Oligonucleotides targeting CHMP2b and methods of use thereof
Targeting CHMP2B with antisense oligonucleotides addresses the molecular mechanisms of ESCRT-III pathway dysfunction in ALS by reducing CHMP7 accumulation and restoring TDP-43 function, offering a therapeutic strategy for neurodegenerative diseases.
Patent Information
- Application Number
- PCT/US2025/015434
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-12
- Filing Date
- 2025-02-11
- Publication Date
- 2025-08-21
AI Technical Summary
The molecular mechanisms underlying the contribution of the ESCRT-III pathway to neurodegenerative diseases such as ALS, particularly in sporadic ALS, remain unclear, with CHMP7-mediated NPC injury and TDP-43 dysfunction being critical but not well understood.
The use of antisense oligonucleotides targeting CHMP2B to inhibit its expression, thereby reducing CHMP7 nuclear accumulation and restoring NPC integrity, which in turn alleviates TDP-43 mislocalization and loss of function.
Inhibiting CHMP2B expression with oligonucleotides effectively decreases CHMP7 nuclear accumulation, mitigates NPC injury, and restores TDP-43 function in neuronal cells, providing a potential therapeutic approach for neurodegenerative diseases like ALS.
Smart Images

Figure US2025015434_21082025_PF_FP_ABST
Abstract
Description
OLIGONUCLEOTIDES TARGETING CHMP2B AND METHODS OF USETHEREOFCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority under 35 U.S.C. §119(e) to U.S. Provisional Application No. 63 / 552,597, filed February 12, 2024. The content of the prior application is considered part of and is hereby incorporated by reference in its entirety.STATEMENT REGARDING GOVERNMENT FUNDING
[0002] This invention was made with Government support under grant HT9425-23-1-0860, awarded by the Defense Health Agency, Medical Research and Development Branch, and under cooperative agreement CA247576, awarded by the National Institutes of Health. The Government has certain rights in the invention.INCORPORATION BY REFERENCE OF SEQUENCE LISTING
[0003] The material in the accompanying sequence listing is hereby incorporated by reference into this application. The accompanying sequence listing xml file, name JHU4730- 1WO Sequence Listing ST26.xml, was created on February 5, 2025, and is 31,018 bytes.BACKGROUND OF THE INVENTIONFIELD OF THE INVENTION
[0004] The present invention relates generally to neurodegenerative disorders and more specifically to treatment of sporadic Amyotrophic Lateral Sclerosis (ALS).BACKGROUND INFORMATION
[0005] Alterations to the composition and function of neuronal nuclear pore complexes (NPCs) have been documented in multiple neurodegenerative diseases including Amyotrophic Lateral Sclerosis (ALS). Moreover, recent work has suggested that injury to the NPC can at least in part contribute to TDP-43 loss of function and mislocalization, a pathological hallmark of ALS and related neurodegenerative diseases. Collectively, these studies highlight a role for disruptions in NPC homeostasis and surveillance as a significant pathophysiologic event in neurodegeneration. The ESCRT-III nuclear surveillance pathway plays a critical role in the surveillance and maintenance of NPCs and the surrounding nuclear environment. Importantly,pathologic alterations to this pathway and its protein constituents have been implicated in neurodegenerative diseases such as ALS. However, the mechanism by which this pathway contributes to disease associated alterations in the NPC remains unknown.
[0006] Amyotrophic Lateral Sclerosis (ALS) is a neurodegenerative disease that impacts the survival and function of neuronal and glial cells that make up the upper and lower motor circuitry within the brain and spinal cord. About 10% of ALS cases are inherited and thus termed familial ALS (fALS). The remaining 90% of cases are sporadic (sALS) with no known family history. Although mutations in over 20 genes that function in diverse cellular processes including RNA metabolism, protein homeostasis, endolysosomal trafficking and autophagy, and cytoskeletal organization have been linked to fALS and sALS, the majority of sALS cases occur with no known genetic cause. Despite the heterogenous etiology of ALS, 97% of cases display characteristic nuclear depletion and cytoplasmic mislocalization and aggregation of the RNA binding protein TDP-43 in a subset of CNS cells at end-stage disease. While the genetics and pathologies of ALS are increasingly well documented, the molecular mechanisms that give rise to altered cellular physiology and pathology, in particular in sALS, remain understudied.
[0007] Multiple studies have now documented a role for impaired nuclear-cytoplasmic compartmentalization as a significant contributor to ALS pathophysiology. Recently, patient induced pluripotent stem cell (iPSC) derived neuron (iPSN) models of sALS and C9orf72 ALS / FTD have been utilized to detail an injury to the nuclear pore complex (NPC) that begins with the reduction of the transmembrane nucleoporin (Nup) POM121 as an early and significant contributor to disease. Given that the NPC and its multiple copies of- 30 individual Nup constituents collectively and critically control multiple cellular processes including nucleocytoplasmic transport (NCT), gene expression, and genome organization alterations to NPC homeostasis are likely to have detrimental and widespread impacts on neuronal function and survival. In fact, it has been demonstrated that the collective reduction of 8 Nups is sufficient to impact active nuclear import and the localization of mediators of nucleocytoplasmic transport (NCT), the localization and function of TDP-43, and neuronal survival in sALS and C9orf72 ALS / FTD iPSNs. Thus, these studies indicate that altered NPC homeostasis is a critical mediator of pathophysiologic events in sALS.
[0008] Recent work has established a fundamental role for the ESCRT-III pathway in the resealing of the nuclear envelope and the surveillance and maintenance of proper NPC assembly, insertion, and function during cell division. The ESCRT-III pathway is comprisedof multiple protein components including CHMP1-7 and the AAA-ATPase VPS4 and broadly functions in membrane remodeling events that occur during cell division, neuronal pruning, endosomal and exosomal trafficking, and multiple vesicular body formation. Additionally, it has been shown that the ESCRT-III pathway may contribute to the piecemeal turnover and replacement of individual Nups in NPCs in non-neuronal cellular model systems. It has recently been demonstrated that the pathologic nuclear accumulation of CHMP7 is sufficient to initiate NPC injury and in turn contribute to TDP-43 dysfunction in sALS iPSNs highlighting alterations to the nuclear surveillance role of the ESCRT-III pathway as a contributor to neurodegenerative pathophysiology. However, ESCRT-III proteins do not typically function as single protein units and pathway function often proceeds following coordinated recruitment and ESCRT protein “activation” (e.g., removal of autoinhibition) and polymerization. This activation step is achieved via protein-protein interactions and can occur between ESCRT-III proteins themselves. As such, the molecular mechanisms that give rise to CHMP7 mediated NPC injury and the involvement of ESCRT-III protein partners in this process remains unknown.SUMMARY OF THE INVENTION
[0009] The present disclosure is based on the seminal discovery that CHMP2B facilitates the pathologic nuclear accumulation or retention of CHMP7 and triggers the reduction of POM121 at the early stages of NPC injury cascades, and that the inhibition of CHMP2B using antisense oligonucleotides can prevent and restore NPC injury associated TDP-43 loss of function in neuronal cells.
[0010] In certain embodiment, the present disclosure provides an isolated oligonucleotide including a nucleic acid sequence of SEQ ID NO: 3-12.
[0011] In some aspects, the present disclosure provides a composition including one or more oligonucleotides described above.
[0012] In certain embodiment, the present disclosure provides a method of modulating CHMP2B expression in a cell including contacting the cell with an oligonucleotide including a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof, thereby modulating the expression of CHMP2B.
[0013] In some aspects, modulating CHMP2B expression includes decreasing CHMP2B expression in the cell compared to CHMP2B expression in a cell contacted with a control oligonucleotide or in a cell not contacted with the oligonucleotide.
[0014] In some aspects, the expression of CHMP2B is measured using immunostaining, confocal imaging, nuclei isolation, Western blotting, or a combination thereof.
[0015] In certain embodiments, the present disclosure provides a method of decreasing or inhibiting nuclear accumulation of CHMP7 in a cell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting nuclear accumulation of CHMP7 in the cell.
[0016] In some aspects, targeting expression of CHMP2B includes decreasing CHMP2B expression in the cell.
[0017] In some aspects, the cell is a neuronal cell. In some aspects, the neuronal cell exhibits pathologic nuclear accumulation of CHMP7 or is at risk of pathologic nuclear accumulation of CHMP7. In some aspects, the neuronal cell is from a subject suffering from Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkinson’s disease, Huntington’s chorea, mild cognitive impairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration.
[0018] In some aspects, the agent that targets expression of CHMP2B is an siRNA, an ASO, or a combination thereof. In some aspects, the ASO includes a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.
[0019] In certain embodiments, the present disclosure provides a method of decreasing or inhibiting a nucleoporin (Nup) turnover in a cell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting Nup turnover in the cell.
[0020] In some aspects, targeting expression of CHMP2B includes decreasing CHMP2B expression in the cell.
[0021] In some aspects, decreasing CHMP2B in the cell includes decreasing or inhibiting nuclear accumulation of CHMP7 in the cell compared to nuclear accumulation of CHMP7 in a cell treated with a control agent or nuclear accumulation of CHMP7 in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0022] In some aspects, decreasing or inhibiting nuclear accumulation of CHMP7 in the cell includes decreasing or inhibiting Nup turnover in the cell compared to Nup turnover in a cell treated with a control agent or Nup turnover in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0023] In some aspects, the neuronal cell exhibits pathologic Nup turnover or is at risk of Nup turnover in the cell.
[0024] In certain embodiments, the present disclosure provides a method of decreasing or inhibiting nuclear pore complex (NPC) injury in a cell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting NPC injury in the cell.
[0025] In some aspects, decreasing CHMP2B in the cell includes decreasing or inhibiting nuclear accumulation of CHMP7 in the cell compared to nuclear accumulation of CHMP7 in a cell treated with a control agent or nuclear accumulation of CHMP7 in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0026] In some aspects, decreasing or inhibiting nuclear accumulation of CHMP7 in the cell includes decreasing or inhibiting Nup turnover in the cell compared to Nup turnover in a cell treated with a control agent or Nup turnover in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0027] In some aspects, decreasing or inhibiting Nup turnover in the cell comprises decreasing or inhibiting NPC injury in the cell compared to NPC injury in a cell treated with a control agent or NPC injury in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0028] In some aspects, the cell is a neuronal cell. In some aspects, the neuronal cell exhibits NPC injury or is at risk of NPC injury in the cell.
[0029] In certain embodiments, the present disclosure provides a method of decreasing or inhibiting TDP-43 mislocalization in a cell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting TDP-43 mislocalization in the cell.
[0030] In some aspects, decreasing CHMP2B in the cell includes decreasing or inhibiting nuclear accumulation of CHMP7 in the cell compared to nuclear accumulation of CHMP7 in a cell treated with a control agent or nuclear accumulation of CHMP7 in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0031] In some aspects, decreasing or inhibiting nuclear accumulation of CHMP7 in the cell includes decreasing or inhibiting Nup turnover in the cell compared to Nup turnover in a cell treated with a control agent or Nup turnover in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0032] In some aspects, decreasing or inhibiting Nup turnover in the cell includes decreasing or inhibiting NPC injury in the cell compared to NPC injury in a cell treated with a control agent or NPC injury in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0033] In some aspects, decreasing or inhibiting NPC injury in the cell includes decreasing or inhibiting TDP-43 mislocalization in the cell compared to TDP-43 mislocalization in a cell treated with a control agent or TDP-43 mislocalization in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0034] In some aspects, the cell is a neuronal cell.
[0035] In some aspects, the neuronal cell exhibits TDP-43 mislocalization or is at risk of TDP-43 mislocalization in the cell.
[0036] In certain embodiments, the present disclosure provides a method of decreasing or inhibiting TDP-43 loss of function in a cell including modulating CHMP2B expression in the cell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting TDP-43 loss of function in the cell.
[0037] In some aspects, decreasing or inhibiting NPC injury in the cell includes decreasing or inhibiting TDP-43 loss of function in the cell compared to TDP-43 loss of function in a cell treated with a control agent or TDP-43 loss of function in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0038] In some aspects, the TDP-43 loss of function results from TDP-43 nuclear depletion, TDP-43 cytoplasmic mislocalization, TDP-43 aggregation, or a combination thereof.
[0039] In certain embodiments, the present disclosure provides a method of treating a neurodegenerative disease in a subject including modulating CHMP2B expression in the subject including administering to the subject an agent that targets CHMP2B, thereby treating the neurodegenerative disease.
[0040] In some aspects, targeting expression of CHMP2B includes decreasing CHMP2B expression in a cell from the subject.
[0041] In some aspects, decreasing CHMP2B expression in the cell decreases nuclear accumulation of CHMP7 in the cell from the subject compared to nuclear accumulation ofCHMP7 in a cell from a subj ect treated with a control agent or nuclear accumulation of CHMP7 in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
[0042] In some aspects, decreasing or inhibiting nuclear accumulation of CHMP7 in the cell from the subject decreases Nup turnover in the cell from the subject compared to Nup turnover in a cell from a subject treated with a control agent or Nup turnover in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
[0043] In some aspects, decreasing Nup turnover in the cell from the subject decreases NPC injury in a cell from the subject compared to NPC injury in a cell from a subject treated with a control agent or NPC injury in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
[0044] In some aspects, decreasing NPC injury decreases TDP-43 mislocalization in the cell from the subject compared to TDP-43 mislocalization in a cell from a subject treated with a control agent or TDP-43 mislocalization in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
[0045] In some aspects, decreasing TDP-43 mislocalization decreases TDP-43 loss of function in the cell from the subject compared to TDP-43 loss of function in a cell from a subject treated with a control agent or TDP-43 loss of function in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
[0046] In some aspects, the TDP-43 loss of function results from TDP-43 nuclear depletion, TDP-43 cytoplasmic mislocalization, TDP-43 aggregation, or a combination thereof in the cell from the subject.
[0047] In some aspects, the cell is a neuronal cell.
[0048] In some aspects, the agent targeting CHMP2B targets CHMP7-CHMP2B protein interactions. In some aspects, the agent targeting CHMP2B is anucleic acid, aprotein, apeptide or a small molecule.
[0049] In some aspects, the neurodegenerative disease is Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkinson’s disease, Huntington’s chorea, mild cognitive impairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration. In some aspects, the neurodegenerative disease is Amyotrophic Lateral Sclerosis (ALS). In some aspects, the ALS is sporadic ALS.
[0050] In some aspects, treating the neurodegenerative disease further includes administering to the subject Edaravone, Riluzole, AMX0035, Tofersen, or a combination thereof.
[0051] In some aspects, administration is oral, systemic, parenteral, intrathecal, intranasal, intravenous, subcutaneous, intracerebroventricular, by inhalation, or by suppository.BRIEF DESCRIPTION OF THE DRAWINGS
[0052] FIGS. 1A-1D illustrate that CHMP7 mediated Nup turnover is overactive in sALS iPSNs. FIG. 1A are images showing maximum intensity projections from Airyscan imaging of Myc (Old) and Flag (New) tagged POM121 in control and sALS iPSN nuclei. FIG. IB is a graph showing quantification of old, mixed, and new spots pre tag exchange (B). FIG. 1C is a graph showing quantification of old, mixed, and new spots one week post tag exchange. FIG. ID is a graph showing quantification of old, mixed, and new spots two weeks post tag exchange.
[0053] FIGS. 2A-2B illustrate siRNA mediated knockdown of CHMP2B in iPSNs 3 weeks following nucleofection of CHMP2B or non-targeting (NT) control siRNAs. FIG. 2A is a set of images that show western blot for CHMP2B expression. siRNA as indicated on bottom, antibody for western blot as indicated on right. FIG. 2B is a graph showing quantification of CHMP2B protein expression in iPSN lysates.
[0054] FIGS. 3A-3D illustrate ASO mediated knockdown of CHMP2B in iPSNs following 3 weeks of treatment with 5 pM scrambled control or CHMP2B targeting ASOs. FIG. 3A is an image showing western blot for CHMP2B expression. ASO as indicated on bottom, antibody for western blot as indicated on right. FIG. 3B is a graph showing quantification of CHMP2B protein expression in iPSN lysates. FIG. 3C is an image showing western blot for CHMP2B expression. ASO and concentration as indicated on bottom, antibody for western blot as indicated on right. FIG. 3D is a graph showing quantification of CHMP2B protein expression in iPSN lysates.
[0055] FIGS. 4A-4B is a set of schematic diagrams of preventative and reparative siRNA and ASO treatment paradigms. FIG. 4A is a schematic diagram showing pathologic events in NPC injury cascades, preventative treatment paradigm, and experimental time points used in this study. FIG. 4B is a schematic diagram showing pathologic events in NPC injury cascades, reparative treatment paradigm, and experimental time points used in this study.
[0056] FIGS. 5A-5H illustrate that reduction of CHMP2B is sufficient to alleviate increased nuclear localization of CHMP7 in sALS iPSNs (3 weeks following nucleofection of CHMP2Bor non-targeting (NT) siRNAs). FIG. 5A is a set of images showing maximum intensity projections from immunostaining and confocal imaging of CHMP7 in control and sALS iPSNs on day 46 of differentiation siRNA and genotype as indicated on left, antibodies for immunostaining as indicated on top. FIG. 5B is a graph showing quantification of nuclear to cytoplasmic ratios of CHMP7. FIG. 5C is a set of images showing maximum intensity projections from immunostaining and confocal imaging of CHMP7 in control and sALS iPSNson day 46 of differentiation . ASO and genotype as indicated on left, antibodies for immunostaining as indicated on top. ASO treatment was initiated at day 15 of differentiation (the time point where nuclear localization of CHMP7 begins to increase in sALS iPSNs). FIG. 5D is a graph showing quantification of nuclear to cytoplasmic ratios of CHMP7. FIG. 5E is a set of images showing maximum intensity projections from immunostaining and confocal imaging of CHMP7 in control and sALS iPSNs on day 81 of differentiation. siRNA and genotype as indicated on left, antibodies for immunostaining as indicated on top. Knockdown was initiated at day 60 of differentiation following the emergence of NPC injury and TDP-43 loss of function and mislocalization. FIG. 5F is a graph showing quantification of nuclear to cytoplasmic ratios of CHMP7. FIG. 5G is a set of images showing maximum intensity projections from immunostaining and confocal imaging of CHMP7 in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. ASO and genotype as indicated on left, antibodies for immunostaining as indicated on top. ASO treatment was initiated at day 60 of differentiation following the emergence of NPC injury and TDP-43 loss of function and mislocalization. FIG. 5H is a graph showing quantification of nuclear to cytoplasmic ratios of CHMP7. n = 5 control and 8 sALS iPSC lines, 100 Map2 + cells per line / treatment. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. **** p < 0.0001. Scale bar = 50 pm
[0057] FIGS. 6A-6D are high magnification images of CHMP7 in control and sALS iPSNs following knockdown of CHMP2B (3 weeks following nucleofection of CHMP2B or nontargeting (NT) siRNAs). FIG. 6A is a set of images showing maximum intensity projections from immunostaining and confocal imaging of CHMP7 in control and sALS iPSNs on day 46 of differentiation. siRNA and genotype as indicated on left, antibodies for immunostaining as indicated on top. FIG. 6B is a set of images showing maximum intensity projections from immunostaining and confocal imaging of CHMP7 in control and sALS iPSNs on day 46 ofdifferentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. ASO and genotype as indicated on left, antibodies for immunostaining as indicated on top. ASO treatment was initiated at day 15 of differentiation (the time point where nuclear localization of CHMP7 begins to increase in sALS iPSNs). FIG. 6C is a set of images showing maximum intensity projections from immunostaining and confocal imaging of CHMP7 in control and sALS iPSNs on day 81 of differentiation. siRNA and genotype as indicated on left, antibodies for immunostaining as indicated on top. FIG. 6D i is a set of images showing maximum intensity projections from immunostaining and confocal imaging of CHMP7 in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. ASO and genotype as indicated on left, antibodies for immunostaining as indicated on top. ASO treatment was initiated at day 60 of differentiation following the emergence of NPC injury and TDP-43 loss of function and mislocalization. Scale bar = 5 pm.
[0058] FIGS. 7A-7H illustrate that reduction of CHMP2B is sufficient to mitigate reduction of nuclear POM121 in sALS iPSNs (3 weeks following nucleofection of CHMP2B or nontargeting (NT) siRNAs). FIG. 7A is a set of images showing maximum intensity projections from immunostaining and confocal imaging of POM121 in control and sALS iPSNs on day 46 of differentiation. siRNA and genotype as indicated on left, antibodies for immunostaining as indicated on top. FIG. 7B is a graph showing quantification of POM121 nuclear intensity. FIG. 7C is a set of images showing maximum intensity projections from immunostaining and confocal imaging of POM121 in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. ASO and genotype as indicated on left, antibodies for immunostaining as indicated on top. ASO treatment was initiated at day 15 of differentiation (the time point where nuclear localization of CHMP7 begins to increase in sALS iPSNs). FIG. 7D is a graph showing quantification of POM121 nuclear intensity. n = 5 control and 8 sALS iPSC lines, 100 Map2 + cells per line / treatment. FIG. 7E is a set of images showing Maximum intensity projections from immunostaining and confocal imaging of POM121 in control and sALS iPSNs on day 81 of differentiation. siRNA and genotype as indicated on left, antibodies for immunostaining as indicated on top. FIG. 7F is a graph showing quantification of POM121 nuclear intensity. FIG. 7G is a set of images showing maximum intensity projections from immunostaining and confocal imaging of POM121 in control and sALS iPSNs on day 81 of differentiation following 3 weeks oftreatment with scrambled control of CHMP2B targeting ASOs. . ASO and genotype as indicated on left, antibodies for immunostaining as indicated on top. ASO treatment was initiated at day 61 of differentiation following the emergence of NPC injury and TDP-43 loss of function and mislocalization. FIG. 7H is a graph showing quantification of P0M121 nuclear intensity. Scale bar = 50 pm.
