High-bioactivity plasmid DNA, preparation and storage thereof, vaccine, kit and use thereof

Abstract

The present invention relates to the field of biomedicine. Particularly provided are a high-bioactivity plasmid DNA, preparation and storage thereof, a vaccine, a kit, and a use thereof. The preparation method for the high-bioactivity plasmid DNA comprises: lysing bacterial cells after expansion culture and collecting a supernatant to obtain a crude solution containing a plasmid; purifying the crude solution by means of two-step liquid chromatography to obtain a purified plasmid DNA; precipitating the purified plasmid DNA by means of an alcohol and / or a polyol to concentrate and activate the plasmid DNA; and storing the plasmid DNA as a precipitate. The provided preparation method meets medical-grade standards, shortens the plasmid DNA purification time and reduces the material cost, improves the plasmid DNA yield and activity, and facilitates long-term storage. In addition, the plasmid DNA has higher in-vivo transfection efficiency and expression stability, thereby facilitating efficient introduction of a target gene into an organism. Thus, the plasmid DNA obtained by means of the method is suitable for use as an active component of a gene therapy drug or a DNA vaccine.

Description

Highly bioactive plasmid DNA, preparation and storage thereof, vaccine, kit and application thereof TECHNICAL FIELD

[0001] The present application belongs to the field of biological medicine, and particularly relates to a highly bioactive plasmid DNA, preparation and storage thereof, vaccine, kit and application thereof. BACKGROUND

[0002] Plasmid DNA is a covalent closed-loop double-stranded DNA molecule derived from bacteria, can express corresponding proteins in target hosts through the carried open reading frame (ORF), is the basis of modern molecular biology, and is also the cornerstone of a series of nucleic acid vaccines and gene therapy. With the vigorous development of the medical field, the demand for medical-grade high biological activity is also increasing day by day. On the one hand, plasmids can encode antigen proteins, and can induce specific cellular and humoral immune responses after being transferred into the host body. DNA vaccines using plasmids as carriers are entering a rapid industrialization stage. On the other hand, as a carrier of genetic information, plasmid is a template for in vitro synthesis of mRNA and an important raw material for packaging processes of viral vectors such as AAV.

[0003] At present, the main purification scheme is alkali lysis + liquid chromatography. In the existing technology of plasmid purification, GE's three-column method and BIA's two-step method are the most commonly used plasmid purification schemes. However, in the actual operation process of GE's three-column method, the concentrated solution of plasmid lysis solution contains a large amount of RNA, which will precipitate in a high-concentration ammonium sulfate solution and be cemented in the molecular sieve, causing significant loss of column efficiency and potential contamination risk. Secondly, this method undergoes three-step liquid purification, and the recovery efficiency is lower than that of two-step liquid purification. Finally, the overall flow rate of this method is slow, which is limited by the volume of the sample loaded on the molecular sieve, also leading to limited processing capacity. Moreover, in the actual operation process of BIA's two-step method, there is still a small amount of host RNA contamination. In addition, this scheme uses traditional alkali lysis method for lysis and adds additional calcium chloride for pre-purification. The obtained product needs to be diluted to meet the sample loading conditions of liquid chromatography, which magnifies the total volume of the feed liquid by several times, requires more loading time, and produces more wastewater. Finally, high-concentration or solid-state ammonium sulfate needs to be used to adjust the sample between the two steps of liquid chromatography, which makes the connection between the two steps of liquid chromatography not smooth, and it is difficult to fully automate the whole process. The overall time cost and material cost are high, and the purity of the obtained plasmid DNA is low.

[0004] Therefore, it is necessary to provide a preparation method of highly bioactive plasmid DNA, so as to obtain medical-grade high-activity plasmid DNA at the lowest possible cost, which is crucial for the development of modern molecular biology.

[0005] SUMMARY

[0006] The technical problem solved by the present application is that the existing plasmid purification process has poor operation continuity, long processing time, low load, high time and material costs, and large loss of biological activity of the obtained plasmid DNA, and the biological activity decreases with the extension of the storage time.

[0007] In view of the above technical problems, the present application provides a high-biological-activity plasmid DNA, a preparation and storage method thereof, a vaccine, a kit and applications thereof.

[0008] The technical scheme of the present application is as follows:

[0009] In a first aspect, the present application provides a high-biological-activity plasmid DNA, characterized in that the expression amount of the protein encoded by the plasmid after intramuscular injection of the plasmid is used to measure the biological activity, and the expression amount of the protein encoded by the high-biological-activity plasmid after intramuscular injection is increased by 10 times or more compared with the plasmid extracted by a traditional method or a commercial kit.

[0010] Preferably, the high-biological-activity plasmid DNA is prepared by the following steps:

[0011] (A) Lysis of bacterial cells: adding an ammonium sulfate solution containing greater than or equal to 2.0 M to lyse bacterial cells containing DNA, and clarifying the obtained lysate to collect the supernatant, i.e., a crude material liquid containing plasmids, wherein the final concentration of ammonium sulfate in the crude material liquid is 2.0-3.2 M;

[0012] (B) Purification of plasmid DNA: subjecting the crude material liquid containing plasmids to hydrophobic chromatography by using a mobile phase containing 1.45 M-2.1 M ammonium sulfate, wherein the mobile phase is used in one or more than one;

[0013] (C) Further purification of plasmid DNA: diluting the hydrophobic chromatography product, and subjecting the diluted hydrophobic chromatography product to ion exchange chromatography by using a mobile phase containing a conductive solution with a concentration of less than or equal to 1 M, to obtain purified plasmid DNA, wherein the mobile phase is used in one or more than one; and

[0014] (D) Activation of plasmid DNA: precipitating the purified plasmid DNA by using a monohydric alcohol and / or a polyhydric alcohol to obtain plasmid DNA precipitate, so as to activate the purified plasmid DNA, i.e., to obtain high-biological-activity plasmid DNA.

[0015] In a second aspect, the present application provides a preparation method of high-biological-activity plasmid DNA, which comprises the following steps:

[0016] (A) lysing bacteria: adding a solution containing ammonium sulfate with a concentration of 2.0 M or more to lyse bacteria containing DNA, and clarifying the obtained lysate to collect supernatant, i.e., a crude solution containing plasmid, wherein the final concentration of ammonium sulfate in the crude solution is 2.0-3.2 M;

[0017] (B) purifying plasmid DNA: subjecting the crude solution containing plasmid to hydrophobic chromatography using a mobile phase containing 1.45 M-2.1 M ammonium sulfate with one or more kinds to obtain a hydrophobic chromatography product;

[0018] (C) further purifying plasmid DNA: diluting the hydrophobic chromatography product, and subjecting the diluted hydrophobic chromatography product to ion exchange chromatography using a mobile phase containing an electrically conductive solution with a concentration of 1 M or less with one or more kinds to obtain purified plasmid DNA; and

[0019] (D) activating plasmid DNA: precipitating the purified plasmid DNA by monohydric alcohol and / or polyhydric alcohol to obtain plasmid DNA precipitate, and activating the purified plasmid DNA, i.e., obtaining plasmid DNA with high biological activity.

[0020] Preferably, it comprises the following steps:

[0021] Step 1) scale-up culture: subjecting bacteria containing plasmid to scale-up culture of bacteria;

[0022] Step 2) lysing bacteria: adding a solution containing ammonium sulfate with a concentration of 2.0 M or more to lyse bacteria containing DNA; preferably, subjecting the bacteria after scale-up culture in Step 1 to solid-liquid separation, and resuspending the separated bacteria with a ratio of the wet weight of the separated bacteria to the volume of the first solution of 1 g:3-10 mL, followed by adding a second solution and a third solution to lyse bacteria containing DNA;

[0023] wherein the first solution is a solution containing ethylenediaminetetraacetic acid and / or tris-hydroxymethyl aminomethane hydrochloride;

[0024] the second solution is an alkaline solution containing a surfactant;

[0025] the third solution is a solution containing ammonium sulfate with a concentration of 2.0 M or more;

[0026] More preferably, the volume ratio of the first solution, the second solution and the third solution is 1:1:2-7, specifically, the bacterial body is mixed with the first solution to resuspend the bacterial body; after resuspension, the second solution is added to the bacterial body to crack the bacterial solution at room temperature according to the above ratio; after cracking, the third solution is added to the cracking product to neutralize the alkaline cracking product according to the above ratio, to obtain a cracking solution, and the cracking solution is clarified to collect the supernatant, i.e. a crude material solution containing plasmid, wherein the final concentration of ammonium sulfate in the crude material solution is 2.0-3.2M;

[0027] Step 3) Purification of plasmid DNA: loading the crude material solution containing plasmid on a hydrophobic chromatography column, and then performing hydrophobic chromatography by using a mobile phase containing one or more than one of 1.45M-2.1M ammonium sulfate, to obtain a hydrophobic chromatography product;

[0028] Step 4) Further purification of plasmid DNA: diluting the hydrophobic chromatography product, loading the diluted hydrophobic chromatography product on an ion exchange chromatography column, and then performing ion exchange chromatography by using a mobile phase containing one or more than one of less than or equal to 1M conductive solution, to obtain purified plasmid DNA;

[0029] Step 5) Activation of plasmid DNA: precipitating the purified plasmid DNA by using monohydric alcohol and / or polyhydric alcohol, and / or precipitating the plasmid DNA by using monohydric alcohol and / or polyhydric alcohol after freeze-drying or ultrafiltration concentration, to activate the purified plasmid DNA, to obtain high-biological-activity plasmid DNA;

[0030] Step 6): Storage of plasmid DNA: storing the high-biological-activity plasmid DNA in monohydric alcohol and / or polyhydric alcohol.

[0031] In a third aspect, the present application provides a storage method of high-biological-activity plasmid DNA, which comprises the following steps:

[0032] (A) Cracking of bacterial body: adding a solution containing more than or equal to 2.0M ammonium sulfate to crack the bacterial body containing DNA, and clarifying the obtained cracking solution to collect the supernatant, i.e. a crude material solution containing plasmid, wherein the final concentration of ammonium sulfate in the crude material solution is 2.0-3.2M;

[0033] (B) Purification of plasmid DNA: performing hydrophobic chromatography on the crude material solution containing plasmid by using a mobile phase containing one or more than one of 1.45M-2.1M ammonium sulfate, to obtain a hydrophobic chromatography product;

[0034] (C) further purifying the plasmid DNA: diluting the hydrophobic chromatography product, and subjecting the diluted hydrophobic chromatography product to ion exchange chromatography with a mobile phase containing a conductive solution of less than or equal to 1 M, and using one or more than one of the following:

[0035] (D) activating the plasmid DNA: precipitating the purified plasmid DNA with a monohydric alcohol and / or a polyhydric alcohol to obtain a plasmid DNA precipitate, and activating the purified plasmid DNA, i.e. obtaining a plasmid DNA with high biological activity; and

[0036] (E) storing the plasmid DNA: storing the plasmid DNA with high biological activity in a monohydric alcohol and / or a polyhydric alcohol.

[0037] Preferably, the storage method comprises the following steps:

[0038] Step 1) expanding culture: expanding culture of bacteria containing plasmids;

[0039] Step 2) lysing the bacteria: adding a solution containing ammonium sulfate of greater than or equal to 2.0 M to the bacteria after the expansion culture of step 1 to lyse the bacteria containing DNA; preferably, performing solid-liquid separation on the bacteria after the expansion culture of step 1, and resuspending the separated bacteria according to a ratio of the wet weight of the separated bacteria to the volume of the first solution of 1 g:3-10 mL, and then adding a second solution and a third solution to lyse the bacteria containing DNA;

[0040] wherein the first solution is a solution containing ethylenediaminetetraacetic acid and / or tris-hydroxymethyl aminomethane hydrochloride;

[0041] the second solution is an alkaline solution containing a surfactant;

[0042] the third solution is a solution containing ammonium sulfate of greater than or equal to 2.0 M;

[0043] wherein, more preferably, the volume ratio of the first solution, the second solution and the third solution is 1:1:2-7, and specifically, the bacteria is mixed with the first solution to resuspend the bacteria; after resuspension, the second solution is added to the bacteria at the above ratio to lyse the bacteria solution at room temperature; after lysis, the third solution is added to the lysis product at the above ratio to neutralize the alkaline lysis product to obtain a lysis solution, and the lysis solution is clarified to collect the supernatant, i.e. a crude material solution containing plasmids, wherein the final concentration of ammonium sulfate in the crude material solution is 2.0-3.2 M;

[0044] Step 3) Purification of plasmid DNA: the crude solution containing plasmid is loaded on a hydrophobic chromatography column, followed by hydrophobic chromatography using a mobile phase containing 1.45M-2.1M ammonium sulfate, with one or more than one;

[0045] Step 4) Further purification of plasmid DNA: the hydrophobic chromatography product is diluted, and the diluted hydrophobic chromatography product is loaded on an ion exchange chromatography column, followed by ion exchange chromatography using a mobile phase containing a conductive solution of less than or equal to 1M, with one or more than one;

[0046] Step 5) Activation of plasmid DNA: the purified plasmid DNA is precipitated by a monohydric alcohol and / or a polyhydric alcohol, and / or the plasmid DNA is concentrated by freeze-drying or ultrafiltration and then precipitated by a monohydric or polyhydric alcohol, to activate the purified plasmid DNA, to obtain high-biological-activity plasmid DNA; and

[0047] Step 6): Storage of plasmid DNA: the high-biological-activity plasmid DNA is stored in a monohydric alcohol and / or a polyhydric alcohol.

[0048] And / or preferably, the monohydric alcohol is ethanol or isopropyl alcohol; the polyhydric alcohol is polyethylene glycol.

