in RNA alone.

[0901] The reduction in protein expression observed when a ‘strong’ Kozak sequence is introduced to the uORF start codon (Figure 1F) is indicative that promoting expression of the uORF, by virtue of the consensus Kozak sequence, results in translational suppression of the downstream ORF. These data therefore further support a model in which translational activity at the uORF comes at the expense of translational activity at the downstream ORF. Put another way, promoting uORF translation inhibits downstream ORF translation, whereas abrogating uORF translation promotes downstream ORF translation.

[0902] Taken together, these data suggest that the uORF in the 5’-UTR of FAN1 is able to repress the expression of ORFs downstream; such repression can be relieved by the effective deletion of the start codon of the uORF. It is likely that deletion of the start codon of the uORF disrupts translation of the uORF itself, thereby relieving translational suppression of the downstream ORF, leading to increased downstream ORF translation and increased protein production.

[0903] Example 2 - A point mutation in the FAN1 uORF start codon increases FAN1 expression

[0904] Following the finding that the putative uORF identified within the FAN1 5’-UTR is capable of modulating the expression of a downstream ORF (Example 1), the present inventors sought to determine whether said uORF is similarly capable of modulating the expression of the downstream ORF when said ORF is the native FAN1 ORF with which it is usually associated.

[0905] To this end, a Hi BiT reporter construct (Figure 2A) was created in which either one of two C- terminally HiBiT-tagged FAN1 ORF and 5’-UTR sequences was present: (1) a wild-type sequence comprising an unmodified FAN1 ORF and 5’-UTR; or, (2) a modified FAN1 ORF and 5’-UTR, wherein the modification consisted of a modified FAN1 5’-UTR sequence consisting of a single point mutation (ATG to ATC) in the FAN1 5’-UTR that resulted in the deletion of the start codon of a uORF.

[0906] The plasmids according to (Figure 2A) were transfected into HOT 116 cells 24h after seeding into 96 well plates (100 ng per well using Transit-2020 reagent (Mirus Bio)) and the expression of HiBiT-tagged FAN1 protein from the FAN1 ORF was measured at 24 hours (n=2; Figure 2B) and 48 hours (n= 2; Figure 2C) after transfection using Nano-Gio Hi BiT Lytic Detection System (Promega).

[0907] At both time points, deletion of the uORF start codon resulted in a significant increase in the amount of FAN1 protein produced from the ORF downstream of the modified FAN1 5’-UTR, as compared with the wild-type 5’-UTR (Figures 2B and 20). These data corroborate those of Example 1 herein and further show that the uORF in the 5’-UTR of FAN1 is able to repress the expression of a native downstream FAN1 ORF. Further, these data show that interventions to modify the uORF (e.g., by modification of the start codon) are able to increase expression of FAN1 protein from the downstream ORF.

[0908] Example 3 - Functional nucleic acid molecules directed toward the 5’-UTR increase FAN1 expression

[0909] Following the surprising finding that modification of the start codon of the putative uORF identified within the FAN1 5’-UTR results in increased expression of both exogenous (Example 1) and endogenous (i.e., FAN1 ; Example 2) downstream ORFs, the present inventors designed a panel of functional nucleic acid molecules that target the 5’-UTR of FAN1 , in particular at the start codon of the uORF.

[0910] It is anticipated that functional nucleic acid molecules that bind at or near the start codon of the uORF within the FAN1 5’-UTR will result in increased expression of the downstream FAN1 ORF (and therefore increase FAN1 protein expression).

[0911] To investigate endogenous FAN1 protein expression, CRISPR engineered cell lines (HCT116 and PGP1-iPSC) were constructed with a HiBiT tag (Promega) inserted at the C- terminus of the FAN1 CDS (Synthego). ASOs were reverse or forward transfected into FAN 1 -HiBiT cell lines at varying doses (5-100nM). Alternatively, ASOs were delivered via free uptake (gymnosis), with ASOs dosed once to twice per week at doses up to 10uM. At various time points post ASO delivery (16h-1 week), FAN 1 -HiBiT levels were quantified using Nano-Gio HiBiT Lytic Detection System (Promega) to determine changes in FAN1 protein levels.