[0059] FIGS. 8A-8D are high magnification images of POM121 in control and sALS iPSNs following knockdown of CHMP2B (3 weeks following nucleofection of CHMP2B or nontargeting (NT) siRNAs). FIG. 8A is a set of images showing maximum intensity projections from immunostaining and confocal imaging of POM121 in control and sALS iPSNs on day 46 of differentiation. siRNA and genotype as indicated on left, antibodies for immunostaining as indicated on top. FIG. 8B is a set of images showing maximum intensity projections from immunostaining and confocal imaging of POM121 in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. ASO and genotype as indicated on left, antibodies for immunostaining as indicated on top. ASO treatment was initiated at day 15 of differentiation (the time point where nuclear localization of CHMP7 begins to increase in sALS iPSNs). FIG. 8C is a set of images showing maximum intensity projections from immunostaining and confocal imaging of POM121 in control and sALS iPSNs on day 81 of differentiation. siRNA and genotype as indicated on left, antibodies for immunostaining as indicated on top. FIG. 8D is a set of images showing maximum intensity projections from immunostaining and confocal imaging of POM121 in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. ASO and genotype as indicated on left, antibodies for immunostaining as indicated on top. ASO treatment was initiated at day 61 of differentiation following the emergence of NPC injury and TDP-43 loss of function and mislocalization. Scale bar = 5 pm.
[0060] FIGS. 9A-9F illustrate siRNA and ASO mediated knockdown of CHMP2B restores levels of POM121 in sALS iPSN nuclei. FIG. 9A is a set of images showing western blot for POM121 expression in nuclei isolated on day 46 of differentiation 3 weeks following nucleofection of CHMP2B or non-targeting (NT) control siRNAs or following 3 weeks of treatment with 5 pM scrambled control or CHMP2B targeting ASOs. Genotype as indicated on top, siRNA and ASO as indicated on bottom, antibody for western blot as indicated on right. siRNA nucleofection or ASO treatment was initiated at day 15 of differentiation (the time pointwhere nuclear localization of CHMP7 begins to increase in sALS iPSNs). FIG. 9B is a graph showing quantification of P0M121 protein expression in Ipsn nuclei lysates 3 weeks following the nucleofection of CHMP2B or NT control siRNAs. FIG. 9C is a graph showing quantification of P0M121 protein expression in Ipsn nuclei lysates following 3 weeks treatment with scrambled control or CHMP2B targeting ASOs. GAPDH was used for normalization. FIG. 9D is a set of images showing western blot for P0M121 expression in nuclei isolated on day 81 of differentiation 3 weeks following nucleofection of CHMP2B or non-targeting (NT) control siRNAs or following 3 weeks of treatment with 5 pM scrambled control or CHMP2B targeting ASOs. Genotype as indicated on top, siRNA and ASO as indicated on bottom, antibody for western blot as indicated on right. siRNA nucleofection or ASO treatment was initiated at day 60 of differentiation following the emergence of NPC injury and TDP-43 loss of function and mislocalization. FIG. 9E is a graph showing quantification of POM121 protein expression in iPSN nuclei lysates 3 weeks following the nucleofection of CHMP2B or NT control siRNAs. FIG. 9F is a graph showing quantification of POM121 protein expression in iPSN nuclei lysates 3 weeks following the nucleofection of CHMP2B or NT control siRNAs following 3 weeks treatment with scrambled control or CHMP2B targeting ASOs GAPDH was used for normalization.
[0061] FIGS. 10A-10C illustrate that reduction of CHMP2B diminishes turnover of POM121 in iPSNs. FIG. 10A is a set of images showing maximum intensity projections from Airyscan imaging of Myc (Old) and Flag (New) tagged POM121 in control and sALS iPSN nuclei. Treatments and time point as indicated on left. FIG. 10B is a graph showing quantification of old, mixed, and new spots one week post tag exchange. FIG. 10C is a graph showing quantification of old, mixed, and new spots two weeks post tag exchange.
[0062] FIGS. 11A-11S illustrate early siRNA mediated knockdown of CHMP2B restores TDP-43 function in sALS iPSNs on day 46 of differentiation (3 weeks following nucleofection of CHMP2B or non-targeting (NT) siRNAs). FIG. 11A is a graph showing qRT-PCR for ELAVL3 mRNAin control and sALS iPSNs . FIG. 11B is a graph showing qRT-PCR for PFKP mRNA in control and sALS iPSNs . FIG. 11C is a graph showing qRT-PCR for RCAN1 mRNA in control and sALS iPSNs . FIG. 11D is a graph showing qRT-PCR for SELPLG. FIG. HE is a graph showing qRT-PCR for STMN2. FIG. HF is a graph showing qRT-PCR for ACTL6B mRNA in control and sALS iPSNs . FIG. 11G is a graph showing qRT-PCR for ARHGAP32. FIG. 11H is a graph showing qRT-PCR for CAMK2B mRNA in control andsALS iPSNs . FIG. Ill is a graph showing qRT-PCR for CDK7 mRNA in control and sALS iPSNs . FIG. 11 J is a graph showing qRT-PCR ioxDNMl. FIG. 11K is a graph showing qRT- PCR for HDGFL2 mRNA in control and sALS iPSNs. FIG. 11L is a graph showing qRT-PCR for MYO18A mRNA in control and sALS iPSNs . FIG. 11M is a graph showing qRT-PCR for SYT7 mRNA in control and sALS iPSNs. FIG. UN is a graph showing qRT-PCR for cryptic exon (CE) containing mRNA, and Truncated STMN2 mRNA in control and sALS iPSNs. FIG. 11O is a graph showing qRT-PCR for Actin mRNA in control and sALS iPSNs . FIG. IIP is a graph showing qRT-PCR for POM121 mRNA in control and sALS iPSNs . GAPDH was used for normalization. Actin and POM121 were used as negative control mRNAs not known to be regulated by TDP-43. FIG. 11Q is a set of images showing maximum intensity projections and confocal imaging of TDP-43 in control and sALS iPSNs. siRNA and genotype as indicated on left, antibodies for immunostaining as indicated on top. FIG. HR is a graph showing quantification of the nuclear to cytoplasmic ratio of TDP-43. FIG. IIS is a graph showing quantification of TDP-43 nuclear intensity.
[0063] FIGS. 12A-12S illustrate early ASO mediated knockdown of CHMP2B restores TDP-43 function in sALS iPSNs. FIG. 12A is a graph showing qRT-PCR for ELAVL3 mRNA in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 12B is a graph showing PFKP mRNA in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 12C is a graph showing RCAN1 mRNA in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 12D is a graph showing SELPLG mRNA in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 12E is a graph showing STMN2. FIG. 12F is a graph showing ACTL6B mRNA in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 12G is a graph showing ARHGAP32. FIG. 12H is a graph showing CAMK2B mRNA in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 121 is a graph showing CDK7 cryptic exon (CE) mRNA in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 12J is a graph showing DNM1 cryptic exon (CE) mRNA in control and sALS iPSNs on day 46 ofdifferentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 12K is a graph showing HDGFL2 cryptic exon (CE) mRNA in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 12L is a graph showing MY018A cryptic exon (CE) mRNA in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 12M is a graph showing SYT7 cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 12N is a graph showing Truncated STMN2 mRNA in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 120 is a graph showing Actin. FIG. 12P is a graph showing P0M121 mRNA in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. GAPDH was used for normalization. Actin and P0M121 were used as negative control mRNAs not known to be regulated by TDP-43. FIG. 12Q is a set of images showing maximum intensity projections and confocal imaging of TDP-43 in control and sALS iPSNs on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. ASO and genotype as indicated on left, antibodies for immunostaining as indicated on top. FIG. 12R is a graph showing quantification of the nuclear to cytoplasmic ratio of TDP-43. FIG. 12S is a graph showing quantification of TDP-43 nuclear intensity
[0064] FIGS. 13A-13S illustrate late stage siRNA mediated knockdown of CHMP2B restores TDP-43 function in sALS iPSNs (3 weeks following nucleofection of CHMP2B or non-targeting (NT) siRNAs). FIG. 13A is a graph showing qRT-PCR for ELA VL3 cryptic exon (CE) mRNA in control and sALS iPSNs on day 81 of differentiation. FIG. 13B is a graph showing PFKP. FIG. 13C illustrates a graph showing RCAN1 cryptic exon (CE) mRNA in control and sALS iPSNs on day 81 of differentiation. FIG. 13D is a graph showing SELPLG. FIG. 13E is a graph showing STMN2 cryptic exon (CE) mRNA in control and sALS iPSNs on day 81 of differentiation. FIG. 13F is a graph showing ACTL6B cryptic exon (CE) mRNA in control and sALS iPSNs on day 81 of differentiation. FIG. 13G is a graph showing ARHGAP32 cryptic exon (CE) mRNA in control and sALS iPSNs on day 81 of differentiation. FIG. 13H is a graph showing CAMK2B cryptic exon (CE) mRNA in control and sALS iPSNs on day 81 of differentiation. FIG. 131 is a graph showing CDK7. FIG. 13J is a graph showing DNM1cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation. FIG. 13K is a graph showing HDGFL2 cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation. FIG. 13L is a graph showing MYO18A cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation. FIG. 13M is a graph showing SYT7 cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation. FIG. 13N is a graph showing Truncated STMN2 mRNA in control and sALS iPSNs on day 81 of differentiation. FIG. 130 is a graph showing Actin mRNA in control and sALS iPSNs on day 81 of differentiation. FIG. 13P is a graph showing POM121 mRNA in control and sALS iPSNs on day 81 of differentiation. Actin and POM121 were used as negative control mRNAs not known to be regulated by TDP-43. FIG. 13Q is a set of images showing maximum intensity projections and confocal imaging of TDP-43 in control and sALS iPSNs on day 81 of differentiation. siRNA and genotype as indicated on left, antibodies for immunostaining as indicated on top. FIG. 13R is a graph showing quantification of the nuclear to cytoplasmic ratio of TDP-43. FIG. 13S is a graph showing quantification of TDP-43 nuclear intensity.
[0065] FIGS. 14A-14S illustrate late stage ASO mediated knockdown of CHMP2B restores TDP-43 function in sALS iPSNs. FIG. 14A is a graph showing qRT-PCR for ELAVL3 cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 14B is a graph showing qRT-PCR io PFKP cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 14C is a graph showing qRT-PCR for RCAN1 cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 14D is a graph showing qRT-PCR for SELPLG cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 14E is a graph showing qRT-PCR for STMN2 cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG.l 4F is a graph showing qRT-PCR for ACTL6B cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 14G is a graph showing qRT-PCR for ARHGAP 32 crypticexon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 14H is a graph showing qRT-PCR for CAMK2B cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 141 is a graph showing qRT-PCR for CDK7 cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 14 J is a graph showing qRT-PCR for DNM1 cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 14K is a graph showing qRT-PCR for HDGFL2 cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 14L is a graph showing qRT-PCR for MYO18A cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 14M is a graph showing qRT-PCR for SYT7 cryptic exon (CE) containing mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 14N is a graph showing qRT-PCR for Truncated STMN2 mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 140 is a graph showing qRT-PCR for Actin mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 14P is a graph showing qRT-PCR for POM121 mRNA in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. ASO treatment was initiated at day 60 of differentiation following the emergence of NPC injury and TDP-43 loss of function and mislocalization. GAPDH was used for normalization. Actin and POM121 were used as negative control mRNAs not known to be regulated by TDP-43. FIG. 14Q is a set of images showing maximum intensity projections and confocal imaging of TDP-43 in control and sALS iPSNs on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. ASO and genotype as indicated on left, antibodies for immunostaining as indicated on top. ASO treatment was initiated at day 60 of differentiation following the emergence of NPC injury and TDP-43 loss of function and mislocalization. FIG.14R is a graph quantification of the nuclear to cytoplasmic ratio of TDP-43. FIG. 14S is a graph showing quantification of TDP-43 nuclear intensity, n = 5 control and 8 sALS iPSC lines, 100 Map2+ cells per line / knockdown.
[0066] FIGS. 15A-15D are graphs showing that siRNA and ASO mediated reduction of CHMP2B increases viability of sALS iPSNs following exposure to excess glutamate. FIG. 15A is a graph showing percent cell viability as measured by Alamar Blue in control and sALS iPSNs following 4 h exposure to 0 or 10 pM glutamate on day 46 of differentiation. PBS was used for normalization. Triton X-100 was used as a positive control to induce neuronal death. FIG. 15B is a graph showing percent cell viability as measured by Alamar Blue in control and sALS iPSNs following 4 h exposure to 0 or 10 pM glutamate on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. FIG. 15C is a graph showing percent cell viability as measured by Alamar Blue in control and sALS iPSNs following 4 h exposure to 0 or 10 pM glutamate on day 81 of differentiation. Triton X-100 was used as a positive control to induce neuronal death. n - 5 control and 8 sALS iPSC lines. Data points represent the average percent viability from 3 technical replicate wells for each line / siRNA. FIG. 15D is a graph showing percent cell viability as measured by Alamar Blue in control and sALS iPSNs following 4 h exposure to 0 or 10 pM glutamate on day 81 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs.
[0067] FIGS. 16A-16D are graphs showing that siRNA and ASO mediated reduction of CHMP2B alleviates glutamate induced neuronal death in sALS iPSNs. FIG. 16A is a graph showing quantification of the percentage of propidium iodide (PI) positive spots normalized to DAPI positive nuclei following 4-hour exposure to 0 or 10 pM glutamate on day 46 of differentiation. FIG. 16B is a graph showing quantification of the percentage of propidium iodide (PI) positive spots normalized to DAPI positive nuclei following 4-hour exposure to 0 or 10 pM glutamate on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. ASO treatment was initiated at day 15 of differentiation (the time point where nuclear localization of CHMP7 begins to increase in sALS iPSNs). FIG. 16C is a graph showing quantification of the percentage of propidium iodide (PI) positive spots normalized to DAPI positive nuclei following 4-hour exposure to 0 or 10 pM glutamate on day 81 of differentiation. FIG. 16D is a graph showing Quantification of the percentage of propidium iodide (PI) positive spots normalized to DAPI positive nuclei following 4-hourexposure to 0 or 10 pM glutamate on day 46 of differentiation following 3 weeks of treatment with scrambled control of CHMP2B targeting ASOs. ASO treatment was initiated at day 60 of differentiation following the emergence of NPC injury and TDP-43 loss of function and mislocalization, n = 5 control and 8 sALS iPSC lines.
[0068] FIGS. 17A-17G illustrate that the proximity between CHMP7 and CHMP2B is increased and sustained in sALS nuclei. FIG. 17A is a set of images showing maximum intensity projections from confocal imaging of CHMP7 - CHMP2B PLA signals in control and sALS iPSNs. Time points as indicated on left; genotype as indicated on top. FIG. 17B is a graph showing quantification of number of PLA signals per nucleus at day 18. FIG. 17C is a graph showing quantification of number of PLA signals per nucleus at day 25. FIG. 17D is a graph showing quantification of number of PLA signals per nucleus at day 32. FIG. 17E is a set of images showing single z sections from apotome based imaging of CHMP7 - CHMP2B PLA signals in control and sALS postmortem layer V motor and occipital cortex tissue. Brain region as indicated on left; genotype as indicated on top. FIG. 17F is a graph showing quantification of number of PLA signals per nucleus in motor cortex tissue. FIG. 17G is a graph showing quantification of number of PLA signals per nucleus in occipital cortex tissue.
[0069] FIGS. 18A-18B are images that show localization of CHMP2B and CHMP7 in control and sALS iPSNs and postmortem human tissues. FIG. 18A is a set of images showing maximum intensity projections from immunostaining and confocal imaging of CHMP7 and CHMP2B in control and sALS iPSNs. Time points as indicated on left, antibody for immunostaining and genotype as indicated on top. FIG. 18B is a set of images showing immunostaining and apotome based fluorescent imaging of CHMP7 and CHMP2B in control and sALS postmortem human tissues. Brain region as indicated on left, antibody for immunostaining and genotype as indicated on top.
[0070] FIGS. 19A-19B are images that show CHMP7 and CHMP2B bind in vitro. FIG. 19A is an image showing Coomassie staining following in vitro binding of recombinant His tagged CHMP7 and GST tagged CHMP2B proteins. Binding reactions as indicated on top; recombinant proteins as indicated on right. This experiment was repeated a total of three times. FIG. 19B is an image showing Coomassie staining following in vitro binding of recombinant GST tagged CHMP7 and His tagged CHMP2B proteins. Binding reactions as indicated on top; recombinant proteins as indicated on right. This experiment was repeated a total of three times.
[0071] FIGS. 20A-20C illustrate that Knockdown of CHMP2B does not restore NPC permeability barrier integrity in sALS iPSNs. FIG. 20A is a set of images showing single z sections from confocal imaging of fluorescently tagged 70 kDa dextrans in digitonin permeabilized control and sALS iPSNs at day 46 of differentiation following 3 weeks of treatment with non-targeting or CHMP2B siRNAs (left) or scrambled control or CHMP2B targeting ASOs (right). Genotype and treatment as indicated on left, dextran as indicated on top. DAPI was used to define the nucleus. FIG. 20B is a graph showing quantification of nuclear intensity of 70 kDa dextran in non-targeting and CHMP2B siRNA treated control and sALS iPSNs. FIG. 20C is a graph showing quantification of nuclear intensity of 70 kDa dextran in scrambled control and CHMP2B targeting ASO treated control and sALS iPSNs.
[0072] FIGS. 21A-21E illustrate that CHMP2B facilitates the activation of CHMP7 to initiate NPC injury in sALS iPSNs. FIG. 21A is a schematic diagram showing graphical depiction of CHMP7 mutants and their resulting functional consequences. FIG. 21B is a diagram showing a schematic overview of experimental paradigm. FIG. 21C is a set of images showing maximum intensity projections from immunostaining and confocal imaging of Flag tagged CHMP7 and endogenous POM121 in control and sALS iPSNs. CHMP7 plasmid and ASO treatment as indicated on left, antibody for immunostaining and genotype as indicated on top FIG. 21D is a graph showing quantification of nuclear to cytoplasmic ratios of CHMP7. FIG. 21E is a graph showing quantification of POM121 nuclear intensity. Scale bar = 50 pm.
[0073] FIGS. 22A-22B illustrate CHMP7 “Open” and CHMP7 AHelix 6 mutants do not associate with CHMP2B in iPSNs. FIG. 22A is a set of images showing maximum intensity projections from confocal imaging ofFlag-CHMP2B PLA signals in control and sALS iPSNs. CHMP7 plasmid as indicated on left, genotype as indicated on top. Note: Anti-Flag antibodies were used to detect Flag tagged CHMP7 proteins. FIG. 22B is a graph showing quantification of number of PLA signals per nucleus. Scale bar = 5 pm.
[0074] FIGS. 23A-23B are graphical models depicting role of CHMP2B in facilitating CHMP7 nuclear retention and activation for pathologic ESCRT-III mediated Nup degradation in sALS. FIG. 23A is a schematic diagram showing that in control human neurons for normal NPC maintenance and Nup turnover, the ESCRT-III protein passively diffuses through the NPC where it undergoes activation via association with CHMP2B. Following ESCRT-III mediated Nup degradation, CHMP7 is inactivated and actively exported from the nucleus. Nup molecules are replenished, and NPC homeostasis is maintained. FIG. 23B is a schematicdiagram showing that in sALS neurons, SUN1 mediated disruptions in NPC permeability barrier integrity lead to increased passive diffusion of CHMP7 into the nucleus where it undergoes activation via association with CHMP2B leading to degradation of specific Nups from the NPC. CHMP2B mediated activation of CHMP7 is sustained leading to continued ESCRT-III mediated Nup removal and degradation giving rise to NPC pathology observed in sALS.DETAILED DESCRIPTION OF THE DISCLOSURE
[0075] The present disclosure is based on the seminal discovery that CHMP2B facilitates the pathologic nuclear accumulation or retention of CHMP7 and triggers the reduction of POM121 at the early stages of NPC injury cascades, and that the inhibition of CHMP2B using antisense oligonucleotides can prevent and restore NPC injury associated TDP-43 loss of function in neuronal cells.
[0076] Before the present systems and methods are described, it is to be understood that this invention is not limited to the particular systems, methods, and experimental conditions described, as such systems, methods, and conditions may vary. It is also to be understood that the terminology used herein is for the purposes of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only in the appended claims.
[0077] As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, references to “the method” include one or more methods, and / or steps of the type described herein which will become apparent to those persons skilled in the art upon reading this disclosure and so forth.
[0078] As used herein, the term “and / or” includes any and all combinations of one or more of the associated listed items.
[0079] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can beused in the practice or testing of the invention, it will be understood that modifications and variations are encompassed within the spirit and scope of the instant disclosure. The preferred methods and materials are now described.
[0080] Importantly, the present disclosure shows that partial knockdown of CHMP2B was sufficient to alleviate NPC injury and downstream TDP-43 dysfunction in sALS neurons thereby highlighting CHMP2B as a potential therapeutic target in disease.
