Method for preparing genetically modified non-human mammal for producing humanized antibody and use thereof

By introducing human IGHV, IGHD, and IGHJ genes in non-human mammals and performing gene editing, the problems of low immune titers and insufficient diversity in whole human nanoantibodies mice were solved, and efficient production of humanized antibodies was achieved, simplifying the drug development process.

WO2025176170A1PCT designated stage Publication Date: 2025-08-28RENGENE BIOTECHNOLOGY CO LTD +1
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/078279
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-20
Filing Date
2025-02-20
Publication Date
2025-08-28

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently produce whole-human nanoantibody mice, resulting in low immune titers and insufficient antibody diversity, affecting the development and application of nanoantibody drugs.

Method used

The mini-Locus technology route was adopted to rearrange and combine human IGHV, IGHD, and IGHJ genes onto BAC, and gene editing was performed in non-human mammals through CRISPR-Cas9 technology, destroying endogenous heavy chain immunoglobulin loci, introducing human genes, and realizing the humanization of MegaB-level genomic fragments.

Benefits of technology

Non-human mammals with high immune titers can be prepared in a short period of time, which can efficiently produce humanized antibodies, improve antibody diversity, simplify drug development process, and reduce risks.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025078279-FTAPPB-I100001
    Figure PCTCN2025078279-FTAPPB-I100001
  • Figure PCTCN2025078279-FTAPPB-I100002
    Figure PCTCN2025078279-FTAPPB-I100002
  • Figure PCTCN2025078279-FTAPPB-I100003
    Figure PCTCN2025078279-FTAPPB-I100003
Patent Text Reader

Abstract

Provided are a method for preparing a genetically modified non-human mammal for producing a humanized antibody and the use thereof. The preparation method comprises: (1) performing disruption of an endogenous heavy chain immunoglobulin locus on a non-human mammal; and (2) introducing into the non-human mammal obtained in the step (1) a human IGHV gene, a human IGHD gene, a human IGHJ gene, and an endogenous IgHG gene, an IgHE gene, an IgHA gene and an LCR region of a non-human mammal. The non-human mammal prepared according to the preparation method can efficiently produce a humanized whole antibody or a heavy-chain-only antibody or a nano antibody after antigen immunization, and has a relatively high immunological potency. In addition, the preparation method can be used to obtain positive animals with a relatively high efficiency, so that humanized mice with different antibody diversities can be easily prepared, and the various strains of mice can be used to realize the sequence diversity of nano antibodies.
Need to check novelty before this filing date? Find Prior Art

Description

Preparation method and application of genetically modified non-human mammals for producing humanized antibodies

[0001] Cross-references

[0002] This application claims priority to Chinese patent application No. 202410190410.0, filed on February 20, 2024, entitled “A method for preparing and applying genetically modified non-human mammals for producing humanized antibodies,” the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present application belongs to the field of biotechnology, and specifically relates to a preparation method and application of a genetically modified non-human mammal for producing humanized antibodies. Background Art

[0004] A type of antibody with a unique structure, single heavy-chain antibody (Heavy-chain-only), is produced in the bodies of camelids and sharks. This antibody is composed only of heavy chains, and the molecular weight of its variable region fragment (15kDa) is about one-tenth of that of traditional antibodies (150-160kDa). The variable region fragment of a single heavy-chain antibody is also called a nanobody. Nanobodies have been widely used in the development of bispecific / multispecific antibodies, CAR-T cell therapy, etc. As of January 2023, four nanobody-based therapeutic drugs have been launched on the market, among which the nanobody-based BCMACAR-T therapy developed by Legend Biotech has achieved excellent clinical results. In addition, more than 10 molecules of nanoantibodies developed as neutralizing antibodies have entered clinical phase II / III. The drug research and development and application of nanoantibodies are still in a relatively early stage and have huge application potential and development prospects.

[0005] The HuNano Mouse is a fully human nanobody mouse used for the development of nanobody drugs. Based on independently developed humanization technology for genome fragments ranging from hundreds of KB to megabase pairs (MB), it achieves the humanization of antibody heavy chain genes, covering the major human heavy chain variable region genes. The HuNano Mouse can be used to directly screen for fully human nanoantibodies, bifunctional antibodies, and CAR-T antibody gene sequences for the treatment of major diseases. The fully human nanoantibody sequences it produces can be used for drug development without undergoing in vitro humanization, saving a significant amount of time and cost, and reducing the risks of subsequent drug development. The use of fully human nanoantibody mice has become an inevitable trend in the development of therapeutic nanoantibody drugs.

[0006] Commonly used techniques for preparing large-fragment (over 100 kilobases) gene humanized animal models include chromosome engineering, RMCE (recombinase-mediated cassette exchange), and single BAC transgenesis. Chromosome engineering technology has a high barrier to entry, a research and development cycle of about five years, and is dependent on embryonic stem cells from the recipient species. Its use is limited to species that can efficiently isolate embryonic stem cells, such as mice. RMCE technology recombines the target fragment into the genome in a size of approximately 200 kb each time. To achieve megabyte-level gene modification, at least five to six gene recombination operations are required on embryonic stem cells, and it takes about five years to complete the animal model. The fragment size of single BAC transgenesis is limited by the size of the BAC. Generally, a single transferred gene is 200 kb, which cannot achieve megabyte-level gene transfer.

[0007] In addition, the immune titers of fully human nanoantibody mice are generally lower than those of wild mice, which also means that the diversity of antibody sequences screened is less.

[0008] Therefore, how to improve the immune titer of fully human nanobody mice and increase the diversity of the antibodies produced is a technical problem that urgently needs to be solved in this field.

[0009] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the application and should not be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the Invention

[0010] Purpose of the Invention

[0011] In response to the problems existing in the above-mentioned prior art, the purpose of the present application is to provide a method for preparing a genetically modified non-human mammal that can efficiently produce humanized antibodies (including whole antibodies, single heavy-chain antibodies and nanobodies), a method for preparing humanized antibodies that specifically bind to antigens based on the non-human mammals produced by the preparation method, and a method for obtaining biological samples.

[0012] The strategy adopted in this application is to rearrange and combine V genes that are more suitable for expressing nanobodies into a BAC (mini-Locus technology route), that is, the mini-1G and mini-4G schemes of this application can also arrange and combine antibody V genes of other races in multiple strains, so as to achieve different diversities in different strains of mice.

[0013] According to the preparation method of the genetically modified non-human mammal of the present application, the MBGE introduction system is used to prepare fully human nano-antibody-producing mice with humanized mega-B-level genome fragments in a short period of time (for example, within six months), and the efficiency of obtaining positive mice with a single injection is as high as about 15%, so that humanized mice with different antibody diversities can be easily prepared (for example, using multiple strains of mice to increase the diversity of nano-antibody sequences); and the prepared non-human mammals have high immune titers and can efficiently produce humanized antibodies (including whole antibodies, single heavy-chain antibodies and nano-antibodies).

[0014] Solution

[0015] To achieve the purpose of this application, this application provides the following technical solutions:

[0016] In a first aspect, the present application provides a genetically modified non-human mammal, which comprises a disruption of its endogenous heavy chain immunoglobulin locus, and the endogenous heavy chain immunoglobulin locus of the non-human mammal comprises a human IGHV gene, a human IGHD gene, a human IGHJ gene and the endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of the non-human mammal.

[0017] In some preferred embodiments, the non-human mammal is a mouse, and the disruption of its endogenous heavy chain immunoglobulin locus comprises deletion of the following gene segments:

[0018] The CH1 fragment of the mouse antibody gene heavy chain IgHM, the Igkc fragment of the mouse antibody gene light chain Igk, and the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ.

[0019] In a feasible embodiment, the CH1 fragment of the mouse antibody gene heavy chain IgHM is a fragment between SEQ ID NO: 7 and SEQ ID NO: 8 on the mouse antibody gene heavy chain IgHM.

[0020] In a feasible embodiment, the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ is a fragment between SEQ ID NO: 14 and SEQ ID NO: 15 of the mouse antibody gene light chain Igλ.

[0021] In other preferred embodiments, the non-human mammal is a mouse, and the disruption of its endogenous heavy chain immunoglobulin locus comprises deletion of the following gene segments:

[0022] The fragments of the mouse antibody gene heavy chain range from IgHM to IgHA-CH1, the Igkc fragment of the mouse antibody gene light chain Igk, and the fragments of the mouse antibody gene light chain Igλ range from IgLc2 to IgLc1.

[0023] In a feasible embodiment, the CH1 fragment of the mouse antibody gene heavy chain IgHM is a fragment between SEQ ID NO: 7 and SEQ ID NO: 19 on the mouse antibody gene heavy chain IgHM.

[0024] In a feasible embodiment, the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ is a fragment between SEQ ID NO: 14 and SEQ ID NO: 15 of the mouse antibody gene light chain Igλ.

[0025] In a feasible embodiment, the human IGHV gene includes part or all of the human IGHV genes selected from the following:

[0026] hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, hIGHV1-2, hIGHV3-74, hIGHV3-72, hIGHV3 -66, hIGHV3-64, hIGHV3-35, hIGHV3-30, hIGHV3-20, hIGHV3-16, hIGHV3-15, hIGHV3-13, hIGHV3-33, hIGHV3-23, hIGHV3-7, h IGHV1-2, hIGHV6-1; optionally, the framework region of the above-mentioned human IGHV genes contains mutations; further optionally, the framework region of hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, hIGHV1-2 genes includes gene mutations that result in the following amino acid mutations: the 4th amino acid in the FR2 region mutates to phenylalanine, the 11th amino acid mutates to glutamate, the 12th amino acid mutates to arginine and the 14th amino acid mutates to glutamate.

[0027] Preferably, the human IGHV gene includes all the above-mentioned human IGHV genes.

[0028] Most preferably, the human IGHV gene includes all the above-mentioned human IGHV genes, wherein the framework regions of hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, and hIGHV1-2 genes include gene mutations that result in the following amino acid mutations: the 4th amino acid in the FR2 region mutates to phenylalanine, the 11th amino acid mutates to glutamate, the 12th amino acid mutates to arginine, and the 14th amino acid mutates to glutamate.

[0029] In a feasible embodiment, the human IGHD gene includes part or all of the human IGHD genes selected from the group consisting of:

[0030] hIGHD1-1, hIGHD2-2, hIGHD3-3, hIGHD4-4, hIGHD5-5, hIGHD6-6, hIGHD1-7, hIGHD2-8, hIGHD3-9, hIGHD3-10, hIGHD4-11, hIGHD5-12, hIGHD6-13, hIGHD1-14 , hIGHD2-15, hIGHD3-16, hIGHD4-17, hIGHD5-18, hIGHD6-19, hIGHD1-20, hIGHD2-21, hIGHD3-22, hIGHD4-23, hIGHD5-24, hIGHD6-25, hIGHD1-26, hIGHD7-27.

[0031] Preferably, the human IGHD gene includes all the above-mentioned human IGHD genes.

