Composition comprising furin-inhibited car macrophages and uses thereof

Abstract

CAR macrophages (CAR-M) can phagocyte tumor cells expressing a target antigen. It is herein shown that the proprotein convertase furin is over-expressed in human primary macrophages in the presence of tumor cells, which is a way to redirect these macrophages towards an anti-inflammatory phenotype. Conversely, inhibition of furin leads to the maintenance of their pro-inflammatory phenotype, even in a tumor cell environment. The present invention proposes to use furin-inhibited CAR-M derived from primary blood monocytes as a therapeutic strategy to treat solid tumors. Surprisingly, the generated furin-inhibited CAR-M display enhanced anti-tumor phagocytic activity against breast cancer cell lines and breast cancer patient-derived tumoroids and a persistent pro-inflammatory phenotype compared to furin-expressing CAR-M. Moreover, it was found that furin-inhibited CAR-M secreted factors can enhance T-cell proliferation and can thereby modulate the tumor microenvironment. Furin-inhibited CAR-M therefore represent a second-generation CAR-M therapeutic strategy for solid tumors.

Description

[0001]Composition comprising Furin-inhibited CAR macrophages and uses thereof SUMMARY OF THE INVENTION CAR macrophages (CAR-M) can phagocyte tumor cells expressing a targetantigen. It is herein shown that the proprotein convertase furin is over-expressed inhuman primary macrophages in the presence of tumor cells, which is a way to redirectthese macrophages towards an anti-inflammatory phenotype. Conversely, inhibition offurin leads to the maintenance of their pro-inflammatory phenotype, even in a tumor cellenvironment. The present invention proposes to use furin-inhibited CAR-M derived fromprimary blood monocytes as a therapeutic strategy to treat solid tumors. Surprisingly, thegenerated furin-inhibited CAR-M display enhanced anti-tumor phagocytic activity against breast cancer cell lines and breast cancer patient-derived tumoroids and a persistentpro-inflammatory phenotype compared to furin-expressing CAR-M. Moreover, it wasfound that furin-inhibited CAR-M secreted factors can enhance T-cell proliferation andcan thereby modulate the tumor microenvironment. Furin-inhibited CAR-M thereforerepresent a second-generation CAR-M therapeutic strategy for solid tumors. BACKGROUND OF THE INVENTION Chimeric antigen receptor (CAR) cell therapy has revolutionized the treatment ofhematological cancers (Gill, S. & Brudno, J. N. Am. Soc. Clin. Oncol. Educ. book. Am.Soc. Clin. Oncol. Annu. Meet. 41, e246–e265 (2021)). However, this therapy remainsineffective in the context of solid tumors due to a number of physical and biological constraints. The main effector cells used in CAR therapies to date are T lymphocytes. In solid tumors, T lymphocytes have difficulty infiltrating a dense and complex environmentand are sensitive to local immunosuppression, which reduces their anti-tumor activity.To overcome these obstacles, alternative immune effector cells that can be engineered to express a CAR molecule, such as CAR macrophages (CAR-M), are being investigated(Maalej, K. M. et al. Mol. Cancer 202322122, 1–54 (2023)). Macrophages are innateimmune cells at the interface between innate and adaptive immunity, with phagocyticactivity. They are known to have numerous and important functions, including inductionof immune responses in acute phases, regulation of hematopoiesis, activation of the immune system, coagulation, destruction of organisms and of tumor cells and tissuerepair and wound healing. Monocytes-macrophages can also be used in adoptiveimmunotherapy for the treatment of some types of cancer in humans. Typically, thesecells can be purified from the circulating blood of patients, cultured ex vivo and activatedto induce their differentiation and increase their tumoricidal power, then reinjected into the patients. It is also possible, using suitable vectors, to transfer or inhibit their genes ex vivo, thereby enabling them to be endowed with superior properties in terms of cytotoxicity and of stimulation of the immune system. The advantage of macrophages over T cells is that they have a natural ability to infiltrate the tumor microenvironment (TME). In fact, macrophages can account for up to50% of immune cells in the TME and are the most common type of immune cells in manycancers (Van Ravenswaay Claasen, H. H., Lab. Invest.67, 166–174 (1992); Gentles, A.J. et al. Nat. Med. 21, 938–945 (2015)). That’s why, recently, CAR-macrophages haveemerged as competitive candidates for the treatment of solid tumors due to their phagocytosis functional properties, antigen presentation and natural infiltration into the TME. Another advantage is that CAR-expressing macrophages (CAR-M) can begenerated from different sources including peripheral blood, iPSCs and the human leukemia monocytic cell line THP-1. PBMC derived M1 macrophages are characterized by their important production of proinflammatory factors such as IL-8, IL-6 and TNF-αand a prominent expression of inflammatory surface markers such as natriuretic peptidereceptor (NPR), CD14 and CD68. iPSCs can be induced into CAR-expressing macrophages (CAR-iMacs) exerting innate immune functions, such as repolarization ofM2 phenotype into pro-inflammatory M1 in an antigen-dependent way, secretion ofimmune-related cytokines, as well as phagocytosis and antitumor capacity. In addition, THP-1 cells can generate M1 macrophage after being stimulated with lipopolysaccharide(LPS) and IFN-γ and are easy to culture and to differentiate into macrophages. Takentogether, unlike CAR-T cells, CAR-M can be generated using several reliable sources.As an additional advantage, CAR-M bear a low risk of GvHD (Graft versus HostDisease). Finally, CAR-M possess unique advantages over CAR-T and CAR-NK cells with regards to two major obstacles observed in solid tumors: ability to migrate and infiltrate into the immunosuppressive TME. In fact, in contrast to T cells poor infiltration,macrophages represent the predominant population of immune cells in the TME(reaching 50%) of various types of cancer such as melanoma, renal, and colorectal cancer. In contrary to lymphocyte-based therapies, macrophages are able to remodel the extracellular matrix (ECM). Moreover, macrophages are an important source of matrix metalloproteinases (MMP) which degrade almost all ECM. Taken together, CAR- M uses unique macrophage properties, especially phagocytosis which gives them a particular value over CAR-T and CAR-NK cell therapies. Consequently, CAR-M would have a significant potential in driving anti-tumor immunity in solid tumors and representan attractive allogeneic cell immunotherapy (Maalej, K. M. et al. Mol. Cancer 202322122, 1–54 (2023)). To date, a few clinical trials of CAR-M are conducted and registered on clinicaltrials.gov and only one clinical trial of CAR-M has received the FDA approval. The first Phase I clinical trial (NCT04660929) CT-0508, a drug candidate from CARISMA Therapeutics, engineered with chimeric adenoviral vector Ad5f35 to target HER2 in solidtumors. In this study conducted by Klichinsky et al. (Nat. Biotechnol.1–7 (2020)), the useof adenoviral infection induced macrophages differentiation into a pro-inflammatory M1 phenotype. A phase-I clinical trial (NCT05007379) using HER2 CAR-M, is designed against organoids from breast cancer patients at different clinical stages. Another phase I clinical trial (NCT04405778) targeted Glypican 3 (GPC3), a protein expressed by some solid tumors but not expressed by normal cells, making it an ideal target for solid tumors. In this study, TAK-102, a GPC3 CAR-M, was tested in GPC3 positive solid tumors patients. Additionally, TAK-103, a MSLN specific CAR-M was also clinically tested (NCT05164666) in patients with MSLN-expressing advanced or metastatic solid tumors(Maalej, K. M. et al. Mol. Cancer 202322122, 1–54 (2023)).Unfortunately, it is known that once macrophages infiltrate the tumor, they can differentiate into anti-inflammatory macrophages and thereby lose their anti-tumor function. In very simple terms, macrophages are often defined according to their M1 (classical-activated macrophages) or M2 (alternative-activated macrophages) activation states. M1 macrophages (“good macrophages”) are those with anti-tumor activity through phagocytosis, presentation of tumor antigens and release of soluble pro- inflammatory factors that stimulate the anti-tumor activity of other effector immune cells. However, once in contact with the tumor, macrophages are rapidly converted to an M2 phenotype with pro-tumor activity (“bad macrophages). Once in this M2 phenotype, macrophages facilitate tumor progression and metastasis by promoting tumor cell invasion, angiogenesis, and immunosuppression. The challenge now is to develop second-generation CAR-M to prevent this anti- inflammatory and pro-tumoral state to occur, so as to make them more effective. Recent advances in gene transfection into effector cells have promoted diverse viral and non-viral engineering methods to overcome this challenge. Indeed, it has been shown that modified lentiviral virions containing Vpx; an accessory protein can efficiently deliver transgenes to myeloid cells. In fact, Vpx, can mediate degradation of SAM domain and HD domain-containing protein 1 (SAMHD1); a myeloid-specific HIV-1 restriction factor that inhibits lentiviral transduction. A supplementary option for macrophage transduction is the use of the chimeric Adenovirus 5-fiber 35 vector (Ad5f35) which can mediate efficient gene transfer into human macrophages. In various studies, Ad5f35 showed a robust transduction of primary human macrophages. In addition, Ad5f35 infected macrophages activate the inflammasome and participate in maintaining the M1 phenotype generated by proinflammatory priming signals. Additionally, transposonsystems, mRNA transfection and bacterial plasmid DNA, have also been used as non-viral strategies for macrophages bioengineering. Moreover, using polymer nanocarriers (mannose-conjugated polyethyleneimine (MPEI)), Kang and colleagues, were able to transfer the genes encoding CAR and IFN-γ into macrophages to enhance their anti-tumor potential (Maalej, K. M. et al. Mol. Cancer 202322122, 1–54 (2023)).In this context, it has been shown that the proprotein convertase PC1 / 3 plays arole in regulating the macrophage phenotype (Duhamel, M. et al. Mol. Cell. Proteomics14, 2857–77 (2015); Duhamel, M. et al. Sci. Rep. 6, 19360 (2016); Duhamel, M. et al.Mol. Cell. Proteomics 17, 1126–1143 (2018)). PC1 / 3 affects the signaling pathways ofseveral TLR receptors and its inhibition leads to increased activation of these pathways, resulting in the activation of transcription factors that enable the expression of severalpro-inflammatory cytokines (Duhamel, M. et al. Mol. Cell. Proteomics 14, 2857–77(2015); Duhamel, M. et al. Sci. Rep.6, 19360 (2016)). However, inhibition of a proproteinconvertase (PC) enzyme in human CAR-M cells has never been studied so far, and thereis still a need to identify strong therapeutic means to enhance and maintain thetherapeutic activity of human CAR-M once they are injected in solid tumors. The present inventors hypothesized that human PC-inhibited CAR-M cells couldbenefit from PC inhibition and represent a serious therapeutic candidate to treat solid tumors. In order to validate this hypothesis, they studied the expression of two PCproteins in primary human macrophages, and found for the first time that