Delivery system for targeting retinal pigment epithelial cell and use thereof

Through the biotin linker covalently with nucleic acids and organic compounds, SMVT transmembrane transporter and lipid nanoparticles are used to achieve efficient delivery and gene editing, solving the efficiency and safety of the retinal pigment epithelial cell delivery system, especially for the treatment of retinal degeneration diseases.

WO2025167275A1PCT designated stage Publication Date: 2025-08-14BASE THERAPEUTICS (SHANGHAI) CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/135058
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-08
Filing Date
2024-11-27
Publication Date
2025-08-14

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently deliver nucleic acids and organic compounds to retinal pigment epithelial cells in delivery systems, especially for the treatment of retinal degeneration diseases such as wet AMD, with low delivery efficiency and safety issues.

Method used

Biotin linkers are used to covalently connect nucleic acids and/or organic compounds, targeted delivery is achieved through SMVT transmembrane transporter, and gene editing and treatment are carried out in combination with lipid nanoparticles (LNPs).

Benefits of technology

It has achieved efficient delivery of nucleic acids and organic compounds to retinal pigment epithelial cells, with a transfection efficiency of nearly 100%, a maximum efficiency of knocking down target genes by 63%, and has shown targeting and safety in vivo.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024135058_14082025_PF_FP_ABST
    Figure CN2024135058_14082025_PF_FP_ABST
Patent Text Reader

Abstract

The present application relates to the biotechnology, and particularly, disclosed is a delivery vector suitable for cell transfection. The delivery vector provided by the present application not only can deliver nucleic acids but also can deliver other organic compounds. The delivery vector provided by the present application has a simple preparation method, low cost, and high delivery efficiency. The delivery vector provided by the present application achieves near 100% transfection efficiency, with a maximal target gene knockdown efficiency of 63%.
Need to check novelty before this filing date? Find Prior Art

Description

A delivery system targeting retinal pigment epithelial cells and its application Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to the use of biotin in preparing nucleic acid and / or organic compound delivery vectors suitable for cell transfection. Background Art

[0002] Sodium dependent multivitamin transporter (SMVT) is an important transmembrane protein responsible for the transmembrane transport of multiple vitamins and other cofactors (such as biotin, pantothenic acid, and lipoic acid). SMVT is expressed in various tissues such as the placenta, intestine, brain, liver, lung, kidney, cornea, retina, and heart. It also has broad substrate specificity and excellent drug delivery capabilities. Drug absorption is usually limited by cell morphology (epithelial tight junctions), physicochemical properties (efflux transporters, enzymatic degradation), and the properties of the substance itself (molecular size, lipophilicity, charge). These obstacles can cause many potential treatments and therapeutic drugs to fail to play a real role, so the delivery system is particularly important in the development of some drugs.

[0003] The retinal pigment epithelium (RPE) is composed of a single layer of retinal pigment epithelial cells (RPE cells) located between the retina and the choroid. The RPE plays a vital role in the normal physiological activities of the eye and eye health. RPE cells are non-dividing cells, and their loss can have an immeasurable impact on eye health.

[0004] As one of the components of the blood-eye barrier, RPE cells secrete vascular endothelial growth factor (VEGF), especially VEGFA (a type of VEGF), which plays an important role in the normal physiological activities of choroidal capillaries. Age-related macular degeneration (AMD) is an acquired retinal degeneration disease that is particularly prevalent in the elderly. Severe central vision damage is caused by the formation of non-neovascular (drusen and RPE abnormalities) and neovascular disorders. Among them, the non-neovascular type is atrophic or dry AMD, and the neovascular type is exudative or wet AMD (wAMD). The choroidal neovascularization (Choroidal Neovascularization, CNV) of wAMD infiltrates into the retina, seriously affecting the patient's vision. Moreover, CNV is stimulated by VEGFA, the capillary permeability increases, and blood leaks into the fundus, further worsening the patient's vision.

[0005] The growth of CNV is regulated by VEGFA. By reducing the VEGFA content in the eye, the CNV atrophies, thereby controlling the progression of the disease and even curing it. RPE cells secrete a large amount of VEGFA to the side close to the choroid to maintain the normal growth of choroidal blood vessels. For patients with wAMD, the VEGFA secreted by RPE cells becomes an accomplice, promoting the development of CNV. Therefore, limiting the secretion of VEGFA by RPE cells is the most important means of treating wAMD. Currently, VEGF neutralizing antibodies are mainly used in clinical practice to treat wet AMD, such as Bevacizumab, Ranibizumab, Aflibercept and Brolucizumab. However, these anti-VEGF drugs have some adverse reactions to long-term repeated administration, such as chorioretinal atrophy.