[0032] In a feasible embodiment, the human IGHJ gene is part or all of the human IGHJ genes selected from the following:

[0033] hIGHJ1, hIGHJ2, hIGHJ2P, hIGHJ3, hIGHJ4, hIGHJ5, hIGHJ3P, hIGHJ6;

[0034] Preferably, the human IGHJ genes include all the above-mentioned human IGHJ genes.

[0035] In a feasible embodiment, the endogenous IgHG gene of the non-human mammal is any one selected from the following:

[0036] (i) an endogenous complete IgHG2c gene of a non-human mammal, or an endogenous IgHG2c gene segment lacking the CH1 domain; or

[0037] (ii) endogenous complete IgHG3, IgHG1, IgHG2b and IgHG2c genes of a non-human mammal, or endogenous IgHG3, IgHG1, IgHG2b and IgHG2c gene segments lacking the CH1 domain.

[0038] When the endogenous IgHG gene of the non-human mammal is an endogenous complete IgHG gene of the non-human mammal, after antigen immunization, the humanized full antibody produced by it is; when the endogenous IgHG gene of the non-human mammal is an endogenous IgHG gene segment lacking the CH1 domain of the non-human mammal, after antigen immunization, the humanized single heavy chain antibody produced by it is.

[0039] Preferably, the human IGHV gene, human IGHD gene and human IGHJ gene are operably linked and can undergo VDJ rearrangement; further preferably, the human IGHV gene, human IGHD gene and human IGHJ gene that are operably linked and / or have undergone VDJ rearrangement are operably linked to the endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of a non-human mammal;

[0040] Preferably, a switch region of endogenous IgHM of a human mammal exists between the human IGHJ gene and the endogenous IgHG gene of the non-human mammal.

[0041] Most preferably, the non-human mammal's endogenous heavy chain immunoglobulin locus comprises all of the genes shown in Table 13 or Table 15.

[0042] In a second aspect, the present application provides a method for preparing a genetically modified non-human mammal as described in the first aspect above, characterized in that the preparation method comprises the following steps:

[0043] (1) Disruption of the endogenous heavy chain immunoglobulin locus in a non-human mammal;

[0044] (2) Introducing the human IGHV gene, human IGHD gene, human IGHJ gene, and the endogenous IgHG gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal into the genetically modified non-human mammal obtained in step (1).

[0045] In a feasible embodiment, the non-human mammal is a mouse, and the disruption of the endogenous heavy chain immunoglobulin locus in step (1) comprises deletion of the following gene segments:

[0046] The CH1 fragment of the mouse antibody gene heavy chain IgHM, the Igkc fragment of the mouse antibody gene light chain Igk, and the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ;

[0047] In a feasible embodiment, the CH1 fragment of the mouse antibody gene heavy chain IgHM is a fragment between SEQ ID NO: 7 and SEQ ID NO: 8 on the mouse antibody gene heavy chain IgHM.

[0048] In a feasible embodiment, the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ is a fragment between SEQ ID NO: 14 and SEQ ID NO: 15 of the mouse antibody gene light chain Igλ.

[0049] Preferably, the gene fragment is deleted by gene editing technology such as CRISPR-Cas9 technology;

[0050] Further preferably, the sgRNA for deleting the CH1 fragment of the mouse antibody gene heavy chain IgHM includes the sgRNA shown in SEQ ID NO: 1 and SEQ ID NO: 2; and / or, the sgRNA for deleting the Igkc fragment of the mouse antibody gene light chain Igk includes the sgRNA shown in SEQ ID NO: 3; and / or, the sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ includes the sgRNA shown in SEQ ID NO: 4 and SEQ ID NO: 5.

[0051] In other feasible embodiments, the non-human mammal is a mouse, and the disruption of the endogenous heavy chain immunoglobulin locus in step (1) comprises deletion of the following gene segments:

[0052] The fragments of mouse antibody gene heavy chain from IgHM to IgHA-CH1, the Igkc fragment of mouse antibody gene light chain Igk, and the fragments of mouse antibody gene light chain Igλ from IgLc2 to IgLc1;

[0053] In a feasible embodiment, the CH1 fragment of the mouse antibody gene heavy chain IgHM is a fragment between SEQ ID NO: 7 and SEQ ID NO: 19 on the mouse antibody gene heavy chain IgHM.

[0054] In a feasible embodiment, the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ is a fragment between SEQ ID NO: 14 and SEQ ID NO: 15 of the mouse antibody gene light chain Igλ.

[0055] Preferably, the gene fragment is deleted by gene editing technology such as CRISPR-Cas9 technology;

[0056] Further preferably, the sgRNA for deleting the fragment from IgHM to IgHA-CH1 of the mouse antibody gene heavy chain includes the sgRNA as shown in SEQ ID NO: 1 and SEQ ID NO: 6; and / or, the sgRNA for deleting the Igkc fragment of the mouse antibody gene light chain Igk includes the sgRNA as shown in SEQ ID NO: 3; and / or, the sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ includes the sgRNA as shown in SEQ ID NO: 4 and SEQ ID NO: 5.

[0057] In some embodiments, the non-human mammal is a mouse, and in step (2),

[0058] The human IGHV gene includes part or all of the human IGHV genes selected from the following:

[0059] hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, hIGHV1-2, hIGHV3-74, hIGHV3-72, hIGHV3 -66, hIGHV3-64, hIGHV3-35, hIGHV3-30, hIGHV3-20, hIGHV3-16, hIGHV3-15, hIGHV3-13, hIGHV3-33, hIGHV3-23, hIGHV3-7, h IGHV1-2, hIGHV6-1; optionally, the framework region of the above-mentioned human IGHV genes comprises mutations; further optionally, the framework region of hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, and hIGHV1-2 genes comprises gene mutations resulting in the following amino acid mutations: the 4th amino acid in the FR2 region mutates to phenylalanine, the 11th amino acid mutates to glutamic acid, the 12th amino acid mutates to arginine, and the 14th amino acid mutates to glutamic acid;

[0060] Preferably, the human IGHV gene includes all the above-mentioned human IGHV genes.

[0061] Most preferably, the human IGHV gene includes all the above-mentioned human IGHV genes, wherein the framework regions of hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, and hIGHV1-2 genes include gene mutations that result in the following amino acid mutations: the 4th amino acid in the FR2 region mutates to phenylalanine, the 11th amino acid mutates to glutamate, the 12th amino acid mutates to arginine, and the 14th amino acid mutates to glutamate.

[0062] And / or, the human IGHD gene includes part or all of the human IGHD genes selected from the following:

[0063] hIGHD1-1, hIGHD2-2, hIGHD3-3, hIGHD4-4, hIGHD5-5, hIGHD6-6, hIGHD1-7, hIGHD2-8, hIGHD3-9, hIGHD3-10, hIGHD4-11, hIGHD5-12, hIGHD6-13, hIGHD1-14 , hIGHD2-15, hIGHD3-16, hIGHD4-17, hIGHD5-18, hIGHD6-19, hIGHD1-20, hIGHD2-21, hIGHD3-22, hIGHD4-23, hIGHD5-24, hIGHD6-25, hIGHD1-26, hIGHD7-27;

[0064] Preferably, the human IGHD gene includes all the above-mentioned human IGHD genes.

[0065] And / or, the human IGHJ gene is part or all of the human IGHJ genes selected from the following:

[0066] hIGHJ1, hIGHJ2, hIGHJ2P, hIGHJ3, hIGHJ4, hIGHJ5, hIGHJ3P, hIGHJ6;

[0067] Preferably, the human IGHJ genes include all the above-mentioned human IGHJ genes.

[0068] And / or, the endogenous IgHG gene of the non-human mammal is any one selected from the following:

[0069] (i) an endogenous complete IgHG2c gene of a non-human mammal, or an endogenous IgHG2c gene segment lacking the CH1 domain; or

[0070] (ii) endogenous complete IgHG3, IgHG1, IgHG2b and IgHG2c genes of a non-human mammal, or endogenous IgHG3, IgHG1, IgHG2b and IgHG2c gene segments lacking the CH1 domain.

[0071] When the endogenous IgHG gene of the non-human mammal is an endogenous complete IgHG gene of the non-human mammal, after antigen immunization, the humanized full antibody produced by it is; when the endogenous IgHG gene of the non-human mammal is an endogenous IgHG gene segment lacking the CH1 domain of the non-human mammal, after antigen immunization, the humanized single heavy chain antibody produced by it is.

[0072] In a preferred embodiment of the above specific embodiment, in step (2), the human IGHV gene, human IGHD gene, human IGHJ gene and endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of a non-human mammal are introduced by the following method:

[0073] Introduce into the mice obtained in step (1):

[0074] (I) one or more BAC clones comprising all of the human IGHV genes, human IGHD genes, and human IGHJ genes; and,

[0075] (II) one or more BAC clones comprising the endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of the non-human mammal.

[0076] Further preferably, in step (2), the human IGHV gene, human IGHD gene, human IGHJ gene and endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of a non-human mammal are introduced by the following method:

[0077] Two BAC clones were introduced into the mice obtained in step (1), wherein:

[0078] One BAC clone carries all of the human IGHV gene, human IGHD gene, and human IGHJ gene, and the other BAC clone carries all of the endogenous IgHG gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal; and the two BAC clones have 5 kb to 50 kb, preferably 5 kb to 20 kb, of gene homology sequence at each end to facilitate gene splicing through overlapping gene sequences.

[0079] Preferably, the genes contained in the two BAC clones are as shown in Table 13 or Table 15.

[0080] In the non-human mammal prepared according to the above preparation method, the human IGHV gene, human IGHD gene and human IGHJ gene are operably linked and can undergo VDJ rearrangement, and the human IGHV gene, human IGHD gene and human IGHJ gene that are operably linked and / or have undergone VDJ rearrangement are operably linked to the endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of the non-human mammal;

[0081] And / or, there is a switch region of endogenous IgHM of the human mammal between the human IGHJ gene and the endogenous IgHG gene of the non-human mammal.

[0082] In a third aspect, the present application provides a method for preparing a humanized whole antibody or single heavy chain antibody or nanobody that specifically binds to an antigen, the method comprising:

[0083] (1) exposing the genetically modified non-human mammal described in the first aspect or the genetically modified non-human mammal prepared by the preparation method described in the second aspect to an antigen;

[0084] (2) collecting B cells from the non-human mammal obtained in step (1), extracting RNA and reverse transcribing it into cDNA, amplifying antibody gene fragments using the cDNA as a template and cloning them into a phage display vector;

[0085] (3) allowing the phage vector obtained in step (2) to express the target antibody, panning the phage, enriching the phage expressing the target antibody and expressing the phage, and obtaining the target antibody, which is a humanized whole antibody or single heavy chain antibody; and

[0086] Optionally, (4) cloning the variable region fragment of the obtained single heavy chain antibody to obtain a humanized nanobody.