[0081] Described herein is a central role of ESCRT-III protein CHMP2B in eliciting CHMP7 mediated NPC injury in sALS iPSNs. Specifically, CHMP2B facilitates the “activation” of CHMP7 within the nucleus thereby triggering the reduction of POM121 at the early stages of NPC injury cascades. Interestingly, sustained CHMP2B mediated activation appears to underlie the pathologic nuclear accumulation / retention of CHMP7 observed in sALS. Critically, moderate reduction of CHMP2B protein via antisense oligonucleotide (ASO) or siRNA approaches abrogates nuclear accumulation of CHMP7, restores the nuclear localization and expression of POM121, and alleviates TDP-43 dysfunction in sALS iPSNs. Thus, these data define a cell biological mechanism underlying CHMP7 nuclear accumulation and subsequent initiation of NPC injury in the pathogenesis of sALS. Moreover, this study highlights the potential of targeting CHMP2B itself of CHMP7 - CHMP2B protein interactions as a therapeutic strategy for sALS.
[0082] In certain embodiment, the present disclosure provides an oligonucleotide including a nucleic acid sequence of SEQ ID NO: 3-12.
[0083] In some aspects, the present disclosure provides a composition including one or more oligonucleotides described above.
[0084] As used herein the term “oligonucleotide” refers to a short chain of DNA or RNA that can be single- or double-stranded. Oligonucleotides bind to their complementary DNA or RNA sequences and can be chemically modified to enhance their properties in the body. Examples of oligonucleotides include but are not limited to antisense oligonucleotides (ASOs), RNA interference (RNAi), small interfering RNA (siRNA) and aptamer RNAs. In some aspects, the oligonucleotide is an antisense oligonucleotide (ASO).
[0085] In certain embodiments, the present disclosure provides a method of modulating CHMP2B expression in a cell including contacting the cell with an oligonucleotide including a nucleic acid sequence of SEQ ID NO: 3 (TGTGACAAGTCCTAGTGGGA), SEQ ID NO: 4 (AGGGTGAGAAAGAGTATGGG), SEQ ID NO: 5 (GGGATGCAGAAATACAGAGG),SEQ ID NO: 6 (AAGTGGCATCTGAAGTAGGG), SEQ ID NO: 7 (TGGTAAGCGAAGATGCCAGA), SEQ ID NO: 8 (ATCACTTACCACCTGCCATG), SEQ ID NO: 9 (GTTGGTGGGACAGAGCAATA), SEQ ID NO: 10 (CACCTAACTCTCTAGTGGCT), SEQ ID NO: 11 (TCAATGGAACAGAGCCCAGA), SEQ ID NO: 12 (CATTTACCCTATGACCCAGC) or a combination thereof, thereby modulating the expression of CHMP2B.
[0086] Also included herein are oligonucleotide including a nucleic acid sequence having about 80% or more sequence identity to SEQ ID Nos:3-12. The terms "sequence identity" or "percent identity" are used interchangeably herein. To determine the percent identity of two polypeptide molecules or two polynucleotide sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first polypeptide or polynucleotide for optimal alignment with a second polypeptide or polynucleotide sequence). The amino acids or nucleotides at corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity=number of identical positions / total number of positions (i.e., overlapping positions) x 100). In some embodiments the length of a reference sequence (e.g. SEQ ID NO:3-12) aligned for comparison purposes is at least 80% of the length of the comparison sequence, and in some embodiments is at least 90% or 100%. In an embodiment, the two sequences are the same length.
[0087] Ranges of desired degrees of sequence identity are approximately 80% to 100% and integer values in between. Percent identities between a disclosed sequence and a claimed sequence can be at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9%. In general, an exact match indicates 100% identity over the length of the reference sequence (e.g., SEQ ID NO:3-12).
[0088] Polynucleotides that are about 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 99.5% or more identical to polynucleotides described herein are embodied within the disclosure.
[0089] For example, a polynucleotide can have 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO:3-12.
[0090] By “pharmaceutically acceptable” it is meant the carrier, diluent or excipient must be compatible with the other ingredients of the formulation and not deleterious to the recipient thereof. Pharmaceutically acceptable carriers, excipients or stabilizers are well known in the art, for example Remington's Pharmaceutical Sciences, 16th edition, Osol, A. Ed. (1980). Pharmaceutically acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed. Examples of carriers, excipients, or stabilizers include, but are not limited to, liposome, nanoparticles, ointment, micelles, microsphere, microparticle, cream, emulsion, gel, anti-adherents such as magnesium stearate, binders such as saccharides and their derivatives (sucrose, lactose, starches, cellulose, sugar alcohols and the like) protein like gelatin and synthetic polymers, lubricants such as talc and silica, and preservatives such as antioxidants, vitamin A, vitamin E, vitamin C, retinyl palmitate, selenium, cysteine, methionine, citric acid, sodium sulfate, parabens, water, alcohol, saline solution, glycol, mineral oil, dimethyl sulfoxide (DMSO), phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (for example, Zn-protein complexes); and / or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG).
[0091] The pharmaceutical composition may also contain other therapeutic agents, and may be formulated, for example, by employing conventional vehicles or diluents, as well as pharmaceutical additives of a type appropriate to the mode of desired administration (for example, excipients, preservatives, etc.) according to techniques known in the art of pharmaceutical formulation.
[0092] In certain embodiments, the compositions disclosed herein are formulated with additional agents that promote entry into the desired cell or tissue. Such additional agents include micelles, liposomes, and dendrimers.
[0093] Therapeutically effective agents useful in the methods of the invention can be suitable for parenteral injection with physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (propyleneglycol, polyethyleneglycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.
[0094] Solid dosage forms for oral administration of the inhibitors useful herein or pharmaceutically acceptable salts or prodrugs thereof include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the compounds described herein or derivatives thereof is admixed with at least one inert customary excipient (or carrier) such as sodium citrate or dicalcium phosphate or (a) fillers or extenders, as for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid, (b) binders, as for example, carboxymethylcellulose, alignates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, (c) humectants, as for example, glycerol, (d) disintegrating agents, as for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, for example.
[0095] Solid compositions of a similar type can also be employed as fillers in soft and hard filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethyleneglycols, and the like.
[0096] Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and others known in the art. Liquid dosage forms for oral administration of the compounds described herein or pharmaceutically acceptable salts or prodrugs thereof include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, the liquid dosage forms can contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents, and emulsifiers, as for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propyleneglycol, 1,3 butyleneglycol, dimethylformamide, oils, in particular, cottonseed oil, groundnut oil, com germ oil, olive oil, castor oil, sesame oil, glycerol, tetrahydrofurfuryl alcohol, polyethyleneglycols, and fatty acid esters of sorbitan, or mixtures of these substances, and the like.
[0097] Inhibitors or agents described herein or pharmaceutically acceptable salts or prodrugs thereof for rectal administrations are optionally suppositories, which can be prepared by mixing the compounds with suitable non-irritating excipients or carriers such as cocoa butter, polyethyleneglycol or a suppository wax, which are solid at ordinary temperatures but liquid at body temperature and therefore, melt in the rectum or vaginal cavity and release the active component.
[0098] In some aspects, modulating CHMP2B expression includes decreasing CHMP2B expression in the cell compared to CHMP2B expression in a cell contacted with a control oligonucleotide or in a cell not contacted with the oligonucleotide.
[0099] As used herein the term “antisense oligonucleotide” or “ASO” refers to a short, synthetic, single-stranded DNA or RNA molecule designed to bind to a specific messenger RNA (mRNA) sequence, thereby inhibiting the function of the mRNA and preventing the production of the corresponding protein. An ASO can effectively modulate gene expression at the RNA level. Examples of ASO include but are not limited to RNase H-dependent oligonucleotides, steric-blocker oligonucleotides, gapmer ASOs, small interfering RNAs (siRNAs), splice switching ASOs (ssASOs), and nanoparticles.
[0100] As used herein the term “small interfering RNA” or “siRNA” refers to a class of noncoding RNA molecules that regulate gene expression. siRNAs bind to messenger RNA (mRNA) and promote its degradation in a process is called RNA interference (RNAi). siRNAs silence the expression of target genes in a sequence-specific manner. SiRNA can directly be introduced into cells.
[0101] As used herein, the term “modulating expression” is meant to refer to detectable changes in expression. As used herein “modulating expression” refers to decreasing expression. A detectable change in expression can be relative to a control sample, such as an identical type of sample from another subject or a sample previously collected from the subject of a method disclosed herein. A detectable change in expression can also be relative to a database or standard value. As non-limiting examples, a threshold for modulated expression can be a 0.5- fold change, a 0.75-fold change, a 1.25-fold change, a 1.5-fold change, a 2-fold change, a 2.5- fold change, a 3-fold change, a 4-fold change, a 5-fold change, a 10-fold change in a level of expression or more.
[0102] As used herein the term “charged multivesicular body protein 2B” or “CHMP2B” refers to a protein that helps regulate protein degradation and transport in cells. CHMP2B is acomponent of the ESCRT-III complex which helps remodel cell membranes. CHMP2B is expressed in many tissues, including the brain, heart, skeletal muscle, and liver. In the brain, CHMP2B is expressed in the cerebral cortex, cerebellum, medulla, and other regions. Mutations in the CHMP2B gene can cause CHMP2B-related diseases. Examples of CHMP2B- related diseases include but are not limited to neurodegenerative diseases such as frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS). CHMP2B-related diseases are caused by mutations in the gene that encodes charged multivesicular body protein 2B (CHMP2B).
[0103] As used herein the term “contacting a cell” refers to the physical interaction between an agent and a cell. The contact can be via diffusion, blood circulation, direct contact, or intercellular j unctions .
[0104] In some aspects, the expression of CHMP2B is measured using immunostaining, confocal imaging, nuclei isolation, Western blotting, or a combination thereof.
[0105] In certain embodiments, the present disclosure provides a method of decreasing or inhibiting nuclear accumulation of CHMP7 in a cell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting nuclear accumulation of CHMP7 in the cell.
[0106] In certain embodiments, the present disclosure provides a method of preventing nuclear accumulation of CHMP7 in a cell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby preventing nuclear accumulation of CHMP7 in the cell. In some aspects, targeting expression of CHMP2B includes decreasing CHMP2B expression in the cell.
[0107] The ASO and siRNA described herein decrease CHMP2B expression. For example, expression of CHMP2B in the cell may be decreased by at least about 5% to about 95%, e.g., about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more relative to corresponding expression of CHMP2B in a reference cell. The expression of CHMP2B in the cell may be silenced relative to corresponding expression of CHMP2B in a reference cell. The reference cell may be but is not limited to the cell prior to treatment, another cell from the same subject, a cell from a reference subject.
[0108] As used herein the term “nuclear accumulation” refers to the process by which proteins or other molecules accumulate in the nucleus of a cell. Several factors may influence nuclear accumulation including but not limited to alternative splicing, subunit composition,proteostasis, and tyrosine phosphorylation. Nuclear accumulation of CHMP7 can cause nuclear pore complex injury, which can lead to TDP-43 dysfunction in ALS. Nuclear accumulation of CHMP7 triggers a cascade of events, involving recruitment of other ESCRT-III components, leading to the degradation of proteins that make up the nuclear pore complex. As a result of NPC damage, TDP-43, a protein that usually resides in the nucleus, can leak out into the cytoplasm, causing it to lose its normal function in RNA processing. The mislocalization of TDP-43 leads to abnormal RNA splicing and processing, which can disrupt the production of essential proteins for neuronal function. TDP-43 dysfunction can trigger cellular stress responses, ultimately leading to neuronal damage and death, characteristic of ALS.
[0109] As used herein the term “charged multivesicular body protein 7” or “CHMP7” refers to a protein that is involved in several cellular processes, including but not limited to nuclear pore surveillance, nuclear envelope closure, endosomal sorting pathway, mitotic nuclear division, and vacuolar transport. CHMP7 is associated with diseases such as: amyotrophic lateral sclerosis (ALS), frontotemporal dementia, and spinal muscular atrophy. CHMP7 is part of the ESCRT-III complex, which promotes nuclear envelope sealing and mitotic spindle disassembly. CHMP7's aberrant nuclear expression and localization may contribute to Nup alterations in ALS.
[0110] The ASO and siRNA described herein decrease CHMP2B expression, which inhibits or reduced CHMP7 nuclear accumulation. For example, nuclear accumulation of CHMP7 in the cell may be decreased by at least about 5% to about 95%, e.g., about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more relative to corresponding nuclear accumulation of CHMP7 in a reference cell. The nuclear accumulation of CHMP7 in the cell may be completely suppressed relative to corresponding nuclear accumulation of CHMP7 in a reference cell. The reference cell may be but is not limited to the cell prior to treatment, another cell from the same subject, a cell from a reference subject.
[0111] As used herein the term “control” or “reference” refers to a standard or comparison group that is used to evaluate the effects of a treatment. Examples of controls of references may include but are not limited to a cell or subject not treated, the same cell or subject prior to treatment, or a cell or subject treated with anon-targeting or scrambled oligonucleotide.
[0112] By an “agent that targets” or a “targeting agent” is meant a molecule that specifically binds to a particular biological target within a cell , such as a protein, enzyme, receptor, or DNA sequence, to produce a desired physiological effect by altering its function. A targetingagent is a specific substance that is designed to interact with its target to achieve a therapeutic outcome.
[0113] As used herein the term “pathologic” refers to an abnormal structural or functional alteration in a cell, tissue, or organ that deviates from its normal state, typically indicating the presence of a disease process.
[0114] As used herein the term “preventing” includes inhibiting and / or reducing. For example, the CHMP2B agent described herein (1) reduces or decreases CHMP7 nuclear accumulation, that is in a cell that has an increased nuclear accumulation of CHMP7, the CHMP2B targeting agent described herein reduces said nuclear accumulation. The reduction includes any reduction of the nuclear accumulation (e.g., 1% reduction of the nuclear accumulation), up to a complete reduction of the nuclear accumulation (e.g., a restoration of a normal level, or a 100% reduction of the nuclear accumulation. CHMP7 nuclear accumulation in a cell can be reduced or decreased by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 05, 96, 97, 98, 99 or 100% after contacting of the cell with the CHMP2B targeting agent. Additionally, the CHMP2B agent described herein (2) inhibits CHMP7 nuclear accumulation, that is, in a cell that is at risk of presenting an increased nuclear accumulation of CHMP7, the CHMP2B targeting agent described herein inhibit said nuclear accumulation before it actually occurs in the cell. The inhibition includes any inhibition of the nuclear accumulation (e.g., 1% inhibition of the otherwise expected / anticipated nuclear accumulation), up to a complete inhibition of the nuclear accumulation (e.g., a complete prevention of nuclear accumulation, or a 100% inhibition of the nuclear accumulation. CHMP7 nuclear accumulation in a cell can be inhibited by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 05, 96, 97, 98, 99 or 100% after contacting of the cell with the CHMP2B targeting agent.
[0115] In some aspects, the cell is a neuronal cell. In some aspects, the neuronal cell exhibits pathologic nuclear accumulation of CHMP7 or is at risk of pathologic nuclear accumulation of CHMP7. In some aspects, the neuronal cell is from a subject suffering from a neurodegenerative disease. In some aspects, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkinson’s disease, Huntington’s chorea, mild cognitive impairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration.
[0116] As used herein “neurodegenerative disease” refers to a disease or disorder that destroys motor neurons or their function, for example. The methods described herein can be applied to any neurodegenerative disease. Exemplary neurodegenerative diseases include synucleinopathies, tauopathies, prion diseases, motor neuron diseases, dementia, transmissible spongiform encephalopathies, systemic atrophies primarily affecting the central nervous system, trinucleotide repeat disorders, proteopathies, amyloidosis, neuronal ceroid lipofuscinoses, and others.
[0117] Amyotrophic lateral sclerosis (ALS), also known as motor neuron disease (MND) or Lou Gehrig’s disease, is a neurodegenerative disease that results in the progressive loss of motor neurons that control voluntary muscles. ALS is the most common type of motor neuron disease. Early symptoms of ALS include stiff muscles, muscle twitches, and gradual increasing weakness and muscle wasting. Limb-onset ALS begins with weakness in the arms or legs, while bulbar-onset ALS begins with difficulty speaking or swallowing. Half of the people with ALS develop at least mild difficulties with thinking and behavior, and about 15% develop frontotemporal dementia. Most people experience pain. The affected muscles are responsible for chewing food, speaking, and walking. Motor neuron loss continues until the ability to eat, speak, move, and finally the ability to breathe is lost. ALS eventually causes paralysis and early death, usually from respiratory failure.
[0118] Alzheimer's disease is characterized by loss of neurons and synapses in the cerebral cortex and certain subcortical regions. This loss results in gross atrophy of the affected regions, including degeneration in the temporal lobe and parietal lobe, and parts of the frontal cortex and cingulate gyrus. Degeneration is also present in brainstem nuclei particularly the locus coeruleus in the pons. Studies using MRI and PET have documented reductions in the size of specific brain regions in people with Alzheimer's disease as they progressed from mild cognitive impairment to Alzheimer's disease, and in comparison, with similar images from healthy older adults. Both A|3 plaques and neurofibrillary tangles are clearly visible by microscopy in brains of those with Alzheimer's disease, especially in the hippocampus. However, Alzheimer's disease may occur without neurofibrillary tangles in the neocortex. Plaques are dense, mostly insoluble deposits of beta-amyloid peptide and cellular material outside and around neurons. Tangles (neurofibrillary tangles) are aggregates of the microtubule-associated protein tau which has become hyperphosphorylated and accumulate inside the cells themselves. Although many older individuals develop some plaques and tanglesas a consequence of aging, the brains of people with Alzheimer's disease have a greater number of them in specific brain regions such as the temporal lobe. Lewy bodies are not rare in the brains of people with Alzheimer's disease.
[0119] Parkinson's disease (PD), or simply Parkinson's, is a long-term degenerative disorder of the central nervous system that mainly affects the motor system. The symptoms usually emerge slowly, and as the disease worsens, non-motor symptoms become more common. The most obvious early symptoms are tremor, rigidity, slowness of movement, and difficulty with walking. Cognitive and behavioral problems may also occur with depression, anxiety, and apathy occurring in many people with PD. Parkinson's disease dementia becomes common in the advanced stages of the disease. Those with Parkinson's can also have problems with their sleep and sensory systems. The motor symptoms of the disease result from the death of cells in the substantia nigra, a region of the midbrain, leading to a dopamine deficit. The cause of this cell death is poorly understood but involves the build-up of misfolded proteins into Lewy bodies in the neurons. Collectively, the main motor symptoms are also known as parkinsonism or a parkinsonian syndrome. No cure for PD is known; treatment aims to reduce the effects of the symptoms. Initial treatment is typically with the medications levodopa (L-DOPA), MAO- B inhibitors, or dopamine agonists. As the disease progresses, these medications become less effective, while at the same time producing a side effect marked by involuntary muscle movements. At that time, medications may be used in combination and doses may be increased. Diet and certain forms of rehabilitation have shown some effectiveness at improving symptoms. Surgery to place microelectrodes for deep brain stimulation has been used to reduce motor symptoms in severe cases where drugs are ineffective. The main pathological characteristics of PD are cell death in the brain's basal ganglia (affecting up to 70% of the dopamine-secreting neurons in the substantia nigra pars compacta by the end of life). In Parkinson's disease, alpha-synuclein becomes misfolded and clump together with other alpha- synuclein. Cells are unable to remove these clumps, and the alpha-synuclein becomes cytotoxic, damaging the cells. These clumps can be seen in neurons under a microscope and are called Lewy bodies. Loss of neurons is accompanied by the death of astrocytes (star-shaped glial cells) and a significant increase in the number of microglia (another type of glial cell) in the substantia nigra. Braak staging is a way to explain the progression of the parts of the brain affected by PD. According to this staging, PD starts in the medulla and the olfactory bulb before moving to the substantia nigra pars compacta and the rest of the midbrain / basal forebrain.Movement symptom onset is associated when the disease begins to affect the substantia nigra pars compacta. Brain cells could be lost by several proposed mechanisms. One mechanism consists of an abnormal accumulation of the protein alpha-synuclein bound to ubiquitin in the damaged cells. This insoluble protein accumulates inside neurons forming inclusions called Lewy bodies. According to the Braak staging, a classification of the disease based on pathological findings proposed by Heiko Braak, Lewy bodies first appear in the olfactory bulb, medulla oblongata, and pontine tegmentum; individuals at this stage may be asymptomatic or may have early nonmotor symptoms (such as loss of sense of smell, or some sleep or automatic dysfunction). As the disease progresses, Lewy bodies develop in the substantia nigra, areas of the midbrain and basal forebrain, and finally, the neocortex. These brain sites are the main places of neuronal degeneration in PD, but Lewy bodies may not cause cell death, and they may be protective (with the abnormal protein sequestered or walled off).
[0120] Pick's disease is a rare form of dementia that affects the brain's frontal and temporal lobes. It's also known as frontotemporal dementia (FTD). FTD may be caused by damage to nerve cells in the frontal and temporal lobes, breakdown of connections between the frontal and temporal lobes and other parts of the brain.
[0121] Frontotemporal lobar degeneration (FTLD) is characterized by progressive neuronal loss predominantly involving the frontal or temporal lobes, and a typical loss of more than 70% of spindle neurons, while other neuron types remain intact. There are three main histological subtypes found at post-mortem: FTLD-tau, FTLD-TDP, and FTLD-FUS. In rare cases, patients with clinical FTD were found to have changes consistent with Alzheimer's disease on autopsy. The most severe brain atrophy appears to be associated with behavioral variant FTD, and corticobasal degeneration. With regard to the genetic defects that have been found, repeat expansion in the C9orf72 gene is considered a major contribution to frontotemporal lobar degeneration, although defects in the GRN and MAPT genes are also associated with it.