[0006] Based on this, there is an urgent need to develop a more efficient and safer drug and method for treating ophthalmic diseases. Summary of the Invention

[0007] In order to solve the above problems, the present application provides the use of biotin in the preparation of a nucleic acid and / or organic compound delivery vector suitable for retinal pigment epithelial cell transfection, in which biotin and the nucleic acid and / or organic compound are connected via a linker and / or a covalent bond.

[0008] The present application also provides a method for delivering nucleic acids and / or organic compounds to cells, comprising contacting the delivery vector used in the above application with cells.

[0009] The present application also provides a gene editing method, comprising contacting the delivery vector used in the above application with cells containing the gene to be edited.

[0010] The present application also provides a delivery vector suitable for cell transfection, which is the delivery vector used in the above application.

[0011] The delivery vector and its application proposed in this specification bring about beneficial effects including but not limited to: (1) The delivery vector provided in this application can deliver not only nucleic acids, but also other organic compounds; (2) The preparation method of the delivery vector provided in this application is simple, low-cost, and has high delivery efficiency; (3) The transfection efficiency of the delivery vector provided in this application is close to 100%; (4) The efficiency of knocking down the target gene of the delivery vector provided in this application is as high as 63%. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The present application will be further described in terms of exemplary embodiments, which will be described in detail with reference to the accompanying drawings. These embodiments are non-limiting, and include:

[0013] FIG1 is an image of ARPE19 cells incubated with Biotin-PEG-RhB and mPEG-RhB, respectively, under a fluorescence microscope according to some embodiments of the present application;

[0014] FIG2 is a flow cytometry graph showing ARPE19 cells incubated with different concentrations of Biotin-PEG-RhB or mPEG-RhB for 1 hour according to some embodiments of the present application;

[0015] FIG3 is a flow cytometry graph showing ARPE19 cells incubated with different concentrations of Biotin-PEG-RhB or mPEG-RhB for 6 hours according to some embodiments of the present application;

[0016] FIG4 is a flow cytometry graph showing ARPE19 cells incubated with different concentrations of Biotin-PEG-RhB or mPEG-RhB for 24 hours according to some embodiments of the present application;

[0017] FIG5 shows the fluorescence positive rate percentage and fluorescence intensity of ARPE19 cells after incubation with different concentrations of Biotin-PEG-RhB or mPEG-RhB according to some embodiments of the present application, FIG5A shows the fluorescence positive rate percentage at different concentrations and time, and FIG5B shows the fluorescence intensity at different concentrations and time;

[0018] FIG6 shows the positive rate of ARPE19 cells transfected with FAM / Cy3-labeled Biotin-siRNA according to some embodiments of the present application;

[0019] FIG7 shows the positive rate of APRE19 cells transfected with Biotin-siRNA-Cy3 at different concentrations for 3 hours according to some embodiments of the present application;

[0020] FIG8 shows the positive rates of APRE19 and 293T cells transfected with Biotin-siRNA-Cy3 at different concentrations 24 hours after transfection according to some embodiments of the present application;

[0021] FIG9 shows the normalized fluorescence intensity of APRE19 and 293T cells 24 hours after transfection of Biotin-siRNA-Cy3 according to some embodiments of the present application;

[0022] FIG10 shows the fluorescence intensity of APRE19 and 293T cells transfected with siRNA-Cy3 according to some embodiments of the present application;

[0023] FIG11 shows the knockdown effects of Biotin-EGFP siRNA-Modified, Biotin-EGFP siRNA or EGFP siRNA on 293T cells and ARPE19 cells according to some embodiments of the present application;

[0024] FIG12 shows the knockdown effects of Biotin-VEGFA siRNA-Modified, VEGFA siRNA, and Negative-siRNA on ARPE19 cells according to some embodiments of the present application;

[0025] FIG13 shows the protein expression of ARPE19 cells after LNPs modified with biotin at different ratios were transfected according to some embodiments of the present application;

[0026] FIG14 shows the protein expression after transfection of 293T, C2C12, N2A or ARPE19 cells with biotin-modified LNPs according to some embodiments of the present application;

[0027] FIG15 shows the in vivo delivery effect of Biotin-siRNA-Cy3 according to some embodiments of the present application;

[0028] FIG16 shows the in vivo delivery effect of Biotin-LNP according to some embodiments of the present application;

[0029] FIG17 shows the base editing efficiency of Biotin-LNP encapsulating ABEmRNA+VEGFAsgRNA in vivo according to some embodiments of the present application;

[0030] Figure 18 shows the base editing efficiency of Biotin-LNP encapsulating ABEmRNA+VEGFAsgRNA in vivo according to some embodiments of the present application. DETAILED DESCRIPTION

[0031] To more clearly illustrate the technical solutions of the embodiments of this specification, the following briefly describes the drawings required for describing the embodiments. Obviously, the drawings described below are merely examples or embodiments of this specification. Those skilled in the art can apply this specification to other similar scenarios based on these drawings without inventive effort. Unless otherwise apparent from the context or otherwise noted, the same reference numerals in the figures represent the same structure or operation.