human primary macrophages do not express PC1 / 3 and that the co-culture of human primary macrophages with cancer cells results in increased furin expression, leading to theexpression of anti-inflammatory cytokines (figure 1). These results suggest that cancercells hijack the anti-tumor activity of human macrophages by inducing the expression of the anti-inflammatory furin protein, which may be a new escape strategy for cancer cells. To prevent this pro-tumoral transition, the inventors specifically inhibited theexpression of furin in human primary macrophages as well as in CAR-M macrophages.By doing so, they found that Furin inhibition not only promotes the phagocytic activity ofCAR-M (figure 5), but also maintains a pro-inflammatory phenotype in contact withcancer cells (figures 6 and 7), which is critical for maintaining therapeutic efficacy overtime. Also, they show here for the first time that the tumor killing capacity of human CAR-M is significantly enhanced by furin inhibition (figure 8).DETAILLED DESCRIPTION OF THE INVENTION As exposed above, the present invention is based on the surprising finding that furin-inhibited CAR-M cells (i) display an enhanced phagocytic activity against tumoroids derived from human tumors (figure 5) and (ii) stay in a pro-inflammatory M1 phenotypeeven in presence of these tumor cells (figures 6 and 7). By eliminating more tumor cells,furin-inhibited CAR-M may open the door in the solid TME to other immune cells, including T lymphocytes. Furthermore, the results presented here show that furin-inhibition in CAR-M amplify T cell proliferation (figure 8F). This collaborative strategycould be the key to making immunotherapy a fearsome force in the treatment of solid tumors. Furin-inhibited CAR-M is thus proposed as a second generation of CAR-M witha durable pro-inflammatory and anti-tumor phenotype, and represent a promisingapproach for CAR immune cell therapy. As used herein, the term “cells of the invention” herein designates furin-inhibitedmacrophages expressing a functional recombinant CAR molecule. These cells are alsoherein called “CAR-M cells of the invention” or “furin-inhibited CAR-M of the invention”. The present invention concerns these cells and their incorporation into pharmaceutical compositions that can be used in cancer therapy, more particularly, in cancer immunotherapy. Specifically, it relates to the isolation, culture, activation and genetic modification of cells of the mononuclear phagocytic system, and their use in cell therapy, for example in adoptive immunotherapy. It also relates to new methods and tools that can be used to generate the cell compositions of the invention.Furin inhibitorsFurin belongs to the family of subtilisin-like proprotein convertase (PC) enzymes,that are involved in the processing of a variety of protein precursors, including proteases,cytokines, growth factors and receptors. Nine PC genes are known, encoding PC1 / 3, PC2, furin, PC4, PC5 / 6, PACE4, PC7, SKI-1 / S1P and PCSK9 (Seidah, N. G. & Prat, A. Nature Reviews Drug Discovery vol.11367–383 (2012)). As used herein, the term “furin” designates interchangeably the FURIN, FUR, PACE, PCSK3, and SPC1 proteins. The human protein has the sequence referenced asNP_001276 (RefSeq) or UniProt P09958 (UniProt). It is encoded by the furin gene(human mRNA: NM_002569). This enzyme is ubiquitously expressed, and in cells it catalyzes the maturation of its targets in the secretory pathway, endosomes and on the cell surface. Due to its widespread expression, Furin has a plethora of reported targets including cytokines,chemokines and growth factors as well as other proteases like matrixmetalloproteinases. Some of its substrates are: proparathyroid hormone, transforming growth factor beta 1 precursor, proalbumin, pro-beta-secretase, membrane type-1 matrix metalloproteinase, beta subunit of pro-nerve growth factor and von Willebrand factor. As used herein, the term “furin” herein also encompass functional variants and / or functional fragments of the above-mentioned furin human proteins. “Functional variants”are mutated versions of the natural furin proteins, whose amino acid sequence share apercentage of identity of at least 75%, preferably of at least 80%, more preferably of atleast 90% with the wild-type human protein. Said variants preferably retain the biologicalfunction of the wild-type human furin protein. In the context of the invention, the identitypercentage between said two homologous sequences is identified by a global alignment of the sequences in their entirety, this alignment being performed by means of an algorithm that is well known by the skilled person, such as the one disclosed in Needleman and Wunsch (1970). Accordingly, sequence comparisons between two amino acid sequences or two nucleotide sequences can be performed for example by using any software known by the skilled person, such as the “needle” software using the “Gap open” parameter of 10, the “Gap extend” parameter of 0.5 and the “Blosum 62”matrix. “Functional fragments” of the furin protein are any fragments of the wild-typehuman furin protein or of functional variants thereof, that retain the biological function of the furin protein. The CAR-M cells of the invention are “furin-inhibited”, which means that the expression and / or activity of furin in these cells is altered. By “inhibiting the expression of furin”, it is herein meant that the overall expression level of the furin protein is lower in the CAR-M macrophages contained in the composition of the invention than in conventional CAR-M non-treated macrophages. To be used in the composition of the invention, the CAR macrophages are preferably genetically modified so that the final expression of furin is at least five to ten times lowerthan in untreated control macrophages. A lower expression can be detected by anyconventional means enabling the measurement of protein levels, such as by qPCR, western blot, immunoprecipitation or northern blot. By “inhibiting the activity of furin”, it is herein meant that the overall activity of the furin protein is lower in the CAR-M macrophages contained in the composition of theinvention than in conventional CAR-M non-treated macrophages. A lower activity of furincan be detected by any conventional means, for example by analyzing if its substrates are less processed in the target cells. Also, it is possible to analyze the increase in the phagocytic ability of the inhibited cells to control that furin is sufficiently inhibited in same. To be used in the composition of the invention, the CAR macrophages are preferably modified so that the final activity of furin is at least two or three times lower than in untreated control macrophages, or so that their phagocytic ability is significantly increased as compared with untreated control macrophages. The inhibitors of furin used in the present invention are preferably very specific of furin and do not modify the expression / activity of other proteins, in particular of other PC proteins. In the context of the invention, inhibition of the expression of furin is preferably achieved by using a gene silencing technology, in particular RNA interference by meansof antisense oligonucleotides that prevent the translation of the furin mRNA into thecorresponding protein. An “oligonucleotide,” as used herein, generally refers to a short, generally single- stranded, generally synthetic, polynucleotide that is generally, but not necessarily, no more than about 200 nucleotides in length. The terms “oligonucleotide” and “polynucleotide” are herein synonymous. In the context of the invention, inhibiting the expression of furin can be achieved by any known gene silencing technology. In a preferred embodiment, it is achieved by using an antisense oligonucleotide, such as a single-stranded ASO, a double-stranded siRNA, a miRNA or a shRNA that specifically inhibit the expression of the furin protein in CAR-M cells. It is also possible to use other technologies, such as splicing modulators,CRISPR enzymes, ribozymes, aptamers, or any other knock-down technologies.In a more preferred embodiment, the inhibitors of furin used in the context of theinvention are siRNAs or shRNAs. siRNAs are double stranded RNAs of 19-21 bases thatwork by RNA-interference. Upon cellular uptake, the siRNA gets incorporated into the RNA-induced silencing complex (RISC), where the antisense strand guides the RISC complex to the target mRNA, leading to its degradation. shRNAs, as opposed to siRNAs,are synthesized in the nucleus of cells, further processed and transported to thecytoplasm, and then incorporated into the RISC for activity. They can achieve a more stable and long-lasting gene inhibition. Useful siRNAs according to the invention have the SEQ ID NO:5-8 or any combination thereof. Alternatively, in the context of the invention, it is possible to inhibit the activity ofthe furin protein in the CAR-M, preferably by using a specific furin- blocking or furin-neutralizing antibody or a small organic molecule affecting the activity of this protein. Asused herein, a “furin-neutralizing” antibody is an antibody or an antibody fragment that isable to block the biological function of the furin, so as for example to impair theprocessing of the reported targets of furin mentioned above or to increase the phagocyticcapacity of macrophage cells. As used herein, the term “furin-inhibitor” therefore designates an antisense anti- furin oligonucleotide (in particular a single-stranded ASO, a double-stranded siRNA, a miRNA or a shRNA), a furin-neutralizing or a furin-blocking antibody or a small organic molecule affecting the expression and / or activity of the furin protein in CAR-M cells.In one aspect, the present invention addresses the in vitro use of a furin inhibitoras described above, for increasing the phagocytic capacity of CAR-M macrophages.Also, it targets an in vitro method for increasing the phagocytic capacity of CAR-Mmacrophages, said method comprising the step of contacting said CAR-M macrophageswith one of the specific furin inhibitor described above.In another aspect, the present invention addresses the in vitro use of a furininhibitor as described above, for inducing and / or maintaining a pro-inflammatoryphenotype in CAR-M macrophages. Also, it targets an in vitro method for inducing and / ormaintaining a pro-inflammatory phenotype in CAR-M macrophages, said methodcomprising the step of contacting said CAR-M macrophages with one of the specific furininhibitors described above.Preferred CAR molecules The human macrophages of the invention express a recombinant CAR molecule to target them to tumor cells. Preferably, the human macrophages of the invention express a CAR molecule targeting an antigen that is specifically expressed at the surface of tumor cells. This surface antigen can be expressed from canonical ORFs or from alternative ORFs. More preferably, macrophages of the invention express a CAR molecule targeting an antigen that is specifically expressed at the surface of solid tumor cells, for example at the surface of breast cancer cells, sarcoma cells, or glioblastoma cells, be they metastatic or not. Three different CAR-macrophages have been already involved in clinical trials totarget solid tumors. Maalej, K. M. et al. Mol. Cancer 202322122, 1–54 (2023) reviewsthem in detail, see in particular its Table 5. Any of these CAR-macrophages can be used in the context of the invention. The CAR-macrophages of the invention target preferably HER2, GPC3, or mesothelin. In particular, it is possible to use human macrophages expressing a CAR molecule targeting the Glypican 3 (GPC3) protein, a protein expressed by some solid tumors but not expressed by normal cells, making it an ideal target for solid tumors(Maalej, K. M. et al. Mol. Cancer 202322122, 1–54 (2023)). Alternatively, it is possible to use human macrophages expressing a CARmolecule targeting the mesothelin membrane protein: Zhang L. et al., (J. Hematol.Oncol.; 13:153 (2020) indeed showed that CAR (MSLN)-iMacs can switch to theinflammatory M1 subtype and promote phagocytosis and immune activation when incubated in-vitro with MSLN-expressing ovarian (OVCAR3) and pancreatic (ASPC1), cancer cells. It is also possible to use human macrophages expressing a CAR molecule consisting of scFv conjugated to a hinge region and CD147 trans-membrane and intracellular domain to target HER2+tumor cells, as these cells effectively activated the expression of matrix metalloproteinases (MMP) and destroy the tumor’s extracellular matrix without affecting the phagocytic activity and inflammatory cytokines and ROS production, reduce the tumor growth and increase the T cell infiltration (Zhang W. et al.,Br. J. Cancer 121:837-45 (2019)).It is also possible to use human macrophages expressing a CAR molecule consisting of a chemokine (C-C motif) ligand 19 (CCL19) which is a ligand to CCR7, in an attempt to target CCR7-expressing immunosuppressive cells. The use of this CAR construct induces the expression of CD3+T cells into tumors, increased pro-inflammatory cytokines production, suppressed tumor growth, decreased metastasis, and prolongedsurvival (Niu Z. et al, J. Pathol. 