[0122] Huntington’s chorea, also known as Huntington's disease, is a genetic disease that causes involuntary movements and other symptoms. Huntington’s chorea is characterized by uncontrollable, jerky movements that affect the face, arms, legs, and torso; difficulty with memory, learning, focus, and multitasking; difficulty with memory, learning, focus, and multitasking; irritability, depression, bipolar disorder, paranoia, and psychosis; impulsivity, outbursts of anger, and aggression; muscle stiffness, balance problems, and difficulty swallowing. Huntington’s disease is caused by a genetic variant of the HTT gene.
[0123] Mild cognitive impairment (MCI) is a condition that causes memory or thinking problems that are more severe than what's typical for a person's age. The symptoms of MCI are not as severe as those of Alzheimer's disease or a related dementia. Mild cognitive impairment (MCI) is a diagnosis that reflects an intermediate stage of cognitive impairment.
[0124] Lewy body dementia (LBD) is a progressive brain disease that causes abnormal protein deposits to accumulate in the brain. These deposits, called Lewy bodies, disrupt brain chemicals and lead to problems with thinking, movement, mood, and behavior.
[0125] Multiple system atrophy (MSA) is a rare, progressive, and debilitating disease that affects the brain and nervous system. MSA causes gradual damage to nerve cells in the brain. This affects balance, movement and the autonomic nervous system, which controls several basic functions, such as breathing, digestion and bladder control.
[0126] Progressive supranuclear palsy (PSP) is a rare neurological disorder that affects body movements, walking and balance, and eye movements. PSP is caused by damage to nerve cells in areas of the brain that control thinking and body movements. PSP is caused by buildup of tau, a protein that's normally broken down in the brain.
[0127] Corticobasal degeneration (CBD) is a rare brain disease that causes the gradual loss of brain cells and function. CBD is characterized by brain cells degeneration in the cerebral cortex and basal ganglia.
[0128] As used herein the term “TAR DNA binding protein 43” or “TDP-43” refers to a protein that accumulates in the brain and is linked to several neurodegenerative diseases. TDP- 43 is a protein crucial for RNA processing within cells. Examples of TDP-43-linked neurodegenerative diseases include but is not limited to as ALS, frontotemporal dementia (FTD), Alzheimer’s disease, limbic predominant age-related TDP-43 encephalopathy (LATE).
[0129] As used herein the term “TDP-43 loss of function” refers to a condition where TDP- 43 is not functioning properly, leading to disruptions in gene expression and ultimately contributing to neurodegeneration, often associated with diseases like amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). In neurodegenerative diseases linked to TDP-43, the protein can aggregate and accumulate in the cytoplasm (cytoplasmic mislocalization and aggregation), leading to a depletion of functional TDP-43 in the nucleus where it is needed (nuclear depletion).
[0130] In some aspects, the agent that targets expression of CHMP2B is an siRNA, an ASO, a small molecule inhibitor, or a combination thereof. In some aspects, the ASO includes anucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.
[0131] In certain embodiments, the present disclosure provides a method of decreasing or inhibiting Nup turnover in a cell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting turnover in the cell. For example, Nup turnover in the cell may be decreased by at least about 5% to about 95%, e.g., about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, relative to corresponding Nup turnover in a reference cell. The Nup turnover in the cell may be silenced relative to corresponding Nup turnover in a reference cell. The reference cell may be but is not limited to the cell prior to treatment, another cell from the same subject, a cell from a subject treated with control.
[0132] In certain embodiments, the present disclosure provides a method of preventing Nup turnover in a cell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby preventing Nup turnover in the cell.
[0133] As used herein the term “preventing” includes inhibiting and / or reducing. For example, the CHMP2B agent described herein (1) reduces or decreases Nup turnover, that is in a cell that has an increased Nup turnover, the CHMP2B targeting agent described herein reduces Nup turnover. The reduction includes any reduction of the Nup turnover (e.g., 1% reduction of the Nup turnover), up to a complete reduction of the Nup turnover (e.g., a restoration of a normal level, or a 100% reduction of the Nup turnover. Nup turnover in a cell can be reduced or decreased by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 05, 96, 97, 98, 99 or 100% after contacting of the cell with the CHMP2B targeting agent. Additionally, the CHMP2B agent described herein (2) inhibits Nup turnover, that is, in a cell that is at risk of presenting an increased Nup turnover, the CHMP2B targeting agent described herein inhibit said Nup turnover before it actually occurs in the cell. The inhibition includes any inhibition of the Nup turnover (e.g., 1% inhibition of the otherwise expected / anticipated Nup turnover), up to a complete inhibition of the Nup turnover (e.g., a complete prevention of Nup turnover, or a 100% inhibition of the Nup turnover. Nup turnover in a cell can be inhibited by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 05, 96, 97, 98, 99 or 100% after contacting of the cell with the CHMP2B targeting agent.
[0134] In some aspects, targeting expression of CHMP2B includes decreasing CHMP2B expression in the cell.
[0135] In some aspects, decreasing CHMP2B in the cell includes decreasing or inhibiting nuclear accumulation of CHMP7 in the cell compared to nuclear accumulation of CHMP7 in a cell treated with a control agent or nuclear accumulation of CHMP7 in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0136] In some aspects, decreasing or inhibiting nuclear accumulation of CHMP7 in the cell deceases Nup turnover in the cell compared to Nup turnover in a cell treated with a control agent or Nup turnover in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0137] In some aspects, the cell is a neuronal cell.
[0138] In some aspects, the neuronal cell exhibits pathologic Nup turnover or is at risk of Nup turnover in the cell.
[0139] In some aspects, the neuronal cell is from a subj ect suffering from Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkin-son’s disease, Huntington’s chorea, mild cognitive impairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration.
[0140] In some aspects, the agent that targets expression of CHMP2B is an siRNA, an ASO, or a combination thereof. In some aspects, the ASO includes a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.
[0141] In certain embodiments, the present disclosure provides a method of decreasing or inhibiting nuclear pore complex (NPC) injury in a cell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting NPC injury in the cell.
[0142] In certain embodiments, the present disclosure provides a method of preventing nuclear pore complex (NPC) injury in a cell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby preventing NPC injury in the cell.
[0143] As used herein the term “preventing” includes inhibiting and / or reducing. For example, the CHMP2B agent described herein (1) reduces or decreases NPC injury, that is in a cell that has an increased NPC injury, the CHMP2B targeting agent described herein reduces NPC injury. The reduction includes any reduction of the NPC injury (e.g., 1% reduction of theNPC injury), up to a complete reduction oftheNPC injury (e.g., a restoration of a normal level, or a 100% reduction of the NPC injury. NPC injury in a cell can be reduced or decreased by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 05, 96, 97, 98, 99 or 100% after contacting of the cell with the CHMP2B targeting agent. Additionally, the CHMP2B agent described herein (2) inhibits NPC injury, that is, in a cell that is at risk of presenting an increased NPC injury, the CHMP2B targeting agent described herein inhibit said NPC injury before it actually occurs in the cell. The inhibition includes any inhibition of the NPC injury (e.g., 1% inhibition of the otherwise expected / anticipated NPC injury), up to a complete inhibition of the NPC injury (e.g., a complete prevention of NPC injury, or a 100% inhibition of the NPC injury. NPC injury in a cell can be inhibited by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 05, 96, 97, 98, 99 or 100% after contacting of the cell with the CHMP2B targeting agent.
[0144] In some aspects, targeting expression of CHMP2B includes decreasing CHMP2B expression in the cell.
[0145] In some aspects, decreasing CHMP2B in the cell includes decreasing or inhibiting nuclear accumulation of CHMP7 in the cell compared to nuclear accumulation of CHMP7 in a cell treated with a control agent or nuclear accumulation of CHMP7 in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0146] In some aspects, decreasing or inhibiting nuclear accumulation of CHMP7 in the cell includes decreasing or inhibiting Nup turnover in the cell compared to Nup turnover in a cell treated with a control agent or Nup turnover in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0147] In some aspects, decreasing or inhibiting Nup turnover in the cell comprises decreasing or inhibiting NPC injury in the cell compared to NPC injury in a cell treated with a control agent or NPC injury in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0148] In some aspects, the cell is a neuronal cell. In some aspects, the neuronal cell exhibits NPC injury or is at risk of NPC injury in the cell. In some aspects, the neuronal cell is from a subj ect suffering from Amyotrophic lateral sclerosis (ALS), Alzheimer’ s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkinson’s disease, Huntington’s chorea, mild cognitive impairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration.
[0149] In some aspects, the agent that targets expression of CHMP2B is an siRNA, an ASO, or a combination thereof.
[0150] In some aspects, the ASO includes a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof
[0151] In certain embodiments, the present disclosure provides a method of decreasing or inhibiting TDP-43 mislocalization in a cell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting TDP-43 mislocalization in the cell.
[0152] In certain embodiments, the present disclosure provides a method of preventing TDP- 43 mislocalization in a cell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby preventing TDP-43 mislocalization in the cell.
[0153] As used herein the term “preventing” includes inhibiting and / or reducing. For example, the CHMP2B agent described herein (1) reduces or decreases TDP-43 mislocalization, that is in a cell that has an increased TDP-43 mislocalization, the CHMP2B targeting agent described herein reduces TDP-43 mislocalization. The reduction includes any reduction of the TDP-43 mislocalization (e.g., 1% reduction of the TDP-43 mislocalization), up to a complete reduction of the TDP-43 mislocalization (e.g., a restoration of a normal level, or a 100% reduction of the TDP-43 mislocalization. TDP-43 mislocalization in a cell can be reduced or decreased by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 05, 96, 97, 98, 99 or 100% after contacting of the cell with the CHMP2B targeting agent. Additionally, the CHMP2B agent described herein (2) inhibits TDP-43 mislocalization, that is, in a cell that is at risk of presenting an increased TDP-43 mislocalization, the CHMP2B targeting agent described herein inhibit said TDP-43 mislocalization before it actually occurs in the cell. The inhibition includes any inhibition of the TDP-43 mislocalization (e.g., 1% inhibition of the otherwise expected / anticipated TDP-43 mislocalization), up to a complete inhibition of the TDP-43 mislocalization (e.g., a complete prevention of TDP-43 mislocalization, or a 100% inhibition of the TDP-43 mislocalization. TDP-43 mislocalization in a cell can be inhibited by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 05, 96, 97, 98, 99 or 100% after contacting of the cell with the CHMP2B targeting agent.
[0154] In some aspects, expression of CHMP2B includes decreasing CHMP2B expression in the cell.
[0155] In some aspects, decreasing CHMP2B in the cell includes decreasing or inhibiting nuclear accumulation of CHMP7 in the cell compared to nuclear accumulation of CHMP7 in a cell treated with a control agent or nuclear accumulation of CHMP7 in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0156] In some aspects, decreasing or inhibiting nuclear accumulation of CHMP7 in the cell includes decreasing or inhibiting Nup turnover in the cell compared to Nup turnover in a cell treated with a control agent or Nup turnover in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0157] In someaspects, decreasing or inhibiting Nup turnover in the cell includes decreasing or inhibiting NPC injury in the cell compared to NPC injury in a cell treated with a control agent or NPC injury in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0158] In some aspects, decreasing or inhibiting NPC injury in the cell includes decreasing or inhibiting TDP-43 mislocalization in the cell compared to TDP-43 mislocalization in a cell treated with a control agent or TDP-43 mislocalization in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0159] In some aspects, the cell is a neuronal cell.
[0160] In some aspects, the neuronal cell exhibits TDP-43 mislocalization or is at risk of TDP-43 mislocalization in the cell.
[0161] In some aspects, the neuronal cell is from a subj ect suffering from Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkin-son’s disease, Huntington’s chorea, mild cognitive impairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration.
[0162] In some aspects, the agent that targets expression of CHMP2B is an siRNA, an ASO, or a combination thereof. In some aspects, the ASO includes a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.
[0163] In certain embodiments, the present disclosure provides a method of decreasing or inhibiting TDP-43 loss of function in a cell including modulating CHMP2B expression in thecell including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting TDP-43 loss of function in the cell.
[0164] In certain embodiments, the present disclosure provides a method of preventing TDP- 43 loss of function in a cell including including contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby preventing the TDP-43 loss of function.
[0165] As used herein the term “preventing” includes inhibiting and / or reducing. For example, the CHMP2B agent described herein (1) reduces or decreases TDP-43 loss of function, that is in a cell that has an increased TDP-43 loss of function, the CHMP2B targeting agent described herein reduces TDP-43 loss of function. The reduction includes any reduction of the TDP-43 loss of function (e.g., 1% reduction of the TDP-43 loss of function), up to a complete reduction of the TDP-43 loss of function (e.g., a restoration of a normal level, or a 100% reduction of the TDP-43 loss of function. TDP-43 loss of function in a cell can be reduced or decreased by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 05, 96, 97, 98, 99 or 100% after contacting of the cell with the CHMP2B targeting agent. Additionally, the CHMP2B agent described herein (2) inhibits TDP-43 loss of function, that is, in a cell that is at risk of presenting an increased TDP-43 loss of function, the CHMP2B targeting agent described herein inhibit said TDP-43 loss of function before it actually occurs in the cell. The inhibition includes any inhibition of the TDP-43 loss of function (e.g., 1% inhibition of the otherwise expected / anticipated TDP-43 loss of function), up to a complete inhibition of the TDP-43 loss of function (e.g., a complete prevention of TDP-43 loss of function, or a 100% inhibition of the TDP-43 loss of function. TDP-43 loss of function in a cell can be inhibited by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 05, 96, 97, 98, 99 or 100% after contacting of the cell with the CHMP2B targeting agent.
[0166] In some aspects, targeting expression of CHMP2B includes decreasing CHMP2B expression in the cell.
[0167] In some aspects, decreasing CHMP2B in the cell includes decreasing or inhibiting nuclear accumulation of CHMP7 in the cell compared to nuclear accumulation of CHMP7 in a cell treated with a control agent or nuclear accumulation of CHMP7 in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0168] In some aspects, decreasing or inhibiting nuclear accumulation of CHMP7 in the cell includes decreasing or inhibiting Nup turnover in the cell compared to Nup turnover in a celltreated with a control agent or Nup turnover in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0169] In some aspects, decreasing or inhibiting Nup turnover in the cell includes decreasing or inhibiting NPC injury in the cell compared to NPC injury in a cell treated with a control agent or NPC injury in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0170] In some aspects, decreasing or inhibiting NPC injury in the cell includes decreasing or inhibiting TDP-43 mislocalization in the cell compared to TDP-43 mislocalization in a cell treated with a control agent or TDP-43 mislocalization in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0171] In some aspects, decreasing or inhibiting NPC injury in the cell includes decreasing or inhibiting TDP-43 loss of function in the cell compared to TDP-43 loss of function in a cell treated with a control agent or TDP-43 loss of function in the cell prior to contacting the cell with the agent targeting CHMP2B.
[0172] In some aspects, the TDP-43 loss of function results from TDP-43 nuclear depletion, TDP-43 cytoplasmic mislocalization, TDP-43 aggregation, or a combination thereof.
[0173] In some aspects, the cell is a neuronal cell.
[0174] In some aspects, the neuronal cell exhibits TDP-43 loss of function or is at risk of TDP-43 loss of function in the cell.
[0175] In some aspects, the neuronal cell is from a subject suffering from Amyo-trophic lateral sclerosis (ALS), Alzheimer’s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkinson’s disease, Huntington’s chorea, mild cognitive im-pairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration.
[0176] In some aspects, the agent that targets expression of CHMP2B is an siRNA, an ASO, or a combination thereof.
[0177] In some aspects the ASO comprises a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.
[0178] In certain embodiments, the present disclosure provides a method of treating a neurodegenerative disease in a subject including modulating CHMP2B expression in the subject including administering to the subject an agent that targets CHMP2B, thereby treating the neurodegenerative disease.
[0179] In certain embodiments, the present disclosure provides a method of preventing a neurodegenerative disease in a subject at risk of having a neurodegenerative disease including modulating CHMP2B expression in the subject including administering to the subject an agent that targets CHMP2B, thereby preventing the neurodegenerative disease.
[0180] The term “treatment” is used interchangeably herein with the term “therapeutic method” or “therapy” and refers to 1) therapeutic treatments or measures that cure, slow down, lessen symptoms of, and / or halt progression of a diagnosed pathologic conditions or disorder, and / or 2) prophylactic / preventative measures. Those in need of treatment may include individuals already having a particular medical disorder as well as those who may ultimately acquire the disorder (i.e., those needing preventive measures).
[0181] The terms “therapeutically effective amount”, “effective dose,” “therapeutically effective dose”, “effective amount,” or the like refer to that amount of the subject compound that will elicit the biological or medical response of a tissue, system, animal or human that is being sought by the researcher, veterinarian, medical doctor or other clinician. Generally, the response is either amelioration of symptoms in a patient or a desired biological outcome (e.g., treating ALS). Such amount should be sufficient to increase neuronal survival. The effective amount can be determined as described herein.
[0182] The terms “administration of’ and or “administering” should be understood to mean providing a pharmaceutical composition in a therapeutically effective amount to the subject in need of treatment. Administration routes can be enteral, topical or parenteral. As such, administration routes include but are not limited to intracutaneous, subcutaneous, intravenous, intraperitoneal, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, transdermal, transtracheal, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal and intrastemal, oral, sublingual buccal, rectal, vaginal, nasal ocular administrations, as well infusion, inhalation, and nebulization. The phrases “parenteral administration” and “administered parenterally” as used herein means modes of administration other than enteral and topical administration. Examples of route of administration include but is not limited to inhalation, otic, buccal, conjunctival, dental, endocervical, endosinusial, endotracheal, enteral, epidural, extra-amniotic, extracorporeal, hemodialysis, infiltration, interstitial, intraabdominal, intraamniotic, intraarterial, intraarticular, intrabiliary, intrabronchial, intrabursal, intracardiac, intracartilaginous, intracaudal, intracavemous, intracavitary, intracerebroventricular, intracistemal, intracorneal, intracoronal, intracoronary, intracorpous cavemaosum,intradermal, intradiscal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intrahippocampal, intraileal, intralesional, intraluminal, intralymphatic, intramedullary, intrameningeal, intramuscular, intraocular, intraovarian, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratendinous, intratesticular, intrathoracic, intratubular, intratumor, intratympanic, intrauterine, intravascular, intravenous, intravenous bolus, intravenous drip, intravesical, intravitreal, iontophoresis, irrigation, laryngeal, nasal, nasogastric, ophthalmic, oral, oropharyngeal, parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, retrobulbar, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, vaginal, infraorbital, intraparenchymal, intrathecal, intraventricular, stereotactic administration, or any combination thereof.
[0183] The pharmaceutical compositions can be administered in a variety of unit dosage forms depending upon the method of administration. Suitable unit dosage forms, include, but are not limited to powders, tablets, pills, capsules, lozenges, suppositories, patches, nasal sprays, injectables, implantable sustained release formulations, lipid complexes.
[0184] In some aspects administration can be in combination with one or more additional therapeutic agents. The phrases “combination therapy”, “combined with” and the like refer to the use of more than one medication or treatment simultaneously to increase the response. The composition of the present invention might for example be used in combination with other drugs or treatment in use to treat neurodegenerative diseases. Specifically the administration of the agent targeting CHMP2B to a subject can be in combination with Edaravone, Riluzole, AMX0035, and / or Tofersen. Such therapies can be administered prior to, simultaneously with, or following administration of the composition of the present invention.
[0185] Throughout, treat, treating, and treatment refer to a method of reducing or delaying one or more effects or symptoms of a neurodegenerative disease or disorder. The subject can be diagnosed with disease or disorder. Treatment can also refer to a method of reducing the underlying pathology rather than just the symptoms. The effect of the administration to the subject can have the effect of but is not limited to reducing one or more symptoms of the neurodegenerative disease or disorder, a reduction in the severity of the neurological disease or injury, the complete ablation of the neurological disease or injury, or a delay in the onset or worsening of one or more symptoms.
[0186] For example, a disclosed method is considered to be a treatment if there is about a 10% reduction in one or more symptoms of the disease in a subject when compared to the subject prior to treatment or when compared to a control subject or control value. Thus, the reduction can be about a 10, 20, 30, 40, 50, 60, 70, 80, 90, .0 100%, or any amount of reduction in between.
[0187] As used herein the term “preventing” includes inhibiting and / or reducing. For example, the CHMP2B agent described herein (1) reduces or decreases neuronal cell death in a subject that has a neuronal cell death, the CHMP2B targeting agent described herein reduces neuronal cell death. The reduction includes any reduction of the neuronal cell death (e.g., 1% reduction of the neuronal cell death), up to a complete reduction of the neuronal cell death (e.g., a restoration of a normal level, or a 100% reduction of the neuronal cell death, neuronal cell death in a subject can be reduced or decreased by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 05, 96, 97, 98, 99 or 100% after administering to the subject the CHMP2B targeting agent. Additionally, the CHMP2B agent described herein (2) inhibits neuronal cell death in a subject that is at risk of presenting an increased neuronal cell death, the CHMP2B targeting agent described herein inhibit said neuronal cell death before it actually occurs in the subject. The inhibition includes any inhibition of the neuronal cell death (e.g., 1% inhibition of the otherwise expected / anticipated neuronal cell death), up to a complete inhibition of the neuronal cell death (e.g., a complete prevention of neuronal cell death, or a 100% inhibition of the neuronal cell death, neuronal cell death in a subject can be inhibited by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 05, 96, 97, 98, 99 or 100% after administering to the subject the CHMP2B targeting agent.
