Bacterial strains for protein glycosylation

Abstract

This disclosure provides non-naturally occurring glycosylation competent bacterial strains that are genetically engineered to express a heterologous RNA polymerase, and methods of making and using the same.

Description

[0001] Bacterial Strains for Protein Glycosylation

[0002] CLAIM OF PRIORITY

[0003] This application claims the benefit of U.S. Provisional Patent Application Serial No. 63 / 551,265, filed on February 8, 2024. The entire contents of the foregoing are hereby incorporated by reference.

[0004] FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0005] This invention was made with Government support under Grant No.

[0006] W911NF2320039 P00001 awarded by the Army Research Office (ARO). The Government has certain rights in the invention.

[0007] SEQUENCE LISTING

[0008] This application contains a Sequence Listing that has been submitted electronically as an XML file named 54808-0012W01_SL_ST26.xml. The XML file, created on February 7, 2025, is 46,477 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.

[0009] TECHNICAL FIELD

[0010] Described herein are non-naturally occurring glycosylation-competent bacterial strains that are genetically engineered to express a heterologous RNA polymerase.

[0011] BACKGROUND

[0012] While standard laboratory strains of E. coli are not capable of protein glycosylation, certain strains have shown that protein glycosylation can be achieved in bacterial hosts with proper engineering. However, no strains have been developed that can support glycosylation of proteins expressed using heterologous promoters, including the most common promoter system used in biotechnology, T7 RNA polymerase (T7Pol). This limits the titers of glycoproteins that can be produced, the ease and portability of using standard plasmid systems for glycoengineering, and requires the addition of expensive purified enzyme components to cell-free glycoprotein synthesis (CFGpS) reactions.

[0013] SUMMARY

[0014] The present disclosure provides bacterial glycosylation competent strains engineered to include a heterologous promoter. For example, the installation of T7Pol into the bacterial genome enables T7-driven expression. Such bacterial strains are capable of glycosylation of target proteins expressed using heterologous RNA polymerases (such as T7) either in living cells or in a cell-free protein synthesis (CFPS) system using cellular extracts. These strains improve and simplify the production of glycosylated proteins by using commonly used and reliable promoter systems and obviate the need to add expensive purified enzyme components in cell-free glycoprotein synthesis reactions.

[0015] In one aspect, the present disclosure provides genetically engineered, non- naturally occurring glycosylation competent bacterial strains, which include a heterologous RNA polymerase.

[0016] In some instances, the RNA polymerase is a bacteriophage RNA polymerase. In some instances, the bacteriophage RNA polymerase is bacteriophage T7 RNA polymerase, bacteriophage T3 RNA polymerase, bacteriophage SP6 RNA polymerase, or a variant thereof. In some instances, the bacteriophage T7 RNA polymerase is resistant to proteases. In some embodiments, the bacteriophage T7 RNA polymerase includes a substitution that replaces a basic amino acid selected from K172 and R173 with a non- basic amino acid and / or that includes a substitution that replaces a basic amino acid selected from K179 and K180 with a non-basic amino acid.

[0017] In some examples, the bacteria is Vibrio nalrigens, Salmonella enterica, Bacillus subtilis, Pseudomonas fluor escens, ox Escherichia coli (E. coli). In some instances, the bacteria is a strain of E. coli. In some instances, the bacterial strain is derived from a W3 110 strain of E. coli. In some embodiments, the bacterial strain is derived from a BL21 or MG1655 strain of A. coli.

[0018] In some embodiments, any of the bacterial strains described herein further exhibit the deletion of a gene encoding GDP -mannose 4,6-dehydratase and / or O-antigen ligase. In some instances, any of the bacterial strains described herein, the heterologous polymerase is expressed via a promoter selected from Lpp5, Lac, LacUV5, ptacl, T7, T3, J23100, and mtcontlO. In some instances, the promoter is Lpp5.

[0019] In some embodiments, any of the bacterial strains described herein, the heterologous polymerase is inserted into a specific locus of the bacterial strain’s genome. In some instances, the locus is LacZ or asl. In some instances, the locus is asl.

[0020] In some instances, the bacterial strain further includes a glycosylation gene. In some instances, the glycosylation gene that enables or improves glycosylation is expressed by a plasmid. In some embodiments, the bacterial genome is engineered to express the glycosylation gene. In some instances, the glycosylation gene includes a gene involved in the synthesis of a lipid-linked oligosaccharide (LLO) and / or an oligosaccharyltransferase (OST). In some examples, the LLO comprises GlcNAc2Man3. In some instances, the OST is from Campylobacter jejuni, Campylobacter coli, Campylobacter lari, Campylobacter Zari, Desulfovibrio desulfricans, Desulfovibrio gigas, ox Desulfovibrio vulgaris. In some instances, the OST gene is PglB, PglO, or PglS. In some instances, the LLO is a bacterial O-antigen. In some embodiments, the LLO includes a glycosylation structure. In some instances, the glycosylation structure comprises GlcNAcGalNAc5 or BacGalNAc5Glc.

[0021] In some embodiments, any of the bacterial strains described herein further exhibit deletion or inactivation of one or more genes that negatively affect a yield or quality of a recombinant protein or glycoprotein that is expressed when using the bacterial strain or when the bacterial strain is utilized to prepare a cell-free extract for protein synthesis or glycoprotein synthesis. In some instances, the one or more genes comprises a nuclease; a protease; a reductase; or a gene involved in amino acid metabolism. In some examples, the nuclease is endA or rne. In some instances, the protease is Lon or OmpT. In some instances, the reductase is gor or trxb.

[0022] In some instances, any of the bacterial strains described herein are further engineered to express, or to express at elevated levels, one or more genes that enhance the yield or quality of a recombinant protein or glycoprotein expressed using the bacterial strain or when the bacterial strain is utilized to prepare a cell-free extract for protein synthesis or glycoprotein synthesis. In some instances, the gene is an isomerase or chaperone such as DsbC or FkpA.

[0023] In another aspect, the disclosure provides platforms for producing a recombinant glycoprotein by expressing the recombinant protein gene from the genome or a plasmid, comprising the any of the bacterial strains described herein.

[0024] In some embodiments, the platforms for preparing a glycosylated protein in vitro, include a cellular extract from the bacterial strain of any of the bacterial strains described herein. In some embodiments, the cell-free platforms for performing glycoprotein synthesis include a cellular extract from the bacterial strain of any of the bacterial strains described herein. In some instances, the cell-free extract from the bacterial strain is obtained using a run-off reaction.

[0025] In some embodiments, the platforms are used for expression and glycosylation of a recombinant protein in bacteria that is expressed using a heterologous RNA polymerase.

[0026] In another aspect, this disclosure provides methods for producing a recombinant glycoprotein, the method comprising expressing the recombinant protein gene from a plasmid, wherein the plasmid is expressed in the bacterial strain of any of the bacterial strains described herein.

[0027] Reference to an element by the indefinite article “a” or “an” does not exclude the possibility that more than one element is present, unless the context clearly requires that there be one and only one element. The indefinite article “a” or “an” thus usually means “at least one.”

[0028] The term “about” means within a statistically meaningful range of a value or values such as a stated concentration, length, molecular weight, pH, time frame, temperature, pressure, or volume. Such a value or range can be within plus or minus 10% of the stated value.

[0029] The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted.

[0030] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, and includes the endpoint boundaries defining the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein.

[0031] The compositions, platforms, and methods described herein have ramifications for both production of glycosylated proteins in living E. coli as well as in cell-free glycoprotein synthesis systems. For living E. coli, they enable use of common T7-driven vectors and more efficient production of target proteins for glycosylation. For cell-free glycoprotein synthesis systems, previous systems required the addition of purified T7Pol, which is expensive and time consuming to produce. The compositions, platforms, and methods described herein allow for all components necessary for cell-free transcription, translation, and glycosylation to be produced and harvested from one strain in the form of an extract. The compositions, platforms, and methods described herein provide a more convenient and more economical way of preparing glycosylated products in bacterial system.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0033] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

[0034] DESCRIPTION OF DRAWINGS

[0035] FIG. 1 A is a schematic diagram showing how glycosylation of proteins in engineered E. coli has been done in the past. Lipid-linked oligosaccharides (LLO) and oligosaccharyltransferase (OST) glycosylation machineries are expressed prior to lysate preparation. The glycan synthesis shown by the boxed area represents a common glycan pathway found in Campylobacter jejuni. The target molecule for glycosylation is added as a plasmid (pTarget) or a linear DNA into the CFPS system. Addition of T7Pol is required to produce glycosylated protein for T7 promoter-driven expression of any proteins including target molecule. In the legend: Und-PP -Undecaprenyl pyrophosphate, GalNAc - N-acetylgalactosamine, N - Asparagine.

[0036] FIG. IB is a schematic diagram showing the result achieved by using previously described glycosylation-competent strains of bacterial. Because T7 Pol is not present in this cell, the cell attempts to use a plasmid (pGlyTarget) to express proteins using the T7 promoter (pT7), but does not result in efficient production of glycosylated product. In the legend: Und-PP -Undecaprenyl pyrophosphate, GalNAc - N-acetylgalactosamine, N - Asparagine.

[0037] FIG. 2A is a schematic diagram illustrating the process of cell-free glycoprotein synthesis using engineered E. coli as described herein. Lipid-linked oligosaccharides (LLO) and oligosaccharyltransferase (OST) glycosylation machineries are expressed prior to lysate preparation. The glycan synthesis shown by the boxed area represents a common glycan pathway found in Campylobacter jejuni. The target molecule for glycosylation is added as a plasmid (pTarget) or as a linear DNA into the CFPS system. T7Pol is integrated into the E. coli genome and thus it is not required to add T7Pol externally to produce glycosylated proteins.

[0038] FIG. 2B is a schematic diagram illustrating the process of glycoprotein production in living cells using engineered E. coli as described herein. Because T7 has been integrated into the genome, the use of a plasmid (pGlyTarget) to express proteins using the T7 promoter (pT7) would result in efficient production of glycosylated product, provided a proper periplasmic signaling sequence is used. Notably, the T7 promoter could be used to express OST or LLO pathways or any number of other useful genes instead of or in addition to the target protein encoded on pGlyTarget.

[0039] FIG. 3A is a schematic diagram showing the T7Pol integration design at an asl- CmR landing pad. A landing pad is a sequence of DNA that is integrated into the genome to facilitate insertion of a gene of interest at that site.

[0040] FIG. 3B is an image of an agarose gel showing T7Pol integration into the lacZ site (Integrant PCR size = 4.2 kb). The presence of the Integrant band in samples 1 and 2 shows that successful integration occurred. FIG. 3C is an image of an agarose gel showing T7Pol integration into asl-CmR site (Integrant PCR band size = 3.8 kb). The presence of the Integrant band in samples 1 and 2 shows successful integration occurred.

[0041] FIG. 3D is a schematic diagram showing T7Pol with or without N-terminus V5 tag. T7Pol architecture consists of a promoter, ribosome binding site (RBS), V5 tag, coding sequence and terminator.

[0042] FIG. 3E is an image of an agarose gel showing T7Pol-No-V5-tag integration into asl-CmR site (Integrant PCR band size = 3.8 kb, positive (+ve) control PCR band size = 3.8 kb, negative (-ve) control PCR size = 0.7 kb). The presence of the Integrant band and the absence of non-integrant band in samples 11 and 12 shows successful integration occurred.

[0043] FIG. 4 is a bar graph showing Cell-free Protein Synthesis (CFPS) activity of cell lysates with or without run off reaction and with or without T7Pol addition to CFPS reaction for sfGFP expression. The integration of T7 polymerase into the genome enables expression without the addition of T7. Run-off reactions (the incubation of the extract at between clarification steps) were also found to improve CFPS yields.

[0044] FIG. 5 is a bar graph showing CFPS activity of cell lysates with or without T7Pol addition to CFPS reaction for sfGFP expression. The figure shows a comparison between wild type (WT) and T7Pol integrated into asl and lacZ sites and the asl site without the V5 tag. The extract derived from cells without the V5 tag provides the highest yields without T7 addition.

[0045] DETAILED DESCRIPTION

[0046] Currently available methods of protein glycosylation are either incompatible with T7 promoter-driven expression or require the addition of T7Pol to produce glycosylated proteins (see FIGs. lA and IB).

[0047] Accordingly, this disclosure provides bacterial glycosylation competent strains that are engineered to include a heterologous RNA polymerase in the genome. For example, a suitable strain includes the E. coli W3110 strain that has been modified such that GDP-mannose 4,6-dehydratase (gmd) and / or O-antigen ligase (waaL) are deleted from the genome, and the T7 Pol gene is integrated into the genome. This enables expression of proteins from plasmids using the T7 promoter (T7-driven expression) that can then be glycosylated within living cells or in cell-free glycoprotein synthesis reactions. These strains express necessary lipid-linked oligosaccharide (LLO) pathways, activated nucleotide sugar pathways, and oligosaccharyltransferase (OST) to enable glycosylation of proteins expressed using heterologous RNA polymerases. LLOs, OSTs, activated nucleotide sugar pathways, and target proteins can be achieved by transformation with one or more plasmids and / or through further genetic engineering.

[0048] These new bacterial systems have ramifications for both production of glycosylated proteins in living E. coli as well as in cell-free glycoprotein synthesis systems. For living E. coli, this would enable use of common T7-driven vectors and therefore simplified or more efficient production of target proteins for glycosylation. For cell-free glycoprotein synthesis systems, previous systems have required the addition of purified T7Pol, which is expensive and time consuming to produce. The new systems allow for all components necessary for cell-free transcription, translation, and glycosylation to be produced and harvested from extract derived from as few as one strain (see FIGS. 2A and 2B).

[0049] The ability to use T7-driven promoters to express target proteins for glycosylation in bacteria as well as the ability to use extract prepared with a single bacterial strain for cell-free glycoprotein synthesis is not only unique in this field, but also provides a more convenient and more economical way of preparing glycosylated products in bacterial system. Primary advantages for cell-free synthesis are that extracts made from these strains do not require the addition of purified T7Pol, whereas the previous systems rely on the purified T7Pol supplementation, which requires additional cost and time.

[0050] Similarly, the primary advantage for in vivo glycosylation is the freedom and portability to use common T7-driven vectors for plasmid-based expression of target proteins and glycosylation machineries. This is important because vectors that use heterologous RNA polymerase promoters, particularly T7-driven vectors are known to provide consistently high yields, are ubiquitous in the field, and are also easier to build and engineer due to their bioorthogonal nature and the fact that many molecular biology tools that have been developed to work with them. I. Glycosylation Competent Bacterial Strains

[0051] The disclosure provides non-naturally occurring glycosylation competent bacterial strains that are genetically engineered to enable the glycosylation of proteins either in living cells or in vitro when used to produce one or more cellular extracts that are combined.

[0052] A variety of prokaryotic strains are suitable for use in the methods described in the present disclosure (z.c., strains that include the appropriate post-translational machinery necessary for protein glycosylation). In some embodiments, the strain is derived from Vibrio natrigens, Salmonella enterica, Bacillus subtil is, Pseudomonas fluoresce ns, ox Escherichia coli (E. coli). In certain specific embodiments, the strain is an E. coli strain that has deletion of genes that encode GDP -mannose 4,6-dehydratase (gmd) and / or O-antigen ligase. In some instances, the strain is derived from E. coli strains W3 110, BL21, or MG1655. In some instances, the strain has been modified to express genes encoding the glycosyltransferases and activated nucleotide sugar enzymes (such as GalM, GalT, and / or GalE) necessary to synthesize LLOs. In other instances, the strain has been modified to express an OST.