253:247-57 (2021)).Finally, yet preferably, it is possible to use human macrophages expressing a CAR molecule targeting the HER2 antigen. As a matter of fact, it has been shown that anti-HER2 CAR-M efficiently induce phagocytosis of the HER2+ovarian SKOV3 tumor cells, pro-inflammatory cytokines secretion, macrophages polarization from M2 to M1 phenotype and are capable of cross-presenting the New York Esophageal Squamous cell carcinoma 1 (NY-ESO-1) antigen to T cells, following NY-ESO-1+ SKOV3 tumorcells phagocytosis (Klichinsky M. et al., Nat. Biotechnol. 1–7 (2020)). In a preferredembodiment, as used by the present inventors in the examples below, the human macrophages of the invention express a CAR molecule containing, as extracellular domain, the sequences of the variable parts of the light and heavy chains of trastuzumab to target the HER2 protein. Apart from the extracellular antigen binding part described above, the CAR molecule can contain any known component that favor macrophage activation andphagocytic activity (for details, see in Chen Y. et al, Biomedicine & Pharmacotherapy,vol.139, 111605 (2021) or in Klichinsky et al, Nat. Biotechnol. 1–7 (2020)).More particularly, as shown in the examples below, the CAR sequence that can be used to generate CAR-M cells according to the invention can be composed of:- a CD8a signaling sequence,- the sequences of the variable parts of the light and heavy chains of trastuzumabto target the HER2 protein,- a linker,- a hinge sequence,- a CD8a transmembrane domain and- the intracytoplasmic part, corresponding to the ζ chain of the TCR / CD3 complex.The CAR sequence can be inserted into a lentiviral vector or an adenoviral vector under the control of a appropriate promoter, typically the EF1a promoter. Any other efficient CAR sequence can be used instead of this example. Vectors In the particular embodiment where furin-inhibited CAR-M are obtained by usingantisense oligonucleotides, it is often required to use a vector to transduce the sequenceof said antisense oligonucleotide. Also, it is necessary, in the context of the invention, to use at least one vector for expressing the CAR molecule into the human macrophage or monocytes cells, so that they become CAR-M cells. In one particular embodiment, two different vectors are used to separatelytransduce i) the CAR molecule and ii) the furin inhibitor into the monocytes / macrophages. This transduction can be concomitant or separated in time.In the vectors of the invention, the CAR molecule and / or furin inhibitor is placedunder the control of regulatory elements permitting its expression. These regulatory elements generally consist of transcription promoter sequences that are capable of functioning in monocytes-macrophages. In particular, they can be promoter sequences of eukaryotic or viral genes. For example, they can be promoter sequences originating from the genome of the monocyte which it is desired to infect. Similarly, they can be promoter sequences originating from the genome of a virus. In this connection, the promoters E2F1 (E2 promoter binding factor 1) or the promoters of EFS (elongation factor 1α short), SFFV (silencing-prone spleen focus forming virus), CMV(cytomegalovirus), RSV (Rous sarcoma virus) may be mentioned for example. Inaddition, these expression sequences may be modified by the addition of activator sequences, regulatory sequences, and the like. In a preferred embodiment, the two different vectors are chosen in the groupconsisting of: adenovirus, adeno- associated virus (AAV), herpesvirus, lentivirus,vaccinia virus, cytomegalovirus (CMV) and the like, that have been shown to effectivelytransfect macrophages. The two vectors can be of similar nature (e.g. the two originatefrom adenoviruses) or of different natures (e.g., one originates from a lentivirus, the otherone from an adenovirus). Advantageously, when the vector contains part or all of a viral genome, said virus is a replication defective virus. The term “replication defective virus” denotes a virus incapable of replicating in the target cell. Generally, the genome of the defective viruses used in the context of the present invention hence lacks at least the sequences neededfor the replication of the said virus in the infected cell. These regions may be eitherremoved (wholly or partially), or rendered non-functional, or replaced by other sequences, in particular by the recombinant nucleic acid. Preferably, the defective virus nevertheless retains the sequences of its genome which are needed for encapsulation of the viral particle. One advantageous vector is the AAV vector, which displays several advantagessuch as i) a long-lasting expression of synthesized genes, ii) a low risk for pathogenicreactions (because they are artificially manufactured and not toxic), iii) they trigger low immunogenic response and iv) they do not integrate the human genome. In order to increase the efficacy of gene expression, and prevent the unintended spread of the virus, genetic modifications of AAV can be performed. These genetic modifications include the deletion of the E1 region, deletion of the E1 region along with deletion of either the E2 or E4 region, or deletion of the entire adenovirus genome except the cis-acting inverted terminal repeats and a packaging signal. Another advantageous vector for the preparation of the cell compositions according to the invention is an adenoviral vector. Indeed, Haddada H. et al. Biochem.Biophys. Res. Commun (1993) showed that adenoviruses are capable of very effectivelyinfecting cells of the monocyte-macrophage line, of being maintained stably therein and of expressing a therapeutic gene. Different serotypes of adenovirus exist, the structureand properties of which vary somewhat but which are not pathogenic for man, and inparticular for non-immunosuppressed subjects. Moreover, these viruses do not integrate in the genome of the cells they infect, and can incorporate large fragments of exogenousDNA. Among the different serotypes, it is preferable in the context of the presentinvention to use adenoviruses type 2 or 5 (Ad 2 or Ad 5). In the case of Ad 5 adenoviruses, the sequences needed for replication are the E1A and E1 B regions. These sequences are preferable deleted from the recombinant nucleic acid used in thepresent invention. The adenoviral vector used in the examples below, which is theAd5F35 vector, is preferably used to transduce one or the two molecule(s) inside primaryhuman macrophages or monocytes (see Klichinsky et al. Nat. Biotechnol.1–7 (2020)).Another advantageous vector for the preparation of the cell compositions according to the invention is a lentivirus. Lentiviruses like HIV have the capacity to infect non-dividing and dividing cells and to integrate into the host cell genome. Due to these characteristics, HIV-based lentiviral vectors have been proposed as good delivery system candidates for gene therapy, but the attempt to use them in clinical trials has raised concerns about their safety including the risk of genetic recombination leading to the generation of replication-competent retrovirus in humans. Further modifications in the packaging and genetic components of viral genes have been carried out to develop safer HIV-based lentiviral vector systems. Today, a number of safe HIV-based lentiviral vectors have been designed for efficiently transducing nucleotides into differentiatedmonocyte-derived macrophages (Leyva F. et al, BMC biotechnology (2011). Any of thesevectors can be used in the context of the present invention. All the techniques of construction of vectors derived from adenoviruses, lentiviruses, or from AAV, and incorporation of heterologous nucleic acid sequences in same, have been described in the literature and can be used in the context of the present invention. The methods traditionally used in molecular biology, such as preparative extractions of plasmid DNA, centrifugation of plasmid DNA in a caesium chloride gradient, agarose or acrylamide gel electrophoresis, purification of DNA fragments by electroelution, phenol or phenol-chloroform extraction of proteins, ethanol or isopropanol precipitation of DNA in a saline medium, transformation in Escherichia coli, and the like,are well known to a person skilled in the art and are amply described in the literature.Once the genome of the viruses has been genetically modified, the viruses are multiplied and recovered and purified according to standard techniques of molecular biology. The transformation of the cells to be included in the composition of the invention with the recombinant nucleic acids of the invention is to be performed in a sterile medium, under conditions adjusted by a person skilled in the art. Notably, the multiplicity of infection has to be adjusted in accordance with the vector used. To generate the cells of the invention, it is also possible to use non-viralrecombinant nucleic acids encoding the CAR molecule or producing the inhibitor of furinexpression. Said non-viral recombinant nucleic acids are preferably DNA plasmids.These nucleic acids make it possible to stably express the CAR molecules or to inhibitthe expression of the furin protein in the target cells. Transduction in the target cells and expression of the components in thetransduced cells is then performed by conventional means. Methods to generate furin-inhibited CAR-M cells The cells of the invention are macrophages. Macrophages are found in vivo in tissues but in very small amounts. Preferably, the macrophages of the invention will beobtained from monocytes circulating in peripheral blood and differentiated into functionalmacrophages ex vivo. The monocytes used to generate the macrophages can originate from the patienthimself (the composition therefore contains autologous cells) or from a donor (the composition therefore contains allogeneic cells). For