[0188] The term “subject” as used herein refers to any individual or patient to which the subject methods are performed. Generally, the subject is human, although as will be appreciated by those in the art, the subject may be a non-human animal. Thus, other animals, including vertebrate such as rodents (including mice, rats, hamsters and guinea pigs), cats, dogs, rabbits, farm animals including cows, horses, goats, sheep, pigs, chickens, etc., and primates (including monkeys, chimpanzees, orangutans and gorillas) are included within the definition of subject.
[0189] The methods of treating or preventing neurodegenerative disease described herein included the administration of an agent that targets CHMP2B expression for modulatingCHMP2B expression in the subject. In some aspects, targeting expression of CHMP2B includes decreasing CHMP2B expression in a cell from the subject.
[0190] In some aspects, decreasing CHMP2B expression in the cell includes decreasing or inhibiting nuclear accumulation of CHMP7 in the cell from the subject compared to nuclear accumulation of CHMP7 in a cell from a subject treated with a control agent or nuclear accumulation of CHMP7 in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
[0191] In some aspects, decreasing or inhibiting nuclear accumulation of CHMP7 in the cell from the subject includes decreasing or inhibiting Nup turnover in the cell from the subject compared to Nup turnover in a cell from a subject treated with a control agent or Nup turnover in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
[0192] In some aspects, decreasing or inhibiting Nup turnover in the cell from the subject includes decreasing or inhibiting NPC injury in a cell from the subject compared to NPC injury in a cell from a subject treated with a control agent or NPC injury in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
[0193] In some aspects, decreasing or inhibiting NPC injury includes decreasing or inhibiting TDP-43 mislocalization in the cell from the subject compared to TDP-43 mislocalization in a cell from a subject treated with a control agent or TDP-43 mislocalization in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
[0194] In some aspects, decreasing TDP-43 mislocalization includes decreasing or inhibiting TDP-43 loss of function in the cell from the subject compared to TDP-43 loss of function in a cell from a subject treated with a control agent or TDP-43 loss of function in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
[0195] In some aspects, the TDP-43 loss of function results from TDP-43 nuclear depletion, TDP-43 cytoplasmic mislocalization, TDP-43 aggregation, or a combination thereof in the cell from the subject.
[0196] In some aspects, the cell is a neuronal cell.
[0197] In some aspects, the agent targeting CHMP2B targets CHMP7-CHMP2B protein interactions. In some aspects, the agent targeting CHMP2B is anucleic acid, aprotein, apeptide or a small molecule.
[0198] In some aspects, the agent that targets expression of CHMP2B is an siRNA, an ASO, or a combination thereof. In some aspects, the ASO includes a nucleic acid sequence of SEQID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.
[0199] In some aspects, the neurodegenerative disease is Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkinson’s disease, Huntington’s chorea, mild cognitive impairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration. In some aspects, the neurodegenerative disease is Amyotrophic Lateral Sclerosis (ALS). In some aspects, the ALS is sporadic ALS.
[0200] In some aspects, treating the neurodegenerative disease further includes administering to the subject Edaravone, Riluzole, AMX0035, Tofersen, or a combination thereof.
[0201] In some aspects, administration is oral, systemic, parenteral, intrathecal, intranasal, intravenous, subcutaneous, intracerebroventricular, by inhalation, or by suppository.
[0202] As used herein the term “nuclear pore complex” or “NPC” refers to a large protein assembly embedded in the nuclear envelope that regulates the movement of molecules between the nucleus and the cytoplasm of a cell. NPCs are found in the nuclear envelope of eukaryotic cells. NPC injury may be caused by abnormally accumulation of CHMP7 in the nucleus. Disruption of the normal transport function of NPC is often implicated in neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS).
[0203] In some aspects, decreasing NPC injury includes increasing POM121 expression, POM121 turnover or a combination thereof.
[0204] As used herein the term “POM121” refers to a transmembrane nucleoporin that acts as a key component of the NPC. POM121 plays a crucial role in the assembly the NPC, particularly during interphase when the nuclear envelope reforms after cell division. POM121 anchors the NPC to the nuclear membrane by acting as a pre-pore for the complex to form around it. POM121 is a type I transmembrane protein that is essential for early stages of NPC assembly. POM121 has a very low turnover rate in live mammalian cells.
[0205] Nup turnover is the process by which nuclear pore complex (NPC) proteins, or Nups, are degraded and replaced. The rate of Nup turnover varies depending on the cell type, the Nup's role, and whether the cell is dividing. Mechanisms that affect Nup turnover include but is not limited to ESCRT-III pathway, NPC-phagy, and Proteasomal degradation.
[0206] In some aspects, administration of the agent targeting CHMP2B increases cell survival in the subject. For example, cell survival in the subject may be increased by at least0.5-10 times greater than cell survival in the subject prior to treatment or cell survival in a subject suffering from disease. Cell survival in the subject may be increased by at least 0.5 times greater than cell survival in the subject prior to treatment or cell survival in a subject suffering from disease. Cell survival in the subject may be increased by at least 1.5 times greater than cell survival in the subject prior to treatment or cell survival in a subject suffering from disease. Cell survival in the subject may be increased by at least 3 times greater than cell survival in the subject prior to treatment or cell survival in a subject suffering from disease. Cell survival in the subject may be increased by at least 5 times greater than cell survival in the subject prior to treatment or cell survival in a subject suffering from disease. Cell survival in the subject may be increased by at least 10 times greater than cell survival in the subject prior to treatment or cell survival in a subject suffering from disease.
[0207] Edaravone is used to treat patients with amyotrophic lateral sclerosis (ALS). Edaravone is a free radical scavenger that scavenges and suppresses the generation of hydroxyl radicals and peroxynitrite radicals. Edaravone may be administered intravenously and orally.
[0208] Riluzole is a neuroprotective drug that treats amyotrophic lateral sclerosis (ALS) and other motor neuron diseases. Riluzole works by blocking the release of glutamate and increasing its reuptake.
[0209] AMX0035 or Relyvrio combines two compounds, sodium phenylbutyrate and taurursodiol, to target and mitigate neurodegeneration by addressing two key cellular pathways: endoplasmic reticulum (ER) stress and mitochondrial dysfunction, which are thought to contribute significantly to neuronal cell death. The combination of these drugs aims to reduce neuronal death by alleviating stress within the ER and improving mitochondrial function.
[0210] Tofersen or Qalsody is an antisense oligoneucleotide used to treat amyotrophic lateral sclerosis (ALS). Via binding to superoxide dismutase 1 (SOD1) mRNA, tofersen causes degradation of SOD1 mRNA and reduction of SOD1 protein synthesis.
[0211] The disclosure also relates to methods of using the binding polypeptides in the diagnosis and treatment of diseases such as amyotrophic lateral sclerosis, Alzheimer's disease, motor neuron disease, Parkinson’s disease and frontotemporal lobar degeneration. Neurodegenerative diseases are characterized by selective neurodegeneration in specific regions of the brain and spinal cord. Amyotrophic Lateral Sclerosis (ALS), commonly known as "Lou Gehrig's disease", is a progressive neurodegenerative disease of unknown etiology.The disease progressively impairs an individual's ability to control voluntary muscle movement. The disease tends to progress rapidly, leading to paralysis and death within 2-5 years of diagnosis in most cases.
[0212] In this disclosure, it is demonstrated that the ESCRT-III protein CHMP2B play a central role in eliciting CHMP7 mediated NPC injury in sALS iPSNs. Specifically, CHMP2B facilitates the “activation” of CHMP7 within the nucleus thereby triggering the reduction of P0M121 at the early stages of NPC injury cascades. Interestingly, sustained CHMP2B mediated activation appears to underlie the pathologic nuclear accumulation / retention of CHMP7 observed in sALS. Critically, moderate reduction of CHMP2B protein via antisense oligonucleotide (ASO) or siRNA approaches abrogates nuclear accumulation of CHMP7, restores the nuclear localization and expression of P0M121, and alleviates TDP-43 dysfunction in sALS iPSNs. Thus, these data define a cell biological mechanism underlying CHMP7 nuclear accumulation and subsequent initiation of NPC injury in the pathogenesis of sALS. Moreover, this study highlights the potential of targeting CHMP2B itself of CHMP7 - CHMP2B protein interactions as a therapeutic strategy for sALS.
[0213] Collectively, the disclosure provides evidence of a role for CHMP2B in facilitating the activation of CHMP7 in human iPSNs to maintain NPCs via ESCRT-III mediated surveillance and homeostasis. Moreover, it was demonstrated that sustained activation of CHMP7 is sufficient to drive NPC injury in sALS. Consequently, ASO or siRNA mediated knockdown of CHMP2B mitigates pathologic reduction of P0M121 and downstream defects in TDP-43 function in sALS iPSNs. As a result, this data mechanistically implicate CHMP2B mediated activation of CHMP7 as a significant contributor to ESCRT-III NPC surveillance and maintenance in human neurons and highlight partial reduction of CHMP2B as a potential therapeutic strategy to alleviate NPC injury cascades in sALS.
[0214] Presented below are examples discussing targeting CHMP2B expression to treat ALS pathologies contemplated for the discussed applications. The following examples are provided to further illustrate the embodiments of the present invention but are not intended to limit the scope of the invention. While they are typical of those that might be used, other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.EXAMPLESEXAMPLE 1Methods
[0215] iPSC maintenance and differentiation
[0216] Control and sALS iPSC lines were obtained from the Answer ALS repository at Cedars Sinai (see Table 1 for demographics information). Based on a recent analysis of 180 iPSC lines, patient iPSC lines with similar patterns of molecular hallmarks of TDP-43 loss of function were selected for this study. iPSCs were maintained in mTeSR Plus media as previously described. Mixed spinal neuron cultures were generated using a recently described modified direct induced motor neuron (diMNs) differentiation protocol. All iPSC and iPSN cultures were maintained at 37 °C with 5% CO2 and routinely tested negative for mycoplasma.
[0217] Table 1: Demographic Information for iPSC Lines
[0218] ASO Treatment of iPSNs
[0219] Previously described non-targeting scrambled control and human CHMP7 targeting ASOs were provided. Human CHMP2B targeting ASOs were independently designed and synthesized by IDT. All ASOs are gapmers and contain phosphorothioate bonds and are 2’-O- mthoxyethyl (2’MOE) modified. ASO sequences are provided in Table 2. CHMP2B ASO 3 was used for all iPSN experiments throughout this manuscript. ASO dosing (5 pM) was initiated at the time points indicated in figure descriptions. Media was exchanged and ASO replenished every 3-4 days for the duration of the experiment.
[0220] Table 2: ASO Sequences
[0221] siRNA mediated Knockdown in iPSNs
[0222] Dharmacon ON-TARGETplus SMARTPool CHMP2B and non-targeting (NT) SMARTPool siRNAs were delivered to iPSNs using the Lonza 4D nucleofection system. At time point indicated in figure descriptions, iPSNs were nucleofected with 500 nM siRNA in suspension using the Lonza P3 Primary Cell 4D Nucleofector Kit and program DC- 104. Following nucleofection, iPSNs were replated and media was exchanged the following day and every 3-4 days thereafter for the duration of the experiment and as indicated in figure legends.
[0223] CHMP2B knockdown was initiated at day 15 of differentiation (the time point where nuclear localization of CHMP7 begins to increase in sALS iPSNs).
[0224] Knockdown was initiated at day 60 of differentiation following the emergence of NPC injury and TDP-43 loss of function and mislocalization in control and sALS iPSNs.
[0225] Plasmid expression in iPSNs
[0226] CHMP7 and POM121 RITE plasmids and sources are detailed in Table 3. Flag tagged CHMP7 Open, CHMP7 AHelix 6, and CHMP7 NES1* / NES2* plasmids were synthesized by Genscript. Gene sequences were cloned into the pcDNA3.1 plasmid backbone using the BamHI and Xhol restriction sites. CHMP7 Open was generated by removing the last 84 amino acids, truncating CHMP7 at amino acid 369. CHMP7 Ahelix6 was generated by removing amino acids 420-430. CHMP7 NES1* / NES2* was generated by making L to A amino acid substitutions at amino acids 388 and 430 within the CHMP7 NESI and NES2 sequences respectively. At the time points indicated in figure legends, iPSNs were dissociated with accutase to generate a single cell suspension as previously described. Plasmid DNA was delivered to iPSNs in suspension using the P3 Primary Cell 4D Nucleofector Kit and program DC- 104 on the 4D Nucleofector. Cuvettes contained 4 x 10A6 iPSNs and 4 pg plasmid DNA. Following nucleofection, iPSNs were replated. Media was exchanged 24 h later and every 3-4 days thereafter for the duration of the experiment. For the experiments utilizing Flag tagged CHMP7 plasmids, at every media change, iPSNs were treated with neomycin for 24 h to enrich for iPSNs expressing plasmid DNA of interest.
[0227] Table 3: Plasmid Information
[0228] Immunostaining and confocal imaging in iPSNs
[0229] To facilitate monolayer based imaging, iPSNs were replated in glass bottom imaging plate 10 days prior to fixation in accordance with a recently described protocol. At time points indicated in figure descriptions, iPSNs were fixed with 4% paraformaldehyde (PF A) in IX PBS for 15 min at room temperature. iPSNs were subsequently washed 3 x 10 min with IX PBS at room temperature and permeabilized with IX PBS containing 0.01% Triton X-100 for 15 min at room temperature. Blocking was then carried out by incubating iPSNs in a 10% goat serum / lX PBS solution for 30 min at room temperature. iPSNs were then incubated with primary antibodies (see Table 4) diluted in block solution for 2 h at room temperature. Following incubation with primary antibodies, iPSNs were washed 3 x 10 min with IX PBS and then incubated with secondary antibodies (see Table 4) diluted in block solution for 45 min at room temperature. iPSNs were then washed IX with IX PBS, incubated with Hoechst solution (1 : 1000 in IX PBS) for 10 min at room temperature, and finally washed with IX PBS for 10 min. Rotation was not used at any step. Addition and removal of all solutions was conducted manually with a P1000 pipette to prevent lifting of iPSNs from the dish. iPSNs were mounted using Prolong Gold Antifade Reagent and sandwiched with a 15 mm glass coverslip to facilitate imaging and storage. Confocal imaging was carried out using a 20X or 63X objective on a Zeiss LSM 980 with AiryScan 2 confocal microscope. Standard frame scanning confocal imaging parameters were used for image acquisition. All images were acquired using identical imaging parameters for each immunostained protein within a given experiment. Nuclear, cytoplasmic, and whole cell intensities were measured in FIJI. Regions of interest were manually outlined using DAPI and Map2 to define nuclear and cell body compartments respectively as has been previously described. Integrated density was then measured in the channel of interest based on defined regions of interest. Corrected total cell fluorescence (CTCF) measurements for the nucleus and cell body were calculated as follows: CTCF = integrated density - (area of region of interest x mean fluorescence background reading).Cytoplasmic CTCFs were calculated by subtracting nuclear CTCF from cell body CTCF. Nuclear / cytoplasmic ratios were calculated as previously described. Genotypes and treatment were blinded for imaging and analysis. All images are presented as maximum intensity projections generated with Zeiss Zen Blue 2.3 software.
[0230] Table 4: Antibody Information
[0231] RITE and AiryScan imaging
[0232] POM121 RITE plasmids were expressed in iPSNs as described above. POM121 RITE plasmids were expressed starting at day 15 of differentiation. Scrambled control or CHMP2B targeting ASO treatment was initiated at day 19 of differentiation. 4-OHT treatment was initiated at day 22 of differentiation. To allow for full incorporation into the NPC, tag exchange was induced one week following nucleofection by adding 4-hydroxytamoxifen (4-OHT) directly to media to a final concentration of 1 pM. Media was exchanged and 4-OHT replenished every 3-4 days for 1-2 weeks. At time points indicated in figure legends, iPSNs were fixed and immunostained as detailed above. AiryScan imaging was carried out using the AiryScan 2 super resolution module on a Zeiss LSM 980 confocal microscope. All images were acquired with a 63X objective and 3X digital zoom. Identical imaging parameters (e.g. laser power, gain) were used to acquire all images.
[0233] The number of Myc and Flag tagged POM121 spots were calculated using automated analysis pipelines where regions of interest are defined by DAPI masks in FIJI that have been previously described. Double counting was avoiding by analyzing each tag individually and then analyzing a colocalized image. The number of colocalized Myc / Flag spots was subtracted from the total of each individual count. Percentages of “old” (Myc), “new” (Flag), or “mixed” (Myc / Flag) POM121 spots were calculated by dividing by the total number of spots detected. Genotypes, treatment, and time points were blinded for imaging and analysis.
[0234] Immunofluorescent staining and imaging of postmortem human tissue
[0235] Formalin fixed parafin embedded postmortem motor and occipital cortex tissue slides were obtained from the Target ALS Human Postmortem Tissue Core. Demographic information for non-neurological control and sALS patient tissues can be found in FIG. 8A- 8D. Deparaffhization was carried out by immersing slides 3 x 5 min in xylene followed by gradual rehydration of tissue sections by immersing in a series of washes for 5 min each: 2 x 100% ethanol, 1 x 90% ethanol, 1 x 70% ethanol, 3X dH2O. Antigen retrieval was carried out by incubating slides in Tissue-Tek antigen retrieval solution (IHC world) in a steamer for 1 h. Following 10 min cooling at room temperature, slides were washed 3 x 5 min with dH2O and then 2 x 5 min with IX PBS. Tissue sections were permeabilized using a 0.4% Triton-X solution (in IX PBS) for 10 min on a shaker and then washed 3 x 5 min with IX PBS. Slides were blocked overnight at 4 °C in DAKO protein-free serum block (DAKO) and then incubated with primary antibody (see Table 4 for antibody information) diluted in DAKO antibody diluent reagent with background reducing agents (DAKO) for 48 h at 4 °C. Tissue sections were then washed 3 x 5 min with IX PBS and incubated with secondary antibody (see Table 4 for antibody information) diluted in DAKO antibody diluent reagent with background reducing agents (DAKO) for 1 h at room temperature. Slides were washed 3 x 5 min with IX PBS, incubated with 2-3 drops of autofluorescence eliminator reagent (Millipore) for 10 s and washed 5 x 5 min with IX PBS. Tissue sections were then incubated with Hoechst solution (1:1000 in IX PBS) for 20 min and then subsequently washed 3 x 5 min with IX PBS. The final PBS wash was exchanged for dH2O and then slides were cover slipped using Prolong Gold Antifade Reagent. Imaging of Map2 positive Layer V neurons was carried out with a 20X objective on a Zeiss Axioimager Z2 fluorescent microscope with an Apotome2. Identical imaging parameters (e.g. exposure time) were used for all images and 10 images were acquired per slide. Zeiss Zen Blue 2.3 was used to generate default apotome processed images.
[0236] Proximity ligation assay (PLA)
[0237] iPSNs: At time points indicated in figure and legends, iPSNs were rinsed 2X with IX PBS and fixed in 4% PFA (in IX PBS) for 15 min. Fixed iPSNs were then washed 3 x 5 min with IX PBS and permeabilized with 0.01% PBST (IX PBS containing 0.01% Triton X-100) for 15 min at room temperature. Proximity ligation was then carried out in accordance with the Duolink PLA Fluorescence protocol (Sigma Aldrich). Briefly, iPSNs were blocked with Duolink Blocking solution in a humidified 37 °C incubator for 1 h and then incubated with primary antibodies (CHMP2B and CHMP7, see Table 4) diluted in IX Duolink AntibodyDiluent for 2 h at room temperature. iPSNs were washed 2 x 5 min with IX Wash Buffer A at room temperature and then incubated with Duolink Anti-Rabbit PLUS and Duolink AntiMouse MINUS probes in IX Duolink Antibody Diluent (80 pL total solution per well of a Cellvis 24 well glass bottom plate) in a humidified 37 °C incubator for 1 h. Following probe incubation, iPSNs were washed 2 x 5 min with IX Wash Buffer A at room temperature and ligation was then carried out by incubation with Ligase diluted 1:40 in IX Ligation buffer (80 pL total solution per well of a Cellvis 24 well glass bottom plate) in a humidified 37 °C incubator for 30 min. iPSNs were washed 2 x 5 min with IX Wash Buffer A at room temperature and amplification was performed by incubating with Polymerase diluted 1:80 in IX Amplification buffer (80 pL total solution per well of a Cellvis 24 well glass bottom plate) in the dark in a humidified 37 °C incubator for 100 min. Following amplification, iPSNs were washed 2 x 10 min with IX Wash Buffer B and 1 x 1 min with 0.0 IX Wash Buffer B at room temperature. One to two drops of Duolink In Situ Mounting Medium with DAPI was added to each well and coverslips were used to seal each well of the plate. All buffers were made fresh prior to use. Confocal imaging was performed using a 63X objective on a Zeiss LSM 980 with AiryScan 2 confocal microscope. Identical imaging parameters (e.g. laser power, gain) were used for all samples. Individual PLA signals within nuclei were counted using automated spot detection in regions of interest defined by DAPI masks on maximum intensity projections in FIJI. Genotypes and time point were blinded for imaging and analysis. Postmortem Human Tissue: Postmortem human tissue slides were subjected to deparaffinization, antigen retrieval, washing, and permeabilization as detailed above. Tissue sections were blocked with Duolink Blocking solution for 1 h at 37 °C in a humidified chamber and incubated with primary antibody (CHMP7 and CHMP2B; see Table 4) diluted in Duolink Antibody Diluent for 48 h at 4 °C. Proximity ligation was then carried out as described above for iPSNs. Following the final wash with 0.01X Wash Buffer B, slides were incubated with autofluorescence eliminator reagent for 10 s and extensively washed with IX PBS (5 x 5 min) prior to cover slipping with Duolink In Situ Mounting Medium with DAPI. Cover slips were sealed with nail polish and tissue sections imaged using a 63X objective on a Zeiss Axioimager Z2 fluorescent microscope with an Apotome2. Layer V was identified based on DAPI and 10-20 images were obtained for each slide. Identical imaging parameters (e.g. exposure time) were used for all images and slides. Zeiss Zen Blue 2.3 was used to generate default apotome processed images used for analysis. Individual PLA signals within nuclei were counted using automated spot detection inregions of interest define by DAPI masks in FIJI. Genotypes and brain region were blinded for imaging and analysis.