[0053] II. Heterologous RNA Polymerases

[0054] In another aspect of the disclosure, the glycosylation competent bacterial strain is genetically engineered to express a heterologous RNA polymerase. Suitable RNA polymerases include, but are not limited to, bacteriophage RNA polymerases. For example, suitable bacteriophage RNA polymerases include bacteriophage T7 RNA polymerase, bacteriophage T3 RNA polymerase, and bacteriophage SP6 RNA polymerase. In some instances, the bacteriophage RNA polymerase is resistant to polymerases.

[0055] When the bacteriophage T7 RNA polymerase, or variants thereof, are used, the T7 RNA polymerase can have the amino acid sequence of SEQ ID NO: 1, and a DNA sequence that encodes the T7 RNA can have the nucleic acid sequence of SEQ ID NO:2. The promoter sequence for T7 RNA polymerase is provided as SEQ ID NO:3 (which may be present on a transcription template for expressing a target protein in the cell-free protein synthesis systems disclosed herein). In some embodiments of the disclosed methods, systems, components and compositions, variants of T7 RNA polymerase may include polymerases having at least about 95%, 96%, 97%, 98%, or 99% amino acid sequence identity to SEQ ID NO: 1 and / or polymerases encoded by a DNA having at least about 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity to SEQ ID NO:2.

[0056] In some embodiments, variants of T7 RNA polymerase are resistant to cleavage by a host protease of a recombinantly engineered source strain in which the variant T7 RNA polymerase is expressed. For example, a variant of T7 RNA polymerase may include a deletion of 1, 2, 3, 4, or 5 amino acids, an insertion of 1, 2, 3, 4, or 5 amino acids, and / or 1, 2, 3, 4, or 5 amino acid substitutions that make the variant resistant to cleavage by a host protease of a recombinantly engineered source strain in which the variant T7 RNA polymerase is expressed. Amino acid substitutions may include replacing one or more basic amino acids (e.g., K172, R173, K179, and / or K180) with an amino acid that is not basic (e.g., a replacement amino acid for K172, R173, K179, and / or KI 80 selected from A, G, I, and L).

[0057] Suitable bacteriophage RNA polymerases for the disclosed methods, systems, components, and compositions may include the bacteriophage T3 RNA polymerase or variants thereof. The amino acid sequence of T3 RNA polymerase is provided herein as SEQ ID NO:4 and a DNA sequence encoding T3 RNA polymerase is provided as SEQ ID NO:5. The promoter sequence for T3 RNA polymerase is provided as SEQ ID NO:6 (which may be present on a transcription template for expressing a target protein in the cell-free protein synthesis systems disclosed herein). In some embodiments of the disclosed methods, systems, components and compositions, variants of T3 RNA polymerase may include polymerases having at least about 95%, 96%, 97%, 98%, or 99% amino acid sequence identity to SEQ ID NO:4 and / or polymerases encoded by a DNA having at least about 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity to SEQ ID NO:5.

[0058] In some embodiments, variants of T3 RNA polymerase are resistant to cleavage by a host protease of a recombinantly engineered source strain in which the variant T3 RNA polymerase is expressed. For example, a variant of T3 RNA polymerase may include a deletion of 1, 2, 3, 4, or 5 amino acids, an insertion of 1, 2, 3, 4, or 5 amino acids, and / or 1, 2, 3, 4, or 5 amino acid substitutions that make the variant resistant to cleavage by a host protease of a recombinantly engineered source strain in which the variant T3 RNA polymerase is expressed. Amino acid substitutions may include replacing one or more basic amino acids (e.g., K173, R174, K180, and / or K181) with an amino acid that is not basic (e.g., a replacement amino acid for KI 73, R174, KI 80, and / or KI 81 selected from A, G, I, and L).

[0059] Suitable bacteriophage RNA polymerases for the disclosed methods, systems, components and compositions may include the bacteriophage SP6 RNA polymerase or variants thereof. The amino acid sequence of SP6 RNA polymerase is provided herein as SEQ ID NO:7 and a DNA sequence encoding SP6 RNA polymerase is provided as SEQ ID NO:8. The promoter sequence for SP6 RNA polymerase is provided as SEQ ID NON (which may be present on a transcription template for expressing a target protein in the cell-free protein synthesis systems disclosed herein). In some embodiments of the disclosed methods, systems, components and compositions, variants of SP6 RNA polymerase may include polymerases having at least about 95%, 96%, 97%, 98%, or 99% amino acid sequence identity to SEQ ID NO:7 and / or polymerases encoded by a DNA having at least about 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity to SEQ ID NO: 8.

[0060] In some embodiments, variants of SP6 RNA polymerase are resistant to cleavage by a host protease of a recombinantly engineered source strain in which the variant SP6 RNA polymerase is expressed. For example, a variant of SP6 RNA polymerase may include a deletion of 1, 2, 3, 4, or 5 amino acids, an insertion of 1, 2, 3, 4, or 5 amino acids, and / or 1, 2, 3, 4, or 5 amino acid substitutions that make the variant resistant to cleavage by a host protease of a recombinantly engineered source strain in which the variant SP6 RNA polymerase is expressed. Amino acid substitutions may include replacing one or more of basic amino acids with an amino acid that is not basic (e.g., a replacement amino acid for a basic amino acid selected from A, G, I, and L).

[0061] The glycosylation competent bacterial strain may be modified to express the heterologous RNA polymerase by methods known in the art including recombination methods known in the art and as disclosed herein. In some embodiments, the glycosylation competent bacterial strain is modified to express the heterologous RNA polymerase by CRISPR methods. In some embodiments, the glycosylation competent bacterial strain is modified to express the heterologous RNA polymerase by recombining a cassette that expresses the heterologous RNA polymerase into the genome of the glycosylation competent bacterial strain, wherein the cassette includes the coding sequence for the heterologous RNA polymerase (e.g., any of SEQ ID NOs:2, 5, or 8, or a variant thereof) operably linked to a suitable promoter for expressing the RNA polymerase. Suitable promoters include inducible promoters or constitutive promoters. In some embodiments, the promoter is characterized as a “strong” promoter as described herein. Examples of useful promoters include: Lpp5, Lac, LacUV5, ptacl, T7, T3, J23100, and mtcontlO. In some embodiments, the heterologous polymerase is inserted into a specific locus of the bacterial strain’s genome. For example, the RNA polymerase is inserted into the LacZ or asl locus of the glycosylation competent bacterial strain’s genome.

[0062] III. Additional Features of the Glycosylation-Competent Bacterial Strains

[0063] A. Glycosylation Genes

[0064] The glycosylation competent bacterial strain that is engineered to express a heterologous polymerase also comprises one or more glycosylation genes that are involved in the glycosylation pathway. More specifically, the one or more genes enable and / or improve glycosylation by the bacterial strain. The glycosylation genes can be expressed by a plasmid, wherein the plasmid is transformed into the bacterial strain. Alternatively, the glycosylation gene can be expressed by the genome of the bacterial strain, wherein the glycosylation competent bacterial strain that is engineered to express a heterologous polymerase is further modified to express the glycosylation gene.

[0065] In some embodiments, the glycosylation genes comprise one or more genes involved in the synthesis of a lipid-linked oligosaccharide (LLO) and / or an oligosaccharyltransferase (OST). This may include glycosyltranferases or genes involved in providing necessary nucleotide-activated sugars for glycosylation. In some instances, the LLO comprises GlcNAc2Man3. In some instances, the LLO is a bacterial O-antigen. In some instances, the LLO comprises a glycosylation structure (e.g., GlcNAcGalNAc5). In some embodiments, the OST is from Campylobacter jejuni, Campylobacter coli, Campylobacter lari, Campylobacter Zari, Desulfovibrio desulfricans, Desulfovibrio gigas, ox Desulfovibrio vulgaris. In some instances, the OST gene is PglB, PglO, or PglS.

[0066] In certain embodiments, the sequence for the LLO synthesis gene cluster and the OST encoding gene sequence are derived from C. jejuni (Wacker M, Linton D, Hitchen PG, Nita-Lazar M, Haslam SM, North SJ, Panico M, Morris HR, Dell A, Wren BW, Aebi M. N-linked glycosylation in Campylobacter jejuni and its functional transfer into E. coli. Science. 2002, 298(5599): 1790-1793) and / or C. lari (Schwarz F, Lizak C, Fan YY, Fleurkens S, Kowarik M, Aebi M. Relaxed acceptor site specificity of bacterial oligosaccharyltransferase in vivo. Glycobiology. 2011, 21(l):45-54). C. jejuni gene cluster include genes encoding proteins capable of synthesizing heptasaccharides which is then transferred to the target protein by an oligosaccharyltransferase (PglB) whereas C. lari gene cluster include genes encoding proteins capable of synthesizing hexasaccharides which is then transferred to the target protein by an oligosaccharyltransferase (PglB). The PglB in C. lari is more flexible in transferring diverse glycans to the acceptor protein for glycosylation (Schwarz F, Lizak C, Fan YY, Fleurkens S, Kowarik M, Aebi M. Relaxed acceptor site specificity of bacterial oligosaccharyltransferase in vivo. Glycobiology. 2011, 21(l):45-54).

[0067] B. Removing genes that negatively impact yield or quality of a recombinant protein

[0068] In some embodiments, the glycosylation competent bacterial strain that is engineered to express a heterologous polymerase further comprises at least one additional genetic knock-out mutation that downregulates or eliminates a negative protein effector for cell-free protein synthesis (CFPS). In certain embodiments, the at least one additional genetic knock-out mutation improves DNA stability, RNA stability, protein stability, amino acid stability, energy supply, or any combination thereof. In certain embodiments, the at least one additional genetic knock-out mutation comprises 1, 2, 3, 4, or more genetic knock-out mutations. In embodiments where the strain comprises 2 or more genetic knock-out mutations, at least 2 of the genetic knock-out mutations may both improve the same attribute, e.g., improved DNA stability, improved RNA stability, improved protein stability, improved amino acid stability, improved nucleotide stability, and / or improved energy supply, or the two mutations may improve two different attributes.

[0069] To improve DNA or RNA stability, the at least one additional genetic knock-out mutation can target the functional inactivation of nucleases. In cells, nucleases play important roles in regulating DNA and mRNA turnover. However, their presence in crude cell extracts used in CFPS is expected to be deleterious, leading to template instability and reaction termination. A non-exhaustive list of potential negative effectors includes: RNase A (encoded by rna) degrades RNA by catalyzing the cleavage of phosphodiester bonds, and identification of strains (e.g., MRE600, Al 9) lacking rna was important for early studies in in vitro translation.

[0070] RNase II (encoded by rnb) is responsible for mRNA decay by 3' to 5' exonuclease activity, and cell extracts lacking RNase II exhibit a 70% increase in CFPS efficiency.

[0071] RNase E (encoded by me) is part of a cold shock degradosome that induces mRNA decay in cold shock, which the cells experience during harvest prior to extract generation.

[0072] MazF (encoded by mazF) is a toxin that degrades mRNA by sequence-specific (ACA) endoribonuclease activity, which could affect transcript stability.

[0073] CsdA (encoded by csdA) is part of a cold shock degradosome along with RNase E and induces mRNA decay in cold shock, which the cells experience during harvest prior to extract generation.

[0074] DNA-specific endonuclease I (encoded by endA) breaks double-stranded DNA, and its deletion has previously shown to be important for extending the duration of CFPS reactions.

[0075] These and other nucleases may be functionally inactivated by the at least on additional genetic knock-out mutation.

[0076] To improve protein stability, the at least one additional genetic knock-out mutation may target the functional inactivation of proteases. Proteases play important roles in regulating protein turnover. However, their presence in CFPS reactions is expected to be deleterious, leading to protein instability issues. A non-exhaustive list of potential negative effectors include: Lon (encoded by Ion) is an ATP-dependent protease that demonstrated improved protein production in cell-free systems in BL21 strains upon transcriptional down regulation.

[0077] Outer membrane protein T (encoded by OmpT) is an aspartyl protease found on the outer membrane. Knockout of OmpT has been shown to prevent protease degradation.

[0078] These and other proteases may be functionally inactivated by the at least on additional genetic knock-out mutation.

[0079] In some embodiments, the at least one additional genetic knock-out mutation may target the functional inactivation of reductases. Like proteases noted above, these reductases play important roles in regulating protein turnover. However, their presence in CFPS reactions is expected to be deleterious, leading to protein instability issues. A non- exhaustive list of potential negative effectors includes: glutathione reductase (encoded by gor) reduces oxidized glutathione to maintain a reducing environment in the cytoplasm of a cell, making synthesis of disulfide-bonded proteins problematic, and thioredoxin reductase (encoded by trxB) catalyze the reduction of thioredoxin.

[0080] The at least one additional genetic knock-out mutation may target proteins known to negatively affect amino acid or energy supply. In a cell, these proteins play important roles in metabolism and substrate turnover. However, their presence in crude cell extracts is expected to be deleterious, leading to decreased amino acid and energy supply to support translation. A non-exhaustive list of potential negative effectors includes:

[0081] Glutamate dehydrogenase (encoded by gdhA) catalyzes the deamination of glutamate, which may affect glutamate's stability.

[0082] Glutamate-cysteine-ligase (encoded by gshA) catalyzes the first step of glutathione synthesis and may decrease the stability of cysteine.

[0083] Serine deaminase I (encoded by sdaA) and serine deaminase II (encoded by sdaB) are two of the three enzymes involved in serine degradation.

[0084] Arginine decarboxylase (encoded by speA) consumes arginine in the biosynthetic production of putrescine.

[0085] Tryptophanase (encoded by tnaA) consumes tryptophan in the production of indole. Lastly, glycerol kinase (encoded by glpK) consumes ATP to phosphorylate glycerol, which could help deplete the energy supply required for cell-free reactions.

[0086] These and other proteins may be functionally inactivated by the at least on additional genetic knock-out mutation.

[0087] Strains having at least one additional genetic knock-out mutation can be prepared by any method of engineering a strain to functionally inactivate the negative effector to lessen or eliminate the negative effector from a lysate prepared from the strain. In certain embodiments, the genetic knock-out mutations can be prepared by inserting either a nonsense mutation and / or a frameshift mutation into the genome of the strain as well as deleting a vital portion of a gene coding sequence. In certain embodiments, the genetic knock-out mutations may be prepared by removing regulatory sequences (i.e., promoter, ribosome binding site) or otherwise changing these sequences in the genome as to render them non-functional. In certain embodiments, negative effectors can be functionally knocked out in cell lysates by introducing a unique affinity tag and subsequently using the tag to selectively remove the effector protein from the lysates. In certain embodiments a strain having at least one additional genetic knock-out mutation may be prepared by multiplex automated genome engineering (MAGE), X-Red recombinase-mediated recombination (Datsenko-Wanner), zinc-finger nucleases (ZFNs), transcription activatorlike effector nucleases (TALENs), clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein-9 nuclease (Cas9), and any other commonly used recombineering and genome engineering tools.

[0088] C. Genes that enhance yield or quality of a recombinant protein

[0089] In some embodiments, the glycosylation competent bacterial strain that is engineered to express a heterologous polymerase further comprises at least one additional upregulated gene product. In certain embodiments, the glycosylation competent bacterial strain that is engineered to express a heterologous polymerase further comprises at least one additional upregulated gene product and at least one additional genetic knock-out mutation. The at least one additional upregulated gene product can be an upregulated gene product that is a positive effector for CFPS. In certain embodiments, the at least one additional upregulated gene product improves energy supply, chaperone levels, translation function, ribosome recycling, or any combination thereof. In certain embodiments, the at least on additional upregulated gene product comprises 1, 2, 3, 4, or more upregulated gene products. In embodiments where the strain comprises two or more upregulated gene products, at least two of the upregulated gene products may both improve the same attribute, such as improved energy supply, improved chaperone levels, improved translation function, or improved ribosome recycling, or the at least two upregulated gene products may each improve a different one of these attributes.