[0049] And / or preferably, the storage temperature is -18 to -24°C.

[0050] And / or preferably, the third solution is an ammonium sulfate solution containing 2.1-4.0M, preferably, the third solution is an ammonium sulfate solution containing 4.0M.

[0051] And / or preferably, in step 3), specifically comprising:

[0052] (1) Column equilibration: equilibrating the hydrophobic chromatography column with the first mobile phase for 2 or more column volumes, preferably 3 column volumes;

[0053] (2) Loading: loading the crude solution containing plasmid through the hydrophobic chromatography column;

[0054] (3) Elution: eluting the hydrophobic chromatography column with the second mobile phase until the indicators are stable;

[0055] (4) Elution: eluting with the third mobile phase, and collecting the elution product to obtain the hydrophobic chromatography product.

[0056] And / or preferably, the first mobile phase is a mixture containing 2.0-2.1M ammonium sulfate, more preferably, a mixture containing 2.1M ammonium sulfate;

[0057] and / or preferably the second mobile phase is a mixture containing 1.90-2.05 M ammonium sulfate, more preferably a mixture containing 1.95-2.00 M ammonium sulfate;

[0058] and / or preferably the third mobile phase is a mixture containing 1.45 M-1.8 M ammonium sulfate, more preferably a mixture containing 1.50-1.8 M ammonium sulfate.

[0059] and / or preferably, in step 4, specifically comprises:

[0060] (1) Column equilibration: equilibrate the ion exchange chromatography column(s) 2 or more, preferably 3 column volumes with the fourth mobile phase;

[0061] (2) Sample loading: mix the hydrophobic chromatography product with the fourth mobile phase at a volume ratio of 1:1-3 to dilute the hydrophobic chromatography product, and then pass the diluted hydrophobic chromatography product through the ion exchange chromatography column;

[0062] (3) Elution: elute the ion exchange chromatography column with the fifth mobile phase until the indicators are stable;

[0063] (4) Elution: elute with the sixth mobile phase and collect the eluted product to obtain the purified plasmid DNA

[0064] wherein the ion exchange chromatography column is an anion exchange chromatography column, preferably a strong anion exchange chromatography column.

[0065] and / or preferably, the conductivity of the diluted hydrophobic chromatography product is less than or equal to 100 mS / cm.

[0066] and / or preferably, the fourth mobile phase is a low conductivity solution of less than or equal to 40 mS / cm, more preferably a mixture of water and / or containing 0-50 mM ethylenediaminetetraacetic acid;

[0067] and / or preferably, the fifth mobile phase is a medium conductivity solution of greater than or equal to 40 mS / cm and less than or equal to 60 mS / cm, more preferably a mixture containing 0.4-0.50 M sodium chloride;

[0068] and / or preferably, the sixth mobile phase is a high conductivity solution of greater than or equal to 60 mS / cm, more preferably a mixture containing 0.5 M-1 M sodium chloride.

[0069] In a fourth aspect, the present application provides a vaccine obtained by using the high-biological-activity plasmid DNA or the high-biological-activity plasmid DNA obtained by the preparation method.

[0070] Preferably, the vaccine is an injection form vaccine, more preferably, the injection form vaccine is obtained by mixing the high biological activity plasmid DNA or the high biological activity plasmid DNA prepared by using the preparation method with a buffer.

[0071] In a fifth aspect, the application provides a kit comprising the high biological activity plasmid DNA or the reagent or vaccine prepared from the high biological activity plasmid DNA prepared by using the preparation method.

[0072] Preferably, the high biological activity plasmid DNA or the high biological activity plasmid DNA prepared by using the preparation method is used in vaccine preparation or gene therapy.

[0073] The beneficial effects of the application include:

[0074] (1) The alkali lysis method of the application is improved over the traditional alkali lysis method. The crude material liquid obtained by the alkali lysis method of the application contains fewer impurities, and does not need to be concentrated, supplemented and replaced, but can be directly connected to liquid chromatography for plasmid purification. The continuity of the purification process is better, and the efficiency of the purification is higher. The RNA concentration in the improved alkali lysis product is low, so that the liquid phase filler in unit volume has a higher load, and the filler is not cemented due to the precipitation of RNA, which is beneficial to equipment maintenance.

[0075] (2) According to the plasmid purification steps of hydrophobic chromatography and ion exchange chromatography of the application, by adding solutions of appropriate concentrations of ammonium sulfate and appropriate concentrations of sodium chloride, respectively, the larger molecular weight RNA and the smaller molecular weight RNA are effectively removed, so that the final obtained plasmid DNA does not contain host RNA and other impurities.

[0076] (3) The purified plasmid DNA is activated by precipitation method (preferably by monohydric alcohol and / or polyhydric alcohol precipitation), or the purified plasmid can be concentrated by ultrafiltration or freeze-drying and then activated by monohydric alcohol or polyhydric alcohol, so that the plasmid DNA has high biological activity and is resistant to long-term storage.

[0077] (4) The yield of the plasmid DNA purification method (two-column liquid chromatography) of the application is better than that of the traditional plasmid DNA purification method (three-column liquid chromatography), the material consumption is smaller, and the overall time is shorter on the basis of saving the ultrafiltration equipment.

[0078] (5) The storage method of the present application is to store the high-biological-activity plasmid DNA obtained by the preparation method of high-biological-activity plasmid DNA in a mono-alcohol or a poly-alcohol at a temperature of -18°C to -24°C. The storage method can keep the biological activity of the plasmid DNA for a long time without significant decrease in the efficiency of in vivo transfection and stability.

[0079] (6) The vaccine of the present application is obtained by the high-biological-activity plasmid DNA obtained by the preparation method of high-biological-activity plasmid DNA. Preferably, the vaccine is an injection type vaccine, which can induce high-titer antibody production and high-level cellular immunity, etc. BRIEF DESCRIPTION OF DRAWINGS

[0080] Fig. 1 is a hydrophobic chromatogram and an agarose gel electrophoresis detection result of pre-experiment 1 of the present application.

[0081] Fig. 2 is an ion exchange chromatogram and an agarose gel electrophoresis detection result of pre-experiment 2 of the present application.

[0082] Fig. 3 is a comparison photograph of bacterial lysate treated by traditional alkaline lysis method and improved alkaline lysis method of the present application and a comparison electrophoretogram of RNA removal.

[0083] Fig. 4 is a 100 ms low-exposure agarose gel electrophoretogram and a 1000 ms high-exposure agarose gel electrophoretogram of examples 1-8 and comparative examples 1-8 of the present application.

[0084] Fig. 5 is a comparison result graph of plasmid DNA obtained by the preparation method of high-biological-activity plasmid DNA of the present application and plasmid DNA obtained by using a commercial kit in application example 1 of the present application.

[0085] Fig. 6 is a comparison result graph of in vivo transfection efficiency and expression stability of plasmid DNA activated by different precipitation methods in application example 2 of the present application.

[0086] Fig. 7 is a comparison result graph of in vivo transfection efficiency and expression stability of plasmid DNA stored by different storage methods in application example 2 of the present application.

[0087] Fig. 8 is a comparison result graph of the preparation method of traditional plasmid DNA and the preparation method of high-biological-activity plasmid DNA in application example 3 of the present application.

[0088] Fig. 9 is an experimental process and a result graph of mouse DNA vaccine immunization using high-biological-activity plasmid DNA obtained by the preparation method of high-biological-activity plasmid DNA in application example 4 of the present application. DETAILED DESCRIPTION

[0089] The technical solutions of the present application will be further described in detail below in combination with specific embodiments and drawings, but the present application is not limited to the following technical solutions.

[0090] Specifically, the present application comprises the following contents:

[0091] I. Lysis of bacterial cells

[0092] The E. coli containing the plasmid is inoculated into LB medium for bacterial cell expansion culture.

[0093] The bacterial cells after expansion culture are subjected to solid-liquid separation by using a hollow fiber column or centrifugation, and the bacterial cells are collected. The wet weight of the separated bacterial cells is measured, and 1:3-10 of the first solution is added to resuspend the separated bacterial cells, followed by the addition of the second solution and the third solution.

[0094] The first solution is a solution containing ethylenediaminetetraacetic acid and / or tris-hydroxymethyl aminomethane hydrochloride; the first solution is preferably 10 mM ethylenediaminetetraacetic acid + 50 mM tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0.

[0095] The second solution is an alkaline solution containing a surfactant; the second solution is preferably 200 mM sodium hydroxide + 1% by weight of sodium dodecyl sulfonate.

[0096] The third solution is an ammonium sulfate solution containing greater than or equal to 2.0 M, preferably the third solution is an ammonium sulfate solution containing 2.1-4.0 M, more preferably the third solution is an ammonium sulfate solution containing 4.0 M.

[0097] The volume ratio of the first solution, the second solution and the third solution is 1:1:2-7, specifically the bacterial cells are mixed with the first solution to resuspend the bacterial cells; after resuspension, the second solution is added to the bacterial cells according to the above ratio to lyse the bacterial solution at room temperature; after lysis, the third solution is added to the lysis product according to the above ratio to neutralize the alkaline lysis product, and the lysis solution is obtained by standing, which is clarified to collect the supernatant, i.e. the crude material solution containing the plasmid. The final concentration of ammonium sulfate in the crude material solution containing the plasmid is 2.0-3.2 M, and the pH is less than 9, which is used to avoid the problems of denatured plasmid or poor RNA removal effect caused by excessive lysis, resulting in product contamination or yield reduction.

[0098] It should be noted that the collection method includes but is not limited to the conventional method of those skilled in the art such as hollow fiber column filtration or centrifugation. The clarification method includes but is not limited to the conventional method of those skilled in the art such as centrifugation or tangential flow filtration.

[0099] In the case of collecting the activated bacterial cells by using a hollow fiber column, it is preferable to use a filter membrane with a pore size of 1 μm or 0.22 μm for filtration.

[0100] The centrifugal parameter for centrifuging the bacterial cells after the expansion culture is 6000-12000 g for 5-30 min.

[0101] The centrifugal parameter for centrifuging the lysis solution is 6000-12000 g for 5-30 min.

[0102] After centrifuging the lysis solution, filtration is further included, preferably using a filter membrane with a pore size of 0.44 μm.

[0103] In the case of clarifying the neutralized lysis solution by tangential flow filtration, it is preferable to use one or a combination of both of a filter membrane with a pore size of 5 μm and a filter membrane with a pore size of 0.22 μm.

[0104] It should be noted that the third solution is an acidic solution containing ammonium sulfate with a concentration of 2.0 M or more, and the addition of other auxiliary components, such as metal chelating agents, acid-base buffers, etc., to the third solution for improving performance without changing the concentration of ammonium sulfate in the third solution is within the scope of the third solution of the present application.

[0105] II. Purification of Plasmid DNA

[0106] (1) The crude solution is loaded on a hydrophobic chromatography column to obtain a hydrophobic chromatography product by a hydrophobic chromatography process. The hydrophobic chromatography column includes a packed column or a monolithic column containing a hydrophobic chromatography medium, and preferably a packed column or a monolithic column of particulate hydrophobic chromatography medium modified with mercapto pyridine. The hydrophobic chromatography column can be of any kind, and its column specifications and volume can also be arbitrary.

[0107] The hydrophobic chromatography process includes: 1. Column equilibration: equilibrating the hydrophobic chromatography column with the first mobile phase for 2 or more column volumes, preferably 3 column volumes, at a linear flow rate of 2 cm / min or more; 2. Loading: passing the crude solution containing the plasmid through the hydrophobic chromatography column at a linear flow rate of 2 cm / min or more; 3. Elution: eluting the column with the second mobile phase for 2 or more column volumes, preferably 3 column volumes, until the indicators are stable, at a linear flow rate of 2 cm / min or more; and 4. Elution: eluting the column with the third mobile phase and collecting the elution product to obtain the hydrophobic chromatography product.

[0108] The first mobile phase is a mixture containing 2.0-2.1 M ammonium sulfate, with a pH of 5.0-8.5, and preferably a mixture containing 2.1 M ammonium sulfate, with a pH of 7.5.

[0109] The second mobile phase is a mixture containing 1.90-2.05 M ammonium sulfate, pH = 5.0-8.5, preferably a mixture containing 1.95-2.00 M ammonium sulfate, pH = 7.5;

[0110] The third mobile phase is a mixture containing 1.45 M-1.8 M ammonium sulfate, pH = 5.0-8.5, preferably a mixture containing 1.50-1.8 M ammonium sulfate, pH = 7.5.

[0111] (2) mixing the hydrophobic chromatography product with the fourth mobile phase to dilute the hydrophobic chromatography product so that the conductivity of the hydrophobic chromatography product is less than or equal to 100 mS / cm, and then loading the hydrophobic chromatography product on an anion exchange chromatography column to purify according to an ion exchange chromatography process to obtain purified plasmid DNA. The anion exchange chromatography column comprises a packed column or a monolithic column containing anion exchange medium, preferably a packed column or a monolithic column of quaternary ammonium-modified strong anion exchange medium. The anion exchange chromatography column can be of any kind, and the column specifications and volume can also be arbitrary.

[0112] The ion exchange chromatography process: 1. Column equilibration: equilibrate the strong anion exchange chromatography column with the fourth mobile phase for 2 or more, preferably 3 column volumes at a linear flow rate of 2 cm / min or more; 2. Sample loading: mix the hydrophobic chromatography product with the fourth mobile phase at a volume ratio of 1:1 or more, preferably 1:1-3, so that the conductivity of the mixed solution is less than or equal to 100 mS / cm to dilute the hydrophobic chromatography product, and then pass the diluted product through the strong anion exchange chromatography column at a linear flow rate of 2 cm / min or more; 3. Elution: elute using the fifth mobile phase for 2 or more, preferably 3 column volumes until the indicators are stable, at a linear flow rate of 2 cm / min or more; 4. Elution: elute using the sixth mobile phase, and collect the eluted product to obtain purified plasmid DNA.