[0238] Digitonin permeabilized iPSN assays
[0239] Digitonin permeabilized iPSN assays were performed as recently described. iPSNs were first rinsed with IX PBS and then permeabilized in permeabilization buffer (10% OptiPrep, 200 pg / mL digitonin) on ice for 5 min. iPSNs were then rinsed briefly with ice cold transport buffer (4 mM HEPES-KOH pH 7.5, 22 mM KOAc, 0.4 mM Mg(OAc)2, 1 mM NaOAc, 0.1 mM EGTA, 50 mM sucrose) and then washed 3 x 5 min with ice cold transport buffer. Permeabilized and washed iPSNs were then incubated with 0.6 mg / mL fluorescent 70 kDa dextran at room temperature for 25 min protected from light. One drop of NucBlue Live Ready Probes (Thermo Fisher Scientific) was added to each well during incubation.
[0240] iPSNs were imaged immediately following incubation with a Zeiss LSM 930 with Airy Scan 2 confocal microscope. A 40X objective and standard line scanning confocal parameters were used to acquire single z section images. Plates were discarded after 15 min. FIJI was used to determine the nuclear intensity of fluorescent 70 kDa dextran. Genotypes and treatment were blinded for imaging and analysis.
[0241] Western blot
[0242] To generate iPSN lysates, at time points indicated in figure legends, iPSNs were rinsed with pre-chilled IX PBS. RIPA buffer (Sigma Aldrich) supplemented with IX EDTA free protease inhibitor cocktail (Roche) was added directly to the wells of the culture plate and iPSNs were incubated on ice for 5 min. Lysates were then collected by scraping with a cell scraper, transferred to an Eppendorf tube, and vortexed vigorously for 30 s to facilitate complete iPSN lysis. Lysates were cleared of debris via centrifugation at 12,000 g for 15 min at 4 °C. Supernatants were transferred to anew Eppendorf tube and protein concentrations were determined using a BCA protein estimation kit. 4X Laemmli buffer supplemented with f>- mercaptoethanol was added to each sample to a final concentration of IX. To obtain nuclear lysates, nuclei were first isolated from iPSNs using the Nuclei PURE Prep Nuclei Isolation Kit as previously described. Isolated nuclei were then lysed and lysates prepared as described above. Immediately prior to SDS-PAGE, sampled were heated at 100 °C for 5 min and cooled to room temperature. 10 pg of protein was loaded in 4-20% acrylamide gels. Gels were run until the dye front ran off and protein was transferred onto a nitrocellulose membrane with the Trans-Blot Turbo Transfer System. Membranes were blocked with 5% nonfat milk in IX TBST(IX TBS with 0.1% Tween-20) for 30 min on a shaker at room temperature. Blots were incubated overnight on a shaker at 4 °C with primary antibody diluted in block solution (see Table 4 for antibody information). Following primary antibody incubation, blots were washed 3 x 10 min with IX TBST and incubated with secondary antibody diluted in block (see Table 4 for antibody information) on a shaker for 1 h at room temperature. Blots were then washed 3 x 10 min with IX TBST. ECL substrate was applied for 30 s, and chemiluminescent images were acquired with the ImageQuant LAS 4000 system. To allow for sequential probing of blots without stripping, chemiluminescent signals were quenched by incubating membranes in 30% H2O2 for 15 min on a shaker at room temperature. Analysis of signal density was carried out in FIJI. GAPDH was used as a loading control for normalization.
[0243] qRT-PCR
[0244] At time points indicated in figure legends, iPSNs were incubated with 1 mL Trizol in wells of the culture plate for 5 min at room temperature. Solutions were then transferred to an Eppendorf tube and Trizol based RNA isolation then proceeded in accordance with manufacturer protocol. cDNA synthesis was carried out using the High-Capacity cDNA Reverse Transcription Kit. 1 pg of RNA was used for each reaction. All qRT-qPCR reactions were conducted using SYBR Green Master Mix or TaqMan Gene Expression Master Mix and an Applied Biosystems QuantStudio 3. Previously described primer sets (see Table 5) were used to detect truncated STMN2 and cryptic exon containing mRNA transcripts. TaqMan Gene Expression Assays (see Table 5) were used to detect mRNA targets. GAPDH was used for normalization of gene expression.
[0245] Table 5: Primer Sequences and TaqMan Probe IDs for qRT-PCR
[0246] In vitro binding
[0247] For each reaction, 2 pg CHMP7 His, CHMP2B GST, CHMP7 GST, CHMP2B His, GST, and His were added to 50 pL binding buffer (50 mM Tris pH 7.4, 150 mM NaCl, 2 mM MgC12, 2 mM CaC12, 10% glycerol, 0.5% NP-40, 1 mM DTT, IX EDTA free protease inhibitor cocktail). For reactions where multiple recombinant proteins were added, proteins were added in a 1 : 1 ratio (2 pg each) and total reaction volume remained the same. Bindingreactions were incubated at 4 °C with end-over-end rotation for 2 h. About 1.5 h into the reaction incubation, magnetic GST or His beads were washed 3 * 10 min with binding buffer. Binding buffer wash was removed, and appropriate binding reactions were added to washed beads. Reactions were then incubated at 4 °C with end-over-end rotation for an additional 1 h. Following incubation, 25 pL supernatant was collected as the unbound fraction and added to 25 pL 2X Laemmli buffer.
[0248] Remaining supernatant was discarded and protein - bead complexes were washed with binding buffer 3 x 5 min at 4 °C with end-over-end rotation. Washes were discarded and beads were resuspending in 50 pL IX Laemmli buffer. 20 uL of each sample was subjected to SDS-PAGE using 4-20% acrylamide gels. Gels were run at a constant 150 V for approximately 45 min until the dye front reached the end of the gel. Following electrophoresis, gels were washed 3 x 5 min with ddH2O and then incubated with SimplyBlue SafeStain for 1 h at room temperature with gentle rocking.
[0249] SimplyBlue-stained gels were washed 3 x 1 h with ddH2O and protein bands were imaged with the ImageQuant LAS 4000 system.
[0250] Statistical analyses
[0251] Experimenters were blinded to iPSC line genotype, treatment condition, and time point throughout the duration of the experiment. All data analysis was carried out using FIJI version 2.3.0 / 1.53q and was completely automated based on automated spot counting and mask-based region of interest definition using DAPI and / or Map2 signals. In cases where regions of interest were manually defined, the experimenter remained blinded to genotype, treatment, and time point information to eliminate bias when defining regions of interest in the DAPI and / or Map2 channels. No data points were excluded from analysis in this study. All statistical analyses were performed using GraphPad Prism version 9 and 10 (GraphPad). Statistical analyses were performed as previously described where the average of individual cells or nuclei per iPSC line and treatment condition was calculated to represent n = 1. Total n’s (iPSC lines and cells per iPSC lines) are reported in figure legends. Student’s t-test, Oneway ANOVA with Tukey’s multiple comparison test, Two-way ANOVA with Tukey’s multiple comparison test, Student’s t-test, or Fisher’s exact test was used as described in figure legends. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Superplots were used to detail the full spread of variability of large data sets and indicate iPSC line averages (displayed individual data points) used for statistical analyses. Within each violin plot, the center dottedline indicates the median value of all data points within the larger individual cell based data set and the two additional dotted lines indicate the 25th and 75th percentiles. Bar graphs were used to display individual data points with error bars representing + / - SEM from bulk data where individual cell or nuclei quantifications were not performed (e.g. western blot, qRT-PCR).EXAMPLE 2CHMP7 / ESCRT-III mediated Nup turnover is over-active in sALS iPSNs
[0252] CHMP7 / ESCRT-III mediated Nup turnover is over-active in sALS iPSNs Prior studies using bulk mass spec-based analyses have demonstrated that many, but not all, Nup proteins long lived within the CNS. Thus, it is thought that entire new NPCs are not inserted into the nuclear envelope following initial assembly in non-dividing neurons. However, the NPC is a highly organized octet structure comprised of multiple copies of individual Nup protein molecules which display differing residence times within NPCs. Thus, within a given NPC, it is likely that individual molecules of each Nup protein are turned over at varying rates in order to maintain NPC homeostasis. Indeed, recent evidence has demonstrated that Nup96, Nup93, Nupl33, and POM121 Nup molecules are turned over within myoblast and myotube NPCs are varying rates with many NPCs containing new and old Nup molecules within 1-2 weeks. Among many cellular functions, the ESCRT-III pathway plays a fundamental role in maintaining nuclear envelope and NPC homeostasis. To ensure nuclear envelope sealing and proper insertion and assembly of NPCs during cell division, the ESCRT-III protein CHMP7 passively translocates from the cytoplasm to the nucleus where it engages in specific proteinprotein interactions to initiate its “activation” and the subsequent recruitment and polymerization of additional ESCRT-III proteins. Ultimately, this results in removal of improperly assembled NPCs and / or sealing of the nuclear envelope. In addition, recent studies have proposed a role for ESCRT-III proteins in the piecemeal turnover of individual Nups within existing NPCs in non-dividing non-neuronal cells. Thus, these data support a fundamental role for the ESCRT-III pathway in the maintenance of NPCs throughout the lifetime of cells. However, whether the CHMP7 / ESCRT-III nuclear surveillance pathway plays a role in maintenance of NPCs throughout the lifetime of human neurons remains unknown.
[0253] It has previously been shown that NPC injury cascades begin with the reduction of POM121 from ALS neuronal NPCs. Thus, preservation of POM121 within NPCs of human neurons is critical for maintenance of NPC composition and function to prevent or reverse downstream pathophysiologic events. Given the prior demonstration that the nuclearaccumulation of CHMP7 is sufficient to drive aberrant and pathologic reduction of specific Nups from the neuronal NPC, described herein is whether the CHMP7 / ESCRT-III nuclear surveillance pathway may be overactive in sALS thereby facilitating aberrant Nup molecule / protein turnover to give rise to this documented NPC injury. Recombination Induced Tag Exchange (RITE) technology was utilized to monitor new and old POM121 expression within control and sALS. Upon initial expression of a previously detailed POM121 RITE plasmid, exogenous POM121 can be visualized with antibodies against a Myc tag. Following addition of 4-hy dr oxy tamoxifen (4-OHT) to induce tag replacement via the loxP-Cre recombinase system, newly synthesized POM121 molecules can be visualized with antibodies against a Flag tag. Thus, old POM121 proteins will be labeled with Myc and new POM121 proteins will be labeled with Flag. When combined with Airyscan imaging which provides increased imaging resolution necessary to visualize individual NPC spots, this methodology affords the opportunity to examine POM121 protein turnover within iPSN NPCs, albeit not at the resolution of individual Nup molecules within NPCs. NPCs in control iPSNs exclusively contained “old” POM121 protein until 2 weeks post tag-exchange induction, at which point NPCs were predominantly composed of a mixture of “new” and “old” POM121 proteins (FIG. 1A-1D; n = 6 control and 6 sALS iPSC lines, 50 iPSNs per line / treatment. Fisher’s exact was used to calculate statistical significance. **** p < 0.0001. Scale bar = 5 pm). These data suggest that a substantial number of POM121 molecules per NPC are likely exchanged at a rate of about every 2 weeks in cultured iPSNs. In contrast, by 1 week post tag-exchange induction, sALS NPCs were comprised almost exclusively of “new” POM121 protein (FIG. 1A-1D). These data suggest that POM121 protein replenishment occurs much more frequently in sALS iPSN NPCs. Consistent with a prior publication detailing a pathological reduction of POM121 in sALS iPSNs, by 2 weeks post-tag exchange induction, even “new” POM121 protein appeared to be partially depleted from sALS iPSNs (FIG. 1A-1D).
[0254] To examine whether the CHMP7 / ESCRT-III nuclear surveillance pathway functioned in the fundamental tumover / replenishment of POM121 protein in iPSNs, antisense oligonucleotides (ASOs) were employed to reduce CHMP7 and examined “new” vs “old’ POM121 protein in iPSN NPCs by Airyscan microscopy. ASO mediated knockdown of CHMP7 was sufficient to prevent the incorporation of “new” POM121, thereby retaining “old” POM121 within NPCs and slowing POM121 turnover in control iPSNs (FIG. 1A-1D). In addition, reduction of CHMP7 resulted in a partial retention of “old” POM121 one weekfollowing induction of tag-exchange in sALS iPSNs (FIG. 1A-1D) indicative of slowed P0M121 turnover. This mixed expression of “old” and “new” P0M121 within sALS iPSN NPCs was maintained 2 weeks post induction of tag-exchange (FIG. 1A-1D). Thus, pathologic CHMP7 / ESCRT-III mediated reduction of P0M121 was prevented consistent with a prior report that knockdown of CHMP7 could restore the localization and expression of P0M121 within ALS NPCs. Together, these data suggest that the fundamental function of the CHMP7 / ESCRT-III nuclear surveillance pathway in facilitating piecemeal Nup turnover within neuronal NPCs is “overactive” in sALS thereby giving rise to pathologic Nup reduction.EXAMPLE 3CHMP2B promotes the nuclear retention of CHMP7 in sALS iPSNs
[0255] Typically, individual ESCRT-III proteins do not function in isolation. Instead, they function as a unit with other pathway constituents. It has previously been demonstrated that the nuclear expression and localization of two of the more well studied ESCRT-III proteins CHMP2B and CHMP4B are not pathologically altered in sALS. However, given the basal nuclear distribution of ESCRT-III proteins in iPSNs, it was hypothesized that perhaps they could be functionally relevant for disease associated alterations in CHMP7 / ESCRT-III mediated nuclear surveillance pathway pathology and function. For this present study, the role of CHMP2B has been focused on given that mutations in CHMP2B have been implicated in Frontotemporal Dementia (FTD) and a lower motor neuron predominant form of ALS. Given the data that CHMP7 dependent Nup turnover is “over-active” in sALS iPSNs (FIG. 1A-1D) and CHMP7 is abnormal accumulated within sALS nuclei, it was first tested whether CHMP2B was functionally implicated in eliciting CHMP7 pathology in sALS. To do this, 2 independent strategies, siRNA (FIG. 2A-2B; GAPDH was used for normalization, n = 3 control iPSC lines. Student’s t-test was used to calculate statistical significance. ** p < 0.01.) and antisense oligonucleotides (FIG. 3A-3D; GAPDH was used for normalization, n = 3 control iPSC lines. One-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. ** p < 0.01, *** p < 0.001, **** p < 0.0001.) to knockdown human CHMP2B in iPSNs were used. In addition, two treatment paradigms (FIG. 2A-2B) were utilized. The first is a “preventative treatment” paradigm where knockdown was initiated prior to the emergence of nuclear accumulation of CHMP7 (FIG. 4A) to facilitate an analysis of the function of CHMP2B in promoting CHMP7 pathology in sALS. The second is a “reparative treatment” where knockdown was initiated following the emergence of multiple NPC injury associatedevents (FIG. 4B) to mimic a clinically relevant scenario where patients received treatment following symptom onset. Immunostaining and confocal imaging for CHMP7 demonstrated that 3 weeks of sustained - 50% reduction of endogenous CHMP2B (FIG. 2A-2B and FIG. 3A-3D; GAPDH was used for normalization, n = 3 control iPSC lines. Two-way ANOVA with Tukey ’s multiple comparison test was used to calculate statistical significance. CHMP2B ASO 3 significance compared to scrambled control as indicated on top, CHMP2B ASO 4 significance compared to scrambled control as indicated on bottom ** p < 0.01, *** p < 0.001, **** p <0.0001.) was sufficient to both prevent and reverse the pathologic nuclear accumulation of CHMP7 in sALS iPSNs (FIG. 5A-5H; n = 5 control and 8 sALS iPSC lines, 100 Map2 + cells per line / knockdown. Two-way ANOVA with Tukey ’s multiple comparison test was used to calculate statistical significance. **** p < 0.0001, see FIG. 6A-6D for high magnification images). There was no difference in the magnitude of prevention with either siRNA or ASO (FIG. 5A-5H). Described herein is that CHMP2B plays a critical role in promoting the aberrant nuclear accumulation / retention of CHMP7 observed in sALS.EXAMPLE 4 Knockdown of CHMP2B alleviates NPC injury cascades in sALS iPSNs
[0256] It has recently been shown that nuclear accumulation of CHMP7 can trigger the reduction of specific Nups from the nucleus in ALS iPSNs. Given that reduction of CHMP2B alleviates nuclear accumulation of CHMP7 in sALS iPSNs (FIG. 5A-5H, FIG. 6A-6D), next whether knockdown of CHMP2B was sufficient to alleviate NPC injury in sALS was investigated. Similar to a recent study, POM121 was elected to be use as an indicator of NPC injury as have previously been demonstrated that reduction of POM121 is one of the earliest pathological events within the NPC itself in ALS iPSNs. Immunostaining and confocal imaging for POM121 demonstrated that reduction of CHMP2B by either ASO or siRNA significantly increased nuclear POM121 immunoreactivity in sALS iPSNs to levels observed in control iPSNs (FIG. 7A-7H; n = 5 control and 8 sALS iPSC lines, 100 Map2 + cells per line / knockdown. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. **** p < 0.0001, see FIG. 8A-8D for high magnification images). Nuclei isolation and Western blotting supported this imaging-based observation (FIG. 9A-9F; n = 5 control and 8 sALS iPSC lines. Tukey’s multiple comparison test was used to calculate statistical significance. **** p < 0.0001. ). Importantly, this restorative effect was observed using both preventative and reparative siRNA and ASO treatment paradigms (FIG.7A-7H, FIG. 8A-8D and FIG. 9A-9F). Next, P0M121 RITE plasmid was utilized to examine the impact of reduced CHMP2B expression on the turnover of P0M121 in sALS iPSN nuclei and NPCs. Airyscan imaging revealed a significant decrease in the incorporation of “new” P0M121 within both control and sALS iPSN nuclei post induction of tag exchange (FIG. 10A- 10C; n = 6 control and 6 sALS iPSC lines, 50 iPSNs per line / treatment. Fisher’s exact was used to calculate statistical significance. **** p < 0.0001. Scale bar = 5 pm.). Interestingly, this sustainment of “old” POM121 expression appeared to be stronger than the effect of CHMP7 knockdown (FIG. 1A-1D and FIG. 10A-10C) suggesting that CHMP2B may function upstream of CHMP7 in ESCRT-III mediated Nup turnover in human neurons. Taken together, these data functionally implicate CHMP2B in the initiation of overactive Nup turnover and ESCRT-III / CHMP7 mediated NPC injuiy in sALS.