[0087] In a fourth aspect, the present application provides a method for preparing a humanized single heavy chain antibody or nanobody that specifically binds to an antigen, the method comprising:

[0088] (1) exposing the genetically modified non-human mammal described in the first aspect or the genetically modified non-human mammal prepared by the preparation method described in the second aspect to an antigen, and then collecting B cells;

[0089] (2) sequencing the nucleic acid encoding the immunoglobulin heavy chain variable region and optionally the light chain variable region in the B cells collected in step (1) to obtain the nucleic acid sequence of the heavy chain variable region and the light chain variable region of the humanized monoclonal antibody or the nucleic acid sequence of the heavy chain variable region of the humanized nanobody;

[0090] (3) expressing a humanized whole antibody or single heavy chain antibody that specifically binds to the antigen based on the sequence obtained in step (2); and

[0091] Optionally, (4) cloning the variable region fragment of the obtained single heavy chain antibody to obtain a humanized nanobody.

[0092] In a fifth aspect, the present application provides a method for obtaining a biological sample, the method comprising:

[0093] (1) exposing the genetically modified non-human mammal described in the first aspect or the genetically modified non-human mammal produced by the production method described in the second aspect to an antigen;

[0094] (2) Collecting biological samples from the animals.

[0095] Preferably, the biological sample is spleen tissue, spleen cells or B cells.

[0096] In a sixth aspect, the present application provides a biological sample obtained by the method described in the fifth aspect above. Beneficial effects

[0097] The genetically modified non-human mammals prepared according to the preparation method described in the present application have high immune titers and can efficiently produce humanized single heavy-chain antibodies or nanoantibodies after antigen immunization. It is an efficient humanized full antibody or single heavy-chain antibody or nanoantibody production platform; in addition, the preparation method of the non-human mammals described in the present application has a high efficiency in obtaining positive animals (up to about 15%), so that humanized mice with different antibody diversities can be easily prepared, and nanoantibody sequence diversity can be achieved using multiple strains of mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0098] One or more embodiments are exemplarily illustrated by the accompanying figures, and these exemplary illustrations do not limit the embodiments. The word "exemplary" is used herein to mean "serving as an example, example, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior or preferred over other embodiments.

[0099] Figure 1 is a schematic diagram of the target sites of the sgRNA for deleting the CH1 region of the mouse IgHM gene in Example 1; wherein the five-star symbols represent the positions of the upstream and downstream targets, respectively.

[0100] FIG2 is an agarose gel electrophoresis diagram of the sgRNA transcription products for deleting the CH1 region of the mouse IgHM gene in Example 1.

[0101] Figure 3 is an agarose gel electrophoresis diagram of the PCR products used to detect gene deletion in homozygous mice of the F2 generation and its offspring in Example 1; wherein the numbers 1 to 4 represent the clone numbers of the tested mice, "+" represents the homozygous positive control, "+ / -" represents the heterozygous control, "-" represents the wild mouse control, and "H2O" represents the water control.

[0102] Figure 4 is a schematic diagram of the target site of the sgRNA for deleting the Igkc gene of the mouse antibody gene light chain Igk in Example 2.

[0103] Figure 5 is an agarose gel electrophoresis diagram of the sgRNA transcription products of the Igkc gene that deletes the mouse antibody gene light chain Igk in Example 2.

[0104] Figure 6 is an agarose gel electrophoresis diagram of the PCR products used to detect gene deletion in homozygous mice of the F2 generation and its offspring in Example 2; wherein the numbers 1 to 5 represent the clone numbers of the tested mice, "+" represents the homozygous positive control, "-" represents the wild mouse control, and "H2O" represents the water control.

[0105] Figure 7 is a schematic diagram of the target sites of the sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ in Example 3; wherein the five-star symbols represent the positions of the upstream and downstream targets, respectively.

[0106] Figure 8 is an agarose gel electrophoresis diagram of the sgRNA transcription products of the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ deleted in Example 3; wherein, "5'Guide RNA" represents the Guide RNA at the Iglc2 position, and "3'Guide RNA" represents the Guide RNA at the Iglc1 position.

[0107] Figure 9 is an agarose gel electrophoresis diagram of the PCR products used to detect gene deletion in homozygous mice of the F2 generation and its offspring in Example 3; wherein the numbers 1 to 6 represent the mouse clone numbers tested, "+" represents the homozygous positive control, "+ / -" represents the heterozygous control, "-" represents the wild mouse control, and "H2O" represents the water control.

[0108] Figure 10 is a schematic diagram of the target of the sgRNA for deleting the fragment between CH1 and IgHA-CH1 of the mouse antibody gene heavy chain IgHM in Example 4; wherein the five-star symbols represent the positions of the upstream and downstream targets, respectively.

[0109] Figure 11 is an agarose gel electrophoresis diagram of the sgRNA transcription products for deleting the fragment between IgHM and IgHA-CH1 of the mouse antibody gene heavy chain in Example 4; wherein, "5'Guide RNA" represents the Guide RNA at the IgM position, and "3'Guide RNA" represents the Guide RNA at the IgHA position.

[0110] Figure 12 is an agarose gel electrophoresis diagram of the PCR products used to detect gene deletion in homozygous mice of the F2 generation and its offspring in Example 4; wherein the numbers 1 to 5 represent the clone numbers of the tested mice, "+" represents the homozygous positive control, "-" represents the wild mouse control, and "H2O" represents the water control.

[0111] Figure 13 is an agarose gel electrophoresis diagram of the PCR products used to identify the deletion of IgM (A), IgK (B) and IgL (C) genes in gene knockout mice in Example 5; wherein the numbers 1 to 9 represent the clone numbers of the tested mice, "+" represents the homozygous positive control, "+ / -" represents the heterozygous control, "-" represents the wild mouse control, and "H2O" represents the water control.

[0112] Figure 14 is an agarose gel electrophoresis diagram of the PCR products used to identify the deletion of the IgA (A), IgK (B) and IgL (C) genes in gene knockout mice in Example 6; wherein the numbers 1 to 3 represent the clone numbers of the tested mice, "+" represents the homozygous positive control, "-" represents the wild mouse control, and "H2O" represents the water control.

[0113] FIG15 is a schematic diagram of the structures of the gene segments introduced by the mini-1G protocol in Example 7.

[0114] Figures 16A-B are agarose gel electrophoresis images of PCR products used to identify the genotype of F1 generation IgM-KL-mini-1G heterozygous mice in Example 7; wherein, Figure A is a gel electrophoresis image for identifying gene introduction, and lanes H1-H16 represent PCR products amplified by H1-H16 primers, respectively, and the primer binding sites are all located on the two BACs of the mini-1G scheme; Figure B is a gel electrophoresis image for identifying gene deletion, and lanes M, K, and L are PCR products for identifying the deletion of the IgM, IgK, and IgL genes in gene knockout mice, respectively.

[0115] FIG17 is a schematic diagram of the structures of the gene segments introduced by the mini-4G protocol in Example 8.

[0116] Figure 18 is an agarose gel electrophoresis diagram of the PCR products used to identify the genotype of mini-4G mice in Example 8; wherein H1-H17 represent the PCR products amplified by H1-H17 primers, respectively, and the primer binding sites are both located on the two BACs in the mini-4G scheme.

[0117] 19A-C are graphs showing the titer detection results of three IgM homozygous mice immunized with OVA antigen in Example 9.

[0118] Figure 20 is a graph showing the results of a Western blotting experiment under reducing conditions of the serum of IgM knockout mice immunized with OVA antigen in Example 9; wherein, lane 1 represents the serum sample of C57BL / 6 wild-type mice after immunization, lane 2 represents the serum sample of IgM CH1 ko heterozygous mice after immunization, and lane 3 represents the serum sample of IgM CH1 ko homozygous mice after immunization. The bands above each lane represent the IgM heavy chain.

[0119] Figure 21 is a diagram showing the RT-PCR test results of spleen cells of IgM gene knockout mice immunized with OVA antigen in Example 9, wherein Figure A is a diagram showing the colony PCR results of the picked clones, and Figure B is a diagram showing the partial sequencing results of the picked clones.

[0120] Figure 22 is a graph showing the titer test results of IgA homozygous mice immunized with OVA (A) and CRP (B) antigens in Example 10.

[0121] Figure 23 is a graph showing the results of a Western blotting experiment under reducing conditions of the serum of IgA homozygous mice immunized with CRP antigen in Example 10; wherein, lanes 1 and 2 are serum samples of C57BL / 6 mice after immunization, respectively, and lane 3 is a serum sample of IgA homozygous mice after immunization.

[0122] Figure 24 is a graph showing the RT-PCR test results of spleen cells of IgA homozygous mice immunized with CRP antigen in Example 10, wherein Figure A is a graph showing the colony PCR results of the picked clones, and Figure B is a graph showing the partial sequencing results of the picked clones.

[0123] FIG25 is a graph showing the titer detection results of IgM-KL (A) and IgA-KL (B) homozygous mice immunized with OVA antigen in Example 11.

[0124] Figures 26A-C are respectively the Coomassie Brilliant Blue staining results of the sera of the four mice, IgM, IgM-KL, IgA and IgA-KL, immunized with OVA antigen in Example 11 (A), the immunoblotting results of Kappa chains in the serum (B), and the immunoblotting results of Lambda chains in the serum (C).

[0125] Figure 27 is a diagram showing the results of a serum Western blot experiment of IgM-KL-mini-1G mice immunized with OVA protein in Example 12; wherein, lanes 1 to 3 are serum samples of IgM-KL-mini-1G mice, and lanes 4 to 6 are serum samples of C57BL / 6 mice.

[0126] Figure 28 shows the genomic RT-PCR product of the IgM-KL-mini-1G heterozygous mouse prepared in Example 7 cloned into Agarose gel electrophoresis of colony PCR of Zero Cloning vector.

[0127] Figure 29 shows the genomic RT-PCR product of the mini-4G mouse prepared in Example 8 cloned into Agarose gel electrophoresis of colony PCR of Zero Cloning vector. DETAILED DESCRIPTION

[0128] To make the purpose, technical solutions, and advantages of the embodiments of this application more clear, the technical solutions in the embodiments of this application will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of this application, not all of them. Based on the embodiments of this application, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of this application.

[0129] In addition, in order to better illustrate the present application, numerous specific details are provided in the following detailed description. It should be understood by those skilled in the art that the present application can be implemented without certain specific details. In some embodiments, raw materials, components, methods, means, etc. well known to those skilled in the art are not described in detail in order to highlight the main purpose of the present application.

[0130] Unless expressly stated otherwise, throughout the specification and claims, the term "comprise" or variations such as "include" or "comprising", etc., will be understood to include the stated elements or components but not to exclude other elements or other components.

[0131] In addition, in the following examples, the mice used were C57BL / 6 mice purchased from Vital River. The starting age of the mice was 4 to 6 weeks old and weighed about 18 g to 22 g.