allogeneic cells, HLA compatibility and matching between the donor and the patient receiving the cells is required. As used herein, the term “macrophages” designates mononuclear cells that have been cultivated and differentiated into macrophages from peripheral blood monocytes(PBMCs), or from their bone marrow or blood precursors, under specific conditionsknown in the art (see also Andressen R. et al., Cancer Res. 1990; Bartholeyns J et al.,Anticancer Res. (1991)). As precursors, it is also possible to use pluripotent stem cells,myeloid stem cells (CFU- GEMM), myelomonocytic stem cells (CFU-GM), CFU-M,monoblasts or promonocytes. Since PBMCs are found in the blood, a PBMCs sample can be obtained by a completely harmless and non-invasive blood collection from the subject. Withdrawal and isolation of PBMCs / monocyte-macrophage cells or their precursors may be performed by any technique known to a person skilled in the art. These different techniques can involve physical separation steps (centrifugation, cell sorting (FACS), and the like), and selection with immunological compounds (specific antibodies for cell markers and the like) or biochemical compounds (membrane receptor ligands), and the like. Cultivating the isolated cells may be performed in different media known to a person skilled in the art (for example RPMI, IMDM), supplemented, inter alia, with serum and amino acids. The culture of the cells is carried out under sterile conditions, preferably at 37° C. It may be performed in culture plates, or preferably inTeflon bags.In a preferred embodiment, the cells contained in the composition of the invention have been obtained by cultivating PBMCs under suitable conditions permitting their differentiation. Monocytes purified from PBMCs are monocyte cells that have been recovered from the peripheral blood of an individual by conventional means. These monocytes purified from PBMCs are positive for the markers: CD14, CD11 b and CD16 but negative for the markers CD56 (which is a marker of NK cells), CD3 (marker of T cells) and CD20 (marker of B cells). Human blood monocyte differentiation into macrophages can for example beinduced in vitro using three different methods, namely by culturing PBMCs either inhuman serum (HS) or in fetal bovine serum (FBS) in presence of granulocyte-macrophage colony-stimulating factor (GM-CSF) or in FBS in presence of macrophagecolony-stimulating factor (M-CSF). At the end of the differentiation step, macrophagesare positive for the markers: CD14, CD11 b, CD71, CD163 and CD206, but negative for the markers CD56 (which is a marker of NK cells), CD3 (marker of T cells) and CD20 (marker of B cells). Preferably, the cell composition of the invention contains more than 90%, preferably more than 95% and ideally more than 99% of macrophages. The presence of these markers can be assessed by any conventional means, e.g., by cytometry (FACS). The transduction of the recombinant nucleic acids carrying the sequences of theCAR molecule and of the furin inhibitor can be performed before or after thedifferentiation of the monocytes into macrophages. In a preferred embodiment, thepurified monocytes are first transduced ex vivo with the recombinant nucleic acids andthen subsequently differentiated / cultured into macrophages. In another preferredembodiment, the recombinant nucleic acids are transduced in the cells once they havebeen differentiated / cultured into macrophages. In any case, the cell composition of the invention contains differentiatedmacrophages expressing a CAR molecule and displaying no furin expression / activity.The modified cells thereby obtained may then be packaged for the purpose of immediate use, and / or stored for the purpose of subsequent use. For an immediate re- administration, the cells are generally suspended in a phosphate buffer or in physiological saline at a concentration varying from 107to 109cells per dose. For their storage, the cells may be frozen, preferably in the presence of preservatives such as glycerol, DMSO, and the like. In a further aspect, the present invention targets a method to generate furin- inhibited CAR-M cells, said method comprising the steps of: a) Obtaining allogenic or autologous human macrophages as describedabove, b) Transfecting in said macrophages a vector encoding a CAR moleculethat recognizes an antigen expressed by a solid tumor, said CARmolecule being operatively linked to a promoter that is functional inmacrophages, so as to obtain CAR-expressing macrophages (CAR- M), c) Inhibiting the expression or activity of furin in said CAR-Mmacrophages, preferably by transducing in the CAR-M macrophages a vector carrying the sequence of an interfering oligonucleotide inhibiting the expression of furin.Interestingly, performing steps b) or c) by using an adenoviral transduction maylead to macrophage activation, which is a way to enhance the therapeutic efficiency of the cells of the invention. More generally, activating the macrophages is recommended before their administration to the patient. If activation does not result from performingsteps b) or c), it can be performed as a supplementary step by any other conventionalmeans. Therefore, if need be, the method of the invention may also contain a step of activating the macrophage cells of the invention, by any conventional means (e.g., by contacting them with IFN-ɣ, or with inflammatory cytokines). Alternatively, the macrophages of the invention can be generated by: a) Withdrawing and isolating of monocytes precursors or pluripotent stem cells from blood or bone marrow or umbilical cord, from the subject in need thereof or from an healthy donor, b) Culturing these cells as disclosed above or by conventional means, so as toobtain / isolate a macrophage population, c) Transforming these cells with the recombinant nucleic acids as defined above, d) Optionally, if need be, activating the macrophages by conventional means, e) Optionally, packaging and / or storage of the cells thereby obtained. As disclosed herein, the terms “in vitro" and “ex vivo" are equivalent and refer to studies or experiments that are performed using biological components (e.g. cells or population of cells) that have been isolated from their usual host organisms (e.g. animals or humans). In contrast, the terms “in vivo” or “in situ” refer to studies that are conducted on whole living organisms (e.g., humans), after administration of the composition of the invention in a living subject. Composition of the invention In another aspect, the present invention relates to a pharmaceutical compositioncomprising an effective amount of furin-inhibited human macrophages expressing aChimeric Antigen Receptor (CAR-M), preferably generated by the methods describedabove. This pharmaceutical composition is hereafter referred to as the “composition ofthe invention”, the “pharmaceutical composition of the invention”, or the “cell compositionof the invention”. An “effective amount” or “therapeutically effective amount” of an agent, e.g., of furin-inhibited human macrophages, refers to an amount effective, at dosages and for periods of time necessary, to elicit the desired biological response in a subject. Suchresponse includes alleviation of the symptoms of the cancer being treated, prevention,inhibition or a delay in the recurrence of symptom of the cancer or of the cancer itself, anincrease in the longevity of the subject compared with the absence of the treatment, orprevention, inhibition or delay in the progression of symptom of the cancer or of thedisease itself. As used herein, an “effective amount” is in particular the amount of theagent effective to achieve the desired therapeutic or prophylactic result. Morespecifically, an “effective amount” as used herein is an amount of the cells of the invention that confers a therapeutic benefit. A therapeutically effective amount is also one in which any toxic or detrimental effects of the agent are outweighed by the therapeutically beneficial effects. An effective amount of the cells of the invention can be administered in one ormore administrations, applications or dosages. Such delivery is dependent on a number of variables including the time period for which the individual dosage unit is to be used, the bioavailability of the agent, the route of administration, etc. In some embodiments,effective amount also refers to the amount of the cells provided herein to achieve aspecified result (e.g., decrease of the tumor size, activation of T cells, etc.). In some embodiments, this term refers to the amount of a therapy which is sufficient to reduce and / or ameliorate the severity and / or duration of a given disease, disorder or condition and / or a symptom related thereto. This term also encompasses an amount necessary for the reduction or amelioration of the advancement or progression of the treatedcancer, reduction or amelioration of the recurrence, development or onset of said cancer.It also encompasses an amount necessary to improve or enhance the prophylactic ortherapeutic effect(s) of another therapy (e.g., a therapy with an immune checkpointinhibitor). In the context of cancer therapy, a therapeutic benefit means for example any amelioration of cancer, including any one of, or combination of, halting or slowing the progression of cancer (e.g., from one stage of cancer to the next), halting or delaying aggravation or deterioration of the symptoms or signs of cancer, reducing the severity ofcancer, inducing remission of cancer, inhibiting tumor cell proliferation, tumor size, ortumor number, or reducing levels of biomarker(s) indicative of the cancer. The pharmaceutical composition of the invention contains, as active principle, the recombinant CAR-M cells described herein, and a pharmaceutically acceptableexcipient. The term “pharmaceutically acceptable excipient" means an excipient that isuseful in preparing a pharmaceutical composition that is generally safe, non-toxic, and desirable, and includes excipients that are acceptable for human pharmaceutical use. Such excipients can be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous. Compositions for the treatment of cancer can usually be administered by parenteral, topical, intravenous, intratumoral, oral, subcutaneous, intraarterial, intracranial, intraperitoneal, intranasal or intramuscular means. A typical route of administration is intravenous or intratumoral, although other routes can be equally effective. For intravenous and intratumoral administration, the composition of the invention will be under liquid form. It will thus contain, apart from the cells, a pharmaceutically- acceptable diluent that does not affect the biological activity of the cells of the invention. Example of such diluents are physiological phosphate-buffered saline, Ringer's solutions, dextrose solution, and Hank's solution. In addition, the pharmaceutical composition or formulation may also include other carriers, adjuvants, or nontoxic, nontherapeutic, nonimmunogenic stabilizers and the like. In a preferred embodiment, the composition of the invention is under a liquid form. The pharmaceutical compositions of the invention can be administered alone to act as an efficient anti-cancer agent. It can also be administered in combination with other active agents, as described below. Combination with other agents A number of innovative combinations have been tested to synergize CAR-cell therapies. For example, chemotherapy, radiotherapy, immune checkpoint inhibitors, tumor immunomodulating therapies and