[0032] As used in this specification and claims, unless the context clearly indicates otherwise, the words "a," "an," "an," and / or "the" do not refer to the singular but also include the plural. Generally speaking, the terms "comprises" and "include" only indicate the inclusion of the steps and elements specifically identified, and these steps and elements do not constitute an exclusive list. A method or apparatus may also include other steps or elements.

[0033] Flowcharts are used throughout this specification to illustrate the operations performed by systems according to embodiments of this specification. It should be understood that preceding or following operations do not necessarily need to be performed in exact order. Instead, the steps may be processed in reverse order or simultaneously. Furthermore, other operations may be added to these processes, or one or more operations may be removed from these processes.

[0034] The present application provides the use of biotin in preparing a nucleic acid and / or organic compound delivery vector suitable for retinal pigment epithelial cell transfection, wherein the biotin and the nucleic acid and / or organic compound are connected via a linker and / or a covalent bond.

[0035] The organic compound in this application refers to a biological functional molecule with a molecular weight of less than 1000 Daltons.

[0036] Nucleic acid refers to a polymer containing at least two deoxyribonucleotides or ribonucleotides in single- or double-stranded form and includes DNA, RNA, and hybrids thereof.

[0037] In some embodiments, the delivery vector is suitable for treating eye-related diseases. In some embodiments, preferably, the eye-related disease can be a VEGF-related eye disease. In some embodiments, the VEGF-related eye disease includes any one or more of age-related macular degeneration, diabetic macular edema, neovascular glaucoma, retinal vein occlusion, or diabetic retinopathy.

[0038] In some embodiments, preferably, the eye-related disease may be an acquired retinal degenerative disease. In some embodiments, more preferably, the acquired retinal degenerative disease may be an age-related macular degeneration disease. In some embodiments, further preferably, the age-related macular degeneration disease may include dry age-related macular degeneration disease and wet age-related macular degeneration disease.

[0039] In some embodiments, the delivery vector is suitable for regulating gene expression. In some embodiments, the delivery vector is suitable for silencing or knocking down gene expression. In some embodiments, preferably, the delivery vector can be used for silencing or knocking down gene expression in retinal pigment epithelial cells. In some embodiments, more preferably, the gene can be a gene abnormally expressed in retinal pigment epithelial cells. In some embodiments, further preferably, the gene can be VEGF. In some embodiments, further preferably, the VEGF can be VEGFA.

[0040] In the present application, "silencing" refers to the non-expression of a specific gene in an organism due to various reasons, and "knockdown" refers to the reduction of the expression of a specific gene product (eg, protein, mRNA, or both).

[0041] In some embodiments, the delivery vector may be suitable for gene editing.

[0042] In some embodiments, the nucleic acid may be RNA or DNA; in some embodiments, preferably, the RNA may include one or more of antisense RNA, ASO, saRNA, mRNA, lncRNA, miRNA, siRNA, piRNA, sgRNA, and tsRNA. In some embodiments, more preferably, the siRNA encoding nucleotide sequence is as shown in SEQ ID NO. 3.

[0043] RNA interference (RNAi) refers to the efficient and specific blocking of specific gene expression in vivo by small double-stranded RNAs (dsRNAs), which promote mRNA degradation and induce cells to exhibit a phenotype consistent with gene deletion. RNAi technology involves designing a gene-targeting sequence (approximately 19-23 bp) of double-stranded RNA (siRNA). This sequence is recognized and cleaved by the Dicer enzyme within the cell, where it is then loaded into the RNA-induced silencing complex (RISC). RISC then binds to the target gene's mRNA and cleaves it, thereby blocking protein translation. Therefore, RNAi technology is a powerful tool for regulating RNA levels without requiring genome modification. Within the cell, siRNAs replicate using themselves as primers, resulting in prolonged mRNA knockdown, representing a method of regulating gene expression at the RNA level. Therefore, the use of siRNA offers numerous advantages over injectable monoclonal antibodies. Furthermore, numerous siRNA drugs are already clinically available. However, their application in ophthalmology is limited. A fundamental reason for this is the difficulty in siRNA delivery.

[0044] The sgRNA can guide the Cas nuclease to a target sequence on a target nucleic acid molecule, where the sgRNA hybridizes to the target sequence and the Cas nuclease cleaves or regulates the target sequence.

[0045] Antisense oligonucleotides (ASOs) are single-stranded deoxyribonucleotides of approximately 18-30 bases that complement the target mRNA to form a DNA-RNA heteroduplex. They induce the RNase H endonuclease to recognize the DNA-RNA substrate and catalyze the degradation of the RNA strand. This knocks down the mRNA and significantly reduces target gene translation, also regulating gene expression at the RNA level.