[0912] ASOs found to upregulate FAN 1 -HiBiT were validated in untagged cell lines, with FAN1 protein production assessed by western blot. Additionally the RNA level of FAN1 following ASO treatment was also confirmed by qPCR. To confirm that ASO activity was due to altered uORF activity, hit ASOs were co-transfected with the dual luciferase constructs described in Example 1 into WT HCT116 cells. ASOs that modulate uORF expression should only significantly impact NIuc expression in the WT construct, and not when cotransfected with the reporter construct with a mutated uORF start codon. Example 4 - Functional nucleic acid molecules directed toward the 5’-UTR increase FAN1 expression

[0913] Following the surprising finding that modification of the start codon of the putative uORF identified within the FAN1 5’-UTR results in increased expression of both exogenous (Example 1) and endogenous (i.e., FAN1; Example 2) downstream ORFs, the present inventors designed a panel of functional nucleic acid molecules that target the 5’-UTR of FAN1, in particular at the start codon of the uORF.

[0914] It is anticipated that functional nucleic acid molecules that bind at or near the start codon of the uORF within the FAN1 5’-UTR will result in increased expression of the downstream FAN1 ORF (and therefore increase FAN1 protein expression).

[0915] To investigate endogenous FAN1 protein expression, CRISPR engineered cell lines (HCT116 and PGP1-iPSC) were constructed with a HiBiT tag (Promega) inserted at the C- terminus of the FAN1 CDS (Synthego). Additional HiBiT-tagging was performed internally on an HD patient-derived CAG127-iPSC cell line.

[0916] To identify a functional hotspot, ASOs were reverse transfected into HCT116 FAN1-HiBiT cell lines at 30nM using either Lipofectamine RNAiMAX (Invitrogen or HiPerFect (Qiagen) transfection reagents. 24h post-transfection, FAN1-HiBiT levels were quantified using Nano- Glo HiBiT Lytic Detection System (Promega) to determine changes in FAN1 protein levels.

[0917] Screening ASO around the start codon of the uORF identified a hotspot upstream of the uORF where ASO binding resulted in FAN1 upregulation (Figure 3). Whilst the hotspot identified is not limited to the following region, targeting the region of -46 / -11 relative to the uORF ATG (i.e., a window encompassing 46 nucleotides to 11 nucleotides upstream of the A of the uORF ATG), using the exemplary ASOs shown in Table 2, yielded particularly effective FAN1 upregulation.

[0918] These results provide proof of principle of the ability of ASOs targeting the 5’-UTR of FAN1 at or near the start codon of the uORF to regulate FAN1 protein levels. Selected ASOs were chosen for further optimisation.

[0919] Example 5 - Optimisation of ASOs

[0920] From the initial ASO screening described in Example 4 (and Figure 3), one ASO (ASO_1) was selected for follow up study, it addition to further sequence variants. To investigate if FAN1 upregulation could be improved by modification of this ASO design, additional ASOs were designed exploring various parameters including ASO length.

[0921] These ASOs, derived from the parental screening ASO, were reverse transfected into a HCT116 FAN1-HiBiT line at 30nM using HiPerFect transfection reagent (Qiagen). Mock transfected cells, which received transfection reagent but no ASO, were used as a negative control, whilst a FAN1 gapmer ASO which results in FAN1 transcript degradation was used as a positive control for transfection efficiency. Cells were assayed 24h post-transfection. To account for any impact ASO treatment has on cell number at assay end point, cell viability was assessed via Cell-Titre Fluor (CTF) assay (Promega). Changes in FAN1 were then assessed via Hi BiT lytic assay (Promega).

[0922] Follow up experiments identified three ASOs (Figure 4) that consistently resulted in FAN1 upregulation in the HCT116 cell line.

[0923] Example 6 - Validation of ASOs in different cellular contexts

[0924] Given the identification of functional ASOs in HCT 116, the inventors sought to confirm ASO- mediated FAN1 upregulation in other cell types, namely patient-derived iPSCs and striatal neurons.