oncolytic viruses can be used concomitantly to enhance the efficiency of CAR-cells mediated therapeutic strategies (see the review of Maalej et al). The pharmaceutical compositions of the invention are thus preferably administered with another active principle. In this context, the pharmaceutical compositions of the invention can contain the cell compositions of the invention as well as another active principle, combined in the same container. As used herein, the term “combined” does not imply that the cells of the invention and the other active principle are necessarily administered simultaneously. It also extends to any use or presentation involving their administration at different time intervals, or in separate containers. The other active principle can also be administered concomitantly with thepharmaceutical composition of the invention. "Concomitant administration" of said active principle with the pharmaceutical composition of the present invention meansadministration with the recombinant cells at such a time that both the active principle andthe composition of the present invention will have a therapeutic effect. Such concomitant administration may involve concurrent (i.e. at the same time), prior, or subsequent administration of the active principle with respect to the administration of a compound of the invention. A person of ordinary skill in the art would have no difficulty determining the appropriate timing, sequence and dosages of administration for particular drugs and compositions of the present invention. This active principle can be for example a chemotherapeutic agent. Exemplarychemotherapeutic agents include, but are not limited to, aldesleukin, altretamine, amifostine, asparaginase, bleomycin, capecitabine, carboplatin, carmustine, cladribine, cisapride, cisplatin, cyclophosphamide, cytarabine, dacarbazine (DTIC), dactinomycin, docetaxel, doxorubicin, dronabinol, duocarmycin, etoposide, filgrastim, fludarabine, fluorouracil, gemcitabine, granisetron, hydroxyurea, idarubicin, ifosfamide, interferon alpha, irinotecan, lansoprazole, levamisole, leucovorin, megestrol, mesna, methotrexate, metoclopramide, mitomycin, mitotane, mitoxantrone, omeprazole, ondansetron, paclitaxel (Taxol™), pilocarpine, prochloroperazine, rituximab, saproin, tamoxifen, taxol,topotecan hydrochloride, trastuzumab, vinblastine, vincristine and vinorelbine tartrate.Other combination therapies include administration with cell-specific antibodies, for example antibodies selective for tumor cell markers, radiation, surgery, and / or hormone deprivation. Antibodies blocking the interaction between CD47, overexpressed on many typesof tumor cells, and the signal regulatory protein α (SIRPα) expressed in myeloid cells orthe inhibitory Fc receptor FcγRIIB have been shown to enhance phagocytosis ofmacrophages (Weiskopf K et al, MAbs; 7:303-10 (2015)). Such antibodies can thereforebe used in or combined with the pharmaceutical composition of the invention. Angiogenesis inhibitors can also be combined with (or contained in) the compositions of the invention. It has been shown that combining CAR-M with PD-1 immune checkpoint inhibitor leads to synergistic tumor control and significantly increases overall survival in a syngeneic CT26 model (Pierini S. et al, Cancer Res.; 81:63 (2021). In a preferred embodiment, the cell composition of the invention is thus combined with (or contains) an effective dose of an immune checkpoint modulator, in particular of an immune checkpoint inhibitor (ICI). “Immune checkpoint inhibitors” (ICI) include anti-PD1 antibodies (such as Nivolumab or Pembrolizumab or Pidilizumab), anti-PD-L1 antibodies (such as Atezolizumab or Durvalumab), anti-CTLA-4 antibodies (such as Ipilimumab or Tremelimumab) and anti-PD-L2 antibodies. Method of treatment In another aspect, the present invention targets a method for treating a solid tumorin a patient in need thereof, comprising the step of administering to said patient the pharmaceutical composition defined above. As used herein, the term “tumor” may be used interchangeably with any of the terms“cancer”, “malignancy”, “neoplasm” and encompasses any disease or pathological condition resulting from uncontrolled cell growth and spread. These terms are meant toinclude any type of tissue, organ or cell, any stage of malignancy (e.g. from a prelesionto stage IV). Typically, tumors, especially malignant tumors, show partial or complete lack of structural organization and functional coordination as compared to normal tissue and generally show a propensity to invade surrounding tissues (spreading) and / or metastasize to farther sites. The present invention is preferably designed for thetreatment of solid tumors as described herein. A “neoplastic cell”, “cancer cell” or “tumorcell” can be used interchangeably to refer to a cell that divides at an abnormal (i.e.increased) rate. As used herein, the term "tumor" encompasses all of primary orrecurrent and / or metastatic tumors. “Primary tumor” is meant to be a tumor growing at the original anatomical site (organ or tissue) where tumor progression began and proceeded to yield a cancerous mass. “Recurrent tumor” is meant to be a tumor that has recurred (come back), usually after a period during which the tumor could not be detected. Tumor cells from a primary tumor may spread to other parts of the body and form new or “metastatic tumor” (also referred to as secondary tumor). The term “liquid tumor” herein means leukemia– or lymphoma–type cancers.Leukemias are cancers of the blood and bone marrow, whereas lymphomas are cancers of the lymphatic system. The term “solid tumor” herein means carcinoma– or sarcoma–type cancers. Thesecancers develop in any tissue. Examples of solid tumors include, but are not limited to squamous cell cancer (e.g. epithelial squamous cell cancer), lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric cancer, sarcoma, or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, oral cancer, liver cancer, bladder cancer, cancer of the urinary tract, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, melanoma, brain cancer, as well as head and neck cancer, and their associated metastases. Specifically, the treatment method of the invention can comprise the steps of:a) Obtaining human macrophages that can be administered to a patient,by any of the method described above, b) Transfecting in said macrophages a vector encoding a CAR moleculethat recognizes an antigen expressed by a solid tumor, said CARmolecule being operatively linked to a promoter that is functional inmacrophages, so as to obtain CAR-expressing macrophages (CAR- M) (e.g., as described above),c) Inhibiting the expression or activity of furin in said macrophages (e.g.,with the inhibitors as described above), d) Optionally, activating the macrophages by conventional means,e) Administering an effective amount of the furin-inhibited CAR-Mobtained after step c) or d) into the patient in need thereof. In a preferred embodiment, the macrophages of step a) originate from a PBMC sample obtained from a human being. For an autologous treatment method, the macrophages of step a) originate from a PBMC sample obtained from the patient himself, and the method of the invention cancomprise the steps of:a) Obtaining a blood or bone marrow or umbilical cord sample from thepatient to be treated,b) Differentiating the monocytes present in said sample intomacrophages, as described above, c) Transfecting in said macrophages a vector encoding a CAR moleculethat recognizes an antigen expressed by the solid tumor present insaid patient, said CAR molecule being operatively linked to a promoterthat is functional in macrophages, so as to obtain CAR-expressing macrophages (CAR-M), d) Inhibiting the expression or activity of furin in said macrophages,e) If need be, activating the macrophages by conventional means,f) Administering an effective amount of the furin-inhibited CAR-Mobtained in step d) or e) into the patient.In these methods, furin inhibition is preferably achieved by means of a chemicalor oligonucleotide inhibitor specifically preventing the expression / activity of furin in human macrophages, as exposed above. More preferably, said inhibitor is an anti-furin shRNA or a siRNA, as described above. As disclosed previously, the vectors carrying the CAR molecule or the oligonucleotide inhibitor are preferably viral vectors, for example a lentiviral vector, anadenoviral or an AAV vector. Preferably, said vectors are from an adenovirus, forexample the pAd5 / F35, or a lentiviral vector. A “patient”, as herein meant, is a human being, that is suffering from cancer,preferably from a solid tumor. Typically, said solid tumor is chosen in the group consistingof: sarcoma, squamous cell cancer (e.g. epithelial squamous cell cancer), lung cancerincluding small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric cancer, or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, oral cancer, liver cancer, bladder cancer, cancer of the urinary tract, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, melanoma, brain cancer, as well as head and neck cancer, and their associated metastases. More preferably, said tumor is a HER2+ solid tumor selected from: breast cancerovarian cancer, sarcoma, glioblastoma, stomach cancer, urothelial cancer, andendometrial cancer, and the CAR molecule contains the variable parts of the light andheavy chains of an antibody targeting the HER2 protein. The present invention encompasses treating methods in which the cell composition of the invention is administered to said subject in need thereof by injection, preferably by intratumoral injection. A systemic injection may be also carried out by perfusion. These injections are usually harmless for the treated subject. The intratumoral administration of the cell composition of the invention is able to increase the in vivo phagocytosis of the tumor cells present in the patient, thereby reducing the amount of tumor cells in said subject, and to induce a strong cytotoxic effect and T cell proliferation within the solid tumor. Importantly, the furin-inhibited human CAR-M macrophages of the invention will keep a pro-inflammatory phenotype once in the solid tumor. As used herein, the terms “treat”, “treating”, “treatment”, and the like refer to reducing or ameliorating the symptoms of a disorder (e.g., solid tumor), and / or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated. Effective doses of the therapeutic entity of the present invention, e.g. for the treatment of cancer, vary depending upon many different factors, including means of administration, target site, physiological state of the patient, whether the patient is human or an animal, other medications administered, and whether treatment is prophylactic or therapeutic. Treatment dosages can be titrated to optimize safety and efficacy. Conversely, in therapeutic applications, a relatively high dosage (50x109monocytes per injection dose per patient) at relatively short intervals (typically each week) is sometimes required until progression of the disease is reduced or terminated, and preferably until the patient shows partial or complete amelioration of symptoms of disease. In another aspect, the present invention concerns the use of furin-inhibited humanmacrophages expressing a Chimeric Antigen Receptor (CAR-M), for preparing a medicament or a pharmaceutical composition intended to strengthen a patient's immunesystem in order to treat cancer, specifically solid cancer.All the characteristics