[0046] In some embodiments, the RNA may be a modified RNA. In some embodiments, preferably, the modification may be a ribose 2'-F or 2'-OMe modification. Modification may make the RNA more stable and prevent RNA degradation.

[0047] In some embodiments, the biotin may be located at the 5' and / or 3' end of the nucleic acid.

[0048] In some embodiments, the organic compound can be any one or more of a peptide, protein, fat, phospholipid, sugar, vitamin, or fluorescent dye. In some embodiments, preferably, the organic compound can be a fluorescent dye. In some embodiments, the fluorescent dye can be a dye that fluoresces under acidic conditions. In some embodiments, the fluorescent dye can be rhodamine or Cy3.

[0049] In some embodiments, the linker can be selected from an amino acid residue, PEG or an alkyl group. In some embodiments, preferably, the amino acid residue can be an amino acid residue formed by 2 to 10 amino acids. In some embodiments, preferably, the molecular weight of the PEG can be 400Da to 40000Da. In some embodiments, preferably, the alkyl group can be C1-C 18 of alkyl.

[0050] In some embodiments, the covalent bond of the covalent linkage may include any one or more of an amide bond, an ester bond, a disulfide bond, a phosphodiester bond, an ether bond, or a thioether bond. In some embodiments, preferably, the covalent bond may be an amide bond.

[0051] In some embodiments, the method of covalent attachment can be photocrosslinking covalent coupling or biochemical coupling.

[0052] In some embodiments, the retinal pigment epithelial cells may be ARPE19 cells.

[0053] The present application also provides a method for delivering nucleic acids and / or organic compounds to cells, comprising contacting the delivery vector used in the above application with cells.

[0054] In some embodiments, the method for delivering nucleic acids and / or organic compounds to cells can be a method for delivering nucleic acids and / or organic compounds to cells for non-disease diagnosis and treatment purposes. In some embodiments, the method for delivering nucleic acids and / or organic compounds to cells can be a method for delivering nucleic acids and / or organic compounds to cells for disease diagnosis and treatment purposes.

[0055] In some embodiments, the methods of delivering nucleic acids and / or organic compounds to cells can be performed in vivo or in vitro.

[0056] In some embodiments, the delivery vector may enter the cell via endocytosis.

[0057] In some embodiments, the cell may be a eukaryotic cell. In some embodiments, preferably, the eukaryotic cell may be selected from HEK293 cells, retinal pigment epithelial cells, mouse myoblasts, or mouse brain neuroma cells. In some embodiments, more preferably, the retinal pigment epithelial cells may be ARPE19 cells.

[0058] The present application also provides a gene editing method, comprising contacting the delivery vector used in the above application with cells containing the gene to be edited.

[0059] In some embodiments, the gene editing method can be a gene editing method for non-disease diagnosis and treatment purposes. In some embodiments, the gene editing method can be a gene editing method for disease diagnosis and treatment purposes.

[0060] In some embodiments, the gene editing methods can be performed in vivo or in vitro.

[0061] In some embodiments, the cell may be a eukaryotic cell. In some embodiments, preferably, the eukaryotic cell may be selected from HEK293 cells, retinal pigment epithelial cells, mouse myoblasts, or mouse brain neuroma cells. In some embodiments, more preferably, the retinal pigment epithelial cells may be ARPE19 cells.

[0062] The present application also provides a method for detecting nucleic acid transfection efficiency, comprising contacting the nucleic acid in the form of a delivery vector in the above application with the cells to be transfected; biotin and a fluorescent dye are respectively connected at both ends of the nucleic acid.

[0063] In some embodiments, the fluorescent dye may include any one or more of CY3, CY5, Pacific, PE, FAM, RhB, APC, FITC, or DAPI. In some embodiments, preferably, the fluorescent dye may be a dye that fluoresces under acidic conditions. In some embodiments, more preferably, the fluorescent dye may be rhodamine or Cy3.

[0064] The present application also provides a delivery vector suitable for cell transfection, which is the delivery vector used in the above application.

[0065] The experimental methods in the following examples, unless otherwise specified, are all conventional methods. The experimental materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent companies. The quantitative experiments in the following examples were all repeated three times, and the results were averaged.

[0066] Example 1 - Biotin-coupled fluorescent substance tracing

[0067] RPE cell membranes contain numerous sodium-dependent multivitamin transporters (SMVTs), which transport a variety of vitamins. SMVTs have a high affinity for biotin. Biotin-conjugated fluorescent substances were used to characterize RPE cell uptake of biotin-conjugated compounds.