[0132] Example 1. Design of sgRNA for deleting the CH1 region of the mouse IgHM gene (hereinafter also referred to as "IgM gene"), preparation and identification of gene knockout mice (hereinafter referred to as "IgM mice" or "IgM homozygous mice")

[0133] To delete the CH1 region of the mouse IgHM gene, we selected two targets, one upstream and one downstream, within the first exon of the mouse IgHM gene, and designed a single sgRNA for each target. A schematic diagram of the sgRNA targets is shown in Figure 1, where the five-pointed stars indicate the locations of the upstream and downstream targets, respectively. The sequences of the two designed sgRNAs and their target sequences are shown in Table 1.

[0134] Construction of 1IgM mice:

[0135] 1.1 The specific steps include: sgRNA primer design, sgRNA in vitro transcription, mouse embryo injection and positive mouse identification.

[0136] 1.2 Experimental reagents:

[0137] MEGAshortscript TM Kit

[0138] MEGAclear TM Kit

[0139] Purification for Large Scale Transcription Reactions

[0140] 1.3 sgRNA Primer Design

[0141] Table 1

[0142] 1.4 Preparation of sgRNA Transcription Template

[0143] 1.4.1 The Taq-mix PCR system is shown in Table 2. Each sample was amplified in 20 μL × 2 tubes.

[0144] Table 2

[0145] 1.4.2 Touchdown procedure is shown in Table 3.

[0146] Table 3

[0147] The PCR products were recovered using a recovery kit and used for the next experiment, in vitro transcription.

[0148] 1.5 In vitro transcription

[0149] 1.5.1 Transcription system is shown in Table 4.

[0150] Table 4

[0151] The above transcription system was placed in a 37°C constant temperature incubator and incubated for 18 h.TM Kit Purification for Large Scale Transcription Reactions

[0152] 1.5.2 Agarose gel electrophoresis of sgRNA transcription products is shown in Figure 2.

[0153] 1.6 Implant cells containing the above sgRNA and Cas9 protein into the host animal:

[0154] Mice are ovulated, fertilized in vitro, and fertilized eggs are cultured. Then, the sgRNA and Cas9 protein are mixed and electroporated into the mouse fertilized eggs, or the Cas9 protein (or Cas9 mRNA, commercially available) is injected into the mouse fertilized eggs together with the sgRNA by microinjection.

[0155] Implanting the fertilized oocytes into surrogate mothers can produce F0 generation chimeric mice. Knockout individuals in the F0 generation of mice can be detected by extracting mouse tail genomic DNA, performing PCR amplification, and analyzing the PCR amplification products.

[0156] In the above PCR amplification, PCR primers mIghM-teko-1F and mIghM-teko-1R were designed at both ends of the deletion sequence, and their sequences are shown in Table 5.

[0157] Table 5

[0158] Analysis of the PCR amplification products includes agarose gel electrophoresis analysis and sequencing analysis to confirm whether the target sequence has been deleted.

[0159] According to the sequencing results of the PCR products, it was confirmed that the length of the deleted sequence was 323 bp. Therefore, the PCR products amplified with the above primers can detect both deleted genes and wild-type genes based on the size of the fragment. Among them, for the wild-type gene and the gene with the target sequence deleted, the target band sizes amplified by primers mIghM-teko-1F and mIghM-teko-1R were 907 bp and 584 bp, respectively (results not shown).

[0160] F0 chimeric mice with correct gene knockout were selected for subsequent breeding and identification.

[0161] 1.7 Breeding heterozygous and homozygous knockout mice:

[0162] F0 generation mice with the target gene knockout were mated with wild-type mice to obtain F1 generation mice. By extracting the mouse tail genome and performing PCR testing, F1 generation heterozygous mice with stable genetic knockout were selected. F1 generation heterozygous mice were then mated with each other to obtain F2 generation homozygous mice with the gene knockout, i.e., IgM homozygous mice. The resulting F2 generation and its homozygous offspring were genotyped using the same method as in step 1.6 above. Sequencing-identified homozygous and heterozygous mice were used as homozygous positive controls (lanes marked "+") and heterozygous controls (lanes marked "+ / -"), respectively. In addition, wild-type mouse controls (lanes marked "-") and negative controls without DNA template (also known as "water controls") were also set up. The results are shown in Figure 3.

[0163] FIG3 shows that, through the above-mentioned procedures, IgM homozygous mice were indeed obtained.

[0164] Example 2. Design of sgRNA for Deleting the Igkc Gene (hereinafter also referred to as "IgK Gene") of the Mouse Antibody Light Chain Gene Igk, Preparation and Identification of Knockout Mice (hereinafter referred to as "IgK Mice" or "IgK Homozygous Mice")

[0165] To knockout the mouse Igk gene, we selected a target site within an exon of the mouse Igkc gene and designed a single guide RNA (sgRNA) targeting this site. A schematic diagram of the sgRNA target site is shown in Figure 4 , and the sequence of the designed sgRNA and its target site are shown in Table 3 .

[0166] Construction of 2IgK mice:

[0167] 2.1 The specific steps include: sgRNA primer design, sgRNA in vitro transcription, mouse embryo injection and positive mouse identification.

[0168] 2.2 Experimental reagents:

[0169] MEGAshortscript TM Kit

[0170] MEGAclear TM Kit

[0171] Purification for Large Scale Transcription Reactions

[0172] 2.3 sgRNA Primer Design

[0173] Table 6

[0174] 2.4 Preparation of sgRNA Transcription Template

[0175] 2.4.1 Taq-mix PCR system is shown in Table 2 above. Each sample is amplified in 20 μL × 2 tubes.

[0176] 2.4.2 Touchdown procedure is shown in Table 3 above.

[0177] The PCR products were recovered using a recovery kit and used for the next experiment, in vitro transcription.

[0178] 2.5 In vitro transcription

[0179] 2.5.1 Transcription system See Table 4 above.

[0180] The above transcription system was placed in a 37°C constant temperature incubator and incubated for 18 h. TM Kit Purification for Large Scale Transcription Reactions

[0181] 2.5.2 Agarose gel electrophoresis of IgK-sgRNA transcription products is shown in Figure 5. Figure 5 shows that after the above transcription process, a single transcription product was obtained, namely IgK-sgRNA, which can be used for subsequent introduction procedures.

[0182] 2.6 Introducing the sgRNA and Cas9 protein into the host animal fertilized eggs:

[0183] Mice are ovulated, fertilized in vitro, and fertilized eggs are cultured. Then, the sgRNA and Cas9 protein are mixed and electroporated into the mouse fertilized eggs, or the Cas9 protein (or Cas9 mRNA, commercially available) is injected into the mouse fertilized eggs together with the sgRNA by microinjection.

[0184] Implanting the fertilized oocytes into surrogate mothers can produce F0 generation chimeric mice. Knockout individuals in the F0 generation of mice can be detected by extracting mouse tail genomic DNA, performing PCR amplification, and analyzing the PCR amplification products.

[0185] In the above PCR amplification, PCR primers KC-nF and KC-nR were designed on both sides of the deletion sequence, and their sequences are shown in Table 7.

[0186] Table 7

[0187] Analysis of the PCR amplification products included agarose gel electrophoresis and sequencing to confirm deletion of the target sequence. Sequencing of the PCR products confirmed that the deletion sequence was 76 bp in length. Therefore, the PCR products amplified with the above primers can detect both deleted and wild-type genes based on their fragment size. For the wild-type gene and the gene with the target sequence deleted, the target bands amplified with primers KC-nF and KC-nR were 299 bp and 223 bp, respectively (results not shown).

[0188] F0 chimeric mice with correct gene knockout were selected for subsequent breeding and identification.

[0189] 2.7 Breeding heterozygous and homozygous knockout mice:

[0190] F0 generation mice with the target gene knockout were mated with wild-type mice to obtain F1 generation mice. By extracting the mouse tail genome and performing PCR analysis, F1 generation heterozygous mice with stable hereditary knockout were selected. F1 generation heterozygous mice were then mated with each other to obtain F2 generation homozygous mice with the knockout gene, i.e., homozygous Igkc knockout mice. The resulting F2 generation and its homozygous offspring were genotyped using the same method as in step (2.6) above. The results are shown in Figure 6.

[0191] FIG6 shows that, through the above-mentioned procedures, IgK homozygous mice were indeed obtained.

[0192] Example 3. Design of sgRNA for Deleting the Segment Between IgLc2 and IgLc1 of the Mouse Antibody Light Chain Igλ Gene (hereinafter also referred to as the "IgL Gene"), Preparation and Identification of Knockout Mice (hereinafter referred to as "IgL Mice" or "IgL Homozygous Mice")

[0193] To delete the region between IgLc2 and IgLc1 in the mouse antibody light chain gene Igλ, we selected one target site upstream of the mouse Iglc2 exon and one target site downstream of the mouse Iglc1 exon, with one sgRNA designed for each target site. A schematic diagram of the sgRNA targets is shown in Figure 7, where the five-star symbols indicate the locations of the upstream and downstream targets, respectively. The sequences of the two designed sgRNAs and their target sites are shown in Table 8.

[0194] 3 Construction of IgL mice:

[0195] 3.1 The specific steps include: sgRNA primer design, sgRNA in vitro transcription, mouse embryo injection and positive mouse identification.

[0196] 3.2 Experimental reagents:

[0197] MEGAshortscriptTM Kit

[0198] MEGAclear TM Kit

[0199] Purification for Large Scale Transcription Reactions

[0200] 3.3 sgRNA Primer Design

[0201] Table 8

[0202] 3.4 Preparation of sgRNA Transcription Template

[0203] 3.4.1 Taq-mix PCR system is shown in Table 2 above. Each sample is amplified in 20 μL × 2 tubes.

[0204] 3.4.2 Touchdown procedure is shown in Table 3 above.

[0205] The PCR products were recovered using a recovery kit and used for the next step of in vitro transcription.

[0206] 3.5 In vitro transcription

[0207] 3.5.1 Transcription system See Table 4 above.

[0208] The above transcription system was placed in a 37°C constant temperature incubator and incubated for 18 h. TM Kit Purification for Large Scale Transcription Reactions Kit recovery.

[0209] 3.5.2 Agarose gel electrophoresis of sgRNA transcription products is shown in Figure 8. Figure 8 shows that after the above transcription process, single transcription products were obtained, namely the two sgRNAs designed based on the upstream and downstream targets as described above, which can be used for subsequent introduction procedures.

[0210] 3.6 Introducing the sgRNA and Cas9 protein into the host animal fertilized eggs:

[0211] Mice are ovulated, fertilized in vitro, and fertilized eggs are cultured. Then, the sgRNA and Cas9 protein are mixed and electroporated into the mouse fertilized eggs, or the Cas9 protein (or Cas9 mRNA, commercially available) is injected into the mouse fertilized eggs together with the sgRNA by microinjection.

[0212] Implanting the fertilized oocytes into surrogate mothers can produce F0 generation chimeric mice. Knockout individuals in the F0 generation of mice can be detected by extracting mouse tail genomic DNA, performing PCR amplification, and analyzing the PCR amplification products.