[0090] For example, to improve energy supply, the at least one additional upregulated gene product may target the upregulation of kinases. In a cell, these proteins play important roles in metabolism and the transfer of phosphate groups. The upregulated presence in crude cell extracts is expected to improve energy supply to support translation. A non-exhaustive list of potential positive effectors includes:

[0091] Acetate kinase (encoded by ackA) increases the overall metabolic flux of metabolites toward substrate-level ATP generation.

[0092] Nucleosi de-diphosphate kinase (encoded by ndk) facilitate the synthesis of NTPs from their corresponding NDPs.

[0093] Pyruvate kinase monomer (encoded by pykF) helps drive ATP generation.

[0094] These and other kinases may be the at least one additional upregulated gene product.

[0095] To improve energy supply, the at least one additional upregulated gene product may target the upregulation of deaminases. In a cell, these proteins may play important roles in metabolism and preparing metabolites. A potential positive effector is cytidine deaminase (encoded by cdd), which initiates the deamination of cytidine which may lead to the synthesis of UTP. These and other deaminases may be the at least one additional upregulated gene product.

[0096] To improve chaperone levels, the at least one upregulated gene product may target the upregulation of isomerases, foldases, and / or holdases. In a cell, these proteins may play important roles in the assisting proteins to adopt functionally active conformations. The upregulated presence in crude cell extracts is expected to improve chaperone levels to support protein production into soluble and / or active confirmations. A non-exhaustive list of potential positive effectors includes: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA (encoded by fkpA) catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides.

[0097] Disulfide bond isomerase (encoded by dsbC) shuffles disulfide bonds into correct positions.

[0098] Chaperone protein DnaK (encoded by dnaK) aids the folding of nascent polypeptide chains and the rescue of misfolded proteins.

[0099] Chaperone protein DnaJ (encoded by danJ) stimulates the ATPase activity of DnaK.

[0100] Protein GrpE (encoded by grpE) stimulates the ATPas activity of DnaK.

[0101] Trigger Factor (encoded by tig) aids the folding of nascent polypeptides.

[0102] The 10 kDa chaperonin subunit (encoded by groS) forms part of the GroEL- GroES chaperonin complex that aids in protein folding.

[0103] The 60 kDa chaperonin subunit (encoded by groL) forms part of the GroEL- GroES chaperonin complex that aids in protein folding.

[0104] These and other isomerases, foldases, and / or holdases may be the at least one additional upregulated gene product.

[0105] To improve translation function, the at least one upregulated gene product may target the upregulation of initiation factors and / or elongation factors. In a cell, these proteins play important roles in the translation function. The upregulated presence in crude cell extracts is expected to improve translation function. A non-exhaustive list of potential positive effectors includes:

[0106] Translation initiation factor IF- 1 (encoded by infA) interacts with the 30S ribosomal subunit to initiate translations.

[0107] Translation initiation faction IF-2 (encoded by infB) has a role in the proper placement of the charged initiator fMet-tRNA via a GTP-dependent mechanism.

[0108] Elongations factor G (encoded by fusA) facilitates translocation of the ribosome by one codon along a mRNA.

[0109] Elongation factor P (encoded by efp) stimulates the synthesis of peptide bonds.

[0110] Elongation factor 4 (encoded by lepA) can alter the rate of translation, leading to increases in the rate of translation under certain stress conditions. Elongation factor TU 2 (encoded by tufB) helps shuttle charge tRNAs to ribosomes.

[0111] These and other initiation factors and / or elongation factors may be the at least one additional upregulated gene product.

[0112] To improve translation function, the at least one upregulated gene product may target the upregulation of recycling factors. In a cell, these proteins play important roles in the ribosome recycling. The upregulated presence in crude cell extracts is expected to improve ribosome recycling. A non-exhaustive list of potential positive effectors includes heat shock protein 15 (encoded by hslR), which is involved with the recycling of free 50S ribosomal subunits, and ribosome-recycling factor (encoded by frr), which promotes rapid recycling of ribosomal subunits after the release of the polypeptide chain. These and other recycling factors may be the at least one additional upregulated gene product.

[0113] Strains having at least one additional genetic knock-out mutation, can be prepared by any method of engineering a strain to functionally increase a positive effector to increase the presence of the positive effector in the lysate prepared from the strain. In certain embodiments, the upregulated gene product is expressed from a plasmid present in the glycosylation competent bacterial strain that is engineered to express a heterologous polymerase and / or expressed from an integration site in the genome of the glycosylation competent bacterial strain that is engineered to express a heterologous polymerase. Additionally, gene upregulation may be enhanced by engineering the promoter and / or ribosome binding site in front of the gene of interest located either on a plasmid or on the genome. A stronger promoter / ribosome binding site would lead to an increase in transcriptional activity. Techniques commonly employed to integrate a plasmid overexpressing a positive effector into a strain includes transformation. Techniques commonly employed to integrate a gene cassette containing a positive effector into the genome for overexpression includes Z-Red recombinase-mediated recombination (Datsenko-Wanner).

[0114] IV. Cell-Free Protein Synthesis (CFPS)

[0115] The present disclosure provides compositions and methods for used in cell-free protein synthesis. Cell-free protein synthesis (CFPS) is known and has been described in the art. (See, e.g., U.S. Pat. Nos. 6,548,276; 7,186,525; 8,734,856; 7,235,382; 7,273,615; 7,008,651; 6,994,986 7,312,049; 7,776,535; 7,817,794; 8,298,759; 8,715,958; 9,005,920; 10,017,794; and 10,118,950, the contents of which are incorporated herein by reference in their entireties). A “CFPS reaction mixture” typically contains a crude or partially- purified cell extract, an RNA translation template, and a suitable reaction buffer for promoting cell-free protein synthesis from the RNA translation template. In some aspects, the CFPS reaction mixture can include exogenous RNA translation template. In other aspects, the CFPS reaction mixture can include a DNA expression template encoding an open reading frame operably linked to a promoter element for a DNA- dependent RNA polymerase. In these other aspects, the CFPS reaction mixture can also include a DNA-dependent RNA polymerase to direct transcription of an RNA translation template encoding the open reading frame. In these other aspects, additional NTP's and divalent cation cofactor can be included in the CFPS reaction mixture.

[0116] A reaction mixture is referred to as complete if it contains all reagents necessary to enable the reaction, and incomplete if it contains only a subset of the necessary reagents. It will be understood by one of ordinary skill in the art that reaction components are routinely stored as separate solutions, each containing a subset of the total components, for reasons of convenience, storage stability, or to allow for applicationdependent adjustment of the component concentrations, and that reaction components are combined prior to the reaction to create a complete reaction mixture. Furthermore, it will be understood by one of ordinary skill in the art that reaction components are packaged separately for commercialization and that useful commercial kits may contain any subset of the reaction components of the invention.

[0117] Altering the physicochemical environment of the CFPS reaction to better mimic the cytoplasm can improve protein synthesis activity. The following parameters can be considered alone or in combination with one or more other components to improve robust CFPS reaction platforms based upon crude cellular extracts (for examples, S12, S30 and S60 extracts).

[0118] The temperature can be any temperature suitable for CFPS. Temperature can be in the general range from about 10° C. to about 40° C., including intermediate specific ranges within this general range, include from about 15° C. to about 35° C., from about 15° C. to about 30° C., from about 15° C. to about 25° C. In certain aspects, the reaction temperature can be about 15° C., about 16° C., about 17° C., about 18° C., about 19° C., about 20° C., about 21° C., about 22° C., about 23° C., about 24° C., or about 25° C.

[0119] The CFPS reaction can include any organic anion suitable for CFPS. In certain aspects, the organic anions can be glutamate and / or acetate, among others. In certain aspects, the concentration for the organic anions is independently in the general range from about 0 mM to about 200 mM, including intermediate specific values within this general range, such as about 0 mM, about 10 mM, about 20 mM, about 30 mM, about 40 mM, about 50 mM, about 60 mM, about 70 mM, about 80 mM, about 90 mM, about 100 mM, about 110 mM, about 120 mM, about 130 mM, about 140 mM, about 150 mM, about 160 mM, about 170 mM, about 180 mM, about 190 mM and about 200 mM, among others.

[0120] The CFPS reaction can also include any halide anion suitable for CFPS. In certain aspects the halide anion can be chloride, bromide, and / or iodide, among others. A useful halide anion is chloride. Generally, the concentration of halide anions, if present in the reaction, is within the general range from about 0 mM to about 200 mM, including intermediate specific values within this general range, such as those disclosed for organic anions generally herein.

[0121] The CFPS reaction may also include any organic cation suitable for CFPS. In certain aspects, the organic cation can be a polyamine, such as spermidine and / or putrescine, among others. Preferably polyamines are present in the CFPS reaction. In certain aspects, the concentration of organic cations in the reaction can be about 0 mM to about 3 mM, about 0.5 mM to about 2.5 mM, or about 1 mM to about 2 mM. In certain aspects, more than one organic cation can be present.

[0122] The CFPS reaction can include any inorganic cation suitable for CFPS. For example, suitable inorganic cations can include monovalent cations, such as sodium, potassium, and / or lithium, among others; and divalent cations, such as magnesium, calcium, and / or manganese, among others. In certain aspects, the inorganic cation is magnesium. In such aspects, the magnesium concentration can be within the general range from about 1 mM to about 50 mM, including intermediate specific values within this general range, such as about 1 mM, about 2 mM, about 3 mM, about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, or about 10 mM, among others. In certain aspects, the concentration of inorganic cations can be within the specific range from about 4 mM to about 9 mM, e.g., within the range from about 5 mM to about 7 mM.

[0123] The CFPS reaction includes nucleoside triphosphates (NTPs). In certain aspects, the reaction uses adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytosine triphosphate (CTP), and uridine triphosphate (UTP). In certain aspects, the concentration of individual NTPs is within the range from about 0.1 mM to about 2 mM.

[0124] The CFPS reaction can also include any alcohol suitable for CFPS. In certain aspects, the alcohol may be a polyol, and more specifically glycerol. In certain aspects the alcohol is between the general range from about 0% (v / v) to about 25% (v / v), including specific intermediate values of about 5% (v / v), about 10% (v / v) and about 15% (v / v), and about 20% (v / v), among others.

[0125] V. Platforms for Preparing Glycosylated Proteins

[0126] This disclosure also provides platforms for preparing glycosylated proteins in vitro, which include a cellular extract from the glycosylation competent bacterial strain that was engineered to express a heterologous polymerase as described herein. Because CFPS exploits an ensemble of catalytic proteins prepared from the crude lysate of cells, the cell extract (whose composition is sensitive to growth media, lysis method, and processing conditions) is the most critical component of extract-based CFPS reactions. Methods for preparing an extract competent for cell-free protein synthesis are well known in the art (see, e.g., U.S. Pat. Nos. 9,528,137, the contents of which are incorporated by reference).

[0127] The platform can include an expression template, a translation template, or both an expression template and a translation template. The expression template serves as a substrate for transcribing at least one RNA that can be translated into a glycosylated protein (e.g., a polypeptide or protein). The translation template is an RNA product that can be used by ribosomes to synthesize the glycosylated protein. In certain embodiments the platform comprises both the expression template and the translation template.

[0128] The platform can include one or more polymerases capable of generating a translation template from an expression template. The polymerase may be supplied exogenously or may be supplied from the organism used to prepare the extract. In certain specific embodiments, the polymerase is expressed from a plasmid present in the organism used to prepare the extract and / or an integration site in the genome of the organism used to prepare the extract.

[0129] The platform can also include an orthogonal translation system. An orthogonal translation system can include one or more orthogonal components that are designed to operate parallel to and / or independent of the organism's orthogonal translation machinery. In certain embodiments, the orthogonal translation system and / or orthogonal components are configured to incorporate unnatural amino acids. An orthogonal component may be an orthogonal protein or an orthogonal RNA. In certain embodiments, an orthogonal protein may be an orthogonal synthetase. In certain embodiments, the orthogonal RNA may be an orthogonal tRNA or an orthogonal rRNA. In certain embodiments, one or more orthogonal components are prepared in vivo or in vitro by the expression of an oligonucleotide template.

[0130] The one or more orthogonal components can be expressed from a plasmid present in the glycosylation competent bacterial strain that is engineered to express a heterologous polymerase, expressed from an integration site in the genome of the glycosylation competent bacterial strain that is engineered to express a heterologous polymerase, co-expressed from both a plasmid present in the glycosylation competent bacterial strain that is engineered to express a heterologous polymerase and an integration site in the genome of the glycosylation competent bacterial strain that is engineered to express a heterologous polymerase, express in the in vitro transcription and translation reaction, or added exogenously as a factor (e g., a orthogonal tRNA or an orthogonal synthetase added to the platform or a reaction mixture).

[0131] Also described herein are platforms for expressing and glycosylating recombinant proteins in living bacterial cells, wherein the proteins are expressed using a heterologous RNA polymerase that is expressed within the cells. For example, a suitable bacterial strain includes the E. coli W3110 strain that has been modified such that GDP-mannose 4,6-dehydratase (gmd) and / or O-antigen ligase (waaL) are deleted from the genome, and the T7 Pol gene is integrated into the genome. This enables expression of proteins from plasmids using the T7 promoter (T7-driven expression) that can then be glycosylated within living cells or in cell-free glycoprotein synthesis reactions.

[0132] These strains express necessary lipid-linked oligosaccharide (LLO) pathways, activated nucleotide sugar pathways, and oligosaccharyltransferase (OST) to enable glycosylation of proteins expressed using heterologous RNA polymerases. LLOs, OSTs, activated nucleotide sugar pathways, and target proteins can be achieved by transformation with one or more plasmids and / or through further genetic engineering. A heterologous RNA polymerase that is expressed within the bacterial cell can facilitate the glycosylation of a desired protein that is also expressed with the cell. For example, a heterologous gene that encodes an RNA polymerase can be integrated into the bacterial genome, or can be introduced into the bacterial cell via a plasmid vector.

[0133] Suitable RNA polymerases include, but are not limited to, bacteriophage RNA polymerases. For example, suitable bacteriophage RNA polymerases include bacteriophage T7 RNA polymerase, bacteriophage T3 RNA polymerase, and bacteriophage SP6 RNA polymerase. In some instances, the bacteriophage RNA polymerase is resistant to polymerases.

[0134] EXAMPLES

[0135] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0136] Example 1: Integration of T7Pol

[0137] Integration of T7Pol into lacZ and asl sites of the genome of the E. coll W3110 strain with deletion of GDP -mannose 4,6-dehydratase (gmd) and O-antigen ligase was addressed. At the LacZ site, we integrated T7Pol with native lac promoter using CRISPR MAD7 nuclease mediated and lambda red assisted homologous recombination method (Zhu X, Yaokang Wu, Xueqin Lv, Yanfeng Liu, Guocheng Du, Jianghua Li and Long Liu. Combining CRISPR-Cpfl and recombineering facilitates fast and efficient genome editing in Escherichia coli. ACS Synth. Biol. 2022, 11(5): 1897-1907). To do this, first the homologous sequence and the target gRNA was cloned into pTarget having the required CRISPR machineries with sacB for counter selection. Then the host cell was transformed with pEdit having lambda red machineries and subsequently transformed with pTarget followed by selection on antibiotic plates containing 50 pg / mL kanamycin for pTarget and 10 pg / mL gentamicin for pEdit and incubated the plate at 30°C for 1-2 days.