explained above for the methods of the invention and thedescription of the tools that are useful to generate the cells of the invention and theexplanations of how to use them, do apply mutatis mutandis to this therapeutic use, andneed not to be repeated here. FIGURE LEGENDS Figure 1: Inhibition of furin proprotein convertase induces activation of THP1 and primaryhuman macrophages. A) Illustration of coculture between THP1 macrophages / primarymacrophages and a breast cancer cell line. B) Expression of PC1 / 3 and furin in THP1 macrophages after 24h and 48 hours of coculture with cancer cells. The fold change is expressed relative to the mRNA levels obtained from cells grown in monoculture.C) Furin expression in primary macrophages after 24h and 48 hours of coculture withcancer cells. The fold change is expressed relative to the mRNA levels obtained from cells grown in monoculture. D) Relative mRNA levels of PC1 / 3 and furin after siRNA inhibition in THP1 macrophages. The fold change is expressed relative to the mRNAlevels obtained from cells treated with siRNA control. E) Expression of pro- and anti-inflammatory markers by THP1 macrophages transfected with furin, PC1 / 3 or control siRNAs. TNF-α, IL-6, iNOS, IL-10 and CD206 mRNA levels were assessed by qPCR. The fold change is expressed relative to the mRNA levels obtained from cells treatedwith siRNA control. F) Relative mRNA levels after furin inhibition in primarymacrophages. The fold change is expressed relative to the mRNA levels obtained fromcells treated with siRNA control. G) Expression of pro- and anti-inflammatory markers byprimary macrophages transfected with furin or control siRNAs. TNF-α, IL-6, IL-10 and CD206 mRNA levels were assessed by qPCR. The fold change is expressed relative to the mRNA levels obtained from cells treated with siRNA control. H) Expression of the co-stimulatory molecules CD80 and CD86 was assessed by flow cytometry in primary macrophages transfected with furin and control siRNAs. Scatter plots show the frequency of CD86+macrophages. Graphs show the ratio of CD80+ and CD86+ siFurinmacrophages relative to siControl macrophages. I) RT-PCR amplification of furin andPC1 / 3 (PCSK1) in primary macrophages.Figure 2: Furin- and PC1 / 3-inhibited THP1 macrophages express intracellular proteinsassociated with pro-inflammatory functions of macrophages. A) THP1 macrophages were transfected with furin, PC1 / 3 and control siRNAs(siCtrl). Cells were lysed prior to FASP and LC-MS / MS analysis. MaxQuant and Perseus software were used for the statistical analysis and a heat map was generated to show proteins that were significantly different between siCtrl, siFurin, siPC1 / 3 and THP1 WT macrophages. Five clusters are highlighted. B-E) Global analysis of protein pathways expressed in THP1 WT and THP1 transfected with different siRNAs (siFurin, siPC1 / 3 or siCtrl). F-G) Biological processes for the siControl, siFurin and siFurin+siPC1 / 3 clusters. The analysis was performed using FunRich software.Figure 3: Exclusive proteins expressed in Furin- and PC1 / 3-inhibited THP1 areassociated with the pro-inflammatory response. A) Venn diagram showing exclusive proteins in each condition (siFurin, siPC1 / 3 and siControl) and global analysis of exclusive protein pathways expressed in THP1 transfected with different siRNAs (siFurin, siPC1 / 3 or siCtrl). B-C) Biological processes of exclusive proteins identified in THP1 siControl, siFurin and siPC1 / 3. Analysis was performed using FunRich software.Figure 4: CAR macrophages show targeted anti-tumor activity. A-C) Validation of CARexpression in THP1 and primary macrophages by flow cytometry. Scatter plots show the frequency of PE+GFP+ macrophages, reflecting macrophages expressing the CAR molecule. CAR-expressing cells are revealed by incubation with biotinylated HER2 protein and anti-biotin PE antibody. B-D) Validation of CAR expression in THP1 andprimary macrophages by microscopy. Cells expressing the CAR molecule are detectedby incubation with HER2-hisTag protein and CAR is detected by a primary antihistidine antibody recognized by a secondary antibody Alexa Fluor 647. E) Representative FACS plots of phagocytosis after 6 and 24 hours of coculture with a 3:1 (macrophages / cancercells) ratio. The rate of phagocytosis is determined́ as the % of CytotellBlue+ and GFP+cells among all cells. F) Quantification of phagocytosis by mock and CAR-HER2 cells of HER2+ cancer cells after 6 and 24 hours of coculture. G) Immunofluorescence analysis of phagocytosis of AU565 (HER2+) cells by mock and CAR-HER2 macrophages. Macrophages are GFP+ and cancer cells are CytotellBlue+. H) Quantification ofphagocytosis by mock and CAR-HER2 cells of HER2- cancer cells after 6 and 24 hoursof coculture.Figure 5: Furin inhibition enhances CAR-M phagocytic activity. A) Microscopy-basedphagocytosis of HER2-coated or control pH-Rodo-labelled beads by THP1 mock or THP1-CAR as observed by confocal microscopy. THP1-CAR and mock were transfected with furin and control siRNAs. Nuclei (blue) were labelled with Hoeschst, beads (red)were stained with pHrodo. B) Quantification of internalization of HER2 beads and blankbeads by THP1-CAR and mock. C) Immunofluorescence analysis of phagocytosis of AU565 (HER2+) cancer cells by primary mock and CAR-M siControl or siFurin.Macrophages are GFP+ and cancer cells are CytotellBlue+. D) Representative FACSplots of phagocytosis after 6 and 24 hours of coculture with a 3:1 ratio(macrophages / cancer cells). The rate of phagocytosis is determined́ as the % ofCytotellBlue+ and GFP+ cells among all cells. E) Quantification of phagocytosis by CAR- M and CAR-M siFurin of HER2+ cancer cells after 6 and 24 hours of coculture.F) Quantification of phagocytosis by mock and CAR-HER2 cells of HER2- cancer cellsafter 6 and 24 hours of coculture. Figure 6: Inhibition of furin in CAR-M results in an increase in their cytokine secretion. CAR-M-siFurin, CAR-M-siCTRL and mock cells were co-cultured with AU565 cells. After culturing for 24 hours, the collected secretome was added to a cytokine array (A). The intensities of the cytokine spots were measured using an iBright Imaging System and analyzed using ImageJ software (B). Figure 7: Furin inhibition maintains a pro-inflammatory phenotype of CAR-M in the presence of cancer cells. A) Description of the procedure for mass spectrometry-based proteomics analysis of FACS-sorted CAR-M after co-culture. CAR-M were transfected with furin siRNA (CAR-HER2-siFurin) or control siRNA (CAR-HER2). CAR-HER2 andCAR-HER2- siFurin were cocultured with the target cell lines (AU565). After 24 hours ofcoculture, the cells were sorted by flow cytometry and lysed prior to analysis by FASP and LC-MS / MS. B) MaxQuant and Perseus software were used for the statistical analysis and a heat map was generated to show proteins that were significantly different between CAR-HER2 and CAR-HER2-siFurin. Two clusters of overexpressed proteins are highlighted. C) Global pathway analysis of overexpressed proteins in CAR-HER2- siFurin. Figure 8: The viability of HER2+ breast cancer tumoroids derived from patient tumours is reduced by furin inhibition in CAR-M. A) FACS plots showing the percentage of primarybreast cancer cells derived from HER2- and HER2+ tumoroids that express the HER2antigen. B) Immunofluorescence analysis of the cytotoxic effect of CAR-M on tumoroids (HER2+ and HER2-) in comparison with mock macrophages. Macrophages are GFP+ and the nuclei (blue) are labelled with Hoeschst. C) Quantification of the size of HER2+and HER2- tumoroids in the presence of CAR-M or mock using ImageJ software.D) Representative FACS plots of phagocytosis after 48 hours of coculture at a ratio of3:1 (macrophages / cancer cells). The % cytotoxicity and residual cancer cells between conditions are shown. E) Schematic of the methodology used to isolate T cells from blood and measure their proliferation index in the presence of the conditioned medium of mock, CAR-M or CAR-M siFurin after co-culture with tumoroids. F) Proliferation index of T cells in the presence of conditioned medium from mock, CAR-M or CAR-M siFurin after co- culture with tumoroids. RPMI is a negative control and CD3 / CD28 is a positive control. EXAMPLES Materials and Methods Cell culture The THP1 and AU565 cell lines were cultured in RPMI medium supplemented with 10% FBS, 1% L-glutamine (2 mM) and 1% penicillin / streptomycin (100 units / ml). MDA-MB- 231 cells were cultured in DMEM supplemented with 10% FBS, 1% L-glutamine (2 mM), and 1% penicillin / streptomycin (100 units / ml). All cell lines were cultured in a humidified atmosphere at 37°C with 5% CO2. Isolation of human PBMC and differentiation of macrophages Human blood was collected from healthy adult donors by the Etablissement Français du Sang (EFS) and processed to isolate peripheral blood mononuclear cells (PBMC) byFicoll density gradient separation. Blood was diluted in 0.1% PBS-EDTA and gentlylayered on Ficoll (Sigma 1077, Ficoll-Paque PLUS, GE Healthcare density 1.077g / ml). After centrifugation, the leukocyte ring, containing monocytes, was collected and washed in PBS-EDTA by centrifugation. The pellet was resuspended in red blood cell lysis buffer (eBioscience™ 10X RBC Lysis Buffer, Invitrogen) and incubated for 5 minutes at room temperature. After cell counting, PBMC were cultured in serum-free RPMI medium(RPMI 1640, 1% penicillin / streptomycin, and 2mM L-glutamine) at 37°C for 90 minutes.Non-adherent cells were removed, and adherent monocytes were cultured for seven days in RPMI 1640 medium supplemented with 10% human serum, 1% penicillin / streptomycin, 2mM L-glutamine, and 50ng / mL M-CSF for differentiation into macrophages. Transfection of THP1 and primary macrophages with siRNA THP1 were seeded at 500,000 cells per well in a 12-well plate and transfected with control siRNAs, furin siRNAs, PC1 / 3 siRNAs at a final concentration of 100nM. The Viromer® GREEN transfection kit (Lipocalyx) was used for the transfection reaction. Briefly, 0.5µl of Viromer was mixed with 45 µl of Viromer buffer. This mixture was thenadded to 5µl of a mix of four siRNAs (anti-furin: SEQ ID NO:4+5+6+7; control: SEQ IDNO: 1+2+3+4) previously diluted to 11µM and incubated for 15 minutes at room temperature before being added to THP1 cells. THP1 cells were then incubated with the transfection solution for 6 hours at 37°C and then differentiated into macrophages with 10 ng / ml phorbol 12-myristate 13-acetate (PMA Sigma Aldrich). Primary macrophages were seeded at 600,000 cells per well of a 12-well plate andtransfected with a mix of four control siRNA (SEQ ID NO:1 + 2 + 3 + 4) or with a mix offour Furin siRNA (SEQ ID NO:5 + 6 + 7 + 8) at a final concentration of 300nM. The INTERFERin® transfection kit (Polyplus Transfection) was used for the transfection reaction. The siRNAs were diluted to a final concentration of 50 nM in Opti-MEM (Gibco, Life technologies) and mixed with 12 µl of Interferin. This mixture was incubated for10 minutes at room temperature and then added to the cells. Macrophages wereincubated at 37°C for 24 hours. After 24 hours, the medium was changed to complete RPMI medium. Plasmid construction and virus The CAR sequence is composed of a CD8a signaling sequence, the sequences of the variable parts of the light and heavy chains of trastuzumab to target the HER2 protein, a linker, a hinge sequence, a CD8a transmembrane domain and the intracytoplasmic part, corresponding to the ζ chain of the TCR / CD3 complex. This sequence of 6571 base pairs was inserted into a lentiviral vector or an adenoviral vector (pAd5 / F35) and under thecontrol of the EF1a promoter (the CAR molecule is completed described in Klichinsky etal, Nat. Biotechnol. 