[0068] Biotin-PEG-RhB (biotin-polyethylene glycol-rhodamine B, MW 3400Da) and mPEG-RhB (methylpolyethylene glycol-rhodamine B, MW 2000Da) were purchased from Aladdin and prepared into 100 μM working solution. ARPE19 cells were seeded and cultured in 24-well plates in DMEM high glucose medium supplemented with 10% FBS, with 1×10 cells per well. 5 cells, which contained penicillin (100U / ml) and streptomycin (100μg / ml). Two hours before incubation, the culture medium was changed to antibiotic-free medium. Then, two wells were added with the prepared Biotin-PEG-RhB (biotin-coupled fluorescent agent) or mPEG-RhB (non-biotin-coupled fluorescent agent) working solution to a final concentration of 1μM (diluted 100 times), and incubated for 1 hour. The cells were then washed three times with PBS. The cell culture plate was placed on a fluorescence microscope and the red laser wavelength band was selected for observation. The results are shown in Figure 1. ARPE19 cells incubated with Biotin-PEG-RhB had strong red fluorescence, while ARPE19 cells incubated with mPEG-RhB had almost no fluorescence.

[0069] Example 2 - Characterization of absorption of biotin-coupled fluorescent substances

[0070] Flow cytometry was performed using biotin-conjugated fluorescent substances to characterize the concentration and time dependence of RPE cells on biotin. Working solutions of Biotin-PEG-RhB (BR, biotin-conjugated) were prepared at 1 mM, 200 μM, 100 μM, 20 μM, and 10 μM, and working solutions of mPEG-RhB (PR, non-biotin-conjugated) were prepared at 1 mM and 100 μM. ARPE19 cells were plated and cultured in 24-well plates in DMEM high-glucose medium supplemented with 10% FBS, containing penicillin (100 U / ml) and streptomycin (100 μg / ml). Two hours before incubation, the medium was changed to antibiotic-free medium. Then, triplicate wells were added to each concentration of Biotin-PEG-RhB or mPEG-RhB, each diluted 100-fold (corresponding to the numbers BR-10μM, BR-2μM, BR-1μM, BR-200nM, BR-100nM, PR-10μM, PR-1μM or BR10K, BR2K, BR1K, BR200, BR100, PR10K, PR1K). Three wells of each concentration were incubated for 1, 6, and 24 hours. Flow cytometry was then used to analyze the cells. As shown in Figures 2-4, ARPE19 cells exhibited excellent uptake of Biotin-PEG-RhB in a concentration-dependent manner. As shown in Figure 5, low concentrations showed a strong dependence on time, while high concentrations produced efficient uptake within a short period of time.

[0071] Example 3- Characterization of biotin-conjugated siRNA absorption 1

[0072] Biotin was conjugated to siRNA (SEQ ID NO: 1) using conventional methods and fluorescently labeled with FAM / Cy3. Flow cytometry was performed to characterize the delivery of siRNA. A 20 μM working solution of Biotin-siRNA-FAM (siRNA-BF) and Biotin-siRNA-Cy3 (siRNA-BC) was prepared. ARPE19 cells were seeded and cultured in a 24-well plate in DMEM high-glucose medium supplemented with 10% FBS, with 1x10 cells per well. 5Cells were incubated with penicillin (100 U / ml) and streptomycin (100 μg / ml). Two hours before incubation, the medium was changed to antibiotic-free medium. Biotin-siRNA-FAM or Biotin-siRNA-Cy3 was then added at a 100-fold dilution to a final concentration of 200 nM. Biotin-siRNA-FAM was transfected with lipo2000 as a control (siRNA-BF+lipo2000). After incubation for 3 hours, the cells were washed three times with PBS and detected by flow cytometry. The results are shown in Figure 6. FAM showed almost no fluorescence, while Cy3 had a positive rate of 34.9%. Because FAM showed no fluorescence under relatively acidic conditions, it was considered that the delivery system was mediated by SMVT-mediated endocytosis.

[0073] SEQ ID NO.1:5'GGCTACGTCCAGGAGCGCACC3'

[0074] Example 4- Characterization of biotin-conjugated siRNA absorption 2

[0075] siRNA (SEQ ID NO: 1) was conjugated to biotin using conventional methods and fluorescently labeled with Cy3. Flow cytometry was performed to characterize the delivery of siRNA. A 20 μM working solution of Biotin-siRNA-Cy3 (siRNA-BC) and siRNA-Cy3 (siRNA-C) was prepared. ARPE19 and 293 cells were seeded and cultured in a 24-well plate in DMEM high-glucose medium supplemented with 10% FBS, penicillin (100 U / ml) and streptomycin (100 μg / ml). Two hours before incubation, the medium was changed to antibiotic-free medium. Biotin-siRNA-Cy3 was then added, diluted to final concentrations of 50 nM, 100 nM, 200 nM, 1 μM, and 2 μM (corresponding to the numbers BC50, BC100, BC200, BC1k, and BC2k). siRNA-Cy3 was diluted to a final concentration of 200 nM (C200), and Lipo2000 was used as a control (C200-lipo). After incubation for 3 or 24 hours, cells were washed three times with PBS and analyzed by flow cytometry. The results are shown in Figures 7-10. The delivery system exhibits concentration- and time-dependent properties. Although low concentrations exhibit lower transfection efficiency than high concentrations in the short term, they also exhibit excellent transfection efficiency over extended periods. Furthermore, the delivery system exhibits superior efficiency in the ARPE19 cell line compared to the 293T cell line.