[0257] In neurodegenerative diseases such as ALS, studies in autopsy tissues have documented an altered nucleocytoplasmic distribution of the RNA binding protein TDP-43. While typically primarily localized to the nucleus, in disease, TDP-43 becomes mislocalized to the cytoplasm where in a small subset of cells it can subsequently assemble into cytoplasmic aggregated. Although detectable in the vast majority of ALS autopsies, the extent to which the subcellular distribution of TDP-43 is altered in individual neurons is extremely variable. Nonetheless, the varying degrees of nuclear depletion are thought to induce a nuclear loss of TDP-43 function that results in detectable and quantifiable alterations in gene expression as well as inclusion of cryptic exons within mRNAs which is one hallmark of alterations in splicing. It has recently been demonstrated that although these molecular signatures of TDP- 43 dysfunction are variable, they are detectable amongst individual sALS patient iPSNs. Moreover, it has been demonstrated that CHMP7 mediated NPC injury is a significant contributor to TDP-43 dysfunction in ALS iPSNs. As a result, a subset of 14 gene expression and mRNA splicing alterations previously established to occur following artificial TDP-43 depletion in human neurons were selected to monitor “TDP-43 function” via qRT-PCR following CHMP2B reduction in sALS iPSNs. In doing so, it was found that both siRNA and ASO mediated reduction of CHMP2B significantly prevented the TDP-43 loss of function events (FIG. 11A-11S; n = 5 control and 8 sALS iPSC lines, 100 Map2+ cells per line / knockdown. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. * p < 0.05, ** p < 0.01, *** p <0.001. Scale bar = 5 pm; and FIG. 12A-12N) and restored TDP-43 function in sALS iPSNs (FIG. 13A-13S; n = 5 controland 8 sALS iPSC lines, 100 Map2+ cells per line / knockdown. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. * p <0.05, ** p <0.01, *** p < 0.001. Scale bar = 5 pm; and FIG.14A-14N). ASO treatment was initiated at day 15 of differentiation (the time point where nuclear localization of CHMP7 begins to increase in sALS iPSNs). Importantly, knockdown of CHMP2B had no impact on the expression of 2 mRNAs, ACTIN and POM121 that are not thought to be regulated by TDP-43 (FIG. 11A-11S - FIG.14O-14P). Consistent with a prevention of TDP-43 loss of function or restoration of TDP-43 function, both siRNA and ASO mediated CHMP2B reduction also prevented and reversed the subtle TDP-43 mislocalization observed in sALS iPSNs (FIG. 11A-11S - FIG.14Q-14S). Thus, in aggregate, these data highlight CHMP2B as a potent mediator of CHMP7 mediated NPC injury cascades in sALS.EXAMPLE 5Knockdown of CHMP2B mitigates glutamate induced neuronal death in sALS iPSNs
[0258] Having established that partial reduction of CHMP2B could protect against and reverse multiple pathophysiologic events in NPC injury cascades in sALS iPSNs (FIG. SASH, FIG. 7A-7H, FIG. 6A-6D, FIG. 8A-8D, FIG. 9A-9F, FIG. 11A-11S, FIG. 12A-12S, FIG. 13A-13S, and FIG. 14A-14S; n = 5 control and 8 sALS iPSC lines. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. ** p < 0.01, **** p <0.0001), it was next asked whether knockdown of CHMP2B was sufficient to increase neuronal survival. Consistent with prior publications, there was no detection of basal levels of cell death in the sALS iPSN cultures (FIG. 15A-15D; ASO treatment was initiated at day 60 of differentiation following the emergence of NPC injury and TDP-43 loss of function and mislocalization. PBS was used for normalization. Triton X-100 was used as a positive control to induce neuronal death. , FIG. 16A-16D; n = 5 control and 8 sALS iPSC lines. Data points represent the average cell death across 10 images per well for each line / ASO. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. **** p < 0.0001). ASO treatment was initiated at day 15 of differentiation (the time point where nuclear localization of CHMP7 begins to increase in sALS iPSNs). PBS was used for normalization. Triton X-100 was used as a positive control to induce neuronal death. However, as it has previously been demonstrated, sALS iPSNs were sensitive to glutamate induced cell death as assessed by independent measures of cell death: Alamar Blue cell viability (FIG. 15A- 15D; n = 5 control and 8 sALS iPSC lines. Data points represent the average percent viabilityfrom 3 technical replicate wells for each line / siRNA. Two-way ANOVA with Tukey ’s multiple comparison test was used to calculate statistical significance. *** p < 0.001, **** p < 0.0001) and propidium iodide uptake (FIG. 16A-16D). This phenomenon was both prevented and reversed by treatment with CHMP2B targeting siRNAs and ASOs (FIG. 15A-15D, FIG. 16A- 16D). Importantly, partial reduction of CHMP2B was not overtly toxic to control iPSNs and had no negative impact on neuronal survival in the absence of glutamate induced cell death (FIG. 15A-15D, FIG. 16A-16D). Together, these data support a protective role for partial reduction of CHMP2B in sALS iPSNs.EXAMPLE 6CHMP7 and CHMP2B persistently associate in close proximity in sALS iPSN nuclei
[0259] ESCRT-III proteins often interact in multi-protein complexes to facilitate polymerization and function. In order to determine whether CHMP7 and CHMP2B interacted in close spatial proximity within sALS iPSN nuclei, proximity ligation assays (PLA) was performed. PLA is a specific and sensitive method enabling the detection of protein - protein interactions in an intact cellular environment. Briefly, hybridized connector oligonucleotides and ligase will join PLA probes (bound to secondary antibodies) to generate a closed DNA circle for amplification when two proteins of interest (detected by specific primary antibodies) are in close proximity to each other. Thus, each discrete PLA spot represents two proteins localized within ~ 40 nm of each other. Using this methodology, a significant increase in the number of CHMP2B - CHMP7 PLA spots in sALS iPSNs at day 25 that was sustained at day 32 compared to control iPSNs was observed (FIG. 17A, 17C-17D; n = 5 control and 8 sALS iPSC lines, 100 nuclei per line / timepoint. Student’s t-test was used to calculate statistical significance. * p < 0.05, **** p < 0.0001). Interestingly, despite the predominant nuclear localization of CHMP7 in sALS iPSNs at day 18 (FIG. 18A), few nuclear PLA signals were detected (FIG. 176A-17B). This is consistent with the time dependent emergence of pathologic CHMP7 / ESCRT-III mediated POM121 reduction in ALS (FIG. 1A-1D and FIG. 10A-10C). An increased number of CHMP2B - CHMP7 PLA spots were also detected in postmortem sALS patient motor cortex, but not occipital cortex, which is unaffected in disease, compared to controls (FIG. 17E-17G). Consistent with a prior study, no alteration in CHMP2B subcellular distribution in sALS iPSNs or postmortem patient tissues was observed (FIG. 18B). Nonetheless, these data provide evidence for an increased and sustained association between CHMP2B and CHMP7 within sALS patient nuclei in disease. Using in vitro binding assays, itwas demonstrated that CHMP2B and CHMP7 recombinant proteins have the capacity to directly bind (FIG. 19A-19B). Although the PLA experiments cannot distinguish between directly bound proteins and those in close proximity in multi-protein complexes, this data suggest that CHMP2B and CHMP7 are, at minimum, in close proximity in ALS nuclei (FIG. 17E-17G) with the potential to directly bind (FIG. 19A-19B).EXAMPLE 7CHMP2B facilitates the activation of CHMP7 / ESCRT-III nucleoporin turnover to initiate pathologic reduction of POM121
[0260] Given the observation that CHMP2B interacts with CHMP7 in iPSN nuclei (FIG. 17E-17G) and functionally contributes to CHMP7 initiated NPC injury cascades (FIG. 5A- 5D, FIG. 7A-7H, FIG. 6A-6D, FIG. 8A-8D, FIG. 9A-9F, FIG. 11A-11S, FIG. 12A-12S, FIG. 13A-13S, and FIG. 14A-14S) and abnormal turnover of POM121 (FIG. 10A-10C) in sALS, next the mechanism by which this occurs was investigated. It has previously been demonstrated that impaired integrity of the passive diffusion permeability barrier of the NPC is a significant contributor to increased nuclear localization of CHMP7 and CHMP7 mediated NPC injury cascades in sALS. To test whether CHMP2B reduction altered passive diffusion through the NPC, digitonin permeabilized cell assays was used to selectively permeabilize the plasma membrane of iPSNs, leaving the nuclear membrane intact, thereby enabling an evaluation of passive influx through the NPC. Similar to the prior publication, a significant increase in the fluorescence of a 70 kDa dextran molecule was observed in the nucleus of sALS iPSNs (FIG. 20A-20C; n = 5 control and 8 sALS iPSC lines, at least 50 nuclei per line / dextran. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. ****p < 0.0001). Interestingly, this was not altered by either siRNA or ASO mediated knockdown of CHMP2B (FIG. 20A-20C). Due to their size, 70 kDa dextran molecules should normally be unable to passively diffuse through the NPC and are therefore excluded from the nucleus as observed in the control iPSNs (FIG. 20A-20C). Therefore, these data suggest that knockdown of CHMP2B does not repair NPC permeability barrier integrity and thus, likely acts to alleviate CHMP7 mediated NPC injury via a distinct mechanism.
[0261] ESCRT-III proteins generally reside in an auto-inhibited state to prevent inappropriate polymerization. In order to function properly, they must first be “activated”, a process which involves the removal of auto-inhibition via conformational changes that occur as a result of protein - protein interactions. During nuclear envelope sealing events the inner nuclearmembrane protein LEM2 / LEMD2 interacts with CHMP7 to ultimately promote its activation in yeast and non-neuronal mammalian cells. In contrast, it was demonstrated that LEMD2 is not required for CHMP7 mediated NPC injury events in human iPSNs. Given that previous reports have suggested that interactions amongst individual ESCRT proteins may facilitate their activation, CHMP2B may facilitate CHMP7 activation in iPSNs. To investigate this hypothesis, a number of Flag tagged CHMP7 mutant plasmid constructs was first generated (FIG. 21A). The removal of the C-terminal region of ESCRT-III proteins has previously been shown to eliminate autoinhibition, thereby converting to an “open” conformation to promote activation and polymerization. As a result, similar to studies in yeast, a Flag tagged CHMP7 “Open” mutant was generated by removing the last 84 amino acids thereby, truncating CHMP7 at amino acid 369 (FIG. 21A) As an additional method to remove auto-inhibition, a Flag tagged AHelix 6 CHMP7 mutant was generated by removing amino acids 420-430 thereby deleting Helix 6 (FIG. 21A). This mutant CHMP7 protein is known to behave similarly to CHMP7 “Open” mutants in promoting the activation of CHMP7 non-neuronal mammalian cells. Notably, both of these approaches also impact the nuclear export sequences (NES) within Helix 5 and Helix 6 of CHMP7. Thus, by nature of removal of these NES sequences within the “Open” and AHelix 6 mutants (FIG. 21A), Flag tagged CHMP7 will be artificially retained within the nucleus as has previously been demonstrated. As has previously been shown that CHMP7 nuclear retention triggers NPC injury in iPSNs, a double NES mutant (CHMP7 NES1* / NES2*) was generated by making an L to A substitution at amino acids 388 (NESI) and 430 (NES2) (FIG. 21A) as an additional control to discriminate the impact of activation and that of nuclear accumulation. Previous studies have demonstrated that this double mutation is sufficient to render both NES’ within CHMP7 inactive while maintaining autoinhibitory activity. For comparison, a previously described Flag tagged wildtype CHMP7 plasmid was employed (FIG. 21A). Importantly for this experimental design, as this CHMP7 ASO targets intron 2 of the human CHMP7 pre-mRNA, these plasmids are insensitive to ASO mediated knockdown. To avoid any compounding artifacts that may arise from interactions between endogenous wildtype CHMP7 and the Flag tagged CHMP7 mutants, iPSNs were subjected to treatment with CHMP7 ASOs (FIG. 21B) to deplete endogenous CHMP7, an approach which consistently yields a > 90% reduction in endogenous CHMP7 protein. Flag tagged CHMP7 plasmids were expressed at the neuronal stage (FIG. 21B) to specifically examine NPC maintenance and not NPC formation that would occur during the iPSC or early neuronaldifferentiation stage. Treatment with neomycin (FIG. 21B) enriched cultures for iPSNs expressing Flag tagged CHMP7 plasmids. Critically, immunostaining and confocal imaging for Flag demonstrated that ASO mediated reduction of CHMP2B mitigated the nuclear accumulation of Flag tagged WT CHMP7 in sALS iPSNs (FIG. 21C-21E; n = 5 control and 8 sALS iPSC lines, 100 Map2 + and Flag + cells per line / overexpression / treatment. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. **** p < 0.0001.) similar to the results for endogenous CHMP7 (FIG. 5A-5H). In addition, all three CHMP7 mutants localized to the nucleus as expected (FIG. 21C-21E). This highlights out approach to “replace” endogenous CHMP7 with Flag tagged CHMP7 variants as a viable strategy for investigating the mechanisms by which ESCRT-III proteins interact to facilitate NPC injury events in disease iPSNs.
[0262] Having validated the experimental approach, immunostaining and confocal imaging was next performed to evaluate the role of CHMP2B in CHMP7 mediated NPC injury, namely the reduction of nuclear POM121 immunoreactivity. As expected, a significant reduction in POM121 immunoreactivity in sALS iPSNs expressing Flag tagged WT CHMP7 that was abrogated by treatment with CHMP2B ASOs was observed (FIG. 21C-21E). It was next tested whether CHMP2B was involved in the activation of CHMP7 by utilizing the Flag tagged CHMP7 “Open” and AHelix 6 plasmids in which auto-inhibition capabilities have been removed (FIG. 21A), thereby artificially “activating” CHMP7 as established by previous studies. Expression of either Flag tagged CHMP7 “Open”, or Flag tagged CHMP7 AHelix 6, resulted in a significant decrease in nuclear POM121 immunoreactivity in control and sALS iPSNs (FIG. 21C-21E). However, in striking contrast to THE results obtained in the context of endogenous (FIG. 7A-7H) or Flag tagged WT CHMP7 (FIG. 21C-21E) expression, ASO mediated knockdown of CHMP2B had no impact on POM121 immunoreactivity in iPSNs expressing Flag tagged CHMP7 “Open” or Flag tagged CHMP7 AHelix 6 (FIG. 21C-21E). Simply retaining CHMP7 in the nucleus by abrogating its nuclear export (CHMP7 NES1* / NES2*) resulted in a significant decrease in POM121 immunoreactivity which was mitigated by ASO medicated reduction of CHMP2B (FIG. 21C-21E). This suggests that in the absence of CHMP2B, CHMP7 nuclear retention alone is not sufficient to initiate POM121 reduction in iPSNs. Critically, PLA confirmed that CHMP7 “Open” and CHMP7 AHelix 6 no longer associated in close spatial proximity to CHMP2B in iPSN nuclei (FIG. 22A-22B; n = 5 control and 8 sALS iPSC lines, at least 100 nuclei per line / plasmid. Two-way ANOVA withTukey’s multiple comparison test was used to calculate statistical significance. * p < 0.05, ** p < 0.01, **** p <0.0001). Therefore, these data collectively support a role for CHMP2B in facilitating and sustaining the activation and / or removal of autoinhibition of CHMP7 to initiate NPC injury in sALS iPSNs.EXAMPLE 8Discussion
[0263] Impaired nucleocytoplasmic compartmentalization has emerged as significant contributor to ALS and related neurodegenerative disease pathophysiology. It has recently been demonstrated that increased nuclear influx of the ESCRT-III protein CHMP7 resulting from SUN1 mediated alterations in NPC permeability barrier integrity occurs prior to documented reduction of specific Nups from the NPC itself in sALS iPSNs. However, the molecular mechanisms by which increased nuclear CHMP7 localization impacts pathologic alterations to the repertoire of Nups within the nucleus and NPCs of sALS neurons remains unknown. In this study, a role for the ESCRT-III protein CHMP2B in the activation of physiologic and pathologic CHMP7 / ESCRT-III Nup turnover was demonstrated in human neurons. In aggregate, described herein is a model whereby prolonged CHMP2B mediated overactivation of CHMP7 / ESCRT-III Nup turnover leads to pathologic NPC injury in sALS iPSNs (FIG. 23A-23B). Importantly, CHMPB mediated activation of the CHMP7 / ESCRT-III nuclear surveillance pathway appears to facilitate CHMP7’s nuclear localization in sALS neurons highlighting the importance of ESCRT-III function in the determination of subunit localization. In turn, two approaches to reduce CHMP2B protein expression were demonstrated, namely siRNA and ASO mediated knockdown, that abrogate sustained “over-activation” of Nup turnover thereby alleviating pathophysiologic events associated with NPC injury including POM121 expression and TDP-43 dysfunction.
[0264] A number of reports have now established a role for CHMP7 in nuclear envelope resealing during cell division. In addition, one study has suggested that ESCRT-III proteins including CHMP2B and CHMP7 can promote the maintenance of nuclear / cytoplasmic compartmentalization during times of nuclear envelope rupture in yeast. Although nuclear envelope abnormalities have been reported in models of C9orf72 ALS / FTD and Profilinl ALS, it remains unclear whether these represent reported alterations to resident nuclear envelope proteins or pathologic rupture sites. Thus, future studies are necessary to determine whether small ruptures within the nuclear envelope impact ESCRT-III nuclear surveillance in ALS.Nonetheless, it has recently been demonstrated that abnormal nuclear localization of CHMP7 is sufficient to initiate pathologic alterations to the NPC itself thereby highlighting a pivotal role for CHMP7 and the ESCRT-III nuclear surveillance pathway in NPC disruption in sALS. However, the mechanisms by which this pathologic increase in nuclear localization of CHMP7 drives disease associated changes to the NPC remains unknown.
[0265] In addition to a role in nuclear envelope sealing, recent studies have also implicated CHMP7 and the ESCRT-III pathway in the proper assembly and insertion of NPCs into the nuclear envelope during cell division. However, little is known regarding the function of ESCRT-III proteins in the maintenance of previously assembled NPCs throughout the lifetime of non-dividing cells such as neurons where entire NPCs are not thought to be reassembled and inserted throughout life. In fact, a number of Nups have been reported to be some of longest- lived proteins in the mammalian CNS. As a result, in order to maintain properly functioning NPCs, it is possible that individual Nup protein molecules are turned over and replenished within NPCs throughout the lifetime of neurons. Indeed, this is supported by a prior study suggesting that Nups are exchanged at varying rates in myoblast and myotube nuclei resulting in individual NPCs containing a mix of new and old Nup proteins. The present disclosure provides evidence supporting a fundamental role for the ESCRT-III pathway and two of its protein constituents, CHMP7 and CHMP2B, in piecemeal POM121 Nup turnover in human iPSNs (FIG. 1A-1D and FIG. 10A-10C). Specifically, described herein is the discovery that reduction of either CHMP7 or CHMP2B significantly slows POM121 turnover in control human iPSNs (FIG. 1A-1D and FIG. 10A-10C). In addition, it appears this fundamental function of the ESCRT-III pathway is “overactive”, hastening POM121 turnover in sALS iPSNs (FIG. 1A-1D and FIG. 10A-10C) thereby giving rise to NPC pathology observed in disease, a process once again slowed by reduction of either CHMP7 or CHMP2B (FIG. 1A- 1D and FIG. 10A-10C). The data is consistent with prior reports documenting a role for ESCRT-III proteins CHMP3 and CHMP2A in piecemeal turnover of Nup93 in non-dividing mouse myoblast cells. Collectively, this highlights an essential role for the nuclear surveillance function of the ESCRT-III pathway in maintenance of NPCs throughout the lifetime of nondividing cells.
[0266] To maintain NPC and NE homeostasis, the ESCRT-III protein CHMP7 passively diffuses into the nucleus, typically in its inactive autoinhibited or “closed” state which prevents aberrant ESCRT polymerization and unregulated function. In order for ESCRT-III mediatedNPC and nuclear envelope surveillance and maintenance events to occur, CHMP7 must then transition into an active or “open” state via protein - protein interactions. Typically, for ESCRT-III mediated nuclear surveillance and maintenance events in cell division, CHMP7 interacts with the inner nuclear membrane protein LEMD2 to facilitate its “activation” and polymerization. In addition, prior reports have demonstrated that interactions between individual ESCRT proteins can result in their activation highlighting the existence of multiple routes to ESCRT protein activation. Given the previous publications demonstrating that LEMD2 is not required for CHMP7’s nuclear localization and function in iPSNs, it was reasoned that specific ESCRT protein interactions may facilitate the nuclear localization and activation of CHMP7 / ESCRT-III function in iPSNs. Indeed, upon reduction of CHMP2B, CHMP7 relocalized to the cytoplasm in sALS iPSNs (FIG. 5A-5H) although passive diffusion through the NPC remained dysregulated (FIG. 20A-20C). By utilizing CHMP7 mutant plasmids in which autoinhibition has been removed, thereby promoting constitutive activation of CHMP7, it is demonstrated that CHMP2B is no longer required for pathologic P0M121 reduction (FIG. 20A-20C). Thus, together with the observations that knockdown of CHMP2B mitigates P0M121 reduction (FIG. 7A-7H) and slows P0M121 turnover (FIG. 10A-10C) in sALS iPSNs, these data suggest that CHMP2B is sufficient to facilitate the activation of the CHMP7 / ESCRT-III NPC surveillance pathway in iPSNs and is a critical mediator of ESCRT- III nuclear surveillance overactivation in sALS. In aggregate, this study establishes not only that CHMP2B is required for pathologic ESCRT-III NPC alterations, but that functionality of ESCRT-III proteins, in this case CHMP7, is an important contributor to their localization in human neurons. This is consistent with prior ESCRT-III pathway studies suggesting that ESCRT-III function proceeds in a stepwise sequence involving localization / membrane targeting, removal of autoinhibition, polymerization of ESCRT-III subunits, VPS4 mediated scission and depolymerization following completion of remodeling events, restoration of autoinhibition, and redistribution throughout the cell. Thus, although many factors including NPC permeability barrier integrity and RNA splicing can impact localization of CHMP7, this study highlights the importance of ESCRT-III protein function in the determination of their localization.
[0267] Using proximity ligation, an increased and sustained association between CHMP2B and CHMP7 was observed in sALS iPSNs and postmortem human tissues (FIG. 17E-17G). Under physiologic conditions, nuclear pools of CHMP7 and CHMP2B may interact in closeproximity in order to facilitate physiologic ESCRT-III mediated Nup turnover. Indeed, it was demonstrated that impaired association between CHMP7 and CHMP2B via ASO mediated reduction of either ESCRT-III subunit dramatically slows both the physiologic and pathologic turnover of P0M121 within NPCs in human neurons (FIG. 1A-1D and FIG. 10A-10C) Although CHMP2B nuclear localization is minimal in control and sALS human neurons (FIG. 18A-18B), it is likely that increased nuclear localization of CHMP7 observed in sALS leads to increased detection of close physical proximity to CHMP2B in ALS neurons (FIG. 17E-17G). Although PLA cannot distinguish between direct binding and proximity within protein complexes, in vitro binding experiments suggest that CHMP7 and CHMP2B proteins can directly bind (FIG. 19A-19B). The stoichiometry of this relationship and whether this direct binding is enhanced by the presence of additional CHMP7 protein will be an important topic of future investigation.