[0138] Colonies were grown on LB at 37°C and colony PCR was performed to verify the integration. Then the culture was passaged on Luria Broth (LB) supplemented with 6% sucrose and no salt for counter selection. After second passage of the culture in LB supplemented with 6% sucrose and no salt, it was tested for loss of pTarget and pEdit. For this, the culture was spot plated on LB, LB with 50 pg / mL of kanamycin for pTarget and LB with 10 pg / mL of gentamicin for pEdit. Finally, the colony that was able to grow on LB but not on LB with kanamycin and gentamicin was chosen and further verified by colony PCR with specific primers pertaining to the targeted edits. The edits were further validated by sequencing of the specific region by PCR amplification and subsequently by whole genome sequencing.

[0139] To integrate T7Pol into the asl site, we first inserted a landing pad with chloramphenicol resistance gene (CmR) into this site in order for our CRISPR genome editing system to be effective (see, e.g., FIG. 3A). This is because the asl site does not have many sequence options for protospacer adjacent motif (PAM) sites to be recognized by MAD7, the nuclease used for CRISPR-based genome editing used in this work. This CmR gene provides multiple options of PAM sites. Once we had inserted this CmR cassette, we then integrated Lpp5 driven T7Pol with and without N-terminal V5 tag into the asl site following the same method as in lacZ site

[0140] We confirmed the genomic integration of landing pad into asl site, T7Pol integration into lacZ and CmR-asl sites. Specifically, a PCR reaction was done and then subsequently, an agarose gel was run on the PCR product. As shown in FIG. 3B, T7Pol was integrated into the genome at the lacZ site. Similarly, FIG. 3C shows that T7Pol was successfully integrated into the genome at the CmR-asl site.

[0141] We then compared strains having T7Pol integrated in lacZ and asl sites with and without the V5 tag. A schematic of the T7Pol with and without the V5 tag is shown in FIG. 3D. First, we ensured successful integration into asl-CmR site with and without the V5 tag (see, FIG. 3E). Integration, as shown in FIG. 3E (by doing a PCR and then agarose gel, as in FIGs. 3B and 3C), was successful. We then compared activity of the strains having T7Pol integrated in lacZ and asl sites, (with and without the V5 tag) by CFPS reactions showing protein production. We found CFPS activity only in the lysates prepared from T7Pol integrated strains that went through the run-off reaction (FIG. 4, see last two bars in both the “No T7Pol added” and “T7Pol added”). We also found higher activity of T7Pol integrated into asl site and that was further improved when V5 tag was removed (FIG. 5, see last bars in both the “No T7Pol added” and “T7Pol added”). We also found T7Pol supplementation in CFPS reaction overall increased expression of target protein, but effect was more pronounced in the activity of WT and lacZ strain (FIGS. 4 and 5). Importantly, we found that the “asl no V5” tag condition benefited only slightly from T7Pol addition, indicating that T7Pol is no longer a significant limitation in the reaction and can therefore be removed as an additive without much loss in yields.

[0142] Example 2: One-Pot Cell-Free Glycosylation

[0143] The strain constructed in Example 1 can be used to enable one-pot cell-free glycosylation using the following method. The E. coli strain endogenously expressing T7Pol is transformed with plasmids containing OST (pOST) (such as the C. jejuni pglB plasmid, SEQ ID NO: 11) and LLO (pLLO) genes (such as the C. lari LLO pathway plasmid, SEQ ID NO: 10). Examples of sequences in the literature that can be used include those from either from C. jejuni (Wacker M, Linton D, Hitchen PG, Nita-Lazar M, Haslam SM, North SJ, Panico M, Morris HR, Dell A, Wren BW, Aebi M. N-linked glycosylation in Campylobacter jejuni and its functional transfer into E. coli. Science. 2002, 298(5599): 1790-1793) or C. lari (Schwarz F, Lizak C, Fan YY, Fleurkens S, Kowarik M, Aebi M. Relaxed acceptor site specificity of bacterial oligosaccharyltransferase in vivo. Glycobiology. 2011, 21(l):45-54). The transformed strain is grown in 1 L of Terrific Broth (TB) medium in a tunair flask at 37°C with 250 rpm. The expression of T7Pol and glycosylation machineries is induced at OD-O.4 by adding 1 mM IPTG and 0.2% L-arabinose (the inducer concentrations can be optimized) and the culture is harvested at OD~3. CFPS extract is prepared following a standard method (Hershewe, J.M., Warfel, K.F., Iyer, S.M. et al. Improving cell-free glycoprotein synthesis by characterizing and enriching native membrane vesicles. Nat Commun 2021 12, 2363). Briefly, the cell pellets are harvested by centrifugation at 8,000xg for 8 minutes at 4°C. Supernatant is discarded and pellets are washed 3 times by S30 buffer. After the 3rdwash, the cell pellets are weighed and frozen in -80°C.

[0144] Cell pellets from -80°C are thawed and resuspended in 4 mL of S30 buffer per gram of cell pellet. The cell pellets are lysed using B 15 homogenizer at 21,000 psi. Then the lysate is clarified by centrifugation at 12,000xg for 10 minutes at 4°C. The clarified lysate are subjected to run off by incubating at 37°C for 1 h. Again, the lysate is clarified by centrifugation at 12,000xg for 10 minutes at 4°C. The supernatant is aliquoted to smaller tubes and should be immediately used for CFPS activity measurement or alternatively should be flash frozen for future uses.

[0145] For the glycosylation study the extract is simply mixed into CFGpS reactions according to standard protocols (Hershewe, J.M., Warfel, K.F., Iyer, S.M. et al. Improving cell-free glycoprotein synthesis by characterizing and enriching native membrane vesicles. Nat Commun 2021 12, 2363) with all the CFPS reagents and the DNA template for the target protein molecule, pGlyTarget. In this example, a glucagon construct containing the glycosylation sequence tag DQNAT (such as SEQ ID NO: 12) is used and incubated at 30°C for 20 h with mild shaking in an incubator. The glycosylation of target protein is detected with SDS-PAGE, Western Blotting, ELISA or / and mass spectrometry.

[0146] Example 3: Protein Glycosylation in Bacterial Cells

[0147] The strain constructed in Example 1 can be used to achieve protein glycosylation in bacterial cells using the following protocol. The target protein plasmid (such as pGlyTarget, SEQ ID NO: 12) is modified in the following manner: i) an amino acid signal peptide sequence from E. coll (such as the sequence from DsbA, MKKIWLALAGLVLAFSASA) is placed in frame at the N-terminus of the target protein sequence to direct the expression of target protein in the periplasm where glycosylation occurs (Fisher AC, Haitjema CH, Guarino C, Celik E, Endicott CE, Reading CA, Merritt JH, Ptak AC, Zhang S and DeLisa MP. Production of secretory and extracellular N- linked glycoproteins in Escherichia coli. Appl Environ Microbiol, 2011 77: 871-81) and ii) the origin of replication is modified to be compatible with pLLO and pOST (an example compatible ori is CloDF13). Then, the E. coll strain endogenously expressing the heterologous polymerase (T7Pol in this example) is transformed with glycosylation machineries containing plasmids pOST and pLLO and the modified pGlyTarget plasmid containing the glycosylation target protein. The transformed strain is grown in 1 L of TB medium in a tunair flask at 37°C with 250 rpm. The expression of T7Pol and glycosylation machineries is induced at OD-O.4 by adding 1 mM IPTG and 0.2% L-arabinose and the culture is harvested after at least 8 h. The cells are then lysed and the glycosylated product is optionally purified and then quantified with SDS-PAGE, Western Blotting, ELISA and / or mass spectrometry.

[0148] SEQUENCES DESCRIBED HEREIN

[0149] SEQ ID NO: 1 (amino acid sequence of T7 RNA polymerase)

[0150] Met Asn Thr lie Asn He Ala Lys Asn Asp Phe Ser Asp He Glu Leu Ala Ala He Pro Phe Asn Thr Leu Ala Asp His Tyr Gly Glu Arg Leu Ala Arg Glu Gin Leu Ala Leu Glu His Glu Ser Tyr Glu Met Gly Glu Ala Arg Phe Arg Lys Met Phe Glu Arg Gin Leu Lys Ala Gly Glu Vai Ala Asp Asn Ala Ala Ala Lys Pro Leu He Thr Thr Leu Leu Pro Lys Met lie Ala Arg He Asn Asp Trp Phe Glu Glu Vai Lys Ala Lys Arg Gly Lys Arg Pro Thr Ala Phe Gin Phe Leu Gin Glu He Lys Pro Glu Ala Vai Ala Tyr He Thr He Lys Thr Thr Leu Ala Cys Leu Thr Ser Ala Asp Asn Thr Thr Vai Gin Ala Vai Ala Ser Ala lie Gly Arg Ala He Glu Asp Glu Ala Arg Phe Gly Arg He Arg Asp Leu Glu Ala Lys His Phe Lys Lys Asn Vai Glu Glu Gin Leu Asn Lys Arg Vai Gly His Vai Tyr Lys Lys Ala Phe Met Gin Vai Vai Glu Ala Asp Met Leu Ser Lys Gly Leu Leu Gly Gly Glu Ala Trp Ser Ser Trp His Lys Glu Asp Ser He His Vai Gly Vai Arg Cys He Glu Met Leu lie Glu Ser Thr Gly Met Vai Ser Leu His Arg Gin Asn Ala Gly Vai Vai Gly Gin Asp Ser Glu Thr He Glu Leu Ala Pro Glu Tyr Ala Glu Ala He Ala Thr Arg Ala Gly Ala Leu Ala Gly He Ser Pro Met Phe Gin Pro Cys Vai Vai Pro Pro Lys Pro Trp Thr Gly He Thr Gly Gly Gly Tyr Trp Ala Asn Gly Arg Arg Pro Leu Ala Leu Vai Arg Thr His Ser Lys Lys Ala Leu Met Arg Tyr Glu Asp Vai Tyr Met Pro Glu Vai Tyr Lys Ala He Asn He Ala Gin Asn Thr Ala Trp Lys He Asn Lys Lys Vai Leu Ala Vai Ala Asn Vai He Thr Lys Trp Lys His Cys Pro Vai Glu Asp He Pro Ala He Glu Arg Glu Glu Leu Pro Met Lys Pro Glu Asp He Asp Met Asn Pro Glu Ala Leu Thr Ala Trp Lys Arg Ala Ala Ala Ala Vai Tyr Arg Lys Asp Lys Ala Arg Lys Ser Arg Arg He Ser Leu Glu Phe Met Leu Glu Gin Ala Asn Lys Phe Ala Asn His Lys Ala He Trp Phe Pro Tyr Asn Met Asp Trp Arg Gly Arg Vai Tyr Ala Vai Ser Met Phe Asn Pro Gin Gly Asn Asp Met Thr Lys Gly Leu Leu Thr Leu Ala Lys Gly Lys Pro He Gly Lys Glu Gly Tyr Tyr Trp Leu Lys He His Gly Ala Asn Cys Ala Gly Vai Asp Lys Vai Pro Phe Pro Glu Arg He Lys Phe He Glu Glu Asn His Glu Asn He Met Ala Cys Ala Lys Ser Pro Leu Glu Asn Thr Trp Trp Ala Glu Gin Asp Ser Pro Phe Cys Phe Leu Ala Phe Cys Phe Glu Tyr Ala Gly Vai Gin His His Gly Leu Ser Tyr Asn Cys Ser Leu Pro Leu Ala Phe Asp Gly Ser Cys Ser Gly He Gin His Phe Ser Ala Met Leu Arg Asp Glu Vai Gly Gly Arg Ala Vai Asn Leu Leu Pro Ser Glu Thr Vai Gin Asp He Tyr Gly He Vai Ala Lys Lys Vai Asn Glu He Leu Gin Ala Asp Ala He Asn Gly Thr Asp Asn Glu Vai Vai Thr Vai Thr Asp Glu Asn Thr Gly Glu He Ser Glu Lys Vai Lys Leu Gly Thr Lys Ala Leu Ala Gly Gin Trp Leu Ala Tyr Gly Vai Thr Arg Ser Vai Thr Lys Arg Ser Vai Met Thr Leu Ala Tyr Gly Ser Lys Glu Phe Gly Phe Arg Gin Gin Vai Leu Glu Asp Thr He Gin Pro Ala He Asp Ser Gly Lys Gly Leu Met Phe Thr Gin Pro Asn Gin Ala Ala Gly Tyr Met Ala Lys Leu He Trp Glu Ser Vai Ser Vai Thr Vai Vai Ala Ala Vai Glu Ala Met Asn Trp Leu Lys Ser Ala Ala Lys Leu Leu Ala Ala Glu Vai Lys Asp Lys Lys Thr Gly Glu He Leu Arg Lys Arg Cys Ala Vai His Trp Vai Thr Pro Asp Gly Phe Pro Vai Trp Gin Glu Tyr Lys Lys Pro He Gin Thr Arg Leu Asn Leu Met Phe Leu Gly Gin Phe Arg Leu Gin Pro Thr He Asn Thr Asn Lys Asp Ser Glu He Asp Ala His Lys Gin Glu Ser Gly He Ala Pro Asn Phe Vai His Ser Gin Asp Gly Ser His Leu Arg Lys Thr Vai Vai Trp Ala His Glu Lys Tyr Gly He Glu Ser Phe Ala Leu He His Asp Ser Phe Gly Thr He Pro Ala Asp Ala Ala Asn Leu Phe Lys Ala Vai Arg Glu Thr Met Vai Asp Thr Tyr Glu Ser Cys Asp Vai Leu Ala Asp Phe Tyr Asp Gin Phe Ala Asp Gin Leu His Glu Ser Gin Leu Asp Lys Met Pro Ala Leu Pro Ala Lys Gly Asn Leu Asn Leu Arg Asp He Leu Glu Ser Asp Phe Ala Phe Ala SEQ ID NO:2 (nucleic acid sequence of T7 RNA polymerase) tcgcgctgca ctggcgtaat gctgaccgga tggctatcgc taatggtctt acgctcaaca 60 ttgataagca acttgacgca atgttaatgg gctgatagtc ttatcttaca ggtcatctgc 120 gggtggcctg aataggtacg atttactaac tggaagaggc actaaatgaa cacgattaac 180 atcgctaaga acgacttctc tgacatcgaa ctggctgcta tcccgttcaa cactctggct 240 gaccattacg gtgagcgttt agctcgcgaa cagttggccc ttgagcatga gtcttacgag 300 atgggtgaag cacgcttccg caagatgttt gagcgtcaac ttaaagctgg tgaggttgcg 360 gataacgctg ccgccaagcc tctcatcact accctactcc ctaagatgat tgcacgcatc 420 aacgactggt ttgaggaagt gaaagctaag cgcggcaagc gcccgacagc cttccagttc 480 ctgcaagaaa tcaagccgga agccgtagcg tacatcacca ttaagaccac tctggcttgc 540 ctaaccagtg ctgacaatac aaccgttcag gctgtagcaa gcgcaatcgg tcgggccatt 600 gaggacgagg ctcgcttcgg tcgtatccgt gaccttgaag ctaagcactt caagaaaaac 660 gttgaggaac aactcaacaa gcgcgtaggg cacgtctaca agaaagcatt tatgcaagtt 720 gtcgaggctg acatgctctc taagggtcta ctcggtggcg aggcgtggtc ttcgtggcat 780 aaggaagact ctattcatgt aggagtacgc tgcatcgaga tgctcattga gtcaaccgga 840 atggttagct tacaccgcca aaatgctggc gtagtaggtc aagactctga gactatcgaa 900 ctcgcacctg aatacgctga ggctatcgca acccgtgcag gtgcgctggc tggcatctct 960 ccgatgttcc aaccttgcgt agttcctcct aagccgtgga ctggcattac tggtggtggc 1020 tattgggcta acggtcgtcg tcctctggcg ctggtgcgta ctcacagtaa gaaagcactg 1080 atgcgctacg aagacgttta catgcctgag gtgtacaaag cgattaacat tgcgcaaaac 1140 accgcatgga aaatcaacaa gaaagtccta gcggtcgcca acgtaatcac caagtggaag 1200 cattgtccgg tcgaggacat ccctgcgatt gagcgtgaag aactcccgat gaaaccggaa 1260 gacatcgaca tgaatcctga ggctctcacc gcgtggaaac gtgctgccgc tgctgtgtac 1320 cgcaaggaca gggctcgcaa gtctcgccgt atcagccttg agttcatgct tgagcaagcc 1380 aataagtttg ctaaccataa ggccatctgg ttcccttaca acatggactg gcgcggtcgt 1440 gtttacgccg tgtcaatgtt caacccgcaa ggtaacgata tgaccaaagg actgcttacg 1500 ctggcgaaag gtaaaccaat cggtaaggaa ggttactact ggctgaaaat ccacggtgca 1560 aactgtgcgg gtgtcgataa ggttccgttc cctgagcgca tcaagttcat tgaggaaaac 1620 cacgagaaca tcatggcttg cgctaagtct ccactggaga acacttggtg ggctgagcaa 1680 gattctccgt tctgcttcct tgcgttctgc tttgagtacg ctggggtaca gcaccacggc 1740 ctgagctata actgctccct tccgctggcg tttgacgggt cttgctctgg catccagcac 1800 ttctccgcga tgctccgaga tgaggtaggt ggtcgcgcgg ttaacttgct tcctagtgag 1860 accgttcagg acatctacgg gattgttgct aagaaagtca acgagattct acaagcagac 1920 gcaatcaatg ggaccgataa cgaagtagtt accgtgaccg atgagaacac tggtgaaatc 1980 tctgagaaag tcaagctggg cactaaggca ctggctggtc aatggctggc tcacggtgtt 2040 actcgcagtg tgactaagcg ttcagtcatg acgctggctt acgggtccaa agagttcggc 2100 ttccgtcaac aagtgctgga agataccatt cagccagcta ttgattccgg caagggtccg 2160 atgttcactc agccgaatca ggctgctgga tacatggcta agctgatttg ggaatctgtg 2220 agcgtgacgg tggtagctgc ggttgaagca atgaactggc ttaagtctgc tgctaagctg 2280 ctggctgctg aggtcaaaga taagaagact ggagagattc ttcgcaagcg ttgcgctgtg 2340 cattgggtaa ctcctgatgg tttccctgtg tggcaggaat acaagaagcc tattcagacg 2400 cgcttgaacc tgatgttcct cggtcagttc cgcttacagc ctaccattaa caccaacaaa 2460 gatagcgaga ttgatgcaca caaacaggag tctggtatcg ctcctaactt tgtacacagc 2520 caagacggta gccaccttcg taagactgta gtgtgggcac acgagaagta cggaatcgaa 2580 tcttttgcac tgattcacga ctccttcggt accattccgg ctgacgctgc gaacctgttc 2640 aaagcagtgc gcgaaactat ggttgacaca tatgagtctt gtgatgtact ggctgatttc 2700 tacgaccagt tcgctgacca gttgcacgag tctcaattgg acaaaatgcc agcacttccg 2760 gctaaaggta acttgaacct ccgtgacatc ttagagtcgg acttcgcgtt cgcgtaacgc 2820 caaatcaata cgactcacta tagagggaca aactcaaggt cattcgcaag agtggcc 2877