[0213] In the above PCR amplification, PCR primers LC2-nF1 and IgL-R2 were designed on both sides of the deletion sequence, and their sequences are shown in Table 9.

[0214] Table 9

[0215] Analysis of the PCR amplification products included agarose gel electrophoresis and sequencing to confirm deletion of the target sequence. Sequencing of the PCR products confirmed that the deletion sequence was approximately 137 kb in length, resulting in a PCR product of 1170 bp when amplified from the knockout mice using the aforementioned primers. PCR primer LC1-nF21 was designed near the 3' end of the deletion sequence. Primers LC1-nF21 and IgL-R2 were used to detect the target fragment without gene deletion, resulting in a PCR product of 1424 bp. The size of the PCR product fragment also confirmed whether it was the wild-type gene or a gene with the target sequence deleted.

[0216] F0 chimeric mice with correct gene knockout were selected for subsequent breeding and identification.

[0217] 3.7 Breeding heterozygous and homozygous knockout mice:

[0218] F0 generation mice with the target gene knockout were mated with wild-type mice to obtain F1 generation mice. By extracting the mouse tail genome and performing PCR analysis, F1 generation heterozygous mice with stable hereditary knockout were selected. F1 generation heterozygous mice were then mated with each other to obtain F2 generation homozygous mice with the gene knockout, i.e., homozygous Igkc knockout mice. The resulting F2 generation and its homozygous offspring were genotyped using the same method as in step (3.6) above. The results are shown in Figure 9.

[0219] FIG9 shows that, through the above-mentioned procedures, IgL homozygous mice were indeed obtained.

[0220] Example 4. Design of sgRNA to Delete the Fragment Between IgHM and IgHA-CH1 of the Mouse Antibody Gene Heavy Chain (hereinafter also referred to as "IgA Gene"), Preparation and Identification of Knockout Mice (hereinafter referred to as "IgA Mice" or "IgA Homozygous Mice")

[0221] To delete the segment between IgHM and IgHA-CH1 in the mouse antibody heavy chain gene, one target was selected upstream of the mouse IgHM exon and one target was selected downstream of exon 1 of the mouse IgHA gene, with one sgRNA designed for each target. A schematic diagram of the sgRNA targets is shown in Figure 10, where the five-star symbols indicate the locations of the upstream and downstream targets, respectively. The sequences of the two designed sgRNAs and their target sequences are shown in Table 10.

[0222] 4 Construction of IgA mice:

[0223] 4.1 Specific steps include: sgRNA primer design, sgRNA in vitro transcription, mouse embryo injection and positive mouse identification.

[0224] 4.2 Experimental reagents:

[0225] 4.2.1 MEGAshortscript TM Kit

[0226] 4.2.2 MEGAclear TM Kit

[0227] Purification for Large Scale Transcription Reactions

[0228] 4.3 sgRNA Primer Design

[0229] Table 10

[0230] 4.4 Preparation of sgRNA Transcription Template

[0231] 4.4.1 Taq-mix PCR system is shown in Table 2 above. Each sample is amplified in 20 μL × 2 tubes.

[0232] 4.4.2 Touchdown procedure is shown in Table 3 above.

[0233] The PCR products were recovered using a recovery kit and used for the next experiment, in vitro transcription.

[0234] 4.5 In vitro transcription

[0235] 4.5.1 Transcription system See Table 4 above.

[0236] The above transcription system was placed in a 37°C constant temperature incubator and incubated for 18 h. TM Kit Purification for Large Scale Transcription Reactions

[0237] 4.5.2 Agarose gel electrophoresis of IgA-sgRNA transcription products is shown in Figure 11. Figure 11 shows that after the above transcription process, single transcription products were obtained, namely the two sgRNAs designed based on the upstream and downstream targets as described above, which can be used for subsequent introduction procedures.

[0238] 4.6 Introducing the sgRNA and Cas9 protein into the host animal fertilized egg:

[0239] Mice are ovulated, fertilized in vitro, and fertilized eggs are cultured. Then, the sgRNA and Cas9 protein are mixed and electroporated into the mouse fertilized eggs, or the Cas9 protein (or Cas9 mRNA, commercially available) is injected into the mouse fertilized eggs together with the sgRNA by microinjection.

[0240] Implanting the fertilized oocytes into surrogate mothers produces F0 generation chimeric mice. Knockout individuals in the F0 generation are detected by extracting mouse tail genomic DNA, amplifying it through PCR, and performing gel electrophoresis and sequencing analysis on the PCR amplification products.

[0241] In the above PCR amplification, PCR primers IgA-KO-1F and IgA-KO / WT-1R were designed on both sides of the deletion sequence, and their sequences are shown in Table 11.

[0242] Table 11

[0243] The PCR amplification products were subjected to agarose gel electrophoresis analysis and sequencing analysis to confirm whether the target sequence was deleted.

[0244] Sequencing analysis of the PCR product confirmed that the deletion sequence was approximately 163 kb in length. The PCR product amplified from the knockout mouse using the aforementioned primers was 1170 bp in size. The PCR primer IgA-KO / WT-1R was designed near the 3' end of the deletion sequence. Primers IgA-WT-1F and IgA-KO / WT-1R were used to detect the target fragment without gene deletion, resulting in a PCR product of 724 bp. The size of the PCR product fragment also confirms whether it is the wild-type gene or a gene with the target sequence deleted.

[0245] F0 chimeric mice with correct gene knockout were selected for subsequent breeding and identification.

[0246] 4.7 Breeding heterozygous and homozygous knockout mice:

[0247] F0 generation mice with the target gene knocked out were mated with wild-type mice to obtain F1 generation mice. By extracting the mouse tail genome and performing PCR testing, F1 generation heterozygous mice with stable genetic knockout were selected. F1 generation heterozygous mice were then mated with each other to obtain F2 generation homozygous mice with positive knockout, i.e., homozygous mice with IgA knockout. The obtained F2 generation and its subsequent homozygous mice were genotyped using the same method as in step (4.6). At the same time, homozygous positive mice identified by sequencing served as homozygous positive controls (i.e., lanes marked with "+"). In addition, wild-type mouse controls (i.e., lanes marked with "-") and negative controls without DNA template (also known as "water controls") were also set up. The results are shown in Figure 12.

[0248] FIG12 shows that, through the above-mentioned procedures, IgA homozygous mice were indeed obtained.

[0249] Example 5. Preparation and identification of IgM, IgK, and IgL triple-knockout mice (referred to herein as "IgM-KL mice")

[0250] The IgM homozygous mice prepared in Example 1 were mated with the IgK homozygous mice prepared in Example 2 to obtain IgM-IgK heterozygous mice; synchronously, the IgM homozygous mice prepared in Example 1 were mated with the IgL homozygous mice prepared in Example 3 to obtain IgM-IgL heterozygous mice; then, the obtained IgM-IgK heterozygous mice were mated with IgM-IgL heterozygous mice to obtain IgM(+ / +)IgK(+ / -)IgL(+ / -) mice; finally, the IgM(+ / +)IgK(+ / -)IgL(+ / -) mice were self-pollinated to obtain IgM(+ / +)IgK(+ / +)IgL(+ / +) mice, which were named IgM-KL mice.

[0251] The target mouse strain was identified by extracting mouse tail genomic DNA, performing PCR amplification, and analyzing the amplified products by gel electrophoresis. Primers for identifying IgM, IgK, and IgL gene deletions were as described in Examples 1, 2, and 3, respectively. Homozygous and heterozygous mice with the corresponding knockout genes, as identified by sequencing, served as homozygous positive controls (lanes marked "+") and heterozygous controls (lanes marked "+ / -"), respectively. In addition, wild-type mouse controls (lanes marked "-") and negative controls without DNA template (also known as "water controls") were also included. The genotype identification results are shown in Figures 13A, 13B, and 13C.

[0252] Figures 13A, 13B, and 13C show that after the above procedures, IgM, IgK, and IgL triple-gene knockout mice were indeed obtained.

[0253] Example 6. Preparation and identification of IgA, IgK, and IgL triple-knockout mice (referred to herein as "IgA-KL mice")

[0254] The IgM-KL homozygous mice prepared in Example 5 were mated with the IgA homozygous mice prepared in Example 4 to obtain IgA-KL heterozygous mice; then, the obtained IgA-KL heterozygous mice were self-pollinated to obtain IgA(+ / +)IgK(+ / +)IgL(+ / +) mice, which were named IgA-KL mice.

[0255] The target mouse strain was identified by extracting mouse tail genomic DNA, performing PCR amplification, and analyzing the amplified products by gel electrophoresis. Primers for identifying IgA and IgK deletions were as described in Examples 4 and 2, respectively, and primers for identifying IgL deletions are shown in Table 12 below. Homozygous positive mice for the corresponding knockout genes, identified by sequencing, served as homozygous positive controls (lanes marked "+"). In addition, wild-type mouse controls (lanes marked "-") and negative controls without DNA template (also known as "water controls") were also included. The genotype identification results are shown in Figures 14A, 14B, and 14C.

[0256] Table 12

[0257] Figures 14A-C show that, through the above procedures, IgA, IgK, and IgL triple-knockout mice were indeed obtained.

[0258] Example 7. Preparation and identification of genetically modified IgM-KL-mini-1G mice of the present application

[0259] In this example, two modified BACs carrying all the human or mouse antibody gene sequences to be introduced were introduced into C57BL / 6J mice to produce mini-1G mice. The two modified BACs are named CH17-185P21-23V-1G and RP23-351J19-1G, respectively. The CH17-185P21-23V-1G BAC carries a total of 23 V genes, complete human D region genes, and J region genes. The RP23-351J19-1G contains mouse IgHG2c (a complete IgHG2c segment when producing traditional antibodies; an IgHG2c segment lacking CH1 when producing nanobodies; in this embodiment, an IgHG2c segment lacking CH1 is introduced), IgHE, IgHA, and LCR regions (35 kb) (detailed information on the genes carried by the two BACs is shown in Table 13). The two parts (i.e., the human J region and the mouse IgHG2c gene) are connected by the mouse IgHM Switch region, as shown in Figure 15.

[0260] The two BAC clones used above, CH17-185P21-23V-1G and RP23-351J19-1G, were obtained by modifying their respective original BAC clone strains (i.e., CH17-185P21 and RP23-351J19, purchased from Invitrogen (Shanghai) Trading Co., Ltd.). The specific modification methods are as follows.

[0261] First, a blank BAC strain was prepared into an electroporation competent state, and the pKD46-Tet plasmid (Wuhan Miaoling Biotechnology Co., Ltd., P7957) was electroporated into the competent state.