[0268] Taken together with a recent publication, a scenario was proposed whereby sALS associated CHMP7 pathology is at least in part the result of increased passive nuclear influx resulting from SUN1 mediated alterations inNPC permeability barrier integrity combined with sustained CHMP2B mediated activation of CHMP7 / ESCRT-III nuclear surveillance within the nucleus (FIG. 23A-23B), highlighting a role for function in determining ESCRT-III protein localization in human neurons. Interestingly, ASO mediated reduction of CHMP2B is still sufficient to mitigate the reduction of P0M121 that results from artificial nuclear retention of CHMP7 via impaired nuclear export (CHMP7 NES1* / NES2*, Fig. 7). Although future investigation is warranted, this data demonstrates that in sALS neurons, impaired nuclear export of CHMP7 alone may not be a primary driver of CHMP7 mediated NPC injury in disease. Further, a scenario was proposed whereby persistent interactions between CHMP7 and CHMP2B leads to over-activation / prolonged activation of ESCRT-III mediated Nup removal and degradation to give rise to NPC pathology observed in sALS (FIG. 23A-23B). However, it remains unclear at this time whether this sustained interaction is the result of continued nuclear influx of CHMP7 thus providing a constant flow of new CHMP7 molecules for activation, and / or through an inability to dissociate activated ESCRT-III protein polymers following their NPC and surveillance function. Typically, recruitment of the AAA-ATPase VPS4 promotes ESCRT-III polymer disassembly. It has recently been demonstrated that VPS4 is recruited and pathologically increased in a CHMP7 dependent manner in ALS nuclei. However, CHMP7 is unable to directly bind to VPS4 due to a charge substitution within itsMicrotubule Interaction and Trafficking Domain Interaction Motif (MIM) domain in Helix 6. Thus, it is likely that other ESCRT-III protein subunits are involved facilitating recruitment of VPS4 for polymer disassembly after ESCRT-III nuclear surveillance function. Interestingly, prior studies indicate that CHMP2B is able to bind to VPS4 in vitro. However, given this data that reduction of CHMP2B alleviates pathologic reduction of P0M121 (FIG. 7A-7H and FIG. 10A-10C), this suggests that CHMP2B is unlikely involved in recruitment of VPS4 for nuclear ESCRT-III polymer disassembly in human neurons. Thus, future investigations are necessary to examine the function of additional ESCRT-III subunits in promoting VPS4 recruitment and polymer disassembly in iPSNs. Nonetheless, taken together, it is described herein that the fundamental ESCRT-III nuclear surveillance pathway is involved in piecemeal turnover of P0M121 in human neurons. Critically, given that aberrant P0M121 reduction is the initiating event for NPC injury cascades in ALS neurons, this study provides essential mechanistic insights into this early event in ALS pathogenesis.
[0269] Notably, mutations in CHMP2B have been implicated in FTD and a subset of lower motor neuron predominant ALS cases. Mutations resulting in a C terminal truncation, thereby removing CHMP2B’s autoinhibitory domain and VPS4 binding site, have been shown to enhance the association between CHMP2B and CHMP4B and impair the recruitment of VPS4. This suggests that disease associated mutations in CHMP2B may additionally lead to NPC injury events in this genetic form of FTD / ALS in a manner similar to the observations in sALS.
[0270] Collectively, this data provides evidence of a role for CHMP2B in facilitating the activation of the CHMP7 / ESCRT-III nuclear surveillance pathway in human iPSNs to maintain NPCs. Moreover, it was demonstrated that sustained activation of CHMP7 / ESCRT-III nuclear surveillance is sufficient to drive NPC injury in sALS. Consequently, ASO or siRNA mediated knockdown of CHMP2B mitigates pathologic reduction of POM121 and downstream defects in TDP-43 function in sALS iPSNs. As a result, this data mechanistically implicate CHMP2B mediated activation of CHMP7 / ESCRT-III nuclear surveillance as a significant contributor to physiologic NPC maintenance and pathologic NPC disruption in human neurons. Prior studies have reported deficiencies in neurite extension and branching as well as synaptic dysfunction in cultured rodent neurons following shRNA mediated depletion of CHMP2B consistent with a role for CHMP2B at the synapse. However, consistent with the observation that CHMP2B knockout mice are largely phenotypically normal, this study suggests that only a partial reduction of CHMP2B following neuronal development may be beneficial in ALS. In supportof this, recent observations indicate that knockdown of CHMP2B prevents toxicity resulting from TDP-43 overexpression in Drosophila and can modulate the phosphorylation of TDP-43 in overexpression models. Thus, in addition to providing critical mechanistic insights into disruptions in CHMP7 / ESCRT-III mediated NPC homeostasis, this data support the potential for partial reduction of CHMP2B as a potential therapeutic strategy to alleviate NPC injury cascades in sALS. Although future studies are necessary to extend these studies to a larger cohort of sALS patient iPSC lines, the recent analysis of 180 control, sALS, C9orf72, TDP-43, and SOD1 iPSC lines has revealed that ~ 75% of patient lines display CHMP7 pathology and ~ 85% have evidence of aberrant POM121 reduction. Thus, this suggests that therapeutically targeting overactivation of ESCRT-III mediated POM121 turnover may be beneficial for a large number of sALS patients. Given the potential for direct binding between CHMP7 and CHMP2B (FIG. 19A-19B), this study also suggests the possibility that small molecule inhibitors of sustained nuclear CHMP7 - CHMP2B interactions may be a future alternative therapeutic approach to alleviate NPC injury cascades in disease.EXAMPLE 9Conclusions
[0271] In this study, it was demonstrated that CHMP2B is required for physiologic neuronal Nup turnover and in turn is a significant mediator of pathologic NPC injury in sALS human neurons. Mechanistically, CHMP2B associates with CHMP7 to promote the activation of ESCRT-III mediated Nup turnover. In sALS neurons, the persistent association between CHMP7 and CHMP2B leads to sustained overactivation of the ESCRT-III nuclear surveillance / Nup turnover pathway to give rise to disease associated NPC injury and in turn contribute to TDP-43 mislocalization and loss of nuclear function. Importantly, it was demonstrated that partial reduction of CHMP2B via siRNA or ASO is sufficient to both prevent and reverse NPC alterations and TDP-43 pathology. Thus, these studies provide critical mechanistic insights into early events in sALS pathogenesis and highlight CHMP2B as a potential therapeutic target for sALS.
[0272] List of sequences
[0273] ASO SequencesASO Scrambled (lonis ID: 676630): CCTATAGGACTATCCAGGAA (SEQ ID NO: 1) ASO CHMP7 (lonis ID: 1508917): TGTTACCCTCAGATACCGCC (SEQ ID NO: 2) ASO CHMP2B ASO 1: TGTGACAAGTCCTAGTGGGA (SEQ ID NO: 3)ASO CHMP2B ASO 2: AGGGTGAGAAAGAGTATGGG (SEQ ID NO: 4)ASO CHMP2B ASO 3: GGGATGCAGAAATACAGAGG (SEQ ID NO: 5)ASO CHMP2B ASO 4: AAGTGGCATCTGAAGTAGGG (SEQ ID NO: 6)ASO CHMP2B ASO 5: TGGTAAGCGAAGATGCCAGA (SEQ ID NO: 7)ASO CHMP2B ASO 6: ATCACTTACCACCTGCCATG (SEQ ID NO: 8)ASO CHMP2B ASO 7: GTTGGTGGGACAGAGCAATA (SEQ ID NO: 9)ASO CHMP2B ASO 8: CACCTAACTCTCTAGTGGCT (SEQ ID NO: 10)ASO CHMP2B ASO 9: TCAATGGAACAGAGCCCAGA (SEQ ID NO: 11)ASO CHMP2B ASO 10: CATTTACCCTATGACCCAGC (SEQ ID NO: 12)
[0274] Primer SequencesSTMN2 Forward: AGCTGTCCATGCTGTCACTG (SEQ ID NO: 33)STMN2 Reverse: GGTGGCTTCAAGATCAGCTC (SEQ ID NO: 34)Truncated STMN2 Forward: GGACTCGGCAGAAGACCTTC (SEQ ID NO: 13)Truncated STMN2 Reverse: GCAGGCTGTCTGTCTCTCTC (SEQ ID NO: 14)GAPDH Forward: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 15)GAPDH Reverse: GAAGATGGTGATGGGATTTC (SEQ ID NO: 16)ACTL6B CE Forward: ATCCTGGATCACACCTACAGC (SEQ ID NO: 17)ACTL6B CE Reverse: AGGAGGATTGCTTGAACCC (SEQ ID NO: 18)ARHGAP32 CE Forward: CACCTTCTAAATTCTGGTTTTGAAG (SEQ ID NO: 19)ARHGAP32 CE Reverse: CAGATACAGACGAAAAAGCTGAGTT (SEQ ID NO: 20)CAMK2B CE Forward: GAGTGCAGAGACTTCCCCC (SEQ ID NO: 21)CAMK2B CE Reverse: CTGCTCCGTGGTCTTAATGAT (SEQ ID NO: 22)CDK7 CE Forward: GCAGTGTGGACATGACTGATA (SEQ ID NO: 23)CDK7 CE Reverse: GTCCACACCTACACCATACATC (SEQ ID NO: 24)DNM1 CE Forward: TGACCCTTTCGGCCCT (SEQ ID NO: 25)DNM1 CE Reverse: CACGAAATCAACATGGCAGT (SEQ ID NO: 26)HDGFL2 CE Forward: TCACACCTGAGAAGAAAGCAG (SEQ ID NO: 27)HDGFL2 CE Reverse: TCCTCTCTTCTGTGTCCCTCT (SEQ ID NO: 28)MYO18A CE Forward: AAGTCCAGGGATGAGATTGTG (SEQ ID NO: 29)MYO18A CE Reverse: GCAGAGTTTTGTCCTCCTCTTTA (SEQ ID NO: 30)SYT7 CE Forward: GCAGTGAGAAGAAGGCTATCAA (SEQ ID NO: 31)SYT7 CE Reverse: CGGCAGACTGGAGCCT (SEQ ID NO: 32)
[0275] Although the invention has been described with reference to the presently preferred embodiment, it should be understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims.
Claims
What Is Claimed Is:
1. An isolated oligonucleotide comprising a nucleic acid sequence of any of SEQ ID NO: 3-12.
2. A composition comprising one or more oligonucleotides of claim 1.
3. A method of modulating CHMP2B expression in a cell comprising contacting the cell with an oligonucleotide comprising a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof, thereby modulating the expression of CHMP2B.
4. The method of claim 3, wherein modulating CHMP2B expression comprises decreasing CHMP2B expression in the cell compared to CHMP2B expression in a cell contacted with a control oligonucleotide or in a cell not contacted with the oligonucleotide.
5. The method of claim 4, wherein the expression of CHMP2B is measured using immunostaining, confocal imaging, nuclei isolation, Western blotting, or a combination thereof.
6. A method of decreasing or inhibiting nuclear accumulation of CHMP7 in a cell comprising contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting nuclear accumulation of CHMP7 in the cell.
7. The method of claim 6, wherein targeting expression of CHMP2B comprises decreasing CHMP2B expression in the cell.
8. The method of claim 6, wherein the cell is a neuronal cell.
9. The method of claim 7, wherein the neuronal cell exhibits pathologic nuclear accumulation of CHMP7 or is at risk of pathologic nuclear accumulation of CHMP7.
10. The method of claim 7, wherein the neuronal cell is from a subject suffering from Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkinson’s disease, Huntington’s chorea, mild cognitive impairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration.
11. The method of claim 6, wherein the agent that targets expression of CHMP2B is an siRNA, an antisense oligonucleotide (ASO), or a combination thereof.
12. The method of claim 11, wherein the ASO comprises a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.
13. A method of decreasing or inhibiting a nucleoporin (Nup) turnover in a cell comprising contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting Nup turnover in the cell.
14. The method of claim 13, wherein targeting expression of CHMP2B comprises decreasing CHMP2B expression in the cell.
15. The method of claim 14, wherein decreasing CHMP2B in the cell comprises decreasing or inhibiting nuclear accumulation of CHMP7 in the cell compared to nuclear accumulation of CHMP7 in a cell treated with a control agent or nuclear accumulation of CHMP7 in the cell prior to contacting the cell with the agent targeting CHMP2B.
16. The method of claim 15, wherein decreasing or inhibiting nuclear accumulation of CHMP7 in the cell comprises decreasing or inhibiting Nup turnover in the cell compared to Nup turnover in a cell treated with a control agent or Nup turnover in the cell prior to contacting the cell with the agent targeting CHMP2B.
17. The method of any of claims 13-15, wherein the cell is a neuronal cell.
18. The method of claim 17, wherein the neuronal cell exhibits pathologic Nup turnover or is at risk of Nup turnover in the cell.
19. The method of claim 17, wherein the neuronal cell is from a subject suffering from Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkinson’s disease, Huntington’s chorea, mild cognitive impairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration.
20. The method of claim 13 , wherein the agent that targets expression of CHMP2B is an siRNA, an ASO, or a combination thereof.
21. The method of claim 20, wherein the ASO comprises a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.
22. A method of decreasing or inhibiting nuclear pore complex (NPC) injury in a cell comprising contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting NPC injury in the cell.
23. The method of claim 22, wherein targeting expression of CHMP2B comprises decreasing CHMP2B expression in the cell.
24. The method of claim 23, wherein decreasing CHMP2B in the cell comprises decreasing or inhibiting nuclear accumulation of CHMP7 in the cell compared to nuclear accumulation of CHMP7 in a cell treated with a control agent or nuclear accumulation of CHMP7 in the cell prior to contacting the cell with the agent targeting CHMP2B.
25. The method of claim 24, wherein decreasing or inhibiting nuclear accumulation of CHMP7 in the cell comprises decreasing or inhibiting Nup turnover in the cell compared to Nup turnover in a cell treated with a control agent or Nup turnover in the cell prior to contacting the cell with the agent targeting CHMP2B.
26. The method of claim 25, wherein decreasing or inhibiting Nup turnover in the cell comprises decreasing or inhibiting NPC injury in the cell compared to NPC injury in a cell treated with a control agent or NPC injury in the cell prior to contacting the cell with the agent targeting CHMP2B.
27. The method of any of claims 22-26, wherein the cell is a neuronal cell.
28. The method of claim 27, wherein the neuronal cell exhibits NPC injury or is at risk of NPC injury in the cell.
29. The method of claim 28, wherein the neuronal cell is from a subject suffering from Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkinson’s disease, Huntington’s chorea, mild cognitive impairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration.
30. The method of claim 22, wherein the agent that targets expression of CHMP2B is an siRNA, an ASO, or a combination thereof.
31. The method of claim 30, wherein the ASO comprises a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.
32. A method of decreasing or inhibiting TDP-43 mislocalization in a cell comprising contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting TDP-43 mislocalization in the cell.
33. The method of claim 32, wherein targeting expression of CHMP2B comprises decreasing CHMP2B expression in the cell.
34. The method of claim 33, wherein decreasing CHMP2B in the cell comprises decreasing or inhibiting nuclear accumulation of CHMP7 in the cell compared to nuclear accumulation of CHMP7 in a cell treated with a control agent or nuclear accumulation of CHMP7 in the cell prior to contacting the cell with the agent targeting CHMP2B.
35. The method of claim 34, wherein decreasing or inhibiting nuclear accumulation of CHMP7 in the cell comprises decreasing or inhibiting Nup turnover in the cell compared to Nup turnover in a cell treated with a control agent or Nup turnover in the cell prior to contacting the cell with the agent targeting CHMP2B.
36. The method of claim 35, wherein decreasing or inhibiting Nup turnover in the cell comprises decreasing or inhibiting NPC injury in the cell compared to NPC injury in a cell treated with a control agent or NPC injury in the cell prior to contacting the cell with the agent targeting CHMP2B.
37. The method of claim 36, wherein decreasing or inhibiting NPC injury in the cell comprises decreasing or inhibiting TDP-43 mislocalization in the cell compared to TDP-43 mislocalization in a cell treated with a control agent or TDP-43 mislocalization in the cell prior to contacting the cell with the agent targeting CHMP2B.
38. The method of any of claims 32-37, wherein the cell is a neuronal cell.
39. The method of claim 38, wherein the neuronal cell exhibits TDP-43 mislocalization or is at risk of TDP-43 mislocalization in the cell.
40. The method of claim 39, wherein the neuronal cell is from a subject suffering from Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkinson’s disease, Huntington’s chorea, mild cognitive impairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration.
41. The method of claim 32, wherein the agent that targets expression of CHMP2B is an siRNA, an ASO, or a combination thereof.
42. The method of claim 41, wherein the ASO comprises a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.
43. A method of decreasing or inhibiting TDP-43 loss of function in a cell comprising modulating CHMP2B expression in the cell comprising contacting the cell with an agent that targets expression of CHMP2B in the cell, thereby decreasing or inhibiting TDP-43 loss of function in the cell.
44. The method of claim 43, wherein targeting expression of CHMP2B comprises decreasing CHMP2B expression in the cell.
45. The method of claim 44, wherein decreasing CHMP2B in the cell comprises decreasing or inhibiting nuclear accumulation of CHMP7 in the cell compared to nuclear accumulation of CHMP7 in a cell treated with a control agent or nuclear accumulation of CHMP7 in the cell prior to contacting the cell with the agent targeting CHMP2B.
46. The method of claim 45, wherein decreasing or inhibiting nuclear accumulation of CHMP7 in the cell comprises decreasing or inhibiting Nup turnover in the cell compared to Nup turnover in a cell treated with a control agent or Nup turnover in the cell prior to contacting the cell with the agent targeting CHMP2B.
47. The method of claim 46, wherein decreasing or inhibiting Nup turnover in the cell comprises decreasing or inhibiting NPC injury in the cell compared to NPC injury in a cell treated with a control agent or NPC injury in the cell prior to contacting the cell with the agent targeting CHMP2B.
48. The method of claim 47, wherein decreasing or inhibiting NPC injury in the cell comprises decreasing or inhibiting TDP-43 mislocalization in the cell compared toTDP-43 mislocalization in a cell treated with a control agent or TDP-43 mislocalization in the cell prior to contacting the cell with the agent targeting CHMP2B.
49. The method of claim 48, wherein decreasing or inhibiting NPC injury in the cell comprises decreasing or inhibiting TDP-43 loss of function in the cell compared to TDP-43 loss of function in a cell treated with a control agent or TDP-43 loss of function in the cell prior to contacting the cell with the agent targeting CHMP2B.
50. The method of claim 43 wherein the TDP-43 loss of function results from TDP-43 nuclear depletion, TDP-43 cytoplasmic mislocalization, TDP-43 aggregation, or a combination thereof.
51. The method of any of claims 43-50, wherein the cell is a neuronal cell.
52. The method of claim 51, wherein the neuronal cell exhibits TDP-43 loss of function or is at risk of TDP-43 loss of function in the cell.
53. The method of claim 51, wherein the neuronal cell is from a subject suffering from Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkinson’s disease, Huntington’s chorea, mild cognitive impairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration.
54. The method of claim 43, wherein the agent that targets expression of CHMP2B is an siRNA, an ASO, or a combination thereof.
55. The method of claim 54, wherein the ASO comprises a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.
56. A method of treating a neurodegenerative disease in a subject comprising modulating CHMP2B expression in the subject comprising administering to the subject an agent that targets CHMP2B, thereby treating the neurodegenerative disease.
57. The method of claim 56, wherein targeting expression of CHMP2B comprises decreasing CHMP2B expression in a cell from the subject.
58. The method of claim 57, wherein decreasing CHMP2B expression in the cell comprises decreasing or inhibiting nuclear accumulation of CHMP7 in the cell from the subject compared to nuclear accumulation of CHMP7 in a cell from a subjecttreated with a control agent or nuclear accumulation of CHMP7 in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
59. The method of claim 58, wherein decreasing or inhibiting nuclear accumulation of CHMP7 in the cell from the subject comprises decreasing or inhibiting Nup turnover in the cell from the subject compared to Nup turnover in a cell from a subject treated with a control agent or Nup turnover in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
60. The method of claim 59, wherein decreasing Nup turnover in the cell from the subject comprises decreasing or inhibiting NPC injury in a cell from the subject compared to NPC injury in a cell from a subject treated with a control agent or NPC injury in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
61. The method of claim 60, wherein decreasing NPC injury comprises decreasing or inhibiting TDP-43 mislocalization in the cell from the subject compared to TDP-43 mislocalization in a cell from a subject treated with a control agent or TDP-43 mislocalization in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
62. The method of claim 61, wherein decreasing TDP-43 mislocalization comprises decreasing or inhibiting TDP-43 loss of function in the cell from the subject compared to TDP-43 loss of function in a cell from a subject treated with a control agent or TDP-43 loss of function in the cell from the subject prior to treating the subject with the agent targeting CHMP2B.
63. The method of claim 62, wherein the TDP-43 loss of function results from TDP-43 nuclear depletion, TDP-43 cytoplasmic mislocalization, TDP-43 aggregation, or a combination thereof in the cell from the subject.
64. The method of any of claims 56-63, wherein the cell is a neuronal cell.
65. The method of claim 56, wherein the agent targeting CHMP2B targets CHMP7- CHMP2B protein interactions.
66. The method of claim 56, wherein the agent targeting CHMP2B is a nucleic acid, a protein, a peptide or a small molecule.
67. The method of any of claims 56-66, wherein the agent that targets expression of CHMP2B is an siRNA, an ASO, or a combination thereof.
68. The method of claim 67, wherein the ASO comprises a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or a combination thereof.
69. The method of any of claims 56-68, wherein the neurodegenerative disease is Amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, motor neuron disease, Parkinson’s disease, Pick’s disease, Parkinson’s disease, Huntington’s chorea, mild cognitive impairment, Lewy Body disease, multiple system atrophy, progressive supranuclear palsy, cortico-basal degeneration or frontotemporal lobar degeneration.
70. The method of claim 69, wherein the neurodegenerative disease is Amyotrophic Lateral Sclerosis (ALS).
71. The method of claim 70, wherein the ALS is sporadic ALS.
72. The method of claim 56, further comprising administering to the subject Edaravone, Riluzole, AMX0035, Tofersen, or a combination thereof.
73. The method of claim 56, wherein administration is oral, systemic, parenteral, intrathecal, intranasal, intravenous, subcutaneous, intracerebroventricular, by inhalation, or by suppository.
Citation Information
Patent Citations
Methods for inhibiting CHMP7 expression in neuronal cells for the treatment of neurodegenerative disorders
US20230407298A1