[0151] SEQ ID NO: 3 (promoter sequence for T7 RNA polymerase) taatacgact cactatag 18

[0152] SEQ ID N0:4 (amino acid sequence of T3 RNA polymerase)

[0153] Met Asn lie lie Glu Asn lie Glu Lys Asn Asp Phe Ser Glu lie Glu Leu Ala Ala He Pro Phe Asn Thr Leu Ala Asp His Tyr Gly Ser Ala Leu Ala Lys Glu Gin Leu Ala Leu Glu His Glu Ser Tyr Glu Leu Gly Glu Arg Arg Phe Leu Lys Met Leu Glu Arg Gin Ala Lys Ala Gly Glu lie Ala Asp Asn Ala Ala Ala Lys Pro Leu Leu Ala Thr Leu Leu Pro Lys Leu Thr Thr Arg lie Vai Glu Trp Leu Glu Glu Tyr Ala Ser Lys Lys Gly Arg Lys Pro Ser Ala Tyr Ala Pro Leu Gin Leu Leu Lys Pro Glu Ala Ser Ala Phe He Thr Leu Lys Vai lie Leu Ala Ser Leu Thr Ser Thr Asn Met Thr Thr He Gin Ala Ala Ala Gly Met Leu Gly Lys Ala lie Glu Asp Glu Ala Arg Phe Gly Arg He Arg Asp Leu Glu Ala Lys His Phe Lys Lys His Vai Glu Glu Gin Leu Asn Lys Arg His Gly Gin Vai Tyr Lys Lys Ala Phe Met Gin Vai Vai Glu Ala Asp Met He Gly Arg Gly Leu Leu Gly Gly Glu Ala Trp Ser Ser Trp Asp Lys Glu Thr Thr Met His Vai Gly He Arg Leu He Glu Met Leu lie Glu Ser Thr Gly Leu Vai Glu Leu Gin Arg His Asn Ala Gly Asn Ala Gly Ser Asp His Glu Ala Leu Gin Leu Ala Gin Glu Tyr Vai Asp Vai Leu Ala Lys Arg Ala Gly Ala Leu Ala Gly He Ser Pro Met Phe Gin Pro Cys Vai Vai Pro Pro Lys Pro Trp Vai Ala He Thr Gly Gly Gly Tyr Trp Ala Asn Gly Arg Arg Pro Leu Ala Leu Vai Arg Thr His Ser Lys Lys Gly Leu Met Arg Tyr Glu Asp Vai Tyr Met Pro Glu Vai Tyr Lys Ala Vai Asn Leu Ala Gin Asn Thr Ala Trp Lys He Asn Lys Lys Vai Leu Ala Vai Vai Asn Glu He Vai Asn Trp Lys Asn Cys Pro Vai Ala Asp He Pro Ser Leu Glu Arg Gin Glu Leu Pro Pro Lys Pro Asp Asp He Asp Thr Asn Glu Ala Ala Leu Lys Glu Trp Lys Lys Ala Ala Ala Gly He Tyr Arg Leu Asp Lys Ala Arg Vai Ser Arg Arg He Ser Leu Glu Phe Met Leu Glu Gin Ala Asn Lys Phe Ala Ser Lys Lys Ala He Trp Phe Pro Tyr Asn Met Asp Trp Arg Gly Arg Vai Tyr Ala Vai Pro Met Phe Asn Pro Gin Gly Asn Asp Met Thr Lys Gly Leu Leu Thr Leu Ala Lys Gly Lys Pro He Gly Glu Glu Gly Phe Tyr Trp Leu Lys He His Gly Ala Asn Cys Ala Gly Vai Asp Lys Vai Pro Phe Pro Glu Arg He Ala Phe He Glu Lys His Vai Asp Asp He Leu Ala Cys Ala Lys Asp Pro He Asn Asn Thr Trp Trp Ala Glu Gin Asp Ser Pro Phe Cys Phe Leu Ala Phe Cys Phe Glu Tyr Ala Gly Vai Thr His His Gly Leu Ser Tyr Asn Cys Ser Leu Pro Leu Ala Phe Asp Gly Ser Cys Ser Gly He Gin His Phe Ser Ala Met Leu Arg Asp Glu Vai Gly Gly Arg Ala Vai Asn Leu Leu Pro Ser Glu Thr Vai Gin Asp He Tyr Gly He Vai Ala Gin Lys Vai Asn Glu He Leu Lys Gin Asp Ala He Asn Gly Thr Pro Asn Glu Met He Thr Vai Thr Asp Lys Asp Thr Gly Glu He Ser Glu Lys Leu Lys Leu Gly Thr Ser Thr Leu Ala Gin Gin Trp Leu Ala Tyr Gly Vai Thr Arg Ser Vai Thr Lys Arg Ser Vai Met Thr Leu Ala Tyr Gly Ser Lys Glu Phe Gly Phe Arg Gin Gin Vai Leu Asp Asp Thr He Gin Pro Ala He Asp Ser Gly Lys Gly Leu Met Phe Thr Gin Pro Asn Gin Ala Ala Gly Tyr Met Ala Lys Leu He Trp Asp Ala Vai Ser Vai Thr Vai Vai Ala Ala Vai Glu Ala Met Asn Trp Leu Lys Ser Ala Ala Lys Leu Leu Ala Ala Glu Vai Lys Asp Lys Lys Thr Lys Glu He Leu Arg His Arg Cys Ala Vai His Trp Thr Thr Pro Asp Gly Phe Pro Vai Trp Gin Glu Tyr Arg Lys Pro Leu Gin Lys Arg Leu Asp Met He Phe Leu Gly Gin Phe Arg Leu Gin Pro Thr He Asn Thr Leu Lys Asp Ser Gly He Asp Ala His Lys Gin Glu Ser Gly He Ala Pro Asn Phe Vai His Ser Gin Asp Gly Ser His Leu Arg Met Thr Vai Vai Tyr Ala His Glu Lys Tyr Gly He Glu Ser Phe Ala Leu He His Asp Ser Phe Gly Thr He Pro Ala Asp Ala Gly Lys Leu Phe Lys Ala Vai Arg Glu Thr Met Vai He Thr Tyr Glu Asn Asn Asp Vai Leu Ala Asp Phe Tyr Ser Gin Phe Ala Asp Gin Leu His Glu Thr Gin Leu Asp Lys Met Pro Pro Leu Pro Lys Lys Gly Asn Leu Asn Leu Gin Asp He Leu Lys Ser Asp Phe Ala Phe Ala

[0154] SEQ ID NO: 5 (nucleic acid sequence of T3 RNA polymerase) gatgaggtgc gcattgtggg gcaaaccgtt acacatagac gcataccttg acaagcgtct 60 acaaggctga tagagtcttt tcttacaggt catcatgagg tggcctgaat aggaacgatt 120 tattcacaat gaggtaagca atgaacatca tcgaaaacat cgaaaagaat gacttctcag 180 aaatcgaact ggctgctatc ccgttcaaca cactggctga ccactacgga agcgccttgg 240 ctaaagagca gttggcttta gaacatgagt cttatgagct aggcgagcgc cgcttcctca 300 agatgcttga gcgtcaagcg aaagctggtg agattgcaga caacgcagcc gctaagccgt 360 tactcgctac gcttctccct aagttaacca cacgtatcgt cgagtggctc gaagagtacg 420 catcgaagaa aggccgcaag cctagcgcat acgcaccgct ccagttactc aagccggagg 480 cctccgcgtt tatcaccctg aaagttatcc ttgcgtcact aaccagtacg aacatgacaa 540 ccattcaggc cgctgctggt atgctgggga aagccattga ggacgaggca cgatttgggc 600 gcatccgtga cctagaagcg aagcacttca agaagcacgt tgaggaacag cttaacaagc 660 gccacgggca agtctacaag aaagcattta tgcaggtggt cgaggccgat atgattggtc 720 gaggtctgct tggtggcgag gcgtggtcta gctgggataa agaaaccacg atgcacgtag 780 ggattcgcct gattgaaatg ctgattgaat ccacgggtct ggtggaatta cagcgccaca 840 acgcaggtaa cgcaggctct gaccatgagg cactgcaact ggcccaagag tacgtggacg 900 tattagcgaa gcgtgcaggc gctctggcgg gtatctctcc gatgttccag ccgtgtgtcg 960 taccgccgaa accttgggta gcaatcacag ggggcggcta ttgggctaac ggtcgcagac 1020 ctttggcact cgttcgcact cactctaaga agggcttgat gcgctacgaa gacgtttaca 1080 tgccagaagt ctacaaggct gtgaacctcg cgcaaaacac cgcatggaaa atcaacaaga 1140 aagttcttgc tgttgtcaat gagattgtta actggaagaa ttgcccggta gcagacattc 1200 catcgctgga gcgccaagag ttaccgccta agcctgacga cattgacacc aacgaggcag 1260 cgctcaagga gtggaagaaa gccgctgctg gtatctatcg cttggacaag gcacgagtgt 1320 ctcgccgtat cagcttagag ttcatgctgg agcaggccaa caagttcgca agtaagaaag 1380 caatctggtt cccttacaac atggactggc gcggtcgtgt gtacgctgtg ccgatgttca 1440 acccgcaagg caacgacatg acgaaaggtc tgctgaccct tgctaaaggc aagccaatcg 1500 gtgaggaagg tttctactgg ctgaaaatcc acggtgcgaa ctgtgcgggt gttgataagg 1560 ttccattccc ggagcgcatc gcgttcattg agaagcacgt agacgacatt ctggcttgcg 1620 ctaaagaccc aatcaataac acttggtggg ctgagcagga ttcaccgttc tgtttcctcg 1680 cgttttgctt cgagtatgca ggcgttacgc accacggtct gagctacaat tgctctctgc 1740 cgctggcgtt cgacgggtct tgctctggta tccagcactt ctccgcgatg ctccgcgatg 1800 aggtaggcgg tcgtgcggtt aacctgctgc caagcgaaac cgtgcaggac atttacggca 1860 tcgttgcaca gaaagtaaac gagattctca aacaggatgc aatcaacggc acgcctaacg 1920 agatgattac cgtgaccgac aaggacaccg gggaaatctc agagaagctc aaacttggaa 1980 cctcaacgct ggcgcaacag tggctggcat atggtgtaac ccgtagcgta actaaacgtt 2040 cggtcatgac gctggcttac ggttccaagg agttcggctt tcgtcaacag gtattggatg 2100 acaccattca gcctgcaatt gacagcggta agggcttgat gttcacccaa ccgaaccaag 2160 cggctggcta tatggctaag ctgatttggg atgcggtaag cgtgaccgta gttgcagcgg 2220 ttgaggcgat gaactggctc aaatctgccg ctaagctgct ggctgctgag gtcaaggaca 2280 agaagaccaa ggagattctg cgccaccgtt gcgcggttca ctggactacg ccggacggct 2340 tcccggtctg gcaggaatac cgcaagccac tccagaagcg tctcgatatg attttcttag 2400 ggcaattccg tctgcaaccg acgattaata ccctcaagga ttcaggcatt gacgcacaca 2460 agcaggagtc tggcatcgct cctaactttg ttcactcaca ggacggtagc cacctccgca 2520 tgacagtcgt ttatgctcac gagaagtatg gcattgagtc ctttgcgctc atccatgaca 2580 gctttgggac tatcccggca gacgctggta agctctttaa ggctgtgcgt gaaacgatgg 2640 ttatcaccta tgagaacaac gatgtgctgg cagacttcta ctctcagttt gccgaccagc 2700 tacacgagac ccaactggac aagatgcctc cgcttccgaa gaaaggaaac ctgaacctgc 2760 aagacattct caagtctgac tttgcctttg cataacaagc acttagcatt aaccctcact 2820 aacgggagac tacttaaggt ctcccacttt aagacacttt aggtactaag agattaaatt 2880 tatgattaac attaag 2896

[0155] SEQ ID NO: 6 (promoter sequence for T3 RNA polymerase) aattaaccct cactaaag 18 SEQ ID N0:7 (amino acid sequence for SP6 RNA polymerase)