1–72020, which is incorporated by reference). A coding sequencefor the fluorescent protein EGFP was also present under the control of the CMVpromoter. The control vector did not contain the CAR molecule sequence (mock). Thevectors and the production of the viral particles (lentivirus and adenovirus) were performed by Vector Builder. Viral transductions THP1 cells were seeded in 24-well plates at 500,000 cells per well. The cells were transduced using a VSV-G pseudotyped lentiviral system at a multiplicity of infection (MOI) of 10 lentiviral particles per THP1 cell in the presence of 8 μg / ml Polybrene (Sigma Aldrich) in complete medium. The plate was centrifuged at 1000 g for 60 minutes at 32°C to allow contact between the cells and the viral particles. Finally, the cells were pelleted by centrifugation and the supernatant was replaced with complete medium. THP1monocytes were sorted to obtain GFP+ cells that had integrated the vector. Cells wereselected using the GFP fluorescence bandpass filter at 525 / 50 nm with a 488 nm laser on an SH800 cell sorter (Sony, Inc). Monocytes were differentiated into macrophages inthe presence of 100 ng / ml PMA in complete medium. THP1 cells were harvested on48 hours after differentiation and analyzed by flow cytometry and immunofluorescenceto determine CAR expression.Primary macrophages were transduced by a chimeric Ad5 / F35 adenoviral system on day5 after differentiation at a MOI of 200 based on PFU titer. Differentiated macrophages were harvested on day 9 (96 hours post-transduction) and analyzed by flow cytometry and immunofluorescence to determine CAR expression. RT-qPCR Total RNA was extracted using TRIzol reagent (QIAGEN). A 1 / 5 volume of chloroform was then added and the mixture was mixed. The mixture was then incubated for15 minutes and centrifuged at 12,000 × g for 15 minutes at 4°C. The aqueous phase wastransferred to a new tube and an equal volume of isopropanol was added. The mixturewas centrifuged at 12,000 × g for 10 min at 4°C. The supernatant was discarded and thepellet was resuspended in 75% ethanol and centrifuged at 7500 × g for 5 min at 4°C. Thesupernatant was then thoroughly removed and discarded. The pellet was resuspended in 10 μL of nuclease-free water. Reverse transcription was further performed using Transcriptase Reverse SuperScript® III (Invitrogen, ThermoFisher Scientific) with 1 µg of total RNA as input. qRT-PCR was performed using SYBR qPCR Mix (AppliedBiosystems, ThermoFisher Scientific) according to the manufacturer’s protocol. A“negative RT” without the addition of the reverse transcriptase was also included as a control to assess gDNA contamination. RT-PCR reactions were also performed using Go Taq polymerase according to the manufacturer’s protocol. Primer sequences arelisted in Table 1 below. Data are presented as mean ± standard error in triplicate.Statistical significance between different siRNA conditions was calculated using ANOVA with multiple comparisons; ****P <0.0001; ***P <0.001; **P <0.01; *P <0.05; NS, not significant. Table 1: Summary of the oligonucleotides used in the study Name Sequence SEQ ID NO:siRNA CTRL TGGTTTACATGTCGACTAA 1siRNA CTRL TGGTTTACATGTTGTGTGA 2siRNA CTRL TGGTTTACATGTTTTCTGA 3siRNA CTRL TGGTTTACATGTTTTCCTA 4siRNA an^-Furin GGACTAAACGGGACGTGTA 5siRNA an^-Furin GCGAGTGGGTCCTAGAGAT 6siRNA an^-Furin CCGCAGATGGGTTTAATGA 7siRNA an^-Furin CAGCTGCGCTCTGGCTTTA 8siRNA an^-PCSK1 (PC1 / 3) GATGGTGAATAGTCGATTT 9siRNA an^-PCSK1 (PC1 / 3) GGAATCACACGGACATTTA 10siRNA an^-PCSK1 (PC1 / 3) GTACTTGGACTTTGAGAAT 11siRNA an^-PCSK1 (PC1 / 3) GGGCTGAACAACAGTATGA 12RT PCR Primer RPS185’ to 3’ fwd GCAGAATCCACGCCAGTACAAG 13RT PCR Primer RPS185’ to 3’ rev GCTTGTTGTCCAGACCATTGGC 14RT PCR Primer furin 5’ to 3’ fwd TGCCACGCCTCATGTGCC 15RT PCR Primer furin 5’ to 3’ rev TCCCGGCAAAGCCAGAGC 16RT PCR Primer PC1 / 35’ to 3’ fwd CGCTGACCTGCACAATGACT 17RT PCR Primer PC1 / 35’ to 3’ rev ATGCAGCACCTGGTTGTCTG 18RT PCR Primer TNF-a 5’ to 3’ fwd CAGAGGGCCTGTACCTCATC 19RT PCR Primer TNF-a 5’ to 3’ rev GGAAGACCCCTCCCAGATAG 20RT PCR Primer IL-65’ to 3’ fwd GGTACATCCTCGACGGCATCT 21RT PCR Primer IL-65’ to 3’ rev GTGCCTCTTTGCTGCTTTCAC 22RT PCR Primer iNOS 5’ to 3’ fwd CAGCGGGATGACTTTCCAAG 23RT PCR Primer iNOS 5’ to 3’ rev AGGCAAGATTTGGACCTGCA 24RT PCR Primer IL-10 5’ to 3’ fwd GATCCAGTTTTACCTGGAGGAG 25RT PCR Primer IL-10 5’ to 3’ rev CCTGAGGGTCTTCAGGTTCTC 26RT PCR Primer CD206 5’ to 3’ fwd CGAGGAAGAGGTTCGGTTCACC 27RT PCR Primer CD206 5’ to 3’ rev GCAATCCCGGTTCTCATGGC 28PCR Primer furin 5’ to 3’ fwd TATGGCTACGGGCTTTTGG 29PCR Primer furin 5’ to 3’ rev TTCGCTGGTGTTTTCAATCTCT 30PCR Primer PCSK15’ to 3’ fwd ATCGCAGGGTAAGGAAGAAGC 31PCR Primer PCSK15’ to 3’ rev CTGGAAGCTGATTTTGCACGG 32PCR Primer Ac^n 5’ to 3’ fwd CACGGCATTGTAACCAACTG 33PCR Primer Ac^n 5’ to 3’ rev TCTCAGCTGTGGTGGTGAAG 34Flow-cytometry Transduction efficiency of THP1 and primary macrophages was determined by flow cytometry based on GFP expression. Mock, CAR-HER2 and untransduced (WT) cells were labelled with the Live Dead Near viability staining kit (633 nm, InvitrogenTM), then washed and fixed with 4% paraformaldehyde (PFA). Transduction efficiency was determined as the percentage of GFP+ cells among live cells. THP1 and primary macrophages were tested for CAR-HER2 expression using a two-step labelling protocol:binding of a biotinylated recombinant HER2 protein (ACROBiosystems) for 1 hour at 4°C,followed by labelling with anti-biotin PE antibody diluted 1:100 (Miltenyi Biotec) for10 minutes at 4°C. Cells were labelled with the viability marker Live Dead Near (633 nm,InvitrogenTM) for 20 minutes at 4°C, then washed and fixed with 4% PFA. The numberof macrophages expressing the CAR molecule was determined as the percentage ofGFP+ PE+ cells among live cells. To study macrophage polarization, macrophages were inhibited with siRNA (siFurin and siCTRL) as described above. After 48 hours of transfection, macrophages were harvested and stained with fluorescein PC5-conjugated anti-human CD80 and BV786- conjugated anti-human CD86 (BD, Biosciences). The cells were washed with PBS andfixed with 4% PFA. Data are presented as mean ± standard error in triplicate. Statisticalsignificance between conditions was calculated using t-test; ****P <0.0001; ***P <0.001; **P <0.01; *P <0.05; NS, not significant. To determine HER2 expression in patient-derived tumoroids, they were dissociated with TrypLE for 15 minutes at 37°C. Cells were washed and counted to reach a concentration of 500,000 cells / condition. Cells were incubated with PE conjugated anti-human HER- 2 / neu antibody (BD, Biosciences). All samples were analyzed using the CytoFLEX LX 2020 (Beckman Coulter). Isotypecontrols were included in all experiments. Flow cytometry data were processed usingKALUZA software. Migration and invasion assay THP1 cells were seeded at 240000 cells / well in a 24-well plate. THP1 cells were transfected with siRNA (siFurin, siPC1 / 3 and siCTRL) as described previously. After48 hours of transfection, THP1 cells were washed with 0% DMEM. For the migrationassay, 10000 MDA-MB-231 cells were added to the transwells (8 µM) and for theinvasion assay, the 8 µm transwells were coated with Matrigel before 200000 MDA-MB- 231 cells were added. The transwells were then placed in the THP1 wells and incubatedfor 24 hours. The inserts were collected and the cells fixed with 4% PFA followed bynuclear labelling with Hoechst (1 / 10000) for 20 minutes. The inserts were mounted on Faramount Dako mounting medium. Analysis was performed using a fluorescence microscope (Nikon).5 random fields per slide were photographed. Image J software was used for image processing. Data are presented as mean ± standard error in triplicate. Statistical significance between different siRNA conditions was calculated using ANOVA with multiple comparisons; ****P <0.0001; ***P <0.001; **P <0.01; *P <0.05; NS, not significant. Bead-based phagocytosis assay 100,000 THP1 WT or CAR-HER2 cells were seeded on glass coverslips pretreated with poly-D-lysine (Sigma Aldrich) in a 24-well plate. Furin and PC1 / 3 inhibition was performed as described above. Monocytic cells were differentiated into macrophages with PMA 100 ng / ml for 24 h. WT macrophages were labelled with the vital dye Cytotell green (AAT Bioquest) at 1:500 dilution for 15 min at 37°C. Streptavidin-coated polystyrene microparticles (5.0-5.9 μm diameter, Spherotech) were sterilized in 70% isopropanol for 20 min. The beads were then incubated with the fluorescent dye pHrodo SE (Invitrogen) diluted in sodium bicarbonate buffer (0.1 M, pH8.5) at a concentration of 10μmol / l for 30 min in the dark. After washing, half of the beads were incubated with biotinylated HER2 protein (ACROBiosystems) at a concentration of 2.5 μg per mg of beads in phosphate buffer (0.1M, pH6.5) for 1 h. The other half was used as a blank bead control (not bound to the biotinylated HER2 protein). After washing, the beads were placed in the presence of mock or CAR macrophages at a ratio of 10 beads per cell for 4 h. Cells were then fixed with 4% PFA at 4°C for 10 min, followed by nuclear labelling with Hoechst (1 / 10000). Slides were mounted on Faramount Dako mounting medium. Analysis was performed using a Zeiss LSM 510 confocal microscope coupled to a Zeiss Axiovert 200 M with a 63X1.4 numerical aperture oil immersion objective.5 random fields per slide were photographed. Image J software was used for image processing. Phagocytosis efficiency was determined by the proportion of cells phagocytosing at least one bead out of the total number of macrophages. Data are presented as mean ± standard error in triplicate. Statistical significance between different conditions was calculated using ANOVA with multiple comparisons; ****P <0.0001; ***P <0.001; **P <0.01; *P <0.05; NS, not significant. Flow cytometry-based phagocytosis assay THP1 mock or THP1 CAR-HER2 were cocultured with AU565 (HER2+) or MDA-MB-231 (HER2-) tumor target cells at a ratio of 1 / 1, 1 / 5 or 1 / 10 (target / effector) for 6, 24 or 48 h at 37°C. Cancer cells were pre-labelled with Cytotell blue (AAT Bioquest) at a 1:500 dilution for 20 min at 37°C prior to coculture. Similarly, mock or CAR-HER2 human monocyte-derived macrophages (96h post- transduction) were cocultured with AU565 cells (HER2+) or MDA-MB-231 (HER2-) tumor target cells at a 3:1 (effector / target) ratio for 6 or 24 hours at 37°C. CAR-HER2 weretransfected with a a mix of four control siRNAs (SEQ ID NO:1+2+3+4) or a mix of fouranti-Furin siRNAs (SEQ ID NO:5+6+7+8) (as previously described). Tumor cells werepre-labelled with Cytotell blue (AAT Bioquest) as described above. After co-culture, cells were trypsinized and analyzed by FACS using CytoFLEX LX 2020 (Beckman Coulter). The percentage of BFP+ GFP+ events was reported as the percentage of phagocytosis. Data are presented as mean ± standard error in triplicate. Statistical significance between Mock, CAR-HER2-siCtrl and CAR-HER2-siFurin was calculated using ANOVA with multiple comparisons; ****P <0.0001; ***P <0.001; **P <0.01; *P <0.05; NS, not significant. Microscopy-based phagocytosis assay 200,000 human monocyte-derived macrophages were seeded on 14 mm coverslips. Cells were transduced with either CAR-HER2 or empty vector (mock). At 96 hours posttransduction, CAR-HER2 macrophages were