[0076] Example 5-Biotin-coupled siRNA knockdown of EGFP in vitro

[0077] Biotin was conjugated to an EGFP-targeting siRNA (SEQ ID NO: 2) using conventional methods, and the knockdown effect of the delivered siRNA was characterized by flow cytometry. Working solutions of Biotin-EGFP siRNA-Modified (EGFP siRNA-BM, ribose 2'-OMe modified), Biotin-EGFP siRNA (EGFP siRNA-B), and EGFP siRNA (EGFP siRNA-O) were prepared at 20 μM. ARPE19 cells were plated and cultured in 24-well plates in DMEM high-glucose medium supplemented with 10% FBS, penicillin (100 U / ml) and streptomycin (100 μg / ml). Two hours before incubation, the medium was changed to antibiotic-free medium. The pEGFP plasmid was then transfected using Lipo2000 and incubated for 6 hours. Then, after washing the cells with PBS, EGFPsiRNA-BM, EGFPsiRNA-B or EGFPsiRNA-O were added and diluted to a final concentration of 1 μM, 200 nM, and 50 nM (corresponding to the numbers BM1k, BM200, BM50, B1k, B200, B50, O1k, O200, and O50, respectively), and 200 nM of EGFPsiRNA-BM (BM200-lip), EGFPsiRNA-B (B200-lip), and EGFPsiRNA-O (O200-lip) were transfected with lipo2000 as controls. After incubation for 24 hours, the cells were washed three times with PBS, detected by flow cytometry, and the 293T cell line was used as a control. The results are shown in Figure 11. The delivery system has a very good knockdown effect on delivering siRNA to ARPE19 cells. Moreover, compared with the 293T cell line, the delivery system has a better efficiency for the ARPE19 cell line.

[0078] SEQ ID NO.2:5'ACGGCAAGCTGACCCTGAAGTTCAT3',

[0079] Example 6- Biotin-coupled siRNA knockdown of VEGFA in vitro

[0080] Biotin was conjugated to siRNA targeting VEGFA (SEQ ID NO: 3) using conventional methods, and qPCR was performed to characterize the knockdown effect of the delivered siRNA. Working solutions of Biotin-VEGFAsiRNA-Modified (BM1), VEGFAsiRNA-Modified (M1), and Negative-siRNA (Mock) were prepared at 20 μM. ARPE19 cells were seeded and cultured in 24-well plates in DMEM high-glucose medium supplemented with 10% FBS, with 1x10 cells per well.5 cells, containing penicillin (100U / ml) and streptomycin (100μg / ml). Two hours before incubation, the culture medium was changed to antibiotic-free medium. Biotin-VEGFAsiRNA-Modified, VEGFAsiRNA-Modified, and Negative-siRNA were added respectively, diluted to a final concentration of 200nM, and a blank was used as a control (Ctrl). After incubation for 48 hours, the cells were washed three times with PBS, and the cells were broken and RNA was extracted for qPCR detection. The results showed that the delivery system had a very good knockdown effect on the delivery of siRNA to ARPE19 cells. The results are shown in Figure 12. The delivery system had a very good knockdown effect on the delivery of siRNA to ARPE19 cells.

[0081] SEQ ID NO.3:5'CCGAAACCATGAACTTTCTGCTGTC3';

[0082] Example 7-In vitro transfection of biotin-coupled lipid nanoparticles 1

[0083] EGFP mRNA (purchased from APExBIO) was delivered into cells by biotin coupling on the surface of lipid nanoparticles (LNP). Flow cytometry was performed to characterize the transfection effect. The LNP surface was modified by coupling biotin to the PEGylated lipids in the LNP formula. The LNP composition is cholesterol 37%, DSPC 10%, SM-10241%, DOTAP 10%, DSPE-PEG 2%; 0-20 mol% biotin was coupled to the LNP surface. EGFP mRNA with an N / P ratio of 6 was encapsulated and prepared into a working solution of 0.4 mg / ml mRNA. ARPE19 cells were seeded and cultured in 24-well plates in DMEM high-glucose culture medium supplemented with 10% FBS, with 1x10 cells per well. 5 Cells were incubated with a 100-μg / ml culture medium containing penicillin (100 U / ml) and streptomycin (100 μg / ml). Two hours before incubation, the medium was changed to antibiotic-free medium. Then, 2.5 μl of LNP solution was added. After 24 hours of incubation, the cells were analyzed by flow cytometry. As shown in Figure 13, biotin-modified LNPs exhibited higher protein expression than unmodified LNPs. Excellent protein expression levels were achieved with only 2% biotin.