[0156] Met Gin Asp Leu His Ala lie Gin Leu Gin Leu Glu Glu Glu Met Phe Asn Gly Gly lie Arg Arg Phe Glu Ala Asp Gin Gin Arg Gin lie Ala Ala Gly Ser Glu Ser Asp Thr Ala Trp Asn Arg Arg Leu Leu Ser Glu Leu lie Ala Pro Met Ala Glu Gly lie Gin Ala Tyr Lys Glu Glu Tyr Glu Gly Lys Lys Gly Arg Ala Pro Arg Ala Leu Ala Phe Leu Gin Cys Vai Glu Asn Glu Vai Ala Ala Tyr lie Thr Met Lys Vai Vai Met Asp Met Leu Asn Thr Asp Ala Thr Leu Gin Ala lie Ala Met Ser Vai Ala Glu Arg lie Glu Asp Gin Vai Arg Phe Ser Lys Leu Glu Gly His Ala Ala Lys Tyr Phe Glu Lys Vai Lys Lys Ser Leu Lys Ala Ser Arg Thr Lys Ser Tyr Arg His Ala His Asn Vai Ala Vai Vai Ala Glu Lys Ser Vai Ala Glu Lys Asp Ala Asp Phe Asp Arg Trp Glu Ala Trp Pro Lys Glu Thr Gin Leu Gin lie Gly Thr Thr Leu Leu Glu lie Leu Glu Gly Ser Vai Phe Tyr Asn Gly Glu Pro Vai Phe Met Arg Ala Met Arg Thr Tyr Gly Gly Lys Thr lie Tyr Tyr Leu Gin Thr Ser Glu Ser Vai Gly Gin Trp lie Ser Ala Phe Lys Glu His Vai Ala Gin Leu Ser Pro Ala Tyr Ala Pro Cys Vai lie Pro Pro Arg Pro Trp Arg Thr Pro Phe Asn Gly Gly Phe His Thr Glu Lys Vai Ala Ser Arg lie Arg Leu Vai Lys Gly Asn Arg Glu His Vai Arg Lys Leu Thr Gin Lys Gin Met Pro Lys Vai Tyr Lys Ala lie Asn Ala Leu Gin Asn Thr Gin Trp Gin lie Asn Lys Asp Vai Leu Ala Vai lie Glu Glu Vai lie Arg Leu Asp Leu Gly Tyr Gly Vai Pro Ser Phe Lys Pro Leu lie Asp Lys Glu Asn Lys Pro Ala Asn Pro Vai Pro Vai Glu Phe Gin His Leu Arg Gly Arg Glu Leu Lys Glu Met Leu Ser Pro Glu Gin Trp Gin Gin Phe lie Asn Trp Lys Gly Glu Cys Ala Arg Leu Tyr Thr Ala Glu Thr Lys Arg Gly Ser Lys Ser Ala Ala Vai Vai Arg Met Vai Gly Gin Ala Arg Lys Tyr Ser Ala Phe Glu Ser lie Tyr Phe Vai Tyr Ala Met Asp Ser Arg Ser Arg Vai Tyr Vai Gin Ser Ser Thr Leu Ser Pro Gin Ser Asn Asp Leu Gly Lys Ala Leu Leu Arg Phe Thr Glu Gly Arg Pro Vai Asn Gly Vai Glu Ala Leu Lys Trp Phe Cys lie Asn Gly Ala Asn Leu Trp Gly Trp Asp Lys Lys Thr Phe Asp Vai Arg Vai Ser Asn Vai Leu Asp Glu Glu Phe Gin Asp Met Cys Arg Asp lie Ala Ala Asp Pro Leu Thr Phe Thr Gin Trp Ala Lys Ala Asp Ala Pro Tyr Glu Phe Leu Ala Trp Cys Phe Glu Tyr Ala Gin Tyr Leu Asp Leu Vai Asp Glu Gly Arg Ala Asp Glu Phe Arg Thr His Leu Pro Vai His Gin Asp Gly Ser Cys Ser Gly lie Gin His Tyr Ser Ala Met Leu Arg Asp Glu Vai Gly Ala Lys Ala Vai Asn Leu Lys Pro Ser Asp Ala Pro Gin Asp lie Tyr Gly Ala Vai Ala Gin Vai Vai lie Lys Lys Asn Ala Leu Tyr Met Asp Ala Asp Asp Ala Thr Thr Phe Thr Ser Gly Ser Vai Thr Leu Ser Gly Thr Glu Leu Arg Ala Met Ala Ser Ala Trp Asp Ser lie Gly lie Thr Arg Ser Leu Thr Lys Lys Pro Vai Met Thr Leu Pro Tyr Gly Ser Thr Arg Leu Thr Cys Arg Glu Ser Vai lie Asp Tyr lie Vai Asp Leu Glu Glu Lys Glu Ala Gin Lys Ala Vai Ala Glu Gly Arg Thr Ala Asn Lys Vai His Pro Phe Glu Asp Asp Arg Gin Asp Tyr Leu Thr Pro Gly Ala Ala Tyr Asn Tyr Met Thr Ala Leu lie Trp Pro Ser lie Ser Glu Vai Vai Lys Ala Pro lie Vai Ala Met Lys Met lie Arg Gin Leu Ala Arg Phe Ala Ala Lys Arg Asn Glu Gly Leu Met Tyr Thr Leu Pro Thr Gly Phe lie Leu Glu Gin Lys lie Met Ala Thr Glu Met Leu Arg Vai Arg Thr Cys Leu Met Gly Asp lie Lys Met Ser Leu Gin Vai Glu Thr Asp lie Vai Asp Glu Ala Ala Met Met Gly Ala Ala Ala Pro Asn Phe Vai His Gly His Asp Ala Ser His Leu lie Leu Thr Vai Cys Glu Leu Vai Asp Lys Gly Vai Thr Ser lie Ala Vai lie His Asp Ser Phe Gly Thr His Ala Asp Asn Thr Leu Thr Leu Arg Vai Ala Leu Lys Gly Gin Met Vai Ala Met Tyr lie Asp Gly Asn Ala Leu Gin Lys Leu Leu Glu Glu His Glu Glu Arg Trp Met Vai Asp Thr Gly He Glu Vai Pro Glu Gin Gly Glu Phe Asp Leu Asn Glu He Met Asp Ser Glu Tyr Vai Phe Ala

[0157] SEQ ID NO: 8 (nucleic sequence for SP6 RNA polymerase) gatgoaagat ttacacgcta tccagcttca attagaagaa gagatgttta atggtggoat 60 tcgtcgcttc gaagcagatc aacaacgcca gattgcagca ggtagcgaga gcgacacagc 120 atggaaccgc cgcctgttgt cagaacttat tgcacctatg gctgaaggca ttcaggctta 180 taaagaagag tacgaaggta agaaaggtcg tgcacctcgc gcattggctt tcttacaatg 240 tgtagaaaat gaagttgcag catacatcac tatgaaagtt gttatggata tgctgaatac 300 ggatgctacc cttcaggcta ttgcaatgag tgtagcagaa cgcattgaag accaagtgcg 360 cttttctaag ctagaaggto acgocgctaa atactttgag aaggttaaga agtcactcaa 420 ggctagccgt actaagtcat atcgtcacgc tcataacgta gctgtagttg ctgaaaaatc 480 agttgcagaa aaggacgcgg actttgaccg ttgggaggcg tggccaaaag aaactcaatt 540 gcagattggt actaccttgc ttgaaatctt agaaggtagc gttttctata atggtgaacc 600 tgtatttatg cgtgctatgc gcacttatgg cggaaagact atttactact tacaaacttc 660 tgaaagtgta ggccagtgga ttagcgcatt caaagagcac gtagcgcaat taagcccagc 720 ttatgcccct tgcgtaatcc ctcctcgtcc ttggagaact ccatttaatg gagggttcca 780 tactgagaag gtagctagcc gtatccgtct tgtaaaaggt aaccgtgagc atgtacgcaa 840 gttgactcaa aagcaaatgc caaaggttta taaggctatc aacgcattac aaaatacaca 900 atggcaaatc aacaaggatg tattagcagt tattgaagaa gtaatccgct tagaccttgg 960 ttatggtgta ccttccttca agccactgat tgacaaggag aacaagccag ctaacccggt 1020 acctgttgaa ttccaacacc tgcgcggtcg tgaactgaaa gagatgctat cacctgagca 1080 gtggcaacaa ttcattaact ggaaaggcga atgcgcgcgc ctatataccg cagaaactaa 1140 gcgcggttca aagtccgccg ccgttgttcg catggtagga caggcccgta aatatagcgc 1200 ctttgaatcc atttacttcg tgtacgcaat ggatagccgc agccgtgtct atgtgcaatc 1260 tagcacgctc tctccgcagt ctaacgactt aggtaaggca ttactccgct ttaccgaggg 1320 acgccctgtg aatggcgtag aagcgcttaa atggttctgc atcaatggtg ctaacctttg 1380 gggatgggac aagaaaactt ttgatgtgcg cgtgtctaac gtattagatg aggaattcca 1440 agatatgtgt cgagacatcg ccgcagaccc tctcacattc acccaatggg ctaaagctga 1500 tgcaccttat gaattcctcg cttggtgctt tgagtatgct caataccttg atttggtgga 1560 tgaaggaagg gccgacgaat tccgcactca cctaccagta catcaggacg ggtcttgttc 1620 aggcattcag cactatagtg ctatgcttcg cgacgaagta ggggccaaag ctgttaacct 1680 gaaaccctcc gatgcaccgc aggatatcta tggggcggtg gcgcaagtgg ttatcaagaa 1740 gaatgcgcta tatatggatg cggacgatgc aaccacgttt acttctggta gcgtcacgct 1800 gtccggtaca gaactgcgag caatggctag cgcatgggat agtattggta ttacccgtag 1860 cttaaccaaa aagcccgtga tgaccttgcc atatggttct actcgcttaa cttgccgtga 1920 atctgtgatt gattacatcg tagacttaga ggaaaaagag gcgcagaagg cagtagcaga 1980 agggcggacg gcaaacaagg tacatccttt tgaagacgat cgtcaagatt acttgactcc 2040 gggcgcagct tacaactaca tgacggcact aatctggcct tctatttctg aagtagttaa 2100 ggcaccgata gtagctatga agatgatacg ccagcttgca cgctttgcag cgaaacgtaa 2160 tgaaggcctg atgtacaccc tgcctactgg cttcatctta gaacagaaga tcatggcaac 2220 cgagatgcta cgcgtgcgta cctgtctgat gggtgatatc aagatgtccc ttcaggttga 2280 aacggatatc gtagatgaag ccgctatgat gggagcagca gcacctaatt tcgtacacgg 2340 tcatgacgca agtcacctta tccttaccgt atgtgaattg gtagacaagg gcgtaactag 2400 tatcgctgta atccacgact cttttggtac tcatgcagac aacaccctca ctcttagagt 2460 ggcacttaaa gggcagatgg ttgcaatgta tattgatggt aatgcgcttc agaaactact 2520 ggaggagcat gaagagcgct ggatggttga tacaggtatc gaagtacctg agcaagggga 2580 gttcgacctt aacgaaatca tggattctga atacgtattt gcctaataga 2630

[0158] SEQ ID NO: 9 (promoter sequence for SP6 RNA polymerase) taatccactg tgatat 16

[0159] SEQ ID NO:10 (pLLO)

[0160] CGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTG

[0161] AAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTG

[0162] TTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGT

[0163] TTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGC

[0164] AAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCT

[0165] TAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGGTGCCCTTAAACG

[0166] CCTGGTGCTACGCCTGAATAAGTGATAATAAGCGGATGAATGGCAGAAATTCGAAGAATAGTTACGGCTTATGACATCT

[0167] TTGTGGACACATCATTCACTTTTTATTCACATCCGGCCCTGAACTCGCTAGGACTTGCCCCGGTGCATTTTTTAAATAC

[0168] CCGCGAAAAATAGAGCTGATCGTCAAATCCAACATTGCGCCCAACGGTCGCTATCGGCATTCGCGTAGTGCTAAGCAGA

[0169] AGTTTCGCCTGGCTGATACGCTGATCTTCGCGCCAGCTCAATACGCTAATGCCTAACTGCTGGCGGAACAGATGTGATA

[0170] ACCGGGAGGGCGACAGGCAGACATGCTGGGCGACGCTGGCGATATCAAAATGGCTGTCCGCCAGATGGTCGCTGATATA CTGGCAGGCATCGCGCACACGGCTATCCATCGGCGGGTGCAACGACTCATTAATTACCGCCATACGTCTGAGCAACAAC