[0113] The fourth mobile phase is a low-conductivity solution with a conductivity of less than or equal to 40 mS / cm, pH = 5.0-8.5; preferably water or TE buffer (0-50 mM ethylenediaminetetraacetic acid + 100 mM tris-hydroxymethyl aminomethane hydrochloride, pH = 7.5);

[0114] The fifth mobile phase is a medium-conductivity solution with a conductivity of greater than or equal to 40 mS / cm and less than or equal to 60 mS / cm, pH = 5.0-8.5. Preferably, it is a mixture containing 0.4-0.50 M sodium chloride, pH = 7.5;

[0115] The sixth mobile phase is a high-conductivity solution with conductivity greater than or equal to 60 mS / cm and pH = 5.0-8.5. Preferably, it is a mixture containing 0.5 M-1 M sodium chloride, and pH = 7.5.

[0116] III. Concentration, activation and storage of plasmid DNA

[0117] The purified plasmid DNA can be precipitated by one of isopropanol precipitation, ethanol precipitation or polyethylene glycol precipitation to obtain a plasmid DNA precipitate, which is used to activate the purified plasmid DNA to obtain high-biological-activity plasmid DNA. Alternatively, the purified plasmid can be concentrated by ultrafiltration or lyophilization and then activated by a monohydric alcohol or a polyhydric alcohol. The high-biological-activity plasmid DNA activated by the monohydric alcohol or the polyhydric alcohol is stored in isopropanol, ethanol or polyethylene glycol at a storage temperature of -18 to -24℃.

[0118] In the isopropanol precipitation, the purified plasmid DNA is mixed with 3 M sodium acetate (pH = 5.5) and isopropanol at a volume ratio of 1:0.1 or more:0.5 or more, centrifuged at 12000 g for 10 min, rinsed twice with 75% by volume ethanol and air-dried.

[0119] In the ethanol precipitation, the purified plasmid DNA is mixed with 3 M sodium acetate (pH = 5.5) and ethanol at a volume ratio of 1:0.1 or more:1.5 or more, centrifuged at 12000 g for 10 min, rinsed twice with 75% by volume ethanol and air-dried.

[0120] In the polyethylene glycol precipitation, the final concentration of sodium chloride is 500 mM and the final concentration of polyethylene glycol is 10% by weight, and after centrifugation at 12000 g for 10 min, the precipitate is rinsed twice with 75% by volume ethanol.

[0121] Specifically, under the same dosage conditions, the purified plasmid DNA obtained by the preparation method provided by the present application, i.e., the high-biological-activity plasmid DNA, has a higher number of transfected cells and a higher total protein expression amount in vivo than the purified plasmid DNA obtained by the preparation method of the prior art.

[0122] In order to better understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in combination with specific examples.

[0123] The various reagents / instruments used in the examples and comparative examples of the present application are all conventional commercially available products, unless otherwise specified. The experimental materials and instrument information used in the present application are shown in Table 1:

[0124] Table 1 Reagents and instruments used in examples and comparative examples

[0125] Bioluminescence imaging to detect the biological activity of plasmid DNA: Dissolve plasmid DNA in PBS buffer (final concentration 1 mg / mL), and inject it into the tibialis anterior muscle of mice, three days later inject luciferin substrate (150 mg / kg body weight) into the abdominal cavity of mice, and detect it using a luciferase in vivo imaging instrument.

[0126] Qubit to detect the concentration of plasmid DNA: According to the Qubit fluorometer kit instructions, use Qubit4 instrument to detect the concentration of plasmid DNA.

[0127] Nanodrop to detect the ultraviolet absorption of plasmid DNA: Take 1 microliter of sample and place it on the sample stage, and read the ultraviolet absorption ratio A280 / A260.

[0128] qPCR to detect host DNA residues: Extract the genome of E. coli DH5a as a standard. Use the following primers 1: ACACGGTCCAGAACTCCTACG (Sequence No. 1) and primer 2: CCGGTGCTTCTTCTGCGGGTAACGTCA (Sequence No. 2) for fluorescence quantitative amplification test. Calculate the amount of host DNA residues in the purified plasmid sample, and the PCR reaction conditions are: 95℃ 5min, (95℃ 10s, 60℃ 20s, 72℃ 20s) 40x, 60℃ 5s.

[0129] BCA to detect protein residues: According to the BCA kit instructions, take 10 microliters of sample to detect the protein residues therein, and convert the units.

[0130] Recombinant C factor method to detect endotoxin residues: According to the recombinant C factor endotoxin detection kit instructions, determine the endotoxin residues in the purified plasmid sample.

[0131] The construction method of plasmid pVAX-luci-tdT in the pre-experiment, examples and comparative examples is as follows:

[0132] The plasmid backbone pVAX was from Invitrogen, luciferase and tdTomato were amplified by primer pairs. The primer pairs for luciferase were Luci-F: CCGTCAGACTCGAGGCCACCATGGAAGACGCCAAAAACAT (Sequence No. 3), Luci-R: CCTCGACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCCACGGCGATCTTTCCGCCCT (Sequence No. 4); the primer pairs for tdTomato were tdT-F: TAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAATGGTGAGCAAGGGCGAGGAG (Sequence No. 5), tdT-R: GGCTGATCAGCGGGTTTAAACTTACTTGTACAGCTCGTCCATGCC (Sequence No. 6). The PCR products were detected by agarose gel electrophoresis and recovered by gel recovery kit. The vector backbone was digested by restriction enzymes Xhol and Pmel, the digested products were detected by agarose gel electrophoresis to ensure complete digestion, and the corresponding fragments were recovered by gel recovery kit. The plasmid construction was completed by using seamless cloning kit (Novagen, C116), specifically, the digested vector and two fragments were mixed at a ratio of 40 ng, 20 ng, 20 ng, and 2x premix components in C116 kit were added, and incubated at 50 degrees Celsius for 5 minutes. The product was transformed into E. coli DH5a and plated for overnight culture. The next day, single colonies were picked for PCR identification and sequencing. Single colonies with correct sequences and high plasmid yields were selected for preservation. The single colonies were preserved with glycerol, specifically, the bacterial liquid grown to the logarithmic growth phase (OD600 = 0.6-1.2) was mixed with 40% (w / v) sterile glycerol at an equal ratio, and stored at -80 degrees Celsius in a ultra-low temperature freezer.

[0133] The construction method of plasmid pB-CAG-iCre-ERT2 in the application example is as follows:

[0134] The plasmid backbone pB-CAG-iCre-ERT2 was purchased from addgene, number 137858, and the LRRK2 gene was cloned from mouse cDNA library using the following primers: LRRK-F: AGGGCGCGGCAGCCGCTTCAGCTAGTGGCAGCTGTCAGGG (Sequence No. 7), LRRK-R: CAGGGAGAAGTTAGTGGCCTCAACAGATGTTCGTCTCAT (Sequence No. 8). The amplified products were detected by agarose gel electrophoresis and recovered using a gel recovery kit for standby. The vector backbone was digested with restriction enzymes Xhol and BamHI, and the digested products were detected by agarose gel electrophoresis to ensure complete digestion and recovered using a gel recovery kit for standby. The plasmid construction was completed using a seamless cloning kit (Invitrogen, C116). Specifically, the digested vector and amplified product were mixed at a ratio of 40 ng to 20 ng, and 2x premix components in the C116 kit were added, and incubated at 50 degrees Celsius for 5 minutes. The product was transformed into E. coli DH5a and plated for overnight culture. The next day, single colonies were picked for PCR identification and sequencing. Single colonies with correct sequences and high plasmid yields were selected for preservation. The single colonies were preserved using glycerol. Specifically, bacterial liquid grown to the logarithmic growth phase (OD600 = 0.6-1.2) was mixed with 40% (w / v) sterile glycerol at an equal ratio, and stored in a -80 degrees Celsius ultra-low temperature freezer.

[0135] The construction method of the plasmid pAAV-DIO-CAG-EYFP in the application example is as follows:

[0136] The plasmid backbone pAAV-DIO-CAG-EYFP was purchased from addgene, number 104052. The red fluorescent protein mScarlet was amplified using the primer pair: ms-f: GGCGCGCCTTACTTGTACAGCTCGTCCATGCCG (Sequence No. 9), ms-r: GCTAGCGCCATGGTGAGCAAGGGCGAGGCAGTG (Sequence No. 10). The amplified product was verified by agarose gel electrophoresis and recovered using a gel recovery kit. The recovered amplified product and the vector backbone were double-digested using the restriction enzymes AscI and NheI, and the digested product was recovered using a gel recovery kit. The plasmid construction was completed using T4 ligase, specifically, the digested vector and fragment were mixed at 80 ng, 50 ng with T4 ligase and its buffer, and ligated at 16°C overnight. The ligation product was transformed into E. coli DH5a and plated for overnight culture. The next day, single colonies were picked for PCR identification and sequencing. Single colonies with correct sequences and high plasmid yields were selected for preservation. The single colonies were preserved using glycerol, specifically, the bacteria solution (OD600 = 0.6-1.2) grown to the logarithmic growth phase was mixed with 40% (w / v) sterile glycerol at an equal ratio, and stored at -80 degrees Celsius in a ultra-low temperature freezer.

[0137] The construction method of the plasmid pAAV-luci-cre in the application example is as follows:

[0138] The plasmid backbone pVAX is from Invitrogen, luciferase and tdTomato are amplified by primer pairs. The primer pairs for luciferase are Luci-F: TTGTTTAGTGAACCGTCAGACTCGAGGCCACCATGGAAGACGCCAAAAACAT (Sequence No. 11), Luci-R: GACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCCACGGCGATCTTTCCGCCCTTCT (Sequence No. 12); the primer pairs for tdTomato are Cre-F: TGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAATGTCCAATTTACTGACCGTACAC (Sequence No. 13), Cre-R: GGCTGATCAGCGGGTTTAAACTTAATCGCCATCTTCCAGCAGGCG (Sequence No. 14). The PCR products are detected by agarose gel electrophoresis and recovered by gel recovery kit. The vector backbone is digested by restriction enzymes Xhol and Pmel, the digested products are detected by agarose gel electrophoresis to ensure complete digestion, and the corresponding fragments are recovered by gel recovery kit. The plasmid construction is completed by using seamless cloning kit (Novagen, C116), specifically, the digested vector and two fragments are mixed at a ratio of 40 ng, 20 ng, 20 ng, and 2x premix component in C116 kit is added, incubated at 50 degrees Celsius for 5 minutes. The product is transformed into E. coli DH5a, and plated for overnight culture. The next day, single colonies are picked for PCR identification and sequencing. Single colonies with correct sequences and high plasmid yield are selected for preservation. The single colonies are preserved by glycerol, specifically, the bacterial liquid grown to logarithmic growth phase (OD600 = 0.6-1.2) is mixed with 40% (w / v) sterile glycerol at equal ratio, and stored at -80 degrees Celsius in ultra-low temperature freezer.

[0139] The construction method of plasmid pVax-S in the application example is as follows:

[0140] The plasmid backbone pVax-S is from Invitrogen, double digested with XhoI and PmeI, the digested product is detected by agarose gel electrophoresis to ensure complete digestion, and the corresponding fragment is recovered using a gel recovery kit for standby. The spike protein sequence of the novel coronavirus COVID-19 is from NCBI, with gene number 43740568. The gene is codon-optimized and fully synthesized for mice by Nanjing Kingsriver Biotechnology Co., Ltd. The synthesized DNA fragment is amplified using the following primers: Spike-F: GGCGGCCGCTCGAGGCCACCATGGATTGGACTTGGATCCTCTTCCTGGTTGCCGCTGCCACTAGAGTGCACAGCGTCAACCTTACTACTAGAAC (Sequence No. 15), Spike-R: CAGTCGAGGCTGATCAGCGGGTTTAAACTTACTTATCGTCGTCATCCTTGTAATCTCTAGATGTGTAATGCAGCTTGACGCCC (Sequence No. 16), the amplified product is verified by agarose gel electrophoresis, and the gel recovery kit is recovered. Specifically, 40 ng of the digested vector and 20 ng of the amplified product are mixed, and 2x premix components in the C116 kit are added, and incubated at 50°C for 5 minutes. The product is transformed into E. coli DH5a, and plated overnight culture. The next day, single colonies are picked for PCR identification and sequencing. Single colonies with correct sequences and high plasmid yields are selected for preservation. The single colonies are preserved with glycerol, specifically, the bacterial solution (OD600 = 0.6-1.2) grown to the logarithmic growth phase is mixed with 40% (w / v) sterile glycerol at the same proportion, and stored at -80°C in a ultra-low temperature freezer.

[0141] wherein 40% (w / v) sterile glycerol is prepared: 40 mL of analytical pure glycerol is mixed with 60 mL of ultrapure water, and autoclaved at 121°C for 30 min.

[0142] Pre-experiment 1: Screening of hydrophobic chromatography conditions

[0143] (1) The E. coli containing pVAX-luci-tdT plasmid was inoculated into 6L LB medium at a ratio of 1:1000 for bacterial expansion culture, and the bacterial expansion culture parameters were 37°C, 220 rpm for 16h. The bacterial body after expansion culture was collected by centrifugation, and the centrifugation parameters were: 8000g, 4°C for 10 min, and 36g of wet bacterial body was obtained.