[0262] Next, for the BAC clone CH17-185P21-23V-1G, the 5' and 3' end fragments to be recombined (as shown in SEQ ID NO: 82 and 83, respectively) were constructed using OverLap-PCR or enzyme ligation methods, and the BAC bacteria carrying the pKD46-Tet plasmid were prepared into an electroporation competent state, and the above-mentioned 5' end fragment to be recombined was electroporated into the competent state, and the corresponding antibiotics were used for screening, and the positive clones were verified by colony PCR; then, the bacterial liquid of the BAC positive clone (i.e., the clone that recombined the 5' end fragment to be recombined) was prepared into an electroporation competent state, and the above-mentioned 3' end fragment to be recombined was electroporated into the competent state, and the corresponding antibiotics were used for screening, and the positive clones were verified by colony PCR. Finally, the positive BAC was extracted from the bacteria and confirmed by Fast-NGS sequencing.

[0263] For the BAC clone RP23-351J19-1G, the fragment to be recombined (as shown in SEQ ID NO: 84) was constructed using OverLap-PCR or enzyme ligation. The BAC bacteria carrying the pKD46-Tet plasmid were prepared into an electroporation competent state, and the above-mentioned fragment to be recombined was then electroporated into the competent state. The corresponding antibiotics were used for screening, and the positive clones were verified by colony PCR. Finally, the positive BAC was extracted from the bacteria and confirmed by Fast-NGS sequencing.

[0264] SEQ ID NO:82

[0265] SEQ ID NO:83

[0266] SEQ ID NO:84

[0267] Table 13. Detailed information on genes carried by each BAC

[0268] In Table 13, "mIgHG2c-CH1" represents the mIgHG2c gene sequence with the CH1 segment removed; and "*" indicates that the specified gene sequence has undergone a gene mutation that results in the following amino acid mutations: the 4th amino acid in the FR2 region is mutated to phenylalanine, the 11th amino acid is mutated to glutamic acid, the 12th amino acid is mutated to arginine, and the 14th amino acid is mutated to glutamic acid.

[0269] The specific procedures are as follows:

[0270] (1) Two BACs carrying all the human antibody gene sequences to be introduced were introduced into C57BL / 6J mice; specifically, the BAC plasmid was first extracted, and then the BAC backbone was cut off and purified using the corresponding restriction endonuclease. The purified BAC genes were mixed in equimolar amounts to prepare an injection solution, and then the injection solution was injected into the male pronucleus of the fertilized egg through the pronucleus, and finally transplanted into a surrogate mouse to obtain F0 generation mice with human antibody genes transferred into them; then, the introduced antibody gene sequence was identified by PCR, and the primers used were shown in Table 14.

[0271] Table 14

[0272] (2) The F0 generation mice introduced with the human antibody gene sequence obtained in step (1) were mated with the IgM-KL homozygous mice prepared in Example 5 to obtain F1 generation heterozygous mice. The F1 generation heterozygous mice that were positive for gene recombination and could be stably inherited were selected by extracting the mouse tail genome and performing PCR testing. Simultaneously, PCR testing was performed on mice with an IgM-KL background. The primers for identifying IgM and IgK deletions were as described in Examples 1 and 2, respectively, and the primers for identifying IgL deletions were as shown in Table 12.

[0273] The results are shown in Figures 16A and B. Figure 16A is a gel electrophoresis diagram for identifying gene introduction, and Figure 16B is a gel electrophoresis diagram for identifying gene deletion.

[0274] The above results show that all the above genes were successfully introduced, that is, IgM-KL-mini-1G heterozygous mice were successfully obtained in this example.

[0275] Example 8. Preparation and identification of genetically modified IgM-KL-mini-4G mice of the present application

[0276] In this example, two modified BACs carrying all the human or mouse antibody gene sequences to be introduced were introduced into C57BL / 6J mice to produce mini-4G mice. The two modified BACs were named CH17-185P21-23V-4G and RP23-351J19-4G respectively; The BAC carries a total of 23 V genes, complete human D region genes and J region genes. RP23-351J19-4G contains mouse IgHG3, IgHG1, IgHG2b and IgHG2c (when producing traditional antibodies, it is the complete IgHG3, IgHG1, IgHG2b and IgHG2c segments; when producing nanoantibodies, it is the IgHG3, IgHG1, IgHG2b and IgHG2c segments lacking CH1; in this embodiment, the IgHG3, IgHG1, IgHG2b and IgHG2c segments lacking CH1 are introduced), IgHE, IgHA and LCR regions (35kb) (detailed information on the genes carried by each BAC is shown in Table 15); the above two parts (i.e., between the human J region and the mouse IgHG2c gene) are connected by the Switch region of mouse IgHM. The schematic diagram is shown in Figure 17.

[0277] The two BAC clones CH17-185P21-23V-4G and RP23-351J19-4G used above were obtained by modifying their respective original BAC clone strains (i.e., CH17-185P21 and RP23-351J19, purchased from Invitrogen (Shanghai) Trading Co., Ltd.). The specific modification methods are as follows:

[0278] The method for obtaining the BAC clone CH17-185P21-23V-4G is almost the same as the method for obtaining CH17-185P21-23V-1G in Example 7, except that the 3'-end fragment to be recombined is different. The 3'-end fragment to be recombined used by CH17-185P21-23V-4G is shown in SEQ ID NO: 85; the method for obtaining the BAC clone RP23-351J19-4G is almost the same as the method for obtaining RP23-351J19-1G in Example 7, except that the fragment to be recombined is different. The fragment to be recombined used by RP23-351J19-4G is shown in SEQ ID NO: 86.

[0279] SEQ ID NO:85

[0280] SEQ ID NO:86

[0281] Table 15. Detailed information on genes carried by each BAC

[0282] In Table 15, "mIgHG3-CH1", "mIgHG1-CH1", "mIgHG2b-CH1" and "mIgHG2c-CH1" respectively represent the sequences of the corresponding genes after the CH1 segment is removed; and "*" indicates that the specified gene sequence has undergone a gene mutation that results in the following amino acid mutations: the 4th amino acid in the FR2 region is mutated to phenylalanine, the 11th amino acid is mutated to glutamic acid, the 12th amino acid is mutated to arginine and the 14th amino acid is mutated to glutamic acid.

[0283] The specific procedures are as follows:

[0284] (1) Two BACs carrying all the human antibody gene sequences to be introduced were introduced into C57BL / 6J mice; specifically, the BAC plasmid was first extracted, and then the BAC backbone was cut and purified using the corresponding restriction endonuclease. The purified BAC genes were mixed in equimolar amounts to prepare an injection solution, which was then injected into the male pronucleus of a fertilized egg through the pronucleus, and finally transplanted into a surrogate mouse to obtain F0 generation mice with human antibody genes transferred into them; then, the introduced antibody gene sequence was identified by PCR, and the primers used were shown in Table 16. The results are shown in Figure 18.

[0285] Table 16

[0286] The results in FIG18 show that all the above genes were successfully introduced, that is, mini-4G mice were successfully obtained in this example.

[0287] Example 9. Phenotypic Detection of IgM Gene-Edited Mice

[0288] (1) Antigen immune response and titer detection in IgM homozygous mice

[0289] Three IgM homozygous mice (prepared in Example 1) were immunized using OVA (chicken ovalbumin, purchased from Beijing Borsi Technology Co., Ltd.) as an antigen. The specific procedure was as follows:

[0290] Select mice aged 6-8 weeks, add an equal volume of Freund's complete adjuvant to the antigen, emulsify until it is insoluble in water, and then perform multiple subcutaneous injections on the mice. The initial immunization dose is 50 μg / mouse, and the injection volume is 0.2 mL / mouse.

[0291] Two weeks after the initial immunization, the second subcutaneous immunization was performed. The antigen was emulsified with an equal volume of Freund's incomplete adjuvant and then injected subcutaneously at multiple points into the mice. The injection dose was reduced to 25 μg / mouse and the injection volume was 0.2 mL / mouse.

[0292] Blood was collected on days 0, 17, and 24, respectively. Plates were coated with goat anti-mouse IgM polyclonal antibody, and the IgM antibody titer in the serum was detected using biotin-labeled antigen and HRP-Streptavidin. The results of the antigen immune titer experiment of three IgM homozygous mice are shown in Figures 19A, 19B, and 19C, respectively.

[0293] As shown in Figures 19A-C, after three OVA immunizations, the IgM antibody titers in the sera of three IgM homozygous mice increased, but the overall titers were very low.

[0294] (II) Western blotting of serum from IgM knockout mice immunized with CRP

[0295] CRP (i.e., human C-reactive protein, purchased from Baiqiao Ruijing) antigen affinity column material was prepared according to the instructions for use of CNBr-activated Sepharose™ 4B (purchased from GE, catalog number 17043001). The volume of CRP-Sepharose filler was set to 1.5 mL with 1.5 mg of CRP antigen.

[0296] One C57BL / 6 wild-type mouse (purchased from Vital River), one IgM heterozygous mouse (F1 generation heterozygous mouse prepared in Example 1), and one IgM homozygous mouse (F2 generation homozygous mouse prepared in Example 1) aged 6-8 weeks were immunized with CRP (the immunization process was the same as for OVA immunization). Seven days after the third immunization, 20-50 μL of blood was collected from the mice, allowed to clot at room temperature for approximately 30 minutes, and serum was collected after centrifugation. One μL of each sample was added to 100 μL of PBS, followed by 10 μL of CRP-Sepharose filler. After reacting at room temperature for 60 minutes, the mixture was centrifuged at 6000 rpm for 30 seconds, and the supernatant was discarded. The filler was washed three times with PBS, resuspended in 10 μL of PBS, and boiled. The cells were subjected to 12% SDS-PAGE electrophoresis, transferred to a PVDF membrane for blocking, and then reacted with a goat anti-mouse IgM antibody (Sigma, ISO2-1KT) and further developed. The results are shown in Figure 20.

[0297] As shown in Figure 20, after immunization with CRP antigen, IgM antibodies that specifically react with antigen CRP were detected in the sera of C57BL / 6 wild-type mice (lane 1), IgM CH1 ko heterozygous mice (lane 2), and IgM CH1 ko homozygous mice (lane 3). Under reducing conditions, the size of the IgM heavy chain of homozygous mice was 60KD, which was significantly smaller than the 78KD IgM heavy chain of wild-type mice, proving that the CH1 domain was successfully knocked out in the IgM mouse strain.

[0298] (III) RT-PCR detection of IgM knockout mice immunized with CRP

[0299] Splenocytes were obtained from the IgM homozygous mice in (2) above that had been immunized three times with CRP antigen. Total RNA was extracted with Trizol and reverse transcribed to obtain cDNA. The variable region and the portion of the CH2 gene connected thereto were amplified using primers specific for the IgM subtype antibody. The upstream primer was the MHV1-12 mixed primer, and the downstream primer was IgHM-CH2-R4. The primers used and their sequences are shown in Table 17, wherein the variable bases S, Y, R, W, M, and K are as defined in the art. Specifically, S is G or C, Y is C or T, R is A or G, W is A or T, M is A or C, and K is G or T.

[0300] Table 17

[0301] The PCR reaction system is shown in Table 18.

[0302] Table 18

[0303] The PCR reaction program is shown in Table 19.