[0171] TGCTCCAGCAGATTGATCGCCAGTAGCTCAGAATAGCGACCTTCCCCTTGCCCGGCGCTGATGATCTGCCCGAACAGTT

[0172] CGCTGAAATGCGGCTGGCGCGCCTCGTCCGGGCGGAAAAATCCTGTCTGGGCAAAGATTGTCGGCCAGGTCAGCCACTC

[0173] CTGCCAGTAGGCGCGAGGCCGGAAATAAACCCACTGGTGATACCACTCGCTGGCGTCCGGATGCCGTCCATAGTGATGA

[0174] ATCTCGCCCGGCGGAAACAATAATATATCGCCAGGCCGACAGACAAACTGCTCGCCATTATTATTAATGACGCCCTCTC

[0175] CGCGGATGGTCAGGTTAAGAATATATCCCTTCATGCCCAACGGACGATCGATAAAAAAATCCAGATATCCATTCGCTTC

[0176] AATTGGCGTCAGCCCGGCGACCAGATGGGCATTAAATGAATATCCCGGCAATAGCGGATCATTTTGCGTTTCAGCCATG

[0177] ATTTCTCTACCCCCCGATGTTCAGAGAAGAAACAAATTGTCCATATCGACCAGGACGACAGAGCTTCCGTCTCCGCAAG

[0178] ACTTTGCGCTTGATGAAAGCACGTATCAACCCCGCTTGTGAAAAGCGCTTTGTAACAAAAGCGTACAGTTCAGGCGATA

[0179] AAATTAAGTAACAGAAGTGTCTATAACTATGGCTGGAATGTCCACATTGAATATTTGCACAGCGTCACACTTTGCAAAG

[0180] CATTAGCATTTTTGTCCATAAGATTAGCGGATCCTGCCTGACGGTTTTTGCCGCGACTCTCTATAATTTCTCCATACCT

[0181] GTTTTTCTGGATGGAGTAAGACCATGGCTCGAGGCGTCACCCATAACAGATACGGACTTTCTCAAAGGAGAGTTATCAA

[0182] TGAAGATCCTTATCACTGGGGGGGCAGGGTACATAGGGAGCCATACGCTGAAGCAATTTCTTGAGACTAATCACGAGAT

[0183] ATGTGTGTTAGATAATCTGAGTAAAGGAAGCAAAAAATCGTTAGATGAACTTTCGAAAATTCGCCCGTTCAAGTTCTTC

[0184] GAACAAGATTTGTCAGATTACGCTGGCATCAAGAAGTTATTCAAAGAGGAAAAGTTCGATGCTATCGTTCACTTTGCAG

[0185] CCAGTATCGAAGTGCCAGAGTCAATGGAGAACCCCCTTAAATACTATATGAACAATACGGCGAATACGTCAAACCTGAT

[0186] ACAGACCTGTCTTGAAACGGGTGTCAAAAAATTTATTTTCTCTAGCACGGCGGCAACTTATGGAGAACCCCAAACCCCA

[0187] ATTGTCGATGAGCAGAGTCCGTTGGCACCTATCAATCCATATGGACAATCAAAGTTGATGTCAGAGAAAGTGTTACAGG

[0188] ATGCAAATATGGCCAACCCTGAGTTCAAATATTGCATTCTTAGATATTTTAACGTGGCGGGCGCGTGCATGAGCTACCC

[0189] AATTGGTCAACGCTACCCGAAGGCCACCCTTCTGATAAAGGTCGCTGCCGAAGTGGCTACGGGCAAACGCGAGAAGCTG

[0190] TACATATTCGGAGATGACTACAATACCAAGGATGGTACTTGTATCCGTGACTTTATACACGTAGACGACATTTCAAGTG

[0191] CACACTTAGCAGCTTTGGAGTACTTAGAGAACAACGAATCTAATATCTTTAATGTGGGGTACGGCCATGGCTTTTCGGT

[0192] AAAGGAAGTAATCGAAACCATGAAGAAGGTATCGGGAGTTGACTTCACCGTAGAACTGGCTCCAAAACGCGCCGGCGAC

[0193] CCATCGGTACTTATATCGAATGCAGACAAGATTAAAACTCTTACGAATTGGAAACCTAAGTATGATGACTTAGAGCTGA

[0194] TTTGTAAATCAGCTTACGAATGGGAAAAGCAGTGCTAAAACGTCTTTTCTTCATCCTTAACGCGCACGATAAGAAATTT

[0195] TTATTTGCCTTGTTAATCTTTAGCATATTTATAGGATTCATTGAGTCTTTTGCTATATCCTTGATAATGCCGTTCGTAT

[0196] CCGTGGCTTCAAATTTTGAATTACTGGAGAAGTCATCTTACTTTCAGCCGGTGTATGAATACCTTAACTTACCATCTTA

[0197] CAAGATTATCGCGTATTTCGGCTGCATCCTGATCGCTTTTTATATTTTCAGAGCGTTTCTTAACGCGTTCTACTTTCAT

[0198] CTTCTGGCACGGTTCTCGAAAGGACGGTATCATTCATTAGCGTGCCGTATCTTTGACAAATACTTGCACCTTGAATACG

[0199] AGAACTTCACGAACAAAAATCAGTCTGAACTTCTGAAGACAATAACGCAAGAAGTGTTTCATTTATCCACGCTGATCTC

[0200] CGCTTTTTTGTTAATGTTATCCGAAAGTTTCGTAGTGTTTCTGCTGTATACACTTCTTTTAATTATAAACTACAAAATT

[0201] ACGTTAGCATTGTCTGCTTTTCTGTTATTGAATGCTTTTATCTTGATTAAAATTCTGTCCCCGCTGGTTAAAAAAGCAA

[0202] GTATAGCCCGTGAAGAAGCAATGAAGAATTATTTCGAAATATTAAATGCGAATCTGAATAACTTGAAGATTATCAAGTT

[0203] GAAGACCAAGGAACAAAGTACCCAGAAACTTTATGAAATTCAATCCGGGCTTTTCGCGAAGGCAAATATAAGTAACGAA

[0204] TCGATGAGTTCAATTCCACGGATTTATCTGGAAGGTATTGGGTTTTGCATGTTATGTTTTATAGTCGTATACCTGGTGT

[0205] TGCGTTACGAATCAGATATCTCGTCCATTCTTGCTACAATCACTATTTTTGTCGTAGCCCTTTACCGCTTAATGCCTAG

[0206] CGCTAATCGCATAATCACATCGTACAACGAGATCACGTATTACAAAAATAGCCTGGATATAATATATAACATTTTAAAT

[0207] GAGAAGGAAGAGAAATTGGGTGACGAGAACATCAAATTTAAAGAGAAGATTGTCCTGAAGAACTTGTTTTTCGCATATA

[0208] AAGGCAAAAAAAATCTGTTCAAAAACTTGAACTTCGAACTTAAGAAAAACGAGAAGATCGCATTCATTGGGAAATCTGG

[0209] TTCAGGAAAGTCCACTCTTGTAGACCTTATCATTGGTTTATTGAAGCCATCCGATGGCGCCATCTTTGTGGACGGCATA

[0210] AAGTTAGATGAGAGTAATATTAAGAGCTTCCGTTCTAAGATTGGCTACATACCACAACAGATTTACTTATTTAACGATA

[0211] GCATAGCGAAAAATATATCTTTCGGGGAGGAGATAGACAAAGCTTTACTTCACAAGGTCATCAAACAAGCTAATTTGGA AAGCTTCGTAAACTCGTTAGAAGATGGCGTGCACACGAAAGTAGGCGATTCCGGTTCTTTCTTATCAGGGGGTCAACGC

[0212] CAGAGAATAGCAATAGCCCGCGCCCTGTATCAGCAACCAGAAATACTGGTCCTGGATGAGGCCACTAGCGCGCTGGACC

[0213] AAGAATCGGAGGCGAAGATTATGGAAGAAATTTATAAAATTAGTAAGGACAAAACCCTGATTATAATAGCACACCGGTT

[0214] GTCCACCATCCAAGGCTGCGATCGGGTTTTTGAGGTGAAACATGGCCATCTTAAAGAGCAAGTATGAAAATCACGTTCA

[0215] TCATAGCCACACTGAATTCAGGAGGAGCCGAGAGAGTTTTAGTGACCCTTGCTAATGAATTATGTGAAAACCACGAGAT

[0216] AAACATAATAAAATTTCATAAGGAGGATTCCTTCTACAAATTAGATCCAAAAATTAAACTGTTTACTCTGGAGCAGTTC

[0217] GACTTCAGCACTTTATACAATAAGATCGCTTCCCGCATAAAAAAATTCAAAGCCTTGAAACAAGCTCTGAAGGACCACA

[0218] AAAGTGACGTTTTCATTTCGTTTTTGGATACTACTAATATTGCCTGTATATGGGCGAACAAAGGATCCAACACTCCCTT

[0219] GATTATATCGGAGCATTCGAGTTATACGTATTTAAAAAGTAAGATTTGGAAATTCTTACGTCGGATAAGTTTCCCCCAT

[0220] GCTAATGCTCTTACCGTGTTGTCTAACGACGACAAGAAATACTACGAGAACTTTATCAAGAAAGTGATTAATATGCCAA

[0221] ATCCATGTCATTTTTCGCCAATTAAAGAAAATCTGGAAAAGGAAAATAACGTGATATTCGTGGGACGTTTGGATCATAA

[0222] TAAGAACGCCAGCATGTTTTTAAAAGCAATTGCGAGACTGGACATTAACCTTCAGAATCAGTACAACTTCTTCATAGCC

[0223] GGGGATGGGGAATTACGTCAAGATCTTGAACAAGAAGCGATAAACCTTAATATTAAAGTCAACTTCCTGGGGAAGGTCG

[0224] AGAATATGCAGGAATTGTATAAAAAAGCCAAAATAATATGTCTGTGCTCTTTCATTGAAGGACTTCCTACGGTCCTTTT

[0225] AGAATCCCTGTACTACCAAGTCGCCCGTATCTCAACCAAGTACACATCCGGCCATAAAGACTTGATCGACGATGGCAAG

[0226] GATGGGTTTCTGGTAGACCTTGACGATGAGAAAGCGTTATCGGAAAAGCTGACCTTGTTGATGCAGGATGAGAATCTTC

[0227] GCAAAACACTTGCTCTTAACGCACAGCAACGCTGTAAGGACTACGAAGTAACTAACGTAGCACAGAAATGGTTAGACCT

[0228] TATCAAAGAGGTCAAAGTATAATATGAAGAAACTGGCCATATTCATCTACTCCTTAGGATCAGGTGGGGCCGAGCGTGT

[0229] GGTATCGACCCTGCTGCCGGTATTGAATCTGAAATATGAGGTACATTTAATCTTGATGAACGATAAAATATCATATGAC

[0230] ATCCCGGAAGTGAACATACATTATCTGGAGAAATCATCTCCGTCAGAAAGTAACCTGGCGAAGTTCTTGAAGTTACCAC

[0231] TGTTAGCCATGAAATACAAGAAGCTTTGCGAGGACTTAAAGATAAATCTTCAATTTGTTTTATTAAACCGTCCTAATTA

[0232] TATAGCTCTTATGGCCAAATCGTTGGGTCTGAAATCAACACTTATAATCAACGAATGTACCACTCCATCTGTTATTTAC

[0233] AAACATAACAACCTGAATAGCTTCATTAACAAATTCCTTATCAAAAAGTTCTATAATAAAGCTGACTTGATATTGGCGA

[0234] ATAGCATCGGTAACAAGGAGGACCTTATACAGAATTTCAACATCGAGGCCAAAAAATGCGACATCCTTTATAACGCAAT

[0235] AGATTTGGAGTCAATAATAGAGAAAAGCAAAGAAGAGATCGACTTCAAGGACCCATTCATTTTATCCGTTGGTCGGTTA

[0236] GATCACGGGAAAAACCATGCGATGTTGATAAGAGCCTATGCCAAAGTAAAAACTGATTTAAAGTTGGTAATCTTGGGCG

[0237] AAGGGATCCTGAAGGACGACTTACTTGCGCTGATCGAGACGTTAAACCTGAAAGATAAAGTGTTTTTGTTAGGCTTCGA

[0238] CAAAAACCCTTATAAATACATGTCGAAGTGTGACTTCTTTGCCTTCGCTTCGTCGTTCGAGGGCTTCAGCAACGTCCTT

[0239] ATCGAATGTCTGGCCTGCAATACGGCCGTATTATGCACTAACCACAAGAGTGGGGCGCGCGAGTTGTTTCTGGACGATG

[0240] AGTTCGGCTTACTTGTAAAAGTAGATGACGAGAAGGCTATGCAAGAGGGGCTGGAGAAAATGTGCAATGACGAAAGCTT

[0241] GAAAGCTACATACCGTCAGAAGGCATTTTTACGTGCAAAAGAATTCGACAAGATTAGCATTGCTAAGCAGTTGTTTGAG

[0242] TTCTTTAACAAAGCGTAAAATGAAAATTGGCATTTTAACGCATTCTGCTATGAGTGTATACTACTTCCGGTTGGCACTG

[0243] ATCAGAGCTTTAGAGAAGAACAACCATGAAGTGATTATCATAACCCCTAAAGATGACTTCGCGATAAAGTTGCAAGAAT

[0244] TAGGGTATAAGGTTTGCTTTTACGATTTGGCACGGTCCTCAGTCAATCCGCTGGTGGTGTTTAAGAACTTATTATCTTT

[0245] GAAGAACACTCTGAAAAACCTGAATTTGGATTTATTGCAGACCTCGGCGCATAAATCCAACACAACCGGTATAATCGCC

[0246] GCCAAAATGGCCGGGATTAAATACACTTTCGGGTTGGTTGAGGGCTTGGGAAGCTTCTATATAGATGATGATTTTAAAT

[0247] CCAAGCTTGTCCGGATGAGTATCAATTTGTTGTACAAGATTTCGTTTAAATTGGCGAACGGTTTCATTTTCGTGAACGA

[0248] GAATAACGCTCTGTTTATGAAGAACCTTGGCCTGAAAGAGGAAAAAATCAAGATAATTAAGTCAGTGGGACTGAATTTG

[0249] AAGCAGTTCTTACCCCTGAAGATTTCAACCGAAGAGAAGCAGGCTTTCTTAAAGGAATATAACATGCCAAATAAGCCAA

[0250] TCGTGTTAATGATATCCAGAGCCTTATGGCACAAAGGAATTAAGGAGTTCTATGAGGCAAGCCAAATATTGAAAGACAA

[0251] GGCTAACTTTGTGTTAGTAGGTGGACGTGACGACAATAAGTCCTGCGCACCTTTGGAATTTTTAAACAGCAACGATGTG

[0252] TTTTACTTGGGAGCGCGGTCAGATATTGCCCACCTGTTAAATTTATGTGACATTTTTGTGTTACCTTCATATAAAGAGG GGTATCCACGCACGGTCTTAGAAGCCCAAGCTTGTAAGAAGGCGTGCGTCGTTTCTGATGCGGAGGGGTGCATAGAGGC

[0253] GGTAGATAATGCAATCGATGGATTGATTTGTAAGTGCAAAGACTCTAAAGACCTTGCCGAAAAAATCGCGGTATTACTG

[0254] GAAGATGAAAAACTTAAGAACACCTTAGCTCAGAATGCCTTTCTGAAAGCCCAGAACTATGACGAAAATATCATTGCCT

[0255] TAAAGTATTTAGATTTTTACCGCGGCTTCACTAATGTATAACAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTT

[0256] TCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATTTGCCCTGCACCTCGCAGAAATAAACAAAC

[0257] CCCCGGGCAGAAATGTCTGGGGGTTTTTCTTTTGGTCATCTTTCTAGTATAAGATTCAGACACGGACGACGCGAGTGGC

[0258] GCCTCGAGGCGCCGATATCAGATCTGGTACCAAGCTTATCGATGATAAGCTGTCAAACATGAGAATTACAACTTATATC

[0259] GTATGGGGCTGACTTCAGGTGCTACATTTGAAGAGATAAATTGCACTGAAATCTAGAAATATTTATCTGATTAATAAGA

[0260] TGATCTTCTTGAGATCGTTTTGGTCTGCGCGTAATCTCTTGCTCTGAAAACGAAAAAACCGCCTTGCAGGGCGGTTTTT

[0261] CGAAGGTTCTCTGAGCTACCAACTCTTTGAACCGAGGTAACTGGCTTGGAGGAGCGCAGTCACCAAAACTTGTCCTTTC

[0262] AGTTTAGCCTTAACCGGCGCATGACTTCAAGACTAACTCCTCTAAATCAATTACCAGTGGCTGCTGCCAGTGGTGCTTT

[0263] TGCATGTCTTTCCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGACTGAACGGGGGGTTCGTGC

[0264] ATACAGTCCAGCTTGGAGCGAACTGCCTACCCGGAACTGAGTGTCAGGCGTGGAATGAGACAAACGCGGCCATAACAGC

[0265] GGAATGACACCGGTAAACCGAAAGGCAGGAACAGGAGAGCGCACGAGGGAGCCGCCAGGGGAAACGCCTGGTATCTTTA

[0266] TAGTCCTGTCGGGTTTCGCCACCACTGATTTGAGCGTCAGATTTCGTGATGCTTGTCAGGGGGGCGGAGCCTATGGAAA

[0267] AACGGCTTTGCCGCGGCCCTCTCACTTCCCTGTTAAGTATCTTCCTGGCATCTTCCAGGAAATCTCCGCCCCGTTCGTA

[0268] AGCCATTTCCGCTCGCCGCAGTCGAACGACCGAGCGTAGCGAGTCAGTGAGCGAGGAAGCGGAATATATCCTGTATCAC

[0269] ATATTCTGCTGACGCACCGGTGCAGCCTTTTTTCTCCTGCCACATGAAGCACTTCACTGACACCCTCATCAGTGCCAAC

[0270] ATAGTAAGCCAGTATACACTCCGCTAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTG

[0271] AACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGG

[0272] CAGCATCACCCGACGCACTTTGCGCCGAATAAATACCTGTGACGGAAGATCACTTCGCAGAATAAATAAATCCTGGTGT

[0273] CCCTGTTGATACCGGGAAGCCCTGGGCCAACTTTTGGCGAAAATGAGACGTTGATCGGCACGTAAGAGGTTCCAACTTT

[0274] CACCATAATGAAATAAGATCACTACCGGGCGTATTTTTTGAGTTATCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGG

[0275] AGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGT

[0276] TGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAG

[0277] TTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTC

[0278] SEQ ID NO: 11 (pOST)