[0144] (2) 36 g of the bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, and after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecyl sulfate) was added to lyse the bacterial solution, and the lysis was performed at room temperature for 3 min, and then 270 mL of a third solution (4 M of ammonium sulfate solution, pH = 5.5) was added, and after thorough mixing, the lysis solution was allowed to stand to obtain a lysate, and the lysate was centrifuged at 10,000 g at 4°C for 30 min to collect the supernatant, which was a crude material solution containing plasmids.

[0145] (3) The crude material solution containing plasmids was loaded on a hydrophobic chromatography column, and a gradiently increased ammonium sulfate solution was used for elution, and the eluate was collected and detected by 1 wt% agarose gel electrophoresis to determine the optimal elution and elution conditions. The hydrophobic chromatography process was as follows: 1. Column equilibration: the column was equilibrated with solution A for 2 column volumes at a flow rate of 10 mL / min; 2. Sample loading: the crude material solution containing plasmids was loaded on the hydrophobic chromatography column at a flow rate of 10 mL / min; 3. Gradient elution: elution was performed using an elution solution including solution A and solution B, solution A was pumped by pump A and solution B was pumped by pump B, and the volume fraction of solution A was gradually reduced and the volume fraction of solution B was gradually increased from 100 vol% of solution A until 100 vol% of solution B was reached. The elution products of the elution solutions with different volume fractions of solution A and different volume fractions of solution B were collected and detected by 1 wt% agarose gel electrophoresis. The electrophoresis gel was exposed for a short time and a long time, respectively, to confirm that all trace components were observed. The hydrophobic chromatography column used was a 26 mm x 10 mm column with a column bed volume of 50 mL and a packing of thiol pyridine. The detection results are shown in (A) of FIG. 1 and (B) of FIG. 1.

[0146] Solution A was 2.1 M ammonium sulfate + 10 mM ethylenediaminetetraacetic acid + 100 mM tris-hydroxymethyl aminomethane hydrochloride, pH = 7.5;

[0147] Solution B was 10 mM ethylenediaminetetraacetic acid + 100 mM tris-hydroxymethyl aminomethane hydrochloride, pH = 7.5.

[0148] As shown in (A) of FIG. 1 and (B) of FIG. 1, (A) of FIG. 1 is a water chromatogram of the elution product of the eluate of solution A with different volume ratios and solution B with different volume ratios collected in the pre-experiment 1 of the present application. (B) of FIG. 1 is a result map of detecting the composition of the elution product by 1% agarose gel electrophoresis. The results show that sample section 7 is the main supercoiled plasmid, and the corresponding eluate is 76% solution A + 24% solution B. Higher volume ratio of solution A (volume ratio > 90%) can remove open circular plasmid (sample section 5), and lower concentration of solution A (volume ratio < 75%) can elute RNA (sample section 9). It can be seen that suitable elution and elution conditions are the key to ensure stable separation of hydrophobic chromatography.

[0149] Therefore, based on pre-experiment 1, the present application selects the following elution and elution conditions for hydrophobic chromatography:

[0150] Elution condition: use 95% solution A + 5% solution B to elute the chromatographic column until the indicators are stable, and the flow rate is 10 mL / min;

[0151] Elution condition: use 76% solution A + 24% solution B for elution, and the flow rate is 10 mL / min.

[0152] Pre-experiment 2: ion exchange chromatography condition screening

[0153] (1) The E. coli containing pVAX-luci-tdT plasmid was inoculated in 6L LB medium at a ratio of 1:1000 for bacterial expansion culture, and the bacterial expansion culture parameters were 37°C, 220rpm for 16h. The bacteria after expansion culture were collected by centrifugation, and the centrifugation parameters were 8000g, 4°C for 10min, and 36g of wet weight of bacteria was obtained.

[0154] (2) 36g of bacteria was mixed with 120mL of first solution (10mM of ethylenediaminetetraacetic acid + 50mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacteria, and 120mL of second solution (200mM of sodium hydroxide + 1% by weight of sodium dodecyl sulfonate) was added to lyse the bacteria, and the bacteria were lysed at room temperature for 3min, then 270mL of third solution (4M of ammonium sulfate solution, pH = 5.5) was added, and after mixing well, the lysate was obtained by standing, and the lysate was centrifuged at 10000g, 4°C for 30min to collect the supernatant, which was the crude material liquid containing plasmid.

[0155] (3) the crude liquid containing plasmid is loaded on a hydrophobic chromatography column to obtain a hydrophobic chromatography product through a hydrophobic chromatography process, the hydrophobic chromatography process: 1. Column equilibration, the chromatography column is equilibrated with solution A for 2 column volumes at a flow rate of 10 mL / min; 2. Sample loading: the crude liquid containing plasmid is loaded on the hydrophobic chromatography column at a flow rate of 10 mL / min; 3. Elution: the chromatography column is eluted with 95% by volume of solution A + 5% by volume of solution B at a flow rate of 10 mL / min until the indicators are stable; 4. Elution: elution is performed with 76% by volume of solution A + 24% by volume of solution B at a flow rate of 10 mL / min to obtain the hydrophobic chromatography product. The hydrophobic chromatography column has a size of 26 mm x 10 mm, a column bed volume of 50 mL, and a filler of a chromatography column of mercapto pyridine.

[0156] (4) the hydrophobic chromatography product is diluted with water at a ratio of 1:1 and loaded on a strong anion exchange chromatography column, elution is performed using a gradiently increased sodium chloride solution, and the eluate is collected and subjected to 1% by weight agarose gel electrophoresis to detect the components to determine the optimal elution and elution conditions. Ion exchange chromatography process: 1. Column equilibration: equilibration is performed with solution B for 2 column volumes at a flow rate of 10 mL / min; 2. Sample loading: the hydrophobic chromatography product is mixed with solution B at a volume ratio of 1:1 and passed through the strong anion exchange chromatography column at a flow rate of 10 mL / min; 3. Elution: elution is performed using an elution solution, the elution solution includes solution C and solution B, solution C is pumped by pump A and solution B is pumped by pump B, starting from 0% by volume of solution C + 100% by volume of solution B, increasing 10% by volume of solution C every 2 column volumes (10 mL) until 100% by volume of solution C + 0% by volume of solution B. The elution products of the elution solutions with different volume ratios of solution C and solution B are collected and subjected to 1% by weight agarose gel electrophoresis for detection. The strong anion exchange chromatography column has a size of 16 mm x 10 mm, a column bed volume of 20 mL, and a filler of a chromatography column of quaternary ammonium ligand. The detection results are shown in (A) of FIG. 2 and (B) of FIG. 2.

[0157] Solution A is 2.1 M ammonium sulfate + 10 mM ethylenediaminetetraacetic acid + 100 mM tris-hydroxymethyl aminomethane hydrochloride, pH = 7.5;

[0158] Solution B is 10 mM ethylenediaminetetraacetic acid + 100 mM tris-hydroxymethyl aminomethane hydrochloride, pH = 7.5;

[0159] Solution C is 1 M sodium chloride + 10 mM ethylenediaminetetraacetic acid + 100 mM tris-hydroxymethyl aminomethane hydrochloride, pH = 7.5.

[0160] As shown in (A) of FIG. 2 and (B) of FIG. 2, (A) of FIG. 2 is an ion exchange liquid chromatogram of the elution product of the eluate of solution C with different volume ratios and solution B with different volume ratios collected in Pre-experiment 2 of the application. (B) of FIG. 2 is a result diagram of detecting the composition of the elution product by 1% agarose gel electrophoresis in Pre-experiment 2 of the application. The results show that the RNA remaining in the hydrophobic chromatography (sample segment 5) will be eluted before the supercoiled plasmid (sample segment 7), and the corresponding eluate of sample segment 7 is: using 90% solution C + 10% solution B, the difference in elution conditions between RNA and supercoiled plasmid is small, but stable, and after multiple similar experiments, using 40%-50% solution C for elution can completely remove RNA, retain DNA, and elute DNA under conditions of higher concentration (>0.5M NaCl).

[0161] Therefore, based on Pre-experiment 2, the application selects the following elution and elution conditions for ion exchange chromatography:

[0162] Elution condition: using 40% solution C + 60% solution B to elute 3 column volumes to stabilize each index;

[0163] Elution condition: using 90% solution C + 10% solution B to elute at a flow rate of 10 mL / min.

[0164] Example 1

[0165] Cracking bacteria:

[0166] (1) The E. coli containing pVAX-luci-tdT plasmid was inoculated into 6L LB medium at a ratio of 1:1000 for bacteria expansion culture, and the bacteria expansion culture parameters were 37°C, 220rpm for 16h. The bacteria after expansion culture were collected by centrifugation, and the centrifugation parameters were: 8000g, 4°C for 10min, and 36g of wet weight of bacteria was obtained.

[0167] (2) 36g of bacteria was mixed with 120mL of the first solution (10mM of ethylenediaminetetraacetic acid + 50mM of tris-hydroxymethyl aminomethane hydrochloride and pH=8.0) to resuspend the bacteria, and after resuspension, 120mL of the second solution (200mM of sodium hydroxide + 1% by weight of sodium dodecyl sulfonate) was added to crack the bacteria, and the cracking was carried out at room temperature for 3min, and then 270mL of the third solution (4M of ammonium sulfate solution, pH=5.5) was added, and after mixing thoroughly, the cracking solution was obtained by standing, at this time, the final concentration of ammonium sulfate in the cracking solution was 2.12M, and the cracking solution was centrifuged at 10000g, 4°C for 30min to collect the supernatant, which was the crude material liquid containing plasmid.

[0168] Purification of plasmid DNA:

[0169] (3) Load the crude feed containing plasmid onto a hydrophobic chromatography column, and obtain a hydrophobic chromatography product through a hydrophobic chromatography process, the hydrophobic chromatography process being: 1. Column equilibration, equilibrate the chromatography column with solution A for 2 column volumes at a flow rate of 10 mL / min; 2. Sample loading: pass the crude feed containing plasmid through the hydrophobic chromatography column at a flow rate of 10 mL / min; 3. Elution: elute the chromatography column with 95% by volume of solution A + 5% by volume of solution B at a flow rate of 10 mL / min until the indicators are stable; 4. Elution: elute with 76% by volume of solution A + 24% by volume of solution B at a flow rate of 10 mL / min to obtain the hydrophobic chromatography product. The hydrophobic chromatography column is a 26 mm x 10 mm column with a column bed volume of 50 mL and a packing of a chromatography column of mercapto pyridine.

[0170] (4) Dilute the hydrophobic chromatography product with water at a ratio of 1:1, load the diluted hydrophobic chromatography product onto a strong anion exchange chromatography column, and obtain purified plasmid DNA through an ion exchange chromatography process, the ion exchange chromatography process being: 1. Column equilibration: equilibrate for 2 column volumes at a flow rate of 10 mL / min; 2. Sample loading: mix the hydrophobic chromatography product with solution B at a volume ratio of 1:1, and pass through the strong anion exchange chromatography column at a flow rate of 10 mL / min; 3. Elution: elute the chromatography column with 40% by volume of solution C + 60% by volume of solution B for 3 column volumes until the indicators are stable; 4. Elution: elute with 90% by volume of solution C + 10% by volume of solution B at a flow rate of 10 mL / min, and collect the elution product of 0.9M sodium chloride solution to obtain the purified plasmid DNA. The strong anion exchange chromatography column is a 16 mm x 10 mm column with a column bed volume of 20 mL and a packing of a chromatography column of quaternary ammonium ligand.

[0171] Solution A is 2.1M ammonium sulfate + 10mM ethylenediaminetetraacetic acid + 100mM tris-hydroxymethyl aminomethane hydrochloride, pH = 7.5;

[0172] Solution B is 10mM ethylenediaminetetraacetic acid + 100mM tris-hydroxymethyl aminomethane hydrochloride, pH = 7.5;

[0173] Solution C is 1M sodium chloride + 10mM ethylenediaminetetraacetic acid + 100mM tris-hydroxymethyl aminomethane hydrochloride, pH = 7.5.

[0174] Concentrate, activate and store the plasmid DNA:

[0175] (5) Ethanol precipitation: mix the purified plasmid DNA with 3M sodium acetate (pH = 5.5) and ethanol at a volume ratio of 1:0.1:3, centrifuge at 12000g for 10 min, and rinse twice with 75% by volume of ethanol to obtain.

[0176] (6) Storage: The plasmid DNA obtained in step (5) is stored in ethanol at -20°C.

[0177] Detection:

[0178] (7) The eluted product composition is detected by 1% agarose gel electrophoresis.

[0179] Example 2

[0180] Specific step (1) is the same as in Example 1.

[0181] (2) 36 g of bacterial cells is mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1% by weight of sodium dodecyl sulfonate) is added to lyse the bacterial solution, the lysis is carried out at room temperature for 3 min, then 300 mL of a third solution (4 M of ammonium sulfate solution, pH = 5.5) is added, after thorough mixing, the lysis solution is obtained by standing, at this time, the final concentration of ammonium sulfate in the lysis solution is 2.22 M, the lysis solution is centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which is the crude material solution containing plasmids.

[0182] Specific steps (3)-(7) are the same as in Example 1.

[0183] Example 3

[0184] Specific step (1) is the same as in Example 1.

[0185] (2) 36 g of bacterial cells is mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1% by weight of sodium dodecyl sulfonate) is added to lyse the bacterial solution, the lysis is carried out at room temperature for 3 min, then 330 mL of a third solution (4 M of ammonium sulfate solution, pH = 5.5) is added, after thorough mixing, the lysis solution is obtained by standing, at this time, the final concentration of ammonium sulfate in the lysis solution is 2.32 M, the lysis solution is centrifuged at 10,000 g and 4°C for 30 min to collect the supernatant, which is the crude material solution containing plasmids.

[0186] Specific steps (3)-(7) are the same as in Example 1.