[0925] 24h post-seeding of patient derived iPSC cells (CAG127 FAN 1 -HiBit), 3’ cholesterol conjugated 2’0Me ASOs were added to cells in serum free media at 2uM. After 24h ASO exposure, media was replaced with full growth media, supplemented with serum, and cells were incubated a further 24h. 48h post-ASO addition, cell count was assessed via IncuCyte (Sartorius), to correct for any ASO-mediated difference in cell growth or number, and changes in FAN1 assessed via HiBiT lytic assay (Promega). HiBiT luminescence (RLU) was normalised to cell count and expressed relative to an untreated control. 3’ palmitate conjugated FAN1 gapmer was used as a positive control for gymnotic uptake, and a 3’ cholesterol conjugated non-targeting ASO was used to control for the non-specific impact of the cholesterol conjugate (Figure 5A). As seen in HCT116, 5’IITR targeting ASOs were found to upregulate FAN1 in this iPSC model system.

[0926] As a next step, the inventors investigated if ASO treatment results in FAN1 upregulation within a disease relevant neuron cell system. HD patient-derived CAG109 striatal neurons (BrainXell) were cultured for 8 weeks according to manufacturer’s guidelines. ASOs were added to neuronal media at a final concentration of 5uM once per week, with ASOs uptaken by cells via gymnosis. After 8 weeks of dosing, cells were collected and lysed in Laemmli buffer. Cell lysates were subject to SDS-PAGE, transferred to a nitrocellulose membrane and Western blotted for the presence of FAN1 (Proteintech) and TLIBB3 (p-tubulin) (R&D Systems). Binding of primary antibodies were detected following the addition of fluorescently labelled secondary antibodies and the membrane was imaged on a LiCor Odyssey M. Band intensity was quantified using Empiria Studio (LiCor). A clear upregulation of FAN1 protein following ASO treatment is observed when compared to untreated control wells.

[0927] Taken together, these data indicate the potential of ASOs that target the hotspot identified at the uOFR ATG region for upregulating FAN1 in a disease-relevant cell type.

[0928] The presently identified hotspot, and the ability of ASOs that target sequences exclusively upstream of the uORF (i.e., not overlapping the ATG start codon), demonstrate that functional nucleic acids of the present invention act by modulating the translation of the uORF. In the case of target sequences that do not encompass the ATG start codon of the uORF, it is thought that the binding of functional nucleic acids perturbs or occludes important functional motifs in the immediate upstream vicinity of the ATG start codon, thereby reducing translational activity at the uORF, leading to the concomitant upregulation of translational activity at the FAN1 ORF.

[0929] NUMBERED EMBODIMENTS

[0930] The invention will now be described by the following numbered embodiments.

[0931] Embodiment 1. A functional nucleic acid molecule of 10 to 40 nucleotides in length, comprising one or more contiguous target-determining nucleotide sequences that are independently 5 or more nucleotides in length, wherein each target-determining nucleotide sequence is at least 80% complementary to a contiguous target nucleotide sequence within the 5’-UTR o Fan1.

[0932] Embodiment 2. The functional nucleic acid molecule embodiment 1, wherein Fan1 is selected from any one or more of: a) FAN1-228, FAN1-217, FAN1-216, FAN1-215, FAN1-207, FAN1-203, FAN1- 202, and / or FAN 1-201 ; and / or b) SEQ ID NOs: 1 to 8.

[0933] Embodiment 3. The functional nucleic acid molecule of embodiment 1 or embodiment 2, wherein the 5’-UTR of Fan1 is a sequence as set forth in any one or more of SEQ ID NOs: 9 to 15.

[0934] Embodiment 4. The functional nucleic acid molecule of any of the preceding embodiments, wherein the target nucleotide sequence comprises: a) a non-uORF sequence; b) a uORF sequence; and / or c) a uORF sequence and a non-uORF sequence.

[0935] Embodiment 5. The functional nucleic acid molecule of embodiment 4, wherein the uORF sequence is as set forth in SEQ ID NO: 16.

[0936] Embodiment 6. The functional nucleic acid molecule of any of the preceding embodiments, wherein the target nucleotide sequence comprises: a) all or part of a start codon, wherein said start codon is not the start codon of the Fan1 ORF; b) does not comprise all or part of a start codon. Embodiment 7. The functional nucleic acid molecule of any of the preceding embodiments, wherein the target nucleotide sequence is a sequence as set forth in any one or more of SEQ ID NOs: 18 to 103, 190 to 191 , and 218.