[0304] Table 19

[0305] Ligation of PCR amplification products The zero cloning vector was used to transform the TOP10 strain and plate it (ampicillin resistance). One clone was selected for colony PCR, and the results are shown in Figure 21A. This positive clone was sequenced, and the sequencing results showed that the IgM antibody heavy chain variable region FR4 was directly connected to CH2 (starting amino acid sequence AVAEMN) in the IgM homozygous mice, as shown in Figure 21B. This indicates that the genomic IgM CH1 exon was successfully knocked out.

[0306] Example 10. Phenotypic Detection of IgA Gene-Edited Mice

[0307] (1) Antigen immune response and titer detection in IgA homozygous mice

[0308] IgA homozygous mice (prepared in Example 4) were immunized with CRP (human C-reactive protein) and OVA (chicken ovalbumin) as antigens, respectively. The immunization method was as follows:

[0309] Select 6-8 week old mice and emulsify the antigen protein with an equal volume of Freund's complete adjuvant until it is insoluble in water. This is then administered subcutaneously at multiple sites. The initial immunization dose is 50 μg / mouse in a 0.2 mL injection volume. Subsequent subcutaneous immunizations are performed every two weeks with the antigen protein emulsified with an equal volume of Freund's incomplete adjuvant and injected subcutaneously at multiple sites. The dose is reduced to 25 μg / mouse in a 0.2 mL injection volume.

[0310] The serum titer detection method is as follows: the antigen protein is diluted to 2 μg / mL, 100 μL is added to the polystyrene enzyme-linked detection plate, and the specific IgA antibodies bound to the antigen protein in the serum are detected using Biotin-goat anti-mouse IgA (Abcam, ab97231).

[0311] The results are shown in Figures 22A and 22B, which show that blood was collected on the 8th day after the third immunization with the antigen protein, and the serum titer was detected by ELISA, which showed that there was basically no IgA antibody specifically binding to the antigen protein in the IgA-CH1-KO homozygous mice, and the serum titer did not exceed 1:400.

[0312] (II) Western blot analysis of serum from CRP-immunized IgA homozygous mice

[0313] CRP antigen affinity column material was prepared according to the instructions of CNBr-activated Sepharose™ 4B (purchased from GE, product number 17043001). The volume of CRP-Sepharose filler was set to 1.5 mL for 1.5 mg of CRP antigen.

[0314] Two 6-8 week old C57BL / 6 wild-type mice and one IgA homozygous mouse (prepared according to Example 4) were immunized with CRP (human C-reactive protein) using the same immunization procedure as described in Section 1 above. Seven days after the third immunization, 20-50 μL of blood was collected from the mice, allowed to clot at room temperature for approximately 30 minutes, and centrifuged to collect serum. For each sample, 2 μL of serum was added to 100 μL of PBS and 10 μL of CRP-Sepharose filler. The mixture was reacted at room temperature for 60 minutes, centrifuged at 6000 rpm for 30 seconds, and the supernatant discarded. The filler was washed three times with PBS, resuspended in 10 μL of PBS, and boiled. The cells were subjected to 12% SDS-PAGE electrophoresis, transferred to a PVDF membrane for blocking, and then reacted with goat anti-mouse IgG Fc HRP (JACKSON, 115-035-071) and further developed.

[0315] According to the design of the present application, because the genes of mouse IgM, IgD, IgG, IgE are knocked out, and the CH1 gene of IgA heavy chain is knocked out, IgA mice will only produce IgA heavy chain antibodies (without CH1 domain) with antigen protein immunity, and IgA single heavy chain molecular weight is about 40KD. After the steps such as separation, electrophoresis, color development, the antibody produced by C57BL / 6 wild-type mice and IgA homozygous mice after antigen protein immunity, the results are as shown in Figure 23. Figure 23 is the Western blotting of mouse serum under reducing conditions, wherein, lanes 1 and 2 are C57BL / 6 mouse serum samples after immunity, and lane 3 is IgA homozygous mouse serum sample after immunity; The result shows that the antibody produced by IgA homozygous mice is consistent with expectation, proving that the gene sequence knockout between CH1 of mouse genome IgHM to IgHA-CH1 is successful.

[0316] (III) RT-PCR detection of spleen cells from IgA homozygous mice immunized with CRP

[0317] Splenocytes were collected from the IgA homozygous mice that had been immunized three times with CRP antigen in step (2) above. Total RNA was extracted with Trizol and reverse transcribed to obtain cDNA. The variable region and the portion of the CH2 gene connected thereto were amplified using primers specific for IgA subtype antibodies. The upstream primer was an MHV1-12 mixed primer (for the sequences of each primer, see Table 16 above), and the downstream primer was IgHA-CH2-R3 (sequence: CTGCATCCTTCCCAGTGGAG, i.e., SEQ ID NO: 77).

[0318] The PCR reaction system is as shown in Table 18 above (except that the downstream primers are different).

[0319] The PCR reaction procedure was the same as that in Table 19 above.

[0320] Ligation of PCR amplification products The zero cloning vector was used to transform the TOP10 strain and plate it (ampicillin resistance). Four clones were selected for colony PCR, and the results are shown in Figure 24A. These four positive clones were sequenced, and partial sequencing results are shown in Figure 24B. These partial sequencing results show that the IgA antibody heavy chain variable region FR4 is directly connected to CH2 in IgA homozygous mice, indicating that the gene sequence between CH1 and IgHA-CH1 in the mouse genome was successfully knocked out.

[0321] Example 11 Phenotypic Detection of IgM-KL & IgA-KL Homozygous Mice

[0322] (1) Antigen immune response and titer detection in IgM-KL & IgA-KL homozygous mice

[0323] Wild-type C57BL / 6, IgM-KL homozygous mice (prepared in Example 5), IgA homozygous mice (prepared in Example 4, as a control), and IgA-KL (prepared in Example 6) homozygous knockout mice were immunized with OVA (chicken ovalbumin) respectively. The specific procedures are as follows:

[0324] Select mice aged 6-8 weeks, add an equal volume of Freund's complete adjuvant to the antigen, emulsify until it is insoluble in water, and then perform multiple subcutaneous injections on the mice. The initial immunization dose is 50 μg / mouse, and the injection volume is 0.2 mL / mouse.

[0325] Two weeks after the initial immunization, the second subcutaneous immunization was performed. The antigen was emulsified with an equal volume of Freund's incomplete adjuvant and then injected subcutaneously at multiple points into the mice. The injection dose was reduced to 25 μg / mouse and the injection volume was 0.2 mL / mouse.

[0326] The serum titer detection method is as follows: the antigen protein is diluted to 2 μg / mL, 100 μL is added to the polystyrene enzyme-linked detection plate, and the specific IgA antibodies binding to the antigen protein in the serum are detected using goat anti-mouse IgM antibody (Sigma, ISO2-1KT) for IgM-KL mice and Biotin-goat anti-mouse IgA (Abcam, ab97231) for IgA-KL mice.

[0327] The results are shown in Figures 25A and 25B, which show that blood was collected on the 8th day after the third immunization with the antigen protein, and the serum titer detection by ELISA showed that there were basically no antibodies specifically binding to the antigen protein in the IgM-KL and IgA-KL homozygous mice, and the serum titer did not exceed 1:400.

[0328] (II) Western blotting of serum from OVA-immunized IgM-KL & IgA-KL homozygous mice

[0329] The serum of IgM, IgM-KL, IgA, and IgA-KL mice, which had been immunized three times with OVA, was stained with Coomassie Brilliant Blue to examine protein abundance. The results are shown in Figure 26A.

[0330] In each experimental group, 0.5 μL of serum samples were loaded. After denaturation by boiling, the samples were applied to a 12% SDS-PAGE gel for electrophoresis. After blocking with PVDF, the membrane was transferred to a goat anti-mouse Kappa polyclonal antibody (HRP* Polyclonal Goat Anti-Mouse Kappa, C030214) and a goat anti-mouse Lamda polyclonal antibody (HRP* Polyclonal Goat Anti-Mouse Lamda, C030213) from Rebo Biotechnology (Shanghai) Co., Ltd. to detect light chain protein expression in the serum of the mice. The results are shown in Figures 26B and 26C.

[0331] As can be seen from Figures 26B and 26C, after antigen immunization, Kappa and Lamda antibodies that specifically react with the antigen OVA were detected in both IgM (lane 1) and IgA mice (lane 3), while Kappa and Lamda antibodies that specifically react with the antigen OVA were not detected in both IgM-KL (lane 2) and IgA-KL mice (lane 4), demonstrating that the light chain protein was completely knocked out in IgM-KL and IgA-KL mice.

[0332] Example 12 Phenotypic Detection of IgM-KL-mini-1G Heterozygous Mice

[0333] (I) Western blot analysis of serum from IgM-KL-mini-1G heterozygous mice

[0334] Three IgM-KL-mini-1G heterozygous mice prepared in Example 7 were immunized with OVA protein. Mice aged 6-8 weeks were selected. The OVA antigen was prepared into a solution with a concentration of 500 ng / μL using sodium chloride injection and injected intraperitoneally into the mice at an injection dose of 200 μL / mouse.

[0335] Western blot analysis was performed on sera from three IgM-KL-mini-1G mice immunized with OVA 72 hours later and three unimmunized C57BL / 6 mice to verify whether human-mouse chimeric single heavy chain antibodies were expressed in IgM-KL-mini-1G heterozygous mice.

[0336] In each group of experiments, 1 μL of serum sample was loaded. After boiling and denaturation, the sample was spotted onto a 12% SDS-PAGE gel for electrophoresis. After blocking with PVDF, goat anti-mouse IgG Fc HRP (JACKSON, 115-035-071) was used to detect the expression of human-mouse chimeric nanobody protein in the mouse serum. The results are shown in Figure 27, where lanes 1 to 3 represent serum samples from IgM-KL-mini-1G mice and lanes 4 to 6 represent serum samples from C57BL / 6 mice.

[0337] As can be seen from Figure 27, human-mouse chimeric nanoantibodies and mouse complete antibody proteins were detected in IgM-KL-mini-1G heterozygous mice immunized with OVA antigen, while only mouse complete antibody proteins were detected in unimmunized C57BL / 6 mice, demonstrating that human-mouse chimeric single heavy chain antibodies were expressed in IgM-KL-mini-1G mice.

[0338] (II) RT-PCR detection of IgM-KL-mini-1G heterozygous mice immunized with OVA

[0339] Peripheral blood was collected from the three IgM-KL-mini-1G heterozygous mice immunized with OVA antigen in the above (1), and total RNA was extracted using Trizol and reverse transcribed to obtain cDNA. Three degenerate primers of the human V gene were combined with one primer of mouse IgHG, and PCR amplification was performed using the cDNA of the sample as a template. The primers used and their sequences are shown in Table 20; in Table 20, the variable bases S, Y, R, W, M, and K are as defined in the art, specifically, S is G or C, Y is C or T, R is A or G, W is A or T, M is A or C, and K is G or T.