[0187] Example 4

[0188] Specific step (1) is the same as in Example 1.

[0189] (2) 36 g of the bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecylsulfate) was added to lyse the bacterial solution, the lysis was performed at room temperature for 3 min, then 480 mL of a third solution (4 M of ammonium sulfate solution, pH = 5.5) was added, after mixing well, the lysis solution was obtained by standing, at this time, the final concentration of ammonium sulfate in the lysis solution was 2.67 M, the lysis solution was centrifuged at 10000 g, 4°C for 30 min to collect the supernatant, i.e. the crude material solution containing the plasmid.

[0190] Specific steps (3)-(7) were the same as in Example 1.

[0191] Example 5

[0192] Specific step (1) was the same as in Example 1.

[0193] (2) 36 g of the bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecylsulfate) was added to lyse the bacterial solution, the lysis was performed at room temperature for 3 min, then 480 mL of a third solution (4 M of ammonium sulfate solution, pH = 5.5) was added, after mixing well, the lysis solution was obtained by standing, at this time, the final concentration of ammonium sulfate in the lysis solution was 2.67 M, the lysis solution was centrifuged at 10000 g, 4°C for 30 min to collect the supernatant, i.e. the crude material solution containing the plasmid.

[0194] Specific steps (3)-(7) were the same as in Example 1.

[0195] Example 6

[0196] Specific step (1) was the same as in Example 1.

[0197] (2) 36 g of the bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecylsulfate) was added to lyse the bacterial solution, the lysis was performed at room temperature for 3 min, then 480 mL of a third solution (4 M of ammonium sulfate solution, pH = 5.5) was added, after mixing well, the lysis solution was obtained by standing, at this time, the final concentration of ammonium sulfate in the lysis solution was 2.67 M, the lysis solution was centrifuged at 10000 g, 4°C for 30 min to collect the supernatant, i.e. the crude material solution containing the plasmid.

[0198] Specific steps (3)-(7) were the same as in Example 1.

[0199] Example 7

[0200] Specific step (1) is the same as Example 1.

[0201] (2) 36 g of bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecyl sulfonate) was added to lyse the bacterial solution, the lysis was carried out at room temperature for 3 min, then 840 mL of a third solution (4 M of ammonium sulfate solution, pH = 5.5) was added, after thorough mixing, the lysis solution was obtained by standing, at this time, the final concentration of ammonium sulfate in the lysis solution was 3.11 M, the lysis solution was centrifuged at 10000 g, 4°C for 30 min to collect the supernatant, which was the crude material solution containing plasmid.

[0202] Specific steps (3)-(7) are the same as Example 1.

[0203] Example 8

[0204] Specific step (1) is the same as Example 1.

[0205] (2) 36 g of bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecyl sulfonate) was added to lyse the bacterial solution, the lysis was carried out at room temperature for 3 min, then 840 mL of a third solution (4 M of ammonium sulfate solution, pH = 5.5) was added, after thorough mixing, the lysis solution was obtained by standing, at this time, the final concentration of ammonium sulfate in the lysis solution was 3.11 M, the lysis solution was centrifuged at 10000 g, 4°C for 30 min to collect the supernatant, which was the crude material solution containing plasmid.

[0206] Specific steps (3)-(7) are the same as Example 1.

[0207] Comparative Example 1

[0208] Specific step (1) is the same as Example 1.

[0209] (2) 36 g of the bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, and after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecylsulfate) was added to lyse the bacterial solution, and the lysis was performed at room temperature for 3 min, and then 120 mL of a third solution (4 M of an ammonium sulfate solution, pH = 5.5) was added, and after thorough mixing, the lysis solution was left to stand to obtain a lysate, at this time, the final concentration of ammonium sulfate in the lysate was 0 M. The lysate was centrifuged at 10,000 g at 4°C for 30 min to collect the supernatant, which was a crude solution containing the plasmid.

[0210] Steps (3) to (7) were the same as in Example 1.

[0211] Comparative Example 2

[0212] Step (1) was the same as in Example 1.

[0213] (2) 36 g of the bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, and after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecylsulfate) was added to lyse the bacterial solution, and the lysis was performed at room temperature for 3 min, and then 60 mL of a third solution (4 M of an ammonium sulfate solution, pH = 5.5) was added, and after thorough mixing, the lysis solution was left to stand to obtain a lysate, at this time, the final concentration of ammonium sulfate in the lysate was 0.8 M. The lysate was centrifuged at 10,000 g at 4°C for 30 min to collect the supernatant, which was a crude solution containing the plasmid.

[0214] Steps (3) to (7) were the same as in Example 1.

[0215] Comparative Example 3

[0216] Step (1) was the same as in Example 1.

[0217] (2) 36 g of the bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, and after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecylsulfate) was added to lyse the bacterial solution, and the lysis was performed at room temperature for 3 min, and then 90 mL of a third solution (4 M of an ammonium sulfate solution, pH = 5.5) was added, and after thorough mixing, the lysis solution was left to stand to obtain a lysate, at this time, the final concentration of ammonium sulfate in the lysate was 1.09 M. The lysate was centrifuged at 10,000 g at 4°C for 30 min to collect the supernatant, which was a crude solution containing the plasmid.

[0218] Steps (3) to (7) were the same as in Example 1.

[0219] Comparative Example 4

[0220] Specific step (1) is the same as Example 1.

[0221] (2) 36 g of bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecyl sulfonate) was added to lyse the bacterial solution. Lysis was performed at room temperature for 3 min, followed by the addition of 120 mL of a third solution (4 M of ammonium sulfate solution, pH = 5.5). After thorough mixing, the lysate was obtained by standing. At this time, the final concentration of ammonium sulfate in the lysate was 1.33 M. The lysate was centrifuged at 10,000 g at 4°C for 30 min to collect the supernatant, which was a crude material solution containing plasmids.

[0222] Specific steps (3) to (7) are the same as Example 1.

[0223] Comparative Example 5

[0224] Specific step (1) is the same as Example 1.

[0225] (2) 36 g of bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecyl sulfonate) was added to lyse the bacterial solution. Lysis was performed at room temperature for 3 min, followed by the addition of 150 mL of a third solution (4 M of ammonium sulfate solution, pH = 5.5). After thorough mixing, the lysate was obtained by standing. At this time, the final concentration of ammonium sulfate in the lysate was 1.54 M. The lysate was centrifuged at 10,000 g at 4°C for 30 min to collect the supernatant, which was a crude material solution containing plasmids.

[0226] Specific steps (3) to (7) are the same as Example 1.

[0227] Comparative Example 6

[0228] Specific step (1) is the same as Example 1.

[0229] (2) 36 g of the bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecylsulfate) was added to lyse the bacterial solution, the lysis was performed at room temperature for 3 min, then 180 mL of a third solution (4 M of ammonium sulfate solution, pH = 5.5) was added, after mixing well, the lysis solution was obtained by standing, at this time, the final concentration of ammonium sulfate in the lysis solution was 1.71 M, the lysis solution was centrifuged at 10000 g, 4 °C for 30 min to collect the supernatant, which was the crude solution containing plasmid.

[0230] Specific steps (3) to (7) were the same as in Example 1.

[0231] Comparative Example 7

[0232] Specific step (1) was the same as in Example 1.

[0233] (2) 36 g of the bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecylsulfate) was added to lyse the bacterial solution, the lysis was performed at room temperature for 3 min, then 180 mL of a third solution (4 M of ammonium sulfate solution, pH = 5.5) was added, after mixing well, the lysis solution was obtained by standing, at this time, the final concentration of ammonium sulfate in the lysis solution was 1.71 M, the lysis solution was centrifuged at 10000 g, 4 °C for 30 min to collect the supernatant, which was the crude solution containing plasmid.

[0234] Specific steps (3) to (7) were the same as in Example 1.

[0235] Comparative Example 8

[0236] Specific step (1) was the same as in Example 1.

[0237] (2) 36 g of the bacterial cells were mixed with 120 mL of a first solution (10 mM of ethylenediaminetetraacetic acid + 50 mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, after resuspension, 120 mL of a second solution (200 mM of sodium hydroxide + 1 wt% of sodium dodecylsulfate) was added to lyse the bacterial solution, the lysis was performed at room temperature for 3 min, then 180 mL of a third solution (4 M of ammonium sulfate solution, pH = 5.5) was added, after mixing well, the lysis solution was obtained by standing, at this time, the final concentration of ammonium sulfate in the lysis solution was 1.71 M, the lysis solution was centrifuged at 10000 g, 4 °C for 30 min to collect the supernatant, which was the crude solution containing plasmid.

[0238] Specific steps (3) to (7) were the same as in Example 1.

[0239] Table 2(1) Screening of final concentration of ammonium sulfate in lysis solution (Examples 1-8)

[0240] Table 2(2) Screening of final concentration of ammonium sulfate in lysis solution (Comparative Examples 1-8)

[0241] As shown in Figure 3, Figure 3(A) is a comparison photograph of the bacterial lysate after the traditional alkaline lysis method (left side of Figure 3(A)) and the treatment of Example 1 of the present application (right side of Figure 3(A)). Figure 3(B) is a comparison electropherogram of the removal of RNA after the traditional alkaline lysis method and Example 1, wherein lane M of Figure 3(B) represents a 5000 bp molecular weight marker, lane 1 represents the removal of RNA in the crude material solution containing plasmid obtained by the traditional alkaline lysis method, and lane 2 represents the removal of RNA in the crude material solution containing plasmid obtained by the alkaline lysis method of the present application. The results show that the improved lysis method of the present application can effectively remove most of the host RNA in the bacterial lysate, significantly reduce the time and material usage of subsequent liquid phase purification, and also improve the plasmid DNA yield. At the same time, it further shows that the bacterial lysis by the alkaline lysis method of the present application has three significant advantages: first, the product of ammonium sulfate neutralization and alkaline lysis produces weak gas, which makes the impurity suspension after lysis float in the upper layer and be more condensed, facilitating removal by filtration or centrifugation. Second, the salting-out effect of ammonium sulfate is obvious, which can remove a large amount of bacterial host RNA while retaining plasmid DNA, facilitating subsequent purification. Third, the salt concentration of the lysis solution is appropriate, and it can directly interface with the hydrophobic chromatography mediated by lyophilic salt without the need for concentration, liquid change, dialysis or material supplement.

[0242] As shown in Figure 4(A), Figure 4(A) is a 100 ms low exposure agarose gel electropherogram for detecting the elution product composition of Comparative Examples 1-8 and Examples 1-8 by 1% by weight agarose gel electrophoresis, and Figure 4(B) is a 1000 ms high exposure agarose gel electropherogram for detecting the elution product composition of Comparative Examples 1-8 and Examples 1-8 by 1% by weight agarose gel electrophoresis, wherein the lanes from left to right represent a 5000 bp DNA marker, Comparative Examples 1-8, Examples 1-8 (8 groups of lanes in the dashed line box), and a 5000 bp DNA marker. The results show that the alkaline lysis method provided by the present application can effectively remove RNA and denatured plasmid DNA. And combined with Tables 2(1)-(2), it is further proved that the final concentration of ammonium sulfate affects the efficiency of RNA removal, and only when the final concentration of ammonium sulfate is greater than or equal to 2.1 M can RNA be effectively removed and DNA denaturation be avoided.

[0243] Application Example 1 (Comparison of plasmid DNA obtained by the preparation method of high biological activity plasmid DNA and plasmid DNA obtained by using commercial kit)

[0244] (1) Respectively, the E. coli containing plasmid pB-CAG-iCre-ERT2, plasmid pVAX-luci-tdT, plasmid pAAV-DIO-CAG-EYFP and plasmid pAAV-luci-cre were inoculated in LB medium at a ratio of 1:1000 for bacterial expansion culture, and the bacterial expansion culture parameters were 37℃, 220rpm for 16h. The bacteria after expansion culture were collected by centrifugation, and the centrifugation parameters were: 8000g, 4℃ for 10min.

[0245] The specific steps (2)-(5) are the same as those in Example 1.

[0246] As shown in Figure 5, (A) of Figure 5 is a 1000ms high exposure agarose gel electrophoresis map of the elution product components of the plasmid DNA obtained by the preparation method of high biological activity plasmid DNA of application example 1 and the plasmid DNA obtained by using commercial kit, wherein lane 1 represents a 5000bp DNA marker; lanes 2-5 represent a 1000ms high exposure agarose gel electrophoresis map of the elution product components of the plasmid DNA obtained by the preparation method of high biological activity plasmid DNA; lane 6 represents a 1000ms high exposure agarose gel electrophoresis map of the elution product components of the plasmid DNA obtained by using commercial kit.

[0247] (B) of Figure 5 is a map and size of the plasmid DNA used in application example 1, wherein the plasmid DNA used in lane 2 is plasmid pB-CAG-iCre-ERT2, the plasmid DNA used in lanes 3 and 6 is plasmid pVAX-luci-tdT, the plasmid DNA used in lane 4 is plasmid pAAV-DIO-CAG-EYFP, and the plasmid DNA used in lane 5 is plasmid pAAV-luci-cre.

[0248] The results show that the upper part of (A) of Figure 5 is a small amount of 100ng loading, and the plasmid DNA obtained by the preparation method of high biological activity plasmid DNA (lanes 2-5) can be seen, in which the supercoiled plasmid DNA occupies the main component, and the lower part of (A) of Figure 5 is a large amount of 5μg loading, and the plasmid DNA obtained by the preparation method of high biological activity plasmid DNA (lanes 2-5) can be seen, in which there is no host RNA at all. The plasmid DNA obtained by using commercial kit (lane 6) has incomplete removal of host RNA. Therefore, the plasmid DNA obtained by the preparation method of high biological activity plasmid DNA is suitable for different sizes of plasmid.