[0084] Example 8-In vitro transfection of biotin-coupled lipid nanoparticles 2

[0085] EGFP mRNA (purchased from APExBIO) was delivered into cells via biotin conjugation to the surface of lipid nanoparticles (LNPs). Flow cytometry was performed to characterize transfection efficacy. The LNP surface was modified by conjugating biotin to the PEGylated lipids in the LNP formulation. The preferred LNP composition is 37% cholesterol, 10% DSPC, 1% SM-1024, 10% DOTAP, 2% DSPE-PEG, and 2% biotin. EGFP mRNA was encapsulated at an N / P ratio of 6, and a working solution of 0.4 mg / ml mRNA was prepared. ARPE19 cells were seeded and cultured in 24-well plates in DMEM high-glucose medium supplemented with 10% FBS, containing penicillin (100 U / ml) and streptomycin (100 μg / ml). Two hours before incubation, the medium was changed to antibiotic-free medium. Then, 2.5 μl of the LNP solution was added. After 24 hours of incubation, flow cytometry was used for analysis, with 293T, C2C12, and N2A cell lines used as controls. The results are shown in Figure 14. Biotin-modified LNPs showed the best transfection and protein expression in ARPE19 cells.

[0086] Example 9-Biotin-conjugated siRNA transfection in vivo

[0087] Biotin was conjugated to fluorescently labeled siRNA (Biotin-siRNA-Cy3) (SEQ ID NO: 1) by conventional methods for in vivo delivery studies. Before subretinal injection, mouse eyes were pretreated. Topical administration of 0.5% proparacaine, 1% tropicamide, and 2.5% phenylephrine was performed. Ketamine (100 mg / kg) and xylazine (10 mg / kg) were then injected. After anesthesia, 2.5% hydropropyl methylcellulose was added to cover the mouse eyeball, and then a small incision was made at the edge of the cornea with a 30-gauge needle. 1 ul (500 ng) of Biotin-siRNA-Cy3 was injected with a 33-gauge syringe. After 24 hours, fundus ophthalmoscopy was performed, and then retinal frozen sections were performed. As shown in Figure 15, the delivery system can deliver siRNA to RPE cells in vivo.

[0088] Example 10-Biotin-coupled LNP in vivo transfection 1

[0089] The LNP surface was modified by biotin coupling, and the EGFPmRNA (purchased from APExBIO) reporter gene was encapsulated inside for in vivo delivery studies. Before subretinal injection, the mouse eyes were pretreated. 0.5% proparacaine, 1% tropicamide and 2.5% phenylephrine were administered topically. Ketamine (100 mg / kg) and xylazine (10 mg / kg) were then injected. After anesthesia, 2.5% hydropropyl methylcellulose was added to cover the mouse eyeball, and then a small incision was made at the edge of the cornea with a 30-gauge needle, and then 1 ul (800 ng) Biotin-EGFPmRNA-LNP was injected with a 33-gauge syringe. After 72 hours, funduscopy imaging was performed, followed by retinal frozen sectioning and RPE-choroidal flat mount imaging. The results are shown in Figure 16, and the delivery system can deliver nanoparticles to RPE cells in vivo.

[0090] Example 11-Biotin-coupled LNP in vivo transfection 2

[0091] By biotin coupling modification on the LNP surface, ABEmRNA (purchased from Kaituo Bio) + VEGFAsgRNA (SEQ ID NO: 4, purchased from KingSher) was encapsulated inside to study the gene editing efficiency in vivo. Before subretinal injection, the mouse eyes were pretreated. Topical administration of 0.5% proparacaine, 1% tropicamide and 2.5% phenylephrine. Ketamine (100mg / kg) and xylazine (10mg / kg) were then injected. After anesthesia, 2.5% hydropropyl methylcellulose was added to cover the mouse eyeball, and then a small incision was made at the edge of the cornea with a 30-gauge needle, and then 1ul (RNA concentration 0.5mg / ml and 1.0mg / ml, ABEmRNA: VEGFAsgRNA = 1: 1) was injected with a 33-gauge syringe. Dissection was performed one week later, and the cornea, sclera, retina, RPE and optic nerve were peeled off. Sanger gene sequencing was then performed. As shown in Figure 17, the delivery system can be ABE to specifically edit the VEGFA gene in RPE cells.

[0092] SEQ ID NO.4:CCACCATGCCAAGGTAAGCG

[0093] Example 12-Biotin-coupled LNP in vivo transfection 3

[0094] The surface of LNP was modified by biotin coupling, and ABEmRNA (purchased from Kaituo Bio) + VEGFAsgRNA (SEQ ID NO: 4, purchased from KingSher) was encapsulated inside to study the gene editing efficiency in vivo. The mice were injected into the tail vein at a dose of 1 mg / kg. The samples were dissected one week later. DNA was extracted from the heart, liver, spleen, lung, kidney, brain, testicle (male mice), ovary (female mice), and small intestine of the mice, and then Sanger sequencing was performed to detect the gene editing situation. As shown in Figure 18, only the liver in the mouse body had very weak gene editing (5%), and there was no gene editing in other tissues. Therefore, the biotin-coupled delivery system can specifically deliver various substances to RPE cells, with strong targeting and high safety.