[0937] Embodiment 8. The functional nucleic acid molecule of any of the preceding embodiments, wherein one or more of the target-determining nucleotide sequences comprises or consists of: a) a sequence independently selected from the group consisting of: SEQ ID NOs: 104 to 189 and 192 to 193; and / or b) a sequence with at least 90% sequence identity to a sequence independently selected from the group consisting of: SEQ ID NOs: 104 to 189 and 192 to 193.

[0938] Embodiment 9. The functional nucleic acid molecule of any of the preceding embodiments, wherein the functional nucleic acid molecule: a) increases the translation of the Fan 1 ORF; and / or b) increases the production of Fan1 protein.

[0939] Embodiment 10. The functional nucleic acid molecule of any of the preceding embodiments, wherein the functional nucleic acid molecule comprises one or more modified nucleosides.

[0940] Embodiment 11. The functional nucleic acid molecule of embodiment 10, wherein the one or more modified nucleosides independently comprise a modified sugar moiety or a modified nucleobase.

[0941] Embodiment 12. The functional nucleic acid molecule of embodiment 10 or embodiment 11 , wherein the one or more modified nucleosides independently comprise a modified sugar moiety independently selected from any one or more of: 2’-deoxy, 2’-MOE, 2’-OMe, and 2’-F.

[0942] Embodiment 13. The functional nucleic acid molecule of any of embodiments 10 to 12, wherein the one or more modified nucleosides comprise a bicyclic sugar moiety, optionally wherein the bicyclic sugar moiety selected from LNA and cET.

[0943] Embodiment 14. The functional nucleic acid molecule of any of the preceding embodiments, wherein the functional nucleic acid molecule comprises one or more modified internucleoside linkages. Embodiment 15. The functional nucleic acid molecule of any of the preceding embodiments, wherein the functional nucleic acid molecule comprises one or more nucleotide analogues.

[0944] Embodiment 16. The functional nucleic acid molecule of any of the preceding embodiments, wherein the functional nucleic acid molecule comprises or consists of: a) SEQ ID NO: 194 to 217; b) SEQ ID NO: 194 to 199; c) ASO_1 to ASO_15 or ASO_17 to 25; and / or d) a contiguous nucleotide sequence that is fully reverse complimentary to a contiguous nucleotide sequence of at least 10 nucleotides in length within SEQ ID NO: 218.

[0945] Embodiment 17 A conjugate comprising the functional nucleic acid molecule of any of the preceding embodiments and one or more moieties covalently bound to said functional nucleic acid molecule.

[0946] Embodiment 18. A pharmaceutically acceptable salt of the functional nucleic acid molecule of any of embodiments 1 to 16, or the conjugate of embodiment 17.

[0947] Embodiment 19. A composition comprising the functional nucleic acid molecule of any of embodiments 1 to 16, the conjugate of embodiment 17, or the pharmaceutically acceptable salt of embodiment 18, and a diluent, solvent, carrier, salt and / or adjuvant.

[0948] Embodiment 20. A pharmaceutical composition comprising the functional nucleic acid molecule of any of embodiments 1 to 16, the conjugate of embodiment 17, or the pharmaceutically acceptable salt of embodiment 18, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0949] Embodiment 21 . An in vitro or in vivo method for modulating Fan1 protein expression in a target cell, the method comprising the steps of exposing the cell to the functional nucleic acid molecule of any of embodiments 1 to 16, the conjugate of embodiment 17, the pharmaceutically acceptable salt of embodiment 18, the composition of embodiment 19, or the pharmaceutical composition of embodiment 20. Embodiment 22. A method of treating, preventing, or delaying the onset of a disease associated with Fan1 protein in a subject comprising administering to the subject a therapeutically or prophylactically effective amount of the functional nucleic acid molecule of any of embodiments 1 to 16, the conjugate of embodiment 17, the pharmaceutically acceptable salt of embodiment 18, or the pharmaceutical composition of embodiment 20.

[0950] Embodiment 23. The functional nucleic acid molecule of any of embodiments 1 to 16, the conjugate of embodiment 17, the pharmaceutically acceptable salt of embodiment 18, or the pharmaceutical composition of embodiment 19 for use in treating, preventing, or delaying the onset of a disease.