[0249] Example 2 (Comparison of transfection efficiency and expression stability of plasmid DNA activated by different precipitation methods and stored by different storage methods)

[0250] 1. Lysis of bacterial cells

[0251] (1) E. coli containing pVAX-luci-tdT plasmid was inoculated into 6L LB medium at a ratio of 1:1000 for bacterial expansion culture, and the bacterial expansion culture parameters were 37°C and 220 rpm for 16h. The bacterial cells after expansion culture were collected by centrifugation, and the centrifugation parameters were 8000g, 4°C for 10min, and 36g of wet bacterial cells were obtained.

[0252] (2) 1g of bacterial cells was mixed with 5mL of the first solution (10mM of ethylenediaminetetraacetic acid + 50mM of tris-hydroxymethyl aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells, and 5mL of the second solution (200mM of sodium hydroxide + 1wt% of sodium dodecyl sulfonate) was added to lyse the bacterial solution, which was incubated at room temperature for 3min, followed by the addition of 15mL of the third solution (4M of ammonium sulfate solution, pH = 5.5). After mixing well, the lysis solution was obtained by standing, at this time, the final concentration of ammonium sulfate in the lysis solution was 2.4M. The lysis solution was centrifuged, and the supernatant containing the crude plasmid was collected.

[0253] 2. Purification of plasmid DNA

[0254] (1) The crude plasmid-containing solution was loaded onto a hydrophobic chromatography column, and a hydrophobic chromatography product was obtained by a hydrophobic chromatography process. The hydrophobic chromatography process was as follows: 1. Column equilibration, the column was equilibrated with solution A for 2 column volumes at a flow rate of 10mL / min; 2. Sample loading: the crude plasmid-containing solution was loaded onto the hydrophobic chromatography column at a flow rate of 10mL / min; 3. Elution: the column was eluted with 92% solution A + 8% solution B at a flow rate of 10mL / min until the indicators were stable; 4. Elution: elution was performed using 75% solution A + 25% solution B at a flow rate of 10mL / min, and the elution product of 1.85M ammonium sulfate was collected to obtain the hydrophobic chromatography product. The hydrophobic chromatography column was 16mmx25mm, the column bed volume was 5mL, and the filler was a chromatographic column of mercapto pyridine.

[0255] (2) The hydrophobic chromatography product is diluted with water at a ratio of 1:1 and loaded on a strong anion exchange chromatography column to obtain purified plasmid DNA through an ion exchange chromatography process: 1. Column equilibration: 2 column volumes are equilibrated using solution B at a flow rate of 10 mL / min; 2. Sample loading: the hydrophobic chromatography product is mixed with solution B at a volume ratio of 1:1 and passed through the strong anion exchange chromatography column at a flow rate of 10 mL / min; 3. Elution: 3 column volumes are eluted using 45% by volume of solution C + 55% by volume of solution B to stabilize each index; 4. Elution: elution is performed using 100% by volume of solution C at a flow rate of 10 mL / min, and 0.9M sodium chloride solution is collected to elute the product to obtain purified plasmid DNA. The strong anion exchange chromatography column is a 16mmx25mm column with a column bed volume of 5mL and a filler of a quaternary ammonium ligand chromatography column.

[0256] Solution A is 2.1M ammonium sulfate + 10mM ethylenediaminetetraacetic acid + 100mM tris-hydroxymethyl aminomethane hydrochloride, pH = 7.5;

[0257] Solution B is 10mM ethylenediaminetetraacetic acid + 100mM tris-hydroxymethyl aminomethane hydrochloride, pH = 7.5;

[0258] Solution C is 1M sodium chloride + 10mM ethylenediaminetetraacetic acid + 100mM tris-hydroxymethyl aminomethane hydrochloride, pH = 7.5.

[0259] 3. Precipitate plasmid DNA

[0260] (1) The purified plasmid DNA obtained by the purification method of section 2 of this application example, the purified plasmid DNA is freeze-dried, or the purified plasmid DNA is ultrafiltered, wherein the ultrafiltration is concentrated using a 300kDa ultrafiltration membrane.

[0261] The purified plasmid DNA or the concentrated plasmid after purification is isopropanol precipitated. The biological activity of the plasmid DNA obtained by the above different concentration treatment methods is detected through in vivo transfection and delivery efficiency determination experiments, and the results are shown in (D) of FIG. 6. (D) of FIG. 6 is a quantitative statistical result of in vivo fluorescence imaging of plasmid DNA obtained by different concentration treatment methods in section 3 of this application example.

[0262] (2) The plasmid DNA purified according to the commercial kit (the same as the commercial kit in application example 1) and the plasmid DNA purified according to the commercial kit are isopropanol precipitated, respectively.

[0263] The biological activity of plasmid DNA purified by a commercial kit after treatment with isopropanol precipitation was then detected by in vivo transfection and delivery efficiency assay, as shown in Figure 6(E). Figure 6(E) shows the quantitative statistical results of isopropanol-precipitated plasmid DNA in in vivo fluorescence imaging.

[0264] (3) The purified plasmid DNA obtained by the purification method of the present invention is precipitated by isopropanol precipitation, ethanol precipitation and polyethylene glycol precipitation respectively, and then freeze-dried.

[0265] The biological activity of plasmid DNA treated by the purification method of this invention and the traditional purification method was then detected by in vivo transfection and delivery efficiency assay, as shown in Figure 6(F). Figure 6(F) shows the quantitative statistical results of in vivo fluorescence imaging of plasmid DNA precipitated with monohydric or polyhydric alcohols.

[0266] The isopropanol precipitation method involves mixing the purified plasmid DNA with 3M sodium acetate (pH=5.5) and isopropanol in a volume ratio of 1:0.1:0.7, centrifuging at 12000g for 10 min, and then washing twice with 75% ethanol.

[0267] Ethanol precipitation method: The purified plasmid DNA was mixed with 3M sodium acetate (pH=5.5) and ethanol in a volume ratio of 1:0.1:3. After centrifugation at 12000g for 10min, the mixture was washed twice with 75% ethanol.

[0268] Polyethylene glycol precipitation method: 500 mM sodium chloride and 10 wt% polyethylene glycol were added, and the mixture was centrifuged at 12000 g for 10 min. The mixture was then washed twice with 75 vol% ethanol.

[0269] As shown in Figure 6, (A) is a plasmid map of the luciferase reporter gene used for in vivo transfection, (B) is an experimental flowchart for in vivo transfection and delivery efficiency determination, (C) is a representative image of in vivo fluorescence imaging, (D) is the quantitative statistical results of plasmid DNA obtained by different concentration treatment methods in Section 3 of this application example in in vivo fluorescence imaging, (E) is the quantitative statistical results of plasmid DNA treated with isopropanol precipitation in in vivo fluorescence imaging, and (F) is the quantitative statistical results of plasmid DNA treated with monohydric or polyhydric alcohol precipitation in in vivo fluorescence imaging.

[0270] The results showed that, after liquid-phase purification, the highest transfection efficiency was achieved by precipitation concentration, followed by ultrafiltration concentration, and the worst was freeze-drying. Precipitation treatment effectively activated plasmid DNA, improving the efficiency and stability of in vivo delivery. Precipitation activation of plasmid DNA was not limited by the preparation method or time of the plasmid; precipitation treatment could effectively restore the biological activity of the plasmid DNA. Ethanol, isopropanol, and polyethylene glycol could all effectively precipitate and activate plasmid DNA and improve expression stability.

[0271] 4. Storing plasmid DNA

[0272] The specific methods for storing the same batch of plasmid DNA under different storage conditions for 21 days are as follows:

[0273] The purified plasmid DNA obtained using the purification method described in Section 2 of this application example was precipitated with ethanol and then lyophilized. The lyophilized plasmid DNA was then stored in PBS buffer, ultrapure water, or anhydrous ethanol at -20°C or 4°C. Subsequently, the biological activity of the plasmid DNA stored in these different methods was assessed through in vivo transfection and delivery efficiency assays, as shown in Figure 7.

[0274] As shown in Figure 7, (A) is a plasmid map of the luciferase reporter gene used for in vivo transfection, (B) is an experimental flowchart for determining in vivo transfection and delivery efficiency, (C) is a representative in vivo fluorescence imaging of the same batch of plasmid DNA after 21 days of storage under different storage conditions, and (D) is a quantitative statistical result of in vivo fluorescence imaging of the same batch of plasmid DNA after 21 days of storage under different storage conditions.

[0275] The results showed that precipitating plasmid DNA using a precipitation method and storing the precipitate at -20 or 4°C maintained the biological activity of the plasmid DNA for an extended period without a significant decrease in in vivo transfection efficiency and stability. Conversely, regardless of whether the plasmid DNA was stored in water or ethanol, its biological activity decreased significantly after storage, manifested as a reduction in in vivo transfection efficiency and expression stability.

[0276] Application Example 3 (Comparison of traditional plasmid DNA preparation methods and highly biologically active plasmid DNA purification methods)

[0277] 1. Purification method for highly biologically active plasmid DNA (two-column liquid chromatography)

[0278] (1) Escherichia coli containing the pVAX-luci-tdT plasmid was inoculated into LB medium at a ratio of 1:1000 for cell expansion culture to obtain 6L of bacterial culture. The cell expansion culture parameters were 37℃, 220rpm for 16h. The expanded bacterial cells were collected by centrifugation at 8000g, 4℃ for 10min.

[0279] (2) 1 g of bacterial cells were mixed with 5 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 8.0) to resuspend the bacterial cells. After resuspending, 5 mL of the second solution (200 mM sodium hydroxide + 1% sodium dodecyl sulfate) was added to lyse the bacterial culture. The lysis was carried out at room temperature for 3 min. Then, 15 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added, and the mixture was thoroughly mixed and allowed to stand to obtain the lysate. The supernatant, i.e., the crude solution containing plasmids, was collected by centrifugation.

[0280] (3) The crude solution containing the plasmid is loaded onto a hydrophobic chromatography column and subjected to hydrophobic chromatography to obtain the hydrophobic chromatographic product. The hydrophobic chromatography procedure is as follows: 1. Column equilibration: Equilibrate the column to two column volumes using solution A at a flow rate of 10 mL / min; 2. Sample loading: Pass the crude solution containing the plasmid through the hydrophobic chromatography column at a flow rate of 10 mL / min; 3. Eluting: Eluting the column with 92% (v / v) solution A + 8% (v / v) solution B until all parameters are stable at a flow rate of 10 mL / min; 4. Elution: Eluting with 75% (v / v) solution A + 25% solution B at a flow rate of 10 mL / min, and collecting the elution product of 1.85 M ammonium sulfate to obtain the hydrophobic chromatographic product. The hydrophobic chromatography column is 16 mm x 25 mm with a column bed volume of 5 mL, and the packing material is a mercaptopyridine column.

[0281] (4) The hydrophobic chromatographic product was diluted with water at a 1:1 ratio and loaded onto a strong anion exchange column. The purified plasmid DNA was obtained through ion exchange chromatography. The ion exchange chromatography procedure was as follows: 1. Column equilibration: Equilibrate two column volumes using solution B at a flow rate of 10 mL / min; 2. Sample loading: Mix the hydrophobic chromatographic product with solution B at a 1:1 volume ratio and pass the mixture through the strong anion exchange column at a flow rate of 10 mL / min; 3. Eluting: Elute three column volumes with 45% (v / v) solution C + 55% (v / v) solution B until all parameters stabilize; 4. Elution: Elute with 100% (v / v) solution C at a flow rate of 10 mL / min and collect the elution product in 0.9 M sodium chloride solution to obtain the purified plasmid DNA. The strong anion exchange column was 16 mm x 25 mm with a column bed volume of 5 mL and packed with quaternary ammonium ligands.

[0282] Solution A consists of 2.1M ammonium sulfate + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, with a pH of 7.5.

[0283] Solution B is 10 mM ethylenediaminetetraacetic acid + 100 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0284] Solution C is 1M sodium chloride + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5.

[0285] 2. Traditional methods for purifying plasmid DNA (three-column liquid chromatography)

[0286] (1) Escherichia coli containing the pVAX-luci-tdT plasmid was inoculated into LB medium at a ratio of 1:1000 for cell expansion culture to obtain 6L of bacterial culture. The cell expansion culture parameters were 37℃, 220rpm for 16h. The expanded bacterial cells were collected by centrifugation at 8000g, 4℃ for 10min.

[0287] (2) 1 g of bacterial cells were mixed with 5 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 8.0) to resuspend the bacterial cells. After resuspending, 5 mL of the second solution (200 mM sodium hydroxide + 1% by weight sodium dodecyl sulfate) was added to lyse the bacterial culture. The lysis was carried out at room temperature for 3 min. Then, 15 mL of the third solution (3 M sodium acetate solution, pH = 5.5) was added, and the mixture was thoroughly mixed and allowed to stand to obtain the lysate. The supernatant, i.e., the crude solution containing plasmids, was collected by centrifugation.

[0288] (3) The lysate was centrifuged at 8000g, 4℃, for 20min to clarify it. The clarified lysate was then concentrated using a 300kDa ultrafiltration membrane to make its volume less than 75mL.

[0289] Molecular sieve chromatography: A Sepharose 6FF packed column with a column volume of 300 mL was used. Two column volumes were balanced with A (2.1 M ammonium sulfate solution + TE). The concentrated lysate in (4) was passed through a molecular sieve and the first peak was collected.