[0095] While the basic concepts have been described above, it will be apparent to those skilled in the art that the detailed disclosure is merely illustrative and does not limit this specification. Although not explicitly stated herein, various modifications, improvements, and revisions to this specification may be made by those skilled in the art. Such modifications, improvements, and revisions are suggested in this specification and remain within the spirit and scope of the exemplary embodiments of this specification.

[0096] This specification also uses specific terms to describe the embodiments of this specification. For example, "one embodiment," "an embodiment," and / or "some embodiments" refer to a feature, structure, or characteristic associated with at least one embodiment of this specification. Therefore, it should be emphasized and noted that references to "one embodiment," "an embodiment," or "an alternative embodiment" two or more times in different locations in this specification do not necessarily refer to the same embodiment. Furthermore, certain features, structures, or characteristics of one or more embodiments of this specification may be appropriately combined.

[0097] In some embodiments, numbers are used to describe the quantity of components and attributes. It should be understood that such numbers used in the description of the embodiments are modified by the modifiers "about", "approximately" or "substantially" in some examples. Unless otherwise stated, "about", "approximately" or "substantially" indicate that the numbers are allowed to vary by ±20%. Accordingly, in some embodiments, the numerical parameters used in the description and claims are approximate values, which may change according to the required characteristics of individual embodiments. In some embodiments, the numerical parameters should take into account the specified significant digits and adopt the general method of retaining digits. Although the numerical domains and parameters used to confirm the breadth of their range in some embodiments of this specification are approximate values, in specific embodiments, the settings of such numerical values ​​are as accurate as possible within the feasible range.

[0098] Finally, it should be understood that the embodiments described in this specification are intended only to illustrate the principles of the embodiments of this specification. Other variations may also fall within the scope of this specification. Therefore, by way of example and not limitation, alternative configurations of the embodiments of this specification may be considered consistent with the teachings of this specification. Accordingly, the embodiments of this specification are not limited to the embodiments explicitly described and illustrated in this specification.

Claims

1. Use of biotin in the preparation of a nucleic acid and / or organic compound delivery vector suitable for retinal pigment epithelial cell transfection, wherein the biotin and the nucleic acid and / or organic compound are connected via a linker and / or a covalent bond.

2. The use according to claim 1, characterized in that The delivery vector is suitable for treating eye-related diseases; and / or, regulating gene expression; and / or, gene editing.

3. The use according to claim 1, characterized in that The delivery vector is used to silence or knock down gene expression in retinal pigment epithelial cells.

4. The use according to claim 2, characterized in that The gene is VEGF.

5. The use according to claim 4, characterized in that The VEGF is VEGFA.

6. The use according to claim 1, wherein The nucleic acid is RNA or DNA; and / or, the biotin is located at the 5' and / or 3' end of the nucleic acid; And / or, the organic compound is any one or more of peptides, proteins, fats, phospholipids, sugars, vitamins or fluorescent dyes; and / or, the linker is selected from an amino acid residue, PEG or an alkyl group; And / or, the covalent bond includes any one or more of an amide bond, an ester bond, a disulfide bond, a phosphodiester bond, an ether bond or a thioether bond.

7. The use according to claim 6, characterized in that The RNA includes one or more of antisense RNA, ASO, saRNA, mRNA, lncRNA, miRNA, siRNA, piRNA, sgRNA, and tsRNA; and / or, the amino acid residue is an amino acid residue formed by 2 to 10 amino acids; The molecular weight of the PEG is 400Da to 40000Da; The alkyl group is C1-C 18 of alkyl.

8. The use according to claim 7, characterized in that The siRNA encoding nucleotide sequence is shown in SEQ ID NO.

3.

9. The use according to claim 6, characterized in that The RNA is a modified RNA.

10. The use according to claim 2, characterized in that The eye-related disease is a VEGF-related eye disease.

11. A method for delivering nucleic acids and / or organic compounds to cells, comprising contacting the delivery vector for use according to any one of claims 1 to 10 with cells.

12. A gene editing method, comprising contacting the delivery vector of any one of claims 1 to 10 with a cell containing a gene to be edited.

13. A delivery vector suitable for cell transfection, wherein the delivery vector is the delivery vector for use according to any one of claims 1 to 10.

Citation Information

Patent Citations

  • Irna agents targeting VEGF

    CA2815554A1

  • Lipid nanoparticle suitable for RPE cell transfection and application thereof

    CN116271105A