[0951] Embodiment 24. Use of the functional nucleic acid molecule of any of embodiments 1 to 16, the conjugate of embodiment 17, the pharmaceutically acceptable salt of embodiment 18, or the pharmaceutical composition of embodiment 19 for the preparation of a medicament for the treatment, prevention, or delay of a disease.

[0952] Embodiment 25. The method according to embodiment 22; the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition for use according to embodiment 23; or use of the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition according to embodiment 24, wherein the disease is a triplet repeat disorder.

[0953] Embodiment 26. The method according to embodiment 22 or embodiment 25; the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition for use according to embodiment 23 or embodiment 25; or use of the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition according to embodiment 24 or embodiment 25, wherein the disease is a disease associated with or caused by CAG triplet repeat expansion, CGG triplet repeat expansion, CTG triplet repeat expansion, GAA triplet repeat expansion, GCC triplet repeat expansion, or GCG triplet repeat expansion.

[0954] Embodiment 27. The method according to any of embodiments 22, 25, and 26; the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition for use according to any of embodiments 23, 25, and 26; or use of the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition according to any of embodiments 24, 25, and 26, wherein the disease is selected from the group consisting of: Huntington’s disease (HD), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), Spinocerebellar Ataxia Type 3 (SCA3), Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7), Spinocerebellar Ataxia Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy, X-linked 1 (SMAX1 / SBMA).

[0955] Embodiment 28. The method according to any of embodiments 22, and 25 to 27; the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition for use according to any of embodiments 23, and 25 to 27; or use of the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition according to any of embodiments 24 to 27, wherein the disease is Huntington’s disease (HD).

Claims

CLAIMS1. A functional nucleic acid molecule of 10 to 40 nucleotides in length, comprising one or more contiguous target-determining nucleotide sequences that are independently 5 or more nucleotides in length, wherein each target-determining nucleotide sequence is at least 80% complementary to a contiguous target nucleotide sequence within the 5’-UTR of Fan1.

2. The functional nucleic acid molecule claim 1 , wherein Fan1 is selected from any one or more of: a) FAN1-228, FAN1-217, FAN1-216, FAN1-215, FAN1-207, FAN1-203, FAN1- 202, and / or FAN 1-201 ; and / or b) SEQ ID NOs: 1 to 8.

3. The functional nucleic acid molecule of claim 1 or claim 2, wherein the 5’-UTR of Fan1 is a sequence as set forth in any one or more of SEQ ID NOs: 9 to 15.

4. The functional nucleic acid molecule of any of the preceding claims, wherein the target nucleotide sequence comprises: a) a non-uORF sequence; b) a uORF sequence; and / or c) a uORF sequence and a non-uORF sequence.

5. The functional nucleic acid molecule of claim 4, wherein the uORF sequence is as set forth in SEQ ID NO: 16.

6. The functional nucleic acid molecule of any of the preceding claims, wherein the target nucleotide sequence comprises none, all, or part of a start codon, wherein said start codon is not the start codon of the Fan 1 ORF.

7. The functional nucleic acid molecule of any of the preceding claims, wherein the target nucleotide sequence is a sequence as set forth in any one or more of SEQ ID NOs: 18 to 103, 190 to 191 , and 218.

8. The functional nucleic acid molecule of any of the preceding claims, wherein one or more of the target-determining nucleotide sequences comprises or consists of: a) a sequence independently selected from the group consisting of: SEQ ID NOs: 104 to 189 and 192 to 193; and / orb) a sequence with at least 90% sequence identity to a sequence independently selected from the group consisting of: SEQ ID NOs: 104 to 189 and 192 to 193.

9. The functional nucleic acid molecule of any of the preceding claims, wherein the functional nucleic acid molecule: a) increases the translation of the Fan 1 ORF; and / or b) increases the production of Fan1 protein.

10. The functional nucleic acid molecule of any of the preceding claims, wherein the functional nucleic acid molecule comprises one or more modified nucleosides.

11. The functional nucleic acid molecule of claim 10, wherein the one or more modified nucleosides independently comprise a modified sugar moiety or a modified nucleobase, optionally wherein the modified sugar moiety is independently selected from any one or more of: 2’-deoxy, 2’-MOE, 2’-OMe, and 2’-F.