[0290] Affinity chromatography: A 50 mL PlasmidSelect packed column was used. The column volume was equilibrated with solution B (2 M ammonium sulfate + TE) for 3 column volumes. The plasmid purified by molecular sieve obtained in (5) was passed through the column and eluted with solution B (2 M ammonium sulfate + TE) for 3 column volumes. The elution was performed with solution C (1.4 M sodium chloride + 2 M ammonium sulfate + TE).

[0291] Ion exchange chromatography: A 50 mL CaptoQ30 packed column was used. The column was equilibrated with two column volumes using solution D (0.4 M sodium chloride + TE). The sample was diluted twice with water and passed through the column. The column was then equilibrated with three column volumes using solution D (0.4 M sodium chloride + TE). Finally, the column was eluted with solution E (1.0 M sodium chloride + TE) to obtain the purified plasmid DNA.

[0292] 3. Isopropanol precipitation: The purified plasmid DNA obtained in steps 1 and 2 of this application example is mixed with 3M sodium acetate (pH=5.5) and isopropanol in a volume ratio of 1:0.1:0.7. After centrifugation at 12000g for 10min, the mixture is washed twice with 75% ethanol.

[0293] 4. The biological activity of the plasmid DNA precipitated with isopropanol obtained in step 3 was detected by in vivo transfection and delivery efficiency assay, as shown in Figure 8.

[0294] Figure 8(A) is a parallel comparison of the traditional plasmid DNA purification method (three-column liquid chromatography) and the highly biologically active plasmid DNA purification method (two-column liquid chromatography) in this application example; Figure 8(B) is an experimental flowchart of the in vivo transfection and delivery efficiency determination in this application example; Figure 8(C) is a plasmid DNA map of the luciferase reporter gene used for in vivo transfection in this application example; Figure 8(D) is a representative image of the plasmid DNA after isopropanol precipitation obtained in Section 3 of this application example in in vivo fluorescence imaging; Figure 8(E) is the quantitative statistical result of the plasmid DNA after isopropanol precipitation obtained in Section 3 of this application example in in vivo fluorescence imaging.

[0295] The results showed that, by using the traditional plasmid DNA purification method (three-column liquid chromatography) and the highly biologically active plasmid DNA purification method (two-column liquid chromatography), the purified plasmid DNA, after precipitation, desalting, concentration and activation, can yield plasmid DNA with similar in vivo delivery efficiency and similar stability.

[0296] 5. The results of comparing the quality control indicators of plasmid DNA after isopropanol precipitation obtained in step 3 were obtained through experiments to determine the in vivo transfection and delivery efficiency, as shown in Table 3.

[0297] As shown in Table 3, the results indicate that the quality control indicators of plasmid DNA prepared by the method of the present invention, such as host DNA residue and endotoxin residue, are significantly lower than those of traditional purification methods, and the plasmid DNA concentration is significantly better than that of traditional purification methods.

[0298] 6. Table 4 compares the time and material consumption of the main steps in the traditional plasmid DNA purification method (three-column liquid chromatography) and the purification method for highly biologically active plasmid DNA (two-column liquid chromatography).

[0299] As shown in Table 4, the results show that the purification method provided by the present invention has a yield that is about 1.5 times that of the traditional purification method, with less material consumption and a total time consumption that is 35% of the classic three-column method, eliminating the need for ultrafiltration equipment and related material consumption.

[0300] In summary, the purification method for highly biologically active plasmid DNA exhibits significantly higher overall performance in terms of in vivo delivery efficiency, stability, quality, yield, and production cost compared to traditional plasmid DNA purification methods.

[0301] Table 3. Comparison of plasmid DNA quality control indicators

[0302] Application Example 4

[0303] 1. pVax-S plasmid DNA encoding the COVID-19 spike protein and its vaccine preparation method

[0304] (1) Escherichia coli containing the pVax-S plasmid was inoculated into LB medium at a ratio of 1:1000 for cell expansion culture to obtain 6L of bacterial culture. The cell expansion culture parameters were 37℃, 220rpm for 16h. The expanded cells were collected by centrifugation at 8000g, 4℃ for 10min.

[0305] (2) 1 g of bacterial cells were mixed with 5 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 8.0) to resuspend the bacterial cells. After resuspending, 5 mL of the second solution (200 mM sodium hydroxide + 1% sodium dodecyl sulfate) was added to lyse the bacterial culture. The lysis was carried out at room temperature for 3 min. Then, 15 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added, and the mixture was thoroughly mixed and allowed to stand to obtain the lysate. The supernatant, i.e., the crude solution containing plasmids, was collected by centrifugation.

[0306] (3) The crude solution containing the plasmid is loaded onto a hydrophobic chromatography column and subjected to hydrophobic chromatography to obtain the hydrophobic chromatographic product. The hydrophobic chromatography procedure is as follows: 1. Column equilibration: Equilibrate the column to two column volumes using solution A at a flow rate of 10 mL / min; 2. Sample loading: Pass the crude solution containing the plasmid through the hydrophobic chromatography column at a flow rate of 10 mL / min; 3. Eluting: Eluting the column with 92% (v / v) solution A + 8% (v / v) solution B until all parameters are stable at a flow rate of 10 mL / min; 4. Elution: Eluting with 75% (v / v) solution A + 25% solution B at a flow rate of 10 mL / min, and collecting the elution product of 1.85 M ammonium sulfate to obtain the hydrophobic chromatographic product. The hydrophobic chromatography column is 16 mm x 25 mm with a column bed volume of 5 mL, and the packing material is a mercaptopyridine column.

[0307] (4) The hydrophobic chromatographic product was diluted with water at a 1:1 ratio and loaded onto a strong anion exchange column. The purified plasmid DNA was obtained through ion exchange chromatography. The ion exchange chromatography procedure was as follows: 1. Column equilibration: Equilibrate two column volumes using solution B at a flow rate of 10 mL / min; 2. Sample loading: Mix the hydrophobic chromatographic product with solution B at a 1:1 volume ratio and pass the mixture through the strong anion exchange column at a flow rate of 10 mL / min; 3. Eluting: Elute three column volumes with 45% (v / v) solution C + 55% (v / v) solution B until all parameters stabilize; 4. Elution: Elute with 100% (v / v) solution C at a flow rate of 10 mL / min and collect the elution product in 0.9 M sodium chloride solution to obtain the purified plasmid DNA. The strong anion exchange column was 16 mm x 25 mm with a column bed volume of 5 mL and packed with quaternary ammonium ligands.

[0308] Solution A consists of 2.1M ammonium sulfate + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, with a pH of 7.5.

[0309] Solution B is 10 mM ethylenediaminetetraacetic acid + 100 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0310] Solution C is 1M sodium chloride + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5.

[0311] (5) Isopropanol precipitation: The purified plasmid DNA was mixed with 3M sodium acetate (pH=5.5) and isopropanol at a volume ratio of 1:0.1:0.7. After centrifugation at 12000g for 10 min, the mixture was washed twice with 75% ethanol. The resulting plasmid DNA precipitate was dissolved in PBS buffer, and the concentration of plasmid DNA was determined using a Qubit4 analyzer. The concentration of plasmid DNA was then diluted to 1 mg / mL with PBS buffer for use as a vaccine (referred to as "pVax-S plasmid DNA vaccine").

[0312] 2. Immunization of mice with pVax-S plasmid DNA vaccine and sample collection

[0313] (1) The specific immunization process and sample collection are shown in Figure 9A. The mice were randomly divided into two groups, namely the pVax-S immunization group and the blank immunization group. The mice were eight-week-old female BalB / C mice.

[0314] pVax-S immunization group: Mice were injected with pVax-S plasmid DNA vaccine encoding the COVID-19 spike protein (the pVax-S plasmid DNA vaccine prepared in Section 1 above) at weeks 0, 2, and 4, respectively. The injection site was the tibialis anterior muscle, and the dose was 5 μg each time.

[0315] Blank immunization group: Mice were immunized with an empty vector that does not encode the immunogen at weeks 0, 2, and 4. The injection site was the anterior tibialis muscle, and the dose was 5 μg each time.

[0316] (2) Blood samples were collected from mice in the pVax-S immunized group and the blank immunized group at weeks 2, 4, and 6 via the orbital vein. After the blood samples were allowed to stand at room temperature for 30 minutes, they were centrifuged at 1000g for 30 minutes, and the supernatant was collected as the serum sample. The serum sample was used to determine the spike protein antibody titer by enzyme-linked immunosorbent assay (ELISA) in Section 3 below, to measure the humoral immune response of the highly biologically active plasmid DNA vaccine obtained by the preparation method of highly biologically active plasmid DNA.

[0317] (3) Mice in the pVax-S immunized group and the blank immunized group were sacrificed by cervical dislocation at week 6, and spleen samples were then collected and soaked in PBS buffer at 0°C. The number of IFN-γ positive spleen cells responding to the spike protein was determined by enzyme-linked immunospot assay (ELISPOT) in Section 4 below, to measure the cellular immune response of the highly biologically active plasmid DNA vaccine prepared by the method of preparing highly biologically active plasmid DNA.

[0318] 3. Enzyme-linked immunosorbent assay (ELISA) to determine spike protein antibody titer

[0319] (1) Dilute the spike protein antigen to 2 μg / mL with antigen coating solution; and add it to the ELISA assay plate at a rate of 100 μL / well, and coat overnight at 4°C;

[0320] (2) The next day, remove the coating solution and wash three times with PBST containing 0.1% Tween-20; add 200 μL of blocking solution and block at 37°C for 2 h. The blocking solution is PBS buffer containing 5% BSA.

[0321] (3) Dilute the serum sample obtained from mice in Section 2, Part (2) above with blocking solution: serum sample = 1:10000, and transfer the diluted serum sample to the coated ELISA plate, 100 μL per well, and incubate at 37°C for 1 h; discard the sample and wash with PBST 3-5 times.

[0322] (4) Add secondary antibody (Goat-anti-mouse IgG). Dilute the secondary antibody at a ratio of 1:20000 (secondary antibody: antibody diluent) and add 100 μL to each well of the ELISA plate washed with PBST in step (3). Incubate at 37°C for 1 hour. Discard the secondary antibody and wash with PBST 3-5 times.

[0323] (5) Add 100 μL of single-component TMB colorimetric solution to each well of the ELISA assay plate washed with PBST in step (4) for color development. After the color development reaches a suitable depth, add 50 μL of stop solution to each well to terminate the process. Use an ELISA reader to read the OD450 absorbance. The statistical results are shown in C in Figure 9.

[0324] 4. Enzyme-linked immunospot assay (ELISPOT) to determine the number of IFN-γ-positive spleen cells in response to the mouse spike protein.

[0325] (1) Add 1.5 mL of 0℃ lymphocyte separation medium to each well of a 24-well plate and place it on an ice plate. Transfer the spleen sample obtained from mice in Section 2, Part (3) above into the plate. Grind the spleen using a 5 / 10 mL syringe plunger until the grinding solution is dark red and turbid to obtain a grinding suspension. Filter the grinding suspension through a flow cytometer; transfer the filtered grinding suspension to 2 mL centrifuge tubes, add 0.3 mL of RPMI-1640 to each tube, and centrifuge at 800 g at 4℃ for 30 min to obtain the lymphocyte layer.

[0326] (2) Aspirate the lymphocyte layer and transfer it to a new 15mL centrifuge tube. Add 10mL of RPMI-1640 medium to each tube, centrifuge at 200g at 4℃ for 10min, discard the supernatant, and obtain the cell pellet.

[0327] (3) Resuspend the cell pellet in 0.6 mL of serum-free lymphocyte culture medium. Dilute 100-fold and place 0.1 mL in each well of a 96-well plate. Add an equal volume of 0.4% trypan blue staining solution. Count the cells using a BioRad automated cell counter to calculate the cell concentration. Dilute the cells to 5 × 10⁶ cells / well using serum-free lymphocyte culture medium according to the cell concentration. 6 / mL, take 200μL into a 96-well plate for later use, and seed the plate with a pipette at a rate of 50μL per well (250,000 cells).

[0328] (4) Dilute the spike protein peptide library with serum-free lymphocyte culture medium to prepare a culture medium with a spike protein peptide library concentration of 0.2 mg / mL, and take 200 μL of the culture medium into a 96-well plate for later use.

[0329] Experimental wells (+): Add 50 μL of the cells obtained in step (3) into the wells containing the culture medium using a pipette.

[0330] Negative control wells (-): Add 50 μL of the cells obtained in step (3) into wells that do not contain the culture medium using a pipette, and incubate at 37°C for 20 hours.

[0331] (5) Pour out the cells and culture medium from the wells, add 200 μL of 0℃ deionized water per well, and incubate at 4℃ for 10 min to lyse the cells; perform color development using the colorimetric reagent in the ELISA kit, specifically, use 250 μL of 1x Washing Buffer working solution per well, let stand for 1 min and then discard the liquid in the well, repeat 3 times; add 100 μL of 1x Biotinylated Antibody working solution to each experimental well. Incubate at 37℃ for 1 hour; use 250 μL of 1x Washing Buffer working solution per well, let stand for 1 min and then discard the liquid in the well, repeat 3 times; add 100 μL of 1x Streptavidin-HRP working solution to each experimental well. Incubate at 37℃ for 1 hour; add 100 μL of AEC chromogenic solution per well, incubate at room temperature in the dark for 30 minutes, and select the termination time based on spot formation. If the room temperature is below 20℃, it is recommended to perform chromogenic incubation at 37℃, checking every 5-10 minutes. Use an ELISPOT plate reader to read the spots, as shown in Figure 9, B. The statistical results are shown in Figure 9, D.