[0340] Table 20

[0341] The PCR reaction system is shown in Table 21.

[0342] Table 21

[0343] The PCR reaction program is shown in Table 22.

[0344] Table 22

[0345] Ligation of PCR amplification products Zero Cloning vector, transform TOP10 strain and apply LB plate (cannabinoid resistance), pick single clones for colony PCR, the results are shown in Figure 28. The positive clones were sequenced, and the sequencing results and human immunoglobulin sequences were analyzed by bioinformatics technology to identify the expression of human VH genes after V (D) J recombination. Among the 60 valid sequencing results of IgM-KL-mini-1G immunized mouse samples, 11 VH gene expressions were detected (Table 23). Among these gene segments, some VH genes are located near the constant region, while others are far away from the constant region. The data results in Table 23 show that the human VH gene on the human-mouse chimeric nanoantibody gene transferred by the mini-1G scheme can be rearranged and expressed in IgM-KL heterozygous background mice.

[0346] Table 23

[0347] Example 13 Phenotypic Detection of Mini-4G F0 Mice

[0348] Peripheral blood was collected from five mini-4G F0 mice (prepared as in Example 8), and total RNA was extracted using Trizol and reverse transcribed to obtain cDNA. Three degenerate primers for the human V gene were combined with one primer for the mouse IgHG gene, and PCR amplification was performed using the sample cDNA as a template. The primer sequences used are shown in Table 20.

[0349] Ligation of PCR amplification products Zero Cloning vector, transform TOP10 strain and apply LB plate (cannabinoid resistance), pick single clones for colony PCR, the results are shown in Figure 29. The positive clones were sequenced, and the sequencing results and human immunoglobulin sequences were analyzed by bioinformatics technology to identify the expression of human VH genes after V (D) J recombination. Among the 66 valid sequencing results of mini-4G mice, 11 VH gene expressions were detected (Table 24). Among these gene segments, some VH genes are located near the constant region, while others are far away from the constant region. The data results in Table 24 show that the human VH gene on the human-mouse chimeric nanoantibody gene transferred by the mini-4G scheme can be rearranged and expressed in C57BL / 6 background mice.

[0350] Table 24

[0351] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit them. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the present application. Industrial Applicability

[0352] The non-human mammals prepared according to the present application can efficiently produce humanized full antibodies or single heavy-chain antibodies or nanobodies after antigen immunization, and have high immune titers. In addition, the preparation method of the present application can obtain positive animals with high efficiency, so that humanized mice with different antibody diversities can be easily prepared, and nanoantibody sequence diversity can be achieved using multiple strains of mice, which has excellent industrialization prospects.

Claims

1. A method for preparing a genetically modified non-human mammal, characterized in that: The preparation method comprises the following steps: (1) disrupting the endogenous heavy chain immunoglobulin locus in a non-human mammal; and, (2) introducing the human IGHV gene, human IGHD gene, human IGHJ gene, and the endogenous IgHG gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal into the genetically modified non-human mammal obtained in step (1); in: The human IGHV gene includes part or all of the human IGHV genes selected from the following: hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, hIGHV1-2, hIGHV3-74, hIGHV3-72, hIGHV3 -66, hIGHV3-64, hIGHV3-35, hIGHV3-30, hIGHV3-20, hIGHV3-16, hIGHV3-15, hIGHV3-13, hIGHV3-33, hIGHV3-23, hIGHV3-7, h IGHV1-2, hIGHV6-1; optionally, the framework region of the above-mentioned human IGHV genes comprises mutations; further optionally, the framework region of hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, and hIGHV1-2 genes comprises gene mutations resulting in the following amino acid mutations: the 4th amino acid in the FR2 region mutates to phenylalanine, the 11th amino acid mutates to glutamic acid, the 12th amino acid mutates to arginine, and the 14th amino acid mutates to glutamic acid; And / or, the human IGHD gene includes part or all of the human IGHD genes selected from the following: hIGHD1-1, hIGHD2-2, hIGHD3-3, hIGHD4-4, hIGHD5-5, hIGHD6-6, hIGHD1-7, hIGHD2-8, hIGHD3-9, hIGHD3-10, hIGHD4-11, hIGHD5-12, hIGHD6-13, hIGHD1-14 , hIGHD2-15, hIGHD3-16, hIGHD4-17, hIGHD5-18, hIGHD6-19, hIGHD1-20, hIGHD2-21, hIGHD3-22, hIGHD4-23, hIGHD5-24, hIGHD6-25, hIGHD1-26, hIGHD7-27; And / or, the human IGHJ gene is part or all of the human IGHJ genes selected from the following: hIGHJ1, hIGHJ2, hIGHJ2P, hIGHJ3, hIGHJ4, hIGHJ5, hIGHJ3P, hIGHJ6; And / or, the endogenous IgHG gene of the non-human mammal is any one selected from the following: (i) an endogenous complete IgHG2c gene of a non-human mammal, or an endogenous IgHG2c gene segment lacking the CH1 domain; or (ii) endogenous complete IgHG3, IgHG1, IgHG2b and IgHG2c genes of a non-human mammal, or endogenous IgHG3, IgHG1, IgHG2b and IgHG2c gene segments lacking the CH1 domain.

2. The preparation method according to claim 1, characterized in that The non-human mammal is a mouse, and in step (1), the disruption of the endogenous heavy chain immunoglobulin locus comprises deletion of the following gene segments: The CH1 fragment of the mouse antibody gene heavy chain IgHM, the Igkc fragment of the mouse antibody gene light chain Igk, and the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ.

3. The preparation method according to claim 2, characterized in that The gene fragment is deleted by CRISPR-Cas9 gene editing technology; Among them, the sgRNA for deleting the CH1 fragment of the mouse antibody gene heavy chain IgHM includes the sgRNA shown in SEQ ID NO: 1 and SEQ ID NO: 2; and / or, the sgRNA for deleting the Igkc fragment of the mouse antibody gene light chain Igk includes the sgRNA shown in SEQ ID NO: 3; and / or, the sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ includes the sgRNA shown in SEQ ID NO: 4 and SEQ ID NO:

5.

4. The preparation method according to claim 1, characterized in that The non-human mammal is a mouse, and in step (1), the disruption of the endogenous heavy chain immunoglobulin locus comprises deletion of the following gene segments: The fragments of the mouse antibody gene heavy chain range from IgHM to IgHA-CH1, the Igkc fragment of the mouse antibody gene light chain Igk, and the fragments of the mouse antibody gene light chain Igλ range from IgLc2 to IgLc1.

5. The preparation method according to claim 4, characterized in that The gene fragment is deleted by CRISPR-Cas9 gene editing technology; Among them, the sgRNA for deleting the fragment between IgHM and IgHA-CH1 of the mouse antibody gene heavy chain includes the sgRNA shown in SEQ ID NO: 1 and SEQ ID NO: 6; and / or, the sgRNA for deleting the Igkc fragment of the mouse antibody gene light chain Igk includes the sgRNA shown in SEQ ID NO: 3; and / or, the sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ includes the sgRNA shown in SEQ ID NO: 4 and SEQ ID NO:

5.

6. The preparation method according to claim 1, characterized in that In step (2), the human IGHV gene, human IGHD gene, human IGHJ gene and endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of the non-human mammal are introduced by the following method: Introduce into the mice obtained in step (1): (I) one or more BAC clones containing all of the human IGHV genes, human IGHD genes, and human IGHJ genes; and, (II) one or more BAC clones comprising the endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of the non-human mammal.

7. The preparation method according to claim 6, characterized in that In step (2), the human IGHV gene, human IGHD gene, human IGHJ gene and endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of the non-human mammal are introduced by the following method: Two BAC clones were introduced into the mice obtained in step (1), wherein: One BAC clone carries all of the human IGHV gene, human IGHD gene, and human IGHJ gene, and the other BAC clone carries all of the endogenous IgHG gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal; and the two BAC clones have 5 kb to 50 kb, preferably 5 kb to 20 kb, of gene homology sequence at each end to facilitate gene splicing through overlapping gene sequences. Preferably, the genes contained in the two BAC clones are as shown in Table 13 or Table 15.

8. The preparation method according to claim 7, characterized in that The human IGHV gene, human IGHD gene and human IGHJ gene are operably linked and can undergo VDJ rearrangement, and the human IGHV gene, human IGHD gene and human IGHJ gene that are operably linked and / or have undergone VDJ rearrangement are operably linked to the endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of the non-human mammal; And / or, a switch region of endogenous IgHM of a human mammal exists between the human IGHJ gene and the endogenous IgHG gene of the non-human mammal.

9. A method for preparing a humanized whole antibody, single heavy chain antibody or nanobody that specifically binds to an antigen, the method comprising: (1) exposing the genetically modified non-human mammal produced by the production method according to any one of claims 1 to 8 to an antigen; (2) collecting B cells from the non-human mammal obtained in step (1), extracting RNA and reverse transcribing it into cDNA, amplifying antibody gene fragments using the cDNA as a template and cloning them into a phage display vector; (3) allowing the phage vector obtained in step (2) to express the target antibody, panning the phage, enriching the phage expressing the target antibody and expressing the phage, and obtaining the target antibody, which is a humanized whole antibody or single heavy chain antibody; and Optionally, (4) cloning the variable region fragment of the obtained single heavy chain antibody to obtain a humanized nanobody.

10. A method for preparing a humanized whole antibody, single heavy chain antibody or nanobody that specifically binds to an antigen, the method comprising: (1) exposing the genetically modified non-human mammal produced by the production method according to any one of claims 1 to 8 to an antigen, and then collecting B cells; (2) sequencing the nucleic acid encoding the immunoglobulin heavy chain variable region and optionally the light chain variable region in the B cells collected in step (1) to obtain the nucleic acid sequence of the heavy chain variable region and the light chain variable region of the humanized monoclonal antibody or the nucleic acid sequence of the heavy chain variable region of the humanized nanobody; (3) expressing a humanized whole antibody or single heavy chain antibody that specifically binds to the antigen based on the sequence obtained in step (2); and Optionally, (4) cloning the variable region fragment of the obtained single heavy chain antibody to obtain a humanized nanobody.

11. A method for obtaining a biological sample, the method comprising: (1) exposing the genetically modified non-human mammal produced by the production method according to any one of claims 1 to 8 to an antigen; (2) Collecting biological samples from the animals.

12. The method according to claim 11, characterized in that The biological sample is spleen tissue, spleen cells or B cells.

13. A biological sample obtained by the method according to claim 11 or 12.

Citation Information

Patent Citations

  • Genetically modified non-human animals with humanized immunoglobulin locus

    CN112400022A

  • Preparation method and application of non-human mammal or progeny thereof

    CN114134144A

  • Recombinant genomes, non-human mammalian cells, and methods of production and uses thereof

    CN114763558A

  • Preparation method and application of genetically modified non-human mammal

    CN117587070A

  • Antibody production

    US20160295842A1