12. The functional nucleic acid molecule of any of claim 10 or claim 11 , wherein the one or more modified nucleosides comprise a bicyclic sugar moiety, optionally wherein the bicyclic sugar moiety selected from LNA and cET.

13. The functional nucleic acid molecule of any of the preceding claims, wherein the functional nucleic acid molecule comprises: a) one or more modified internucleoside linkages; and / or b) one or more nucleotide analogues.

14. The functional nucleic acid molecule of any of the preceding claims, wherein the functional nucleic acid molecule comprises or consists of any one of the sequences selected from the group consisting of SEQ ID NOs: 194 to 217.

15. A conjugate comprising the functional nucleic acid molecule of any of the preceding claims and one or more moieties covalently bound to said functional nucleic acid molecule.

16. A pharmaceutically acceptable salt of the functional nucleic acid molecule of any of claims 1 to 14, or the conjugate of claim 15.

17. A composition comprising the functional nucleic acid molecule of any of claims 1 to 14, the conjugate of claim 15, or the pharmaceutically acceptable salt of claim 16, and a diluent, solvent, carrier, salt and / or adjuvant.

18. A pharmaceutical composition comprising the functional nucleic acid molecule of any of claims 1 to 14, the conjugate of claim 15, or the pharmaceutically acceptable salt of claim 15, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

19. An in vitro or in vivo method for modulating Fan1 protein expression in a target cell, the method comprising the steps of exposing the cell to the functional nucleic acid molecule of any of claims 1 to 14, the conjugate of claim 15, the pharmaceutically acceptable salt of claim 16, the composition of claim 17, or the pharmaceutical composition of claim 18.

20. A method of treating, preventing, or delaying the onset of a disease associated with Fan1 protein in a subject comprising administering to the subject a therapeutically or prophylactically effective amount of the functional nucleic acid molecule of any of claims 1 to14, the conjugate of claim 15, the pharmaceutically acceptable salt of claim 16, the composition of claim 17, or the pharmaceutical composition of claim 18.

21. The functional nucleic acid molecule of any of claims 1 to 14, the conjugate of claim15, the pharmaceutically acceptable salt of claim 16, the composition of claim 17, or the pharmaceutical composition of claim 18, for use in treating, preventing, or delaying the onset of a disease.

22. Use of the functional nucleic acid molecule of any of claims 1 to 14, the conjugate of claim 15, the pharmaceutically acceptable salt of claim 16, the composition of claim 17, or the pharmaceutical composition of claim 18, for the preparation of a medicament for the treatment, prevention, or delay of a disease.

23. The method according to claim 20; the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, composition, or the pharmaceutical composition for use according to claim 21 ; or use of the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, or the pharmaceutical composition according to claim 22, wherein the disease is a triplet repeat disorder.

24. The method according to claim 20 or claim 21 ; the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, composition, or the pharmaceutical compositionfor use according to claim 21 or claim 23; or use of the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, composition, or the pharmaceutical composition according to claim 22 or claim 23 wherein the disease is a disease associated with or caused by CAG triplet repeat expansion, CGG triplet repeat expansion, CTG triplet repeat expansion, GAA triplet repeat expansion, GCC triplet repeat expansion, or GCG triplet repeat expansion.

25. The method according to any of claims 20, 23, and 24; the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, composition, or the pharmaceutical composition for use according to any of claims 21 , 23, and 24; or use of the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, composition, or the pharmaceutical composition according to any of claims 22, 23, and 24, wherein the disease is selected from the group consisting of: Huntington’s disease (HD), Spinocerebellar Ataxia Type 1 (SCA1), Spinocerebellar Ataxia Type 2 (SCA2), Spinocerebellar Ataxia Type 3 (SCA3), Spinocerebellar Ataxia Type 6 (SCA6), Spinocerebellar Ataxia Type 7 (SCA7), Spinocerebellar Ataxia Type 17 (SCA17), dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy, X-linked 1 (SMAX1 / SBMA).

26. The method according to any of claims 20, and 23 to 25; the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, composition, or the pharmaceutical composition for use according to any of claims 21 , and 23 to 25; or use of the functional nucleic acid molecule, conjugate, pharmaceutically acceptable salt, composition, or the pharmaceutical composition according to any of claims 22 to 25, wherein the disease is Huntington’s disease (HD).

Images