[0332] Figure 9C shows the serum anti-spike protein antibody titer in mice immunized with three doses of pVax-S or in a blank immunization group, as detected by enzyme-linked immunosorbent assay (ELISA). The results indicate that the plasmid purified using the purification method of this invention can induce high-titer antibody production in DNA vaccines. Figure 9B shows the results of an ELISA assay on spleen cells from mice immunized with three doses of pVax-S or in a blank immunization group. Figure 9D shows the number of interferon-γ positive cells responding to the spike protein in spleen cells from mice immunized with three doses of pVax-S and in a blank immunization group, as detected by ELISA. The results demonstrate that the highly biologically active plasmid DNA prepared by the method of this invention can induce high levels of cellular immunity in DNA vaccines.

[0333] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A highly biologically active plasmid DNA, characterized in that, Biological activity is measured by the expression level of the protein encoded by the plasmid after intramuscular injection. The expression level of the protein encoded by the highly biologically active plasmid DNA after intramuscular injection is 10 times or more higher than that of plasmids extracted by conventional methods or kits.

2. The highly biologically active plasmid DNA according to claim 1, wherein, The highly biologically active plasmid DNA was prepared by the following steps: (A) Lysis of bacterial cells: Add ammonium sulfate solution containing greater than or equal to 2.0M to lyse bacterial cells containing DNA. Clarify the obtained lysate and collect the supernatant, i.e., the crude solution containing plasmids. The final concentration of ammonium sulfate in the crude solution is 2.0-3.2M. (B) Purification of plasmid DNA: The crude solution containing plasmid is subjected to hydrophobic chromatography through a mobile phase containing a mixture of 1.45M-2.1M ammonium sulfate to obtain hydrophobic chromatographic products. The mobile phase is one or more types. (C) Further purification of plasmid DNA: Dilute the hydrophobic chromatography product, and pass the diluted hydrophobic chromatography product through a mobile phase containing a conductive solution of less than or equal to 1 M for ion exchange chromatography to obtain purified plasmid DNA. The mobile phase may be one or more types. (D) Activation of plasmid DNA: The purified plasmid DNA is precipitated by monohydric alcohol and / or polyhydric alcohol to obtain plasmid DNA precipitate, which is used to activate the purified plasmid DNA, thus obtaining highly biologically active plasmid DNA.

3. The method for preparing highly biologically active plasmid DNA according to claim 1, characterized in that, It includes the following steps: (A) Lysis of bacterial cells: Add ammonium sulfate solution containing greater than or equal to 2.0M to lyse bacterial cells containing DNA. Clarify the obtained lysate and collect the supernatant, i.e., the crude solution containing plasmids. The final concentration of ammonium sulfate in the crude solution is 2.0-3.2M. (B) Purification of plasmid DNA: The crude solution containing plasmid is subjected to hydrophobic chromatography through a mobile phase containing a mixture of 1.45M-2.1M ammonium sulfate to obtain hydrophobic chromatographic products. The mobile phase is one or more types. (C) Further purification of plasmid DNA: Dilute the hydrophobic chromatography product, and pass the diluted hydrophobic chromatography product through a mobile phase containing a conductive solution of less than or equal to 1 M for ion exchange chromatography to obtain purified plasmid DNA. The mobile phase may be one or more types. (D) Activation of plasmid DNA: The purified plasmid DNA is precipitated by monohydric alcohol and / or polyhydric alcohol to obtain plasmid DNA precipitate, which is used to activate the purified plasmid DNA, thus obtaining highly biologically active plasmid DNA.

4. The preparation method according to claim 3, characterized in that, It includes the following steps: Step 1) Scale-up culture: The bacterial strain containing the plasmid is subjected to scale-up culture; Step 2) Lysis of bacterial cells: Add an ammonium sulfate solution containing ≥2.0M to the bacterial cells after expansion culture in Step 1 to lyse the bacterial cells containing DNA; preferably, perform solid-liquid separation on the bacterial cells after expansion culture in Step 1, and resuspend the separated bacterial cells at a ratio of 1g:3-10mL based on the wet weight of the separated bacterial cells to the volume of the first solution (g:mL), and then add a second solution and a third solution to lyse the bacterial cells containing DNA; Wherein, the first solution is a solution containing ethylenediaminetetraacetic acid and / or tris(hydroxymethyl)aminomethane hydrochloride; The second solution is an alkaline solution containing a surfactant; The third solution is an ammonium sulfate solution containing 2.0 M or more; In this process, the volume ratio of the first solution, the second solution, and the third solution is 1:1:2-7. Specifically, the bacterial cells are mixed with the first solution to resuspend the bacterial cells; after resuspension, the second solution is added to the bacterial cells in the above ratio to lyse the bacterial solution at room temperature; after lysis, the third solution is added to the lysis products in the above ratio to neutralize the alkaline lysis products, thereby obtaining a lysate. The lysate is then clarified, and the supernatant, i.e., the crude solution containing plasmids, is collected. The final concentration of ammonium sulfate in the crude solution is 2.0-3.2M. Step 3) Purification of plasmid DNA: The crude solution containing the plasmid is loaded onto a hydrophobic chromatography column and then subjected to hydrophobic chromatography with a mobile phase containing a mixture of 1.45M-2.1M ammonium sulfate to obtain hydrophobic chromatographic products. The mobile phase is one or more types. Step 4) Further purification of plasmid DNA: Dilute the hydrophobic chromatographic product, load the diluted hydrophobic chromatographic product onto an ion-exchange chromatography column, and then perform ion-exchange chromatography with a mobile phase containing a conductive solution of 1 M or less to obtain purified plasmid DNA. One or more species; Step 5) Activating plasmid DNA: The purified plasmid DNA is precipitated with a monohydric alcohol and / or a polyhydric alcohol, and / or concentrated by lyophilization or ultrafiltration followed by precipitation with a monohydric or polyhydric alcohol to activate the purified plasmid DNA, obtaining highly biologically active plasmid DNA; and Step 6): Storing plasmid DNA: Storing the highly biologically active plasmid DNA in a monohydric alcohol and / or a polyhydric alcohol.

5. A method for storing highly biologically active plasmid DNA, characterized in that, It includes the following steps: (A) Lysis of bacterial cells: Add ammonium sulfate solution containing greater than or equal to 2.0M to lyse bacterial cells containing DNA. Clarify the obtained lysate and collect the supernatant, i.e., the crude solution containing plasmids. The final concentration of ammonium sulfate in the crude solution is 2.0-3.2M. (B) Purification of plasmid DNA: The crude solution containing plasmid is subjected to hydrophobic chromatography through a mobile phase containing a mixture of 1.45M-2.1M ammonium sulfate to obtain hydrophobic chromatographic products. The mobile phase is one or more types. (C) Further purification of plasmid DNA: dilute the hydrophobic chromatography product, and pass the diluted hydrophobic chromatography product through a mobile phase containing a conductive solution of less than or equal to 1 M for ion exchange chromatography to obtain purified plasmid DNA. The mobile phase may be one or more types. (D) Activation of plasmid DNA: The purified plasmid DNA is precipitated by passing it through a monohydric alcohol and / or a polyhydric alcohol to obtain a plasmid DNA precipitate, which is used to activate the purified plasmid DNA, thus obtaining highly biologically active plasmid DNA; and (E) Storage of plasmid DNA: Storing highly biologically active plasmid DNA in monohydric and / or polyhydric alcohols.

6. The storage method according to claim 5, characterized in that, It includes the following steps: It includes the following steps: Step 1) Scale-up culture: The bacterial strain containing the plasmid is subjected to scale-up culture; Step 2) Lysis of bacterial cells: An ammonium sulfate solution containing ≥2.0 M is added to the bacterial cells after the expansion culture in Step 1 to lyse the DNA-containing cells; preferably, solid-liquid separation is performed on the bacterial cells after the expansion culture in Step 1, and the weight is calculated as the wet weight of the separated bacterial cells to the volume ratio of the first solution (g:mL). The separated bacterial cells were resuspended at a wet weight ratio of 1g to 3-10mL of the first solution, and then the second and third solutions were added to lyse the DNA-containing bacterial cells. Wherein, the first solution is a solution containing ethylenediaminetetraacetic acid and / or tris(hydroxymethyl)aminomethane hydrochloride; The second solution is an alkaline solution containing a surfactant; The third solution is an ammonium sulfate solution containing 2.0 M or more; In this process, the volume ratio of the first solution, the second solution, and the third solution is 1:1:2-7. Specifically, the bacterial cells are mixed with the first solution to resuspend the bacterial cells; after resuspension, the second solution is added to the bacterial cells in the above ratio to lyse the bacterial solution at room temperature; after lysis, the third solution is added to the lysis products in the above ratio to neutralize the alkaline lysis products, thereby obtaining a lysate. The lysate is then clarified, and the supernatant, i.e., the crude solution containing plasmids, is collected. The final concentration of ammonium sulfate in the crude solution is 2.0-3.2M. Step 3) Purification of plasmid DNA: The crude solution containing the plasmid is loaded onto a hydrophobic chromatography column and then subjected to hydrophobic chromatography with a mobile phase containing a mixture of 1.45M-2.1M ammonium sulfate to obtain hydrophobic chromatographic products. The mobile phase is one or more types. Step 4) Further purification of plasmid DNA: Dilute the hydrophobic chromatography product, load the diluted hydrophobic chromatography product onto an ion exchange chromatography column, and then perform ion exchange chromatography through a mobile phase containing a conductive solution of less than or equal to 1 M to obtain purified plasmid DNA. The mobile phase may be one or more types. Step 5) Activating plasmid DNA: The purified plasmid DNA is precipitated with a monohydric alcohol and / or a polyhydric alcohol, and / or concentrated by lyophilization or ultrafiltration followed by precipitation with a monohydric or polyhydric alcohol to activate the purified plasmid DNA, obtaining highly biologically active plasmid DNA; and Step 6): Storing plasmid DNA: Storing the highly biologically active plasmid DNA in a monohydric alcohol and / or a polyhydric alcohol.

7. The preparation method according to claim 3 or 4, or the storage method according to claim 5 or 6, characterized in that, The monohydric alcohol is ethanol or isopropanol; the polyhydric alcohol is polyethylene glycol.

8. The preparation method or storage method according to any one of claims 3-7, characterized in that, Storage temperature is -18 to -24℃.

9. The preparation method or storage method according to any one of claims 3-8, characterized in that, The third solution is an ammonium sulfate solution containing 2.1-4.0M, preferably an ammonium sulfate solution containing 4.0M.

10. The preparation method or storage method according to any one of claims 3-9, characterized in that, Step 3) specifically includes: (1) Column equilibration: Use two or more hydrophobic chromatography columns to equilibrate with the first mobile phase, preferably three column volumes; (2) Sample loading: The crude liquid containing plasmids is passed through a hydrophobic chromatography column; (3) Eluting: Elute the hydrophobic chromatography column with the second mobile phase until all indicators are stable; (5) Elution: Elution was performed using a third mobile phase, and the eluted product was collected to obtain the hydrophobic chromatographic product.

11. The preparation method or storage method according to any one of claims 3-10, characterized in that, The first mobile phase is a mixture containing 2.0-2.1M ammonium sulfate, preferably a mixture containing 2.1M ammonium sulfate; The second mobile phase is a mixture containing 1.90-2.05M ammonium sulfate, preferably a mixture containing 1.95-2.00M ammonium sulfate; The third mobile phase is a mixture containing 1.45M-1.8M ammonium sulfate, preferably a mixture containing 1.50-1.8M ammonium sulfate.

12. The preparation method or storage method according to any one of claims 3-11, characterized in that, Step 4 specifically includes: (1) Column equilibration: Use two or more ion-exchange chromatographic columns with a fourth mobile phase, preferably three column volumes; (2) Sample loading: The hydrophobic chromatographic product is mixed with the fourth mobile phase at a volume ratio of 1:1-3 to dilute the hydrophobic chromatographic product, and then the diluted hydrophobic chromatographic product is passed through an ion exchange chromatography column. (3) Eluting: Elute the ion exchange column with the fifth mobile phase until the column volume of each index is stable; (4) Elution: Elute using the sixth mobile phase and collect the elution product to obtain purified plasmid DNA. The ion exchange column is an anion exchange column, and preferably, the ion exchange column is a strong anion exchange column.

13. The preparation method or storage method according to any one of claims 3-12, characterized in that, The conductivity of the diluted hydrophobic chromatographic product is below 100 mS / cm.

14. The preparation method or storage method according to any one of claims 3-13, characterized in that, The fourth mobile phase is a low-conductivity solution with a conductivity of less than 40 mS / cm, preferably a mixture of water and / or containing 0-50 mM ethylenediaminetetraacetic acid; The fifth mobile phase is a medium conductivity solution with a conductivity between 40-60 mS / cm, preferably a mixture containing 0.4-0.50 M sodium chloride; The sixth mobile phase is a high conductivity solution with a conductivity of 60 mS / cm or higher, preferably a mixture containing 0.5 M to 1 M sodium chloride.

15. A vaccine obtained by using highly biologically active plasmid DNA as described in claim 1 or 2, or highly biologically active plasmid DNA obtained by any of the preparation methods described in 3-14.

16. The vaccine according to claim 15, characterized in that, The vaccine is an injectable vaccine. Preferably, the injectable vaccine is obtained by mixing highly biologically active plasmid DNA obtained by the preparation method described in claim 1 or 2 or any of the preparation methods described in 3-14 with a buffer solution.

17. A kit comprising a reagent or vaccine made from highly biologically active plasmid DNA as described in claim 1 or 2, or from plasmid DNA prepared by the method for preparing highly biologically active plasmid DNA according to any one of claims 3-14.

18. The use of the highly biologically active plasmid DNA according to claim 1 or 2, or the highly biologically active plasmid DNA prepared by any one of claims 3-14, in vaccine preparation or gene therapy.

Images