[0279] ATGTTAAAGAAAGAGTATCTCAAGAACCCATATTTAGTGCTCTTTGCGATGATTATCCTTGCATATGTGTTTAGCGTTT

[0280] TCTGCAGATTTTATTGGGTCTGGTGGGCATCCGAGTTTAATGAGTACTTCTTCAATAATCAGTTAATGATCATTAGCAA

[0281] TGATGGCTATGCGTTTGCCGAGGGCGCACGTGATATGATCGCTGGTTTTCATCAGCCGAATGATTTATCGTATTATGGC

[0282] AGTTCGCTGTCTGCACTCACGTATTGGCTTTATAAAATCACCCCGTTTTCATTTGAAAGCATCATTTTATATATGAGCA

[0283] CGTTTCTGTCCTCACTCGTGGTCATTCCTACCATTCTTTTAGCTAACGAATACAAACGTCCTCTGATGGGGTTTGTAGC

[0284] CGCCCTGCTCGCCAGCATTGCGAACAGCTATTATAATCGTACAATGAGTGGCTATTATGATACCGATATGCTCGTAATT

[0285] GTGCTGCCAATGTTTATTCTTTTCTTTATGGTTAGAATGATTTTAAAGAAAGACTTCTTCTCACTTATTGCGTTGCCAT

[0286] TGTTTATAGGAATTTATCTCTGGTGGTATCCTAGCTCATATACTCTGAATGTGGCGCTGATTGGTCTGTTTCTCATTTA

[0287] TACGCTGATTTTCCATAGAAAAGAAAAGATATTTTATATAGCGGTCATTCTCAGTAGTTTGACCCTTTCAAATATAGCC

[0288] TGGTTTTATCAATCCGCCATTATCGTTATCTTGTTTGCCCTTTTCGCCCTTGAGCAGAAAAGATTAAATTTTATGATAA

[0289] TAGGTATTTTAGGGTCCGCCACACTTATCTTTCTGATTCTCTCAGGCGGTGTTGATCCAATACTTTATCAGCTCAAATT

[0290] TTATATATTTCGGTCGGATGAATCGGCCAATCTGACGCAGGGATTTATGTATTTTAATGTAAATCAAACCATACAGGAA

[0291] GTTGAAAATGTCGATTTATCTGAATTTATGAGACGTATTTCCGGCTCGGAAATAGTTTTCCTTTTCAGTTTATTTGGTT TTGTTTGGCTTCTGCGGAAACATAAAAGTATGATTATGGCACTCCCAATCTTGGTATTAGGATTCTTAGCGCTGAAAGG

[0292] TGGCTTGAGATTTACAATTTATAGTGTTCCCGTCATGGCTCTTGGGTTTGGTTTCTTGTTAAGCGAGTTTAAGGCAATA

[0293] ATGGTGAAGAAATATAGCCAACTTACCAGCAATGTATGTATTGTCTTTGCGACTATTCTTACGCTCGCGCCTGTGTTTA

[0294] TTCATATTTACAACTATAAAGCGCCAACGGTGTTTTCTCAAAATGAAGCCAGTTTACTTAATCAACTGAAGAATATAGC

[0295] AAATAGAGAAGATTATGTTGTAACTTGGTGGGATTATGGTTATCCGGTGCGGTATTATTCAGATGTGAAAACATTAGTC

[0296] GATGGTGGGAAGCATCTTGGTAAGGATAATTTCTTCCCATCCTTTGCCTTGAGCAAAGATGAACAAGCAGCAGCGAATA

[0297] TGGCGCGTCTGAGCGTAGAATATACCGAGAAATCTTTCTATGCACCTCAAAATGATATTCTGAAAACAGACATTCTCCA

[0298] AGCTATGATGAAGGATTATAACCAATCTAATGTAGATTTGTTTCTCGCAAGTCTGTCAAAACCGGATTTTAAAATCGAT

[0299] ACACCAAAGACCCGTGATATTTATTTATATATGCCCGCCCGGATGTCTCTCATCTTTAGCACAGTTGCCTCGTTTAGCT

[0300] TTATAAATTTAGATACTGGCGTTCTCGATAAACCTTTTACGTTTTCTACTGCATATCCGCTTGATGTTAAGAATGGGGA

[0301] AATTTATTTATCGAACGGGGTGGTCCTTAGCGATGACTTTCGTTCATTTAAAATCGGCGATAATGTTGTTAGCGTGAAC

[0302] AGTATCGTTGAGATTAATTCAATTAAACAAGGTGAATACAAAATCACCCCTATTGATGATAAGGCGCAGTTTTATATAT

[0303] TTTATTTAAAGGATTCGGCTATCCCTTACGCGCAATTTATACTCATGGATAAAACGATGTTTAATTCAGCATACGTGCA

[0304] GATGTTCTTTCTTGGGAATTATGATAAGAACTTATTTGACTTAGTGATTAATAGTAGAGATGCCAAGGTTTTCAAACTC

[0305] AAAATAGACTACAAGGACGATGACGACAAGGGATAAGTCGACGTTTAAACGGTCTCCAGCTTGGCTGTTTTGGCGGATG

[0306] AGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCTGGCGGCAGT

[0307] AGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCC

[0308] ATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTT

[0309] GTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGG

[0310] GTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCG

[0311] TTTCTACAAACTCTTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATG

[0312] CTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTT

[0313] GCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTA

[0314] CATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTT

[0315] AAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTC

[0316] AGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGC

[0317] TGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTT

[0318] TTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGC

[0319] GTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCG

[0320] GCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTT

[0321] ATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCC

[0322] GTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTC

[0323] ACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTT

[0324] AAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGT

[0325] CAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAA

[0326] ACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGA

[0327] GCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACAT

[0328] ACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACG

[0329] ATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTAC

[0330] ACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGG

[0331] TAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGG

[0332] GTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAAC GCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGG

[0333] ATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGA

[0334] GGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTC

[0335] AGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCC

[0336] CCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACC

[0337] GTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCAGATCAATTCGCGCGCGA

[0338] AGGCGAAGCGGCATGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTCCGTCAAGCC

[0339] GTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAAC

[0340] TCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGA

[0341] CGGTGGCGATAGGCATCCGGGTGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGAC

[0342] GCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATA

[0343] TCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCGGTGGATGGAGCG

[0344] ACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTC

[0345] CCCTTGCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCC

[0346] GTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACC

[0347] ATTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAAC

[0348] AAATTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGT

[0349] CGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATC

[0350] CCGGCAGCAGGGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGAGAAGAAACCAATTGTCCATA

[0351] TTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGC

[0352] ATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACA

[0353] TTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTT

[0354] TTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTGGGCTAACAGGAGGAATTAACC

[0355] SEQ ID NO: 12 (pGlyTarget)

[0356] CGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGT

[0357] TCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCA

[0358] CGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCC

[0359] AGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCG

[0360] TCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACA

[0361] ACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGATGAAAATCGAAGAAGGTAAACTG

[0362] GTAATCTGGATTAACGGCGATAAAGGCTATAACGGTCTCGCTGAAGTCGGTAAGAAATTCGAGAAAGATACCGGAATTA

[0363] AAGTCACCGTTGAGCATCCGGATAAACTGGAAGAGAAATTCCCACAGGTTGCGGCAACTGGCGATGGCCCTGACATTAT

[0364] CTTCTGGGCACACGACCGCTTTGGTGGCTACGCTCAATCTGGCCTGTTGGCTGAAATCACCCCGGACAAAGCGTTCCAG

[0365] GACAAGCTGTATCCGTTTACCTGGGATGCCGTACGTTACAACGGCAAGCTGATTGCTTACCCGATCGCTGTTGAAGCGT

[0366] TATCGCTGATTTATAACAAAGATCTGCTGCCGAACCCGCCAAAAACCTGGGAAGAGATCCCGGCGCTGGATAAAGAACT

[0367] GAAAGCGAAAGGTAAGAGCGCGCTGATGTTCAACCTGCAAGAACCGTACTTCACCTGGCCGCTGATTGCTGCTGACGGG

[0368] GGTTATGCGTTCAAGTATGAAAACGGCAAGTACGACATTAAAGACGTGGGCGTGGATAACGCTGGCGCGAAAGCGGGTC

[0369] TGACCTTCCTGGTTGACCTGATTAAAAACAAACACATGAATGCAGACACCGATTACTCCATCGCAGAAGCTGCCTTTAA

[0370] TAAAGGCGAAACAGCGATGACCATCAACGGCCCGTGGGCATGGTCCAACATCGACACCAGCAAAGTGAATTATGGTGTA

[0371] ACGGTACTGCCGACCTTCAAGGGTCAACCATCCAAACCGTTCGTTGGCGTGCTGAGCGCAGGTATTAACGCCGCCAGTC CGAACAAAGAGCTGGCGAAAGAGTTCCTCGAAAACTATCTGCTGACTGATGAAGGTCTGGAAGCGGTTAATAAAGACAA

[0372] ACCGCTGGGTACCGTAGCGCTGAAGTCTTACGAGGAAGAGTTGGCGAAAGATCCACGTATTGCCGCCACCATGGAAAAC

[0373] GCCCAGAAAGGTGAAATCATGCCGAACATCCCGCAGATGTCCGCTTTCTGGTATGCCGTGCGTACTGCGGTGATCAACG CCGCCAGCGGTCGTCAGACTGTCGATGAAGCCCTGAAAGACGCGCAGACTCGTATCACCAAGGAAAACCTGTATTTTCA GGGCCACTCACAGGGCACATTCACCAGTGACTACAGCAAGTACCTGGACTCCAGGGCCGCCCAGGATTTCGTGCAGTGG CTGATGAATACCAAGGGCTCGGGCAGAGATCAGAACGCGACCGTCGACGGCTCGAAGGGCTCGCATCATCACCACCACC ACCACCATTAAGTCGACCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTA GCATAACCCC TTGGGGCC TC TAAACGGGTC TTGAGGGGTTTTTTGC TGAAAGCCAATTCTGATTAGAAAAAC TCATCGA GCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGG AGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATA CAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGA ATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATC AACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACA GGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATA CCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGT CGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCA TGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGC GAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCTTCGAGCAAGACGTTTCCCGTTGAAT ATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGT GCAATGTAACATCAGAGATTTTGAGACACAACGTGAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATC TGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGA

[0374] AGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAA CTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGG

[0375] OTHER EMBODIMENTS

[0376] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

[0377] 2129813. docx

Claims

WHAT IS CLAIMED IS:

1. A genetically engineered, non-naturally occurring glycosylation competent bacterial strain, comprising a heterologous RNA polymerase.

2. The bacterial strain of claim 1, wherein the RNA polymerase is a bacteriophage RNA polymerase.

3. The bacterial strain of claim 2, wherein the bacteriophage RNA polymerase is bacteriophage T7 RNA polymerase, bacteriophage T3 RNA polymerase, bacteriophage SP6 RNA polymerase, or a variant thereof.

4. The bacterial strain of claim 3, wherein the bacteriophage T7 RNA polymerase is resistant to proteases.

5. The bacterial strain of claim 4, wherein the bacteriophage T7 RNA polymerase comprises a substitution that replaces a basic amino acid selected from K172 and R173 with a non-basic amino acid and / or that includes a substitution that replaces a basic amino acid selected from K179 and K180 with a non-basic amino acid.

6. The bacterial strain of any one of claims 1 to 5, wherein the bacteria is Vibrio natrigens, Salmonella enterica, Bacillus subtilis, Pseudomonas fluorescens, or Escherichia coli (E. coli) .

7. The bacterial strain of any one of claims 1 to 5, wherein the bacteria is a strain of E. coli.

8. The bacterial strain of claim 7, wherein the bacterial strain is derived from a W3110 strain of E. coli.

9. The bacterial strain of claim 7, wherein the bacterial strain is derived from a BL21 or MG1655 strain of / / . coli.

10. The bacterial strain of any one of claims 1 to 9, wherein a gene encoding GDP -mannose 4,6-dehydratase and / or O-antigen ligase is deleted.

11. The bacterial strain of any one of claims 1 to 10, wherein the heterologous polymerase is expressed via a promoter selected from Lpp5, Lac, LacUV5, ptacl, T7, T3, J23100, and mtcontlO.

12. The bacterial strain of claim 11, wherein the promoter is Lpp5.

13. The bacterial strain of any one of claims 1 to 12, wherein the heterologous polymerase is inserted into a specific locus of the bacterial strain’s genome.

14. The bacterial strain of claim 13, wherein the specific locus is LacZ or asl.

15. The bacterial strain of claim 14, wherein the specific locus is asl.

16. The bacterial strain of any one of claims 1 to 15, wherein the bacterial strain further comprises a glycosylation gene.

17. The bacterial strain of claim 16, wherein the glycosylation gene that enables or improves glycosylation is expressed by a plasmid.

18. The bacterial strain of claim 16, wherein the bacterial genome is engineered to express the glycosylation gene.

19. The bacterial strain of claim 16, wherein the glycosylation gene comprises a gene involved in the synthesis of a lipid-linked oligosaccharide (LLO) and / or an oligosaccharyltransferase (OST).

20. The bacterial strain of claim 19, wherein the LLO comprises GlcNAc2Man3.

21. The bacterial strain of claim 19, wherein the OST is from Campylobacter jejuni, Campylobacter coll, Campylobacter lari, Campylobacter Zari, Desulfovibrio desulfricans, Desulfovibrio gigas, or Desulfovibrio vulgaris.

22. The bacterial strain of claim 19, wherein the OST gene is PglB, PglO, or PglS.

23. The bacterial strain of claim 19, wherein the LLO is a bacterial O-antigen.

24. The bacterial strain of claim 19, wherein the LLO comprises a glycosylation structure.

25. The bacterial strain of claim 24, wherein the glycosylation structure comprises GlcNAcGalNAc5 or BacGalNAc5Glc.

26. The bacterial strain of any one of claims 1 to 25, wherein one or more genes that negatively affect a yield or quality of a recombinant protein or glycoprotein that is expressed when using the bacterial strain or when the bacterial strain is utilized to prepare a cell-free extract for protein synthesis or glycoprotein synthesis, are deleted or inactivated.

27. The bacterial strain of claim 26, wherein the one or more genes comprise a nuclease; a protease; a reductase; or a gene involved in amino acid metabolism.

28. The bacterial strain of claim 27, wherein the nuclease is endA or rne.

29. The bacterial strain of claim 27, wherein the protease is Lon or OmpT.

30. The bacterial strain of claim 27, wherein the reductase is gor or trxb.

31. The bacterial strain of any one of claims 1-30, further engineered to express, or to express at elevated levels, one or more genes that enhance the yield or quality of a recombinant protein or glycoprotein expressed using the bacterial strain or when the bacterial strain is utilized to prepare a cell-free extract for protein synthesis or glycoprotein synthesis.

32. The bacterial strain of claim 31, wherein the gene is an isomerase or chaperone comprising DsbC or FkpA.

33. A platform for producing a recombinant glycoprotein by expressing the recombinant protein gene from the genome or a plasmid, comprising the bacterial strain of any one of claims 1 to 32.

34. A platform for preparing a glycosylated protein in vitro, the platform comprising a cellular extract from the bacterial strain of any one of claims 1 to 32.

35. A cell-free platform for performing glycoprotein synthesis, the platform comprising a cellular extract from the bacterial strain of any one of claims 1 to 32.

36. The platform of claim 35, wherein the cell-free extract from the bacterial strain is obtained using a run-off reaction.

37. A platform for expression and glycosylation of a recombinant protein in bacteria that is expressed using a heterologous RNA polymerase.

38. A method for producing a recombinant glycoprotein, the method comprising expressing the recombinant protein gene from a plasmid, wherein the plasmid is expressed in the bacterial strain of any one of claims 1 to 32.

Images