transfected with a mix of four controlsiRNAs (SEQ ID NO:1+2+3+4) or with a mix of four anti-Furin siRNAs (SEQ IDNO:5+6+7+8). After 48 hours of transfection, Mock, CAR-HER2-siCtrl or CAR-HER2- siFurin cells were cocultured with AU565 tumor target cells at a ratio of 3:1(effector / target) for 6 hours at 37°C. Coverslips were collected and cells fixed with 4%PFA for 10 minutes at 4°C, followed by nuclear labelling with Hoechst (1 / 10000). Slides were mounted with Faramount Dako mounting medium. Analysis was performed using a Zeiss LSM 510 confocal microscope coupled to a Zeiss Axiovert 200 M with a 63x1.4 numerical aperture oil immersion objective.5 random fields per slide were photographed. Image J software was used for image processing. Cytokine array A Human Cytokine Antibody Array (ab133997, Abcam) was used to quantify 42 cytokines in culture medium according to the manufacturer’s instructions. Medium was obtained from primary macrophages that were either mock, CAR-HER2 or CAR-HER2 transfected with the mix of four siRNAs anti-Furin. After the array membranes were incubated in 1× blocking buffer for 30 min at room temperature, a sample of each culture medium was applied to the membranes and incubated overnight at 4 °C on a rocking platform shaker. After four washes in Wash Buffer I and three washes in Wash Buffer II, the membranes were incubated overnight at 4°C with biotin-conjugated anti-cytokines and then with HRP-conjugated streptavidin. The washed arrays were then treated with chemiluminescence detection reagents and images were captured using an iBright CL750 Imaging System (Invitrogen). The levels of each cytokine were quantified using Fiji software. Data are presented as mean ± standard error in triplicate. Statistical significance between Mock, CAR-HER2-siCtrl and CAR-HER2-siFurin was calculated using ANOVA with multiple comparisons; ****P <0.0001; ***P <0.001; **P <0.01; *P <0.05; NS, not significant. CAR-M sorting by FACS after coculture After 24 hours of coculture of primary CAR-HER2 or mock macrophages with AU565 tumor cells at a ratio of 3:1, the cells were trypsinized and sorted. Primary CAR-HER2 macrophages were selected using the GFP fluorescence bandpass filter at 525 / 50 nm with a 488 nm laser on an SH800 cell sorter (Sony, Inc). Proteomic sample preparation THP1 were transfected with a mix of four anti-Furin siRNAs (SEQ ID NO:5+6+7+8), witha mix of four anti-PC1 / 3 siRNAs (SEQ ID NO:9+10+11+12) or with a mix of four controlsiRNAs (SEQ ID NO:1+2+3+4). After 48 hours of transfection, proteins were extractedwith RIPA buffer and quantified by the Bradford method.30 µg of protein cell extracts were reduced with an equivalent volume of reducing buffer (dithiothreitol-DTT 0.1 M) for 40 minutes at 56 °C and loaded into Amicon ultracentrifugal filters (Millipore). Samples were then subjected to the filter-aided sample preparation (FASP) protocol, which included denaturation in urea buffer (8M, Tris-HCl 0.1M, pH8) and alkylation with 55 mM iodoacetamide for 20 minutes in the dark. The proteins were then digested overnight at 37°C with 40 µg / ml of trypsin (Promega). Digestion was stopped with 0.5% TFA. Samples were desalted using a Millipore C18 ZipTip and eluted with 20 µl of elution solution (80% ACN / 20% 0.1%TFA). The solution was then dried with a SpeedVac. Dried samples were solubilized in a resuspension solution (2% ACN / 80% formic acid 0.1%) prior to LC-MS / MS analysis. Similarly, after cell sorting, proteins were extracted and digested as described above. LC-MS / MS analysis Samples were separated by on-line reversed-phase chromatography using a Thermo Scientific Easy-nLC 1000 system equipped with a trap column (75 µm ID x 2 cm, Thermo Scientific) and a C18 packed-tip column (75 µm ID x 50 cm, Thermo Scientific). Peptides were separated using increasing amounts of acetonitrile (5-35% over 100 min) at a flow rate of 300 nl / min. The LC eluent was electrosprayed directly from the analytical column, and a voltage of 2.4 kV was applied via the liquid junction of the nanospray source. The chromatography system was coupled to a Thermo Scientific Q-Exactive mass spectrometer, which was programmed to acquire in a data-dependent acquisition mode (top 10). Full scan MS analysis was performed over a m / z range of 300 to 1600, a resolution of 70,000 FWHM, an AGC of 3e6 ions, and a maximum injection time of 120 ms. For MS / MS analysis, the m / z mass range was set between 200 and 2000, with an AGC of 5e4 ions, a maximum injection time of 60 ms, and a resolution of 17500 FWHM. Higher Energy Collision Dissociation (HCD) was set to 30%. Precursor ions with charge states greater than +1 and less than +8 were selected for fragmentation, with a dynamic exclusion time of 25 seconds. Data analysis Proteins were identified using the MaxQuant software (Cox, J. & Mann, M. Nat.Biotechnol. 2008 2612 26, 1367–1372 (2008)) version 1.6.10.43 by comparing all MS / MS data with the proteome database of the complete reviewed proteome of Homo sapiens (Uniprot, release July 2018; 8054 entries). Lys-C trypsin specificity was used for the digestion mode with two missed cleavages. Cysteine carbamidomethylation was set as a fixed modification. N-terminal acetylation and methionine oxidation were chosen as variable modifications. For MS spectra, an initial mass tolerance of 6 ppm was selected, and the MS / MS tolerance was set to 20 ppm for HCD data. For identification, the false discovery rate (FDR) was set at 0.01 for peptide spectral matches (PSMs) and at the protein level. Relative, label-free quantification of proteins was performed using the MaxLFQ algorithm integrated into MaxQuant with the default parameters20. Analysis of identified proteins was performed using Perseus software (http: / / www.perseus-framework.org / ) (version 1.6.10.43) (Tyanova, S. et al. The Perseus computational platform forcomprehensive analysis of (prote)omics data. Nat. Methods 13, 731–740 (2016)). Thefile containing the identification information was used with hits to the reverse database, and proteins identified with modified peptides and potential contaminants were removed. The LFQ intensity was then logarithmized (log2[x]). Categorical annotation of the rows was used to define different groups (CAR-HER2 and CAR-HER2-siFurin). Two-sample t-test was performed using a student’s t-test with a p-value of 0.05, with grouping maintained in randomization. Results were normalized by z-score and presented as hierarchical clustering. Functional annotation and characterization of identified proteins were performed using STRING (version 10.5, http: / / string-db.org) and Funrich (version 3.1.3, http: / / www.funrich.org / ). Subnetwork enrichment pathway analysis Elsevier’s Pathway Studio (version 11.0 / / Elsevier) was used to map all relationships between the differentially expressed proteins across all conditions based on the Ariadne ResNet. For proteins identified in the shotgun analysis, the Subnetwork Enrichment Analysis (SNEA) algorithm was used to detect the statistically significant altered biological pathways in which the identified proteins are involved. This algorithm uses Fisher’s statistical test to detect any non-random associations between two categorical variables organized by a specific relationship. This algorithm also starts by creating a central “seed” from all the relevant identities in the database and establishes links to associated entities based on their relationship to the seed. SNEA compares the subnetwork distribution to the background distribution using a one-sided Mann–Whitney U test and calculates a p-value, which represents statistical significancebetween different distributions. In all analyses that we performed, the GenBank ID wasused to create experimental groups based on the different conditions present foranalysis. Pathway networks were reconstructed based on biological processes and molecular functions for each individual protein, together with its associated targets. Primary breast cancer tumoroids culture and co-culture with macrophages The tumor tissue biopsy was minced and placed in digestion medium in a reduced volume of 2 mL to avoid loss of material. The digestion medium consisted of Hank’s balanced salt solution (HBSS, Gibco) with antibiotics and antifungals (1X penicillin / streptomycin, 1X amphoteromicin) containing 1 mg / mL collagenase type IV (Sigma) and 5 U / mL hyaluronidase (Sigma). The tumor tissue was digested at 37 °C for 2 hours and mixed every 15 minutes to facilitate digestion. After digestion, 6 mL of HBSS with antibiotics was added and the cell suspension was filtered through a 100 μm filter (Dutcher) to retain residual tissue pieces. The suspension was centrifuged at 300 g for 5 minutes. If red pellet was visible, the erythrocytes were lysed in 1 mL red blood cell lysis buffer (RBC, Invitrogen) for 5 minutes at room temperature. The suspension was then completed with 6 mL HBSS with antibiotics and centrifuged at 300 g for 5 minutes. The cell pellet was resuspended in a reduced growth factor solubilized basement membrane matrix for organoid culture (Matrigel®, Corning) and plated dropwise into 24- well plates. Matrigel was allowed to solidify in the incubator for 30 minutes and then500 μL of complete culture medium was added. The complete tumoroid culture mediumconsisted of Advanced DMEM (Gibco) supplemented with 1X Glutamax, 10 mM Hepes, 1X penicillin / streptomycin, 1X amphoteromicin, 50 μg / mL Primocin, 1X B27 supplement, 5 mM nicotinamide, 1.25 mM N-acetylcysteine, 250 ng / mL R-spondin 1, 5 nM heregulinβ- 1, 100 ng / mL noggin, 20 ng / mL FGF-10, 5 ng / mL FGF-7, 5 ng / mL EGF, 500 nM A83-01, 500 nM SB202190 and 5 μM Y-27632. Semi-liquid co-culture was performed in non- adherent PrimeSurface plates (MS-9024OZ) in which Mock or CAR macrophages (treated with siControl or siFurin) were mixed with tumoroids (HER2+ or HER2-) in complete tumoroid culture medium supplemented with 2% Matrigel in a 3:1 (effector / target) ratio for 48 hours at 37°C. Microscopy of tumoroids After 48 hours of coculture, tumoroids were collected and placed in a Labteck (Dutscher), previously coated with poly-D-lysine, for 24 hours at 37°C to allow adhesion. Mixed tumoroids were then fixed with 4% PFA for 24 hours at 4°C, followed by a permeabilization step (PBS, 1% Triton X-100, 0.1%Tween+glycine 0.1M) for 24 hours at 4°C. The nuclei were then labeled with Hoescht (1 / 2000) for 24 hours at 4°C. Finally, a series of clearing steps were performed using a buffer consisting of 50% formamide and 10% polyethylene glycol for 1 hour, followed by 50% formamide and 10% polyethylene glycol for 6 hours. Clearing steps were performed at room temperature. Tumoroids were stored in clearing buffer until analysis. Analysis was performed on a CSU-W1 spinning disc (Gataca Systems) with Live-SR module, controlled by Metamorph software. An initial analysis was performed using a 40x / 1.3 numerical aperture oil immersion objective, followed by an analysis using a 10x / 0.3 numerical aperture oil immersion objective. Image stacks were acquired with a delta z of 0.3 µm.5 random fields per condition were photographed. Image J software was used for image processing. Statistical significance between mock, CAR-HER2-siCtrl and CAR-HER2-siFurin was calculated using ANOVA with multiple comparisons; ****P <0.0001; ***P <0.001; **P <0.01; *P <0.05; NS, not significant. Flow cytometry-based tumoroid phagocytosis assay Similarly, mock or CAR macrophages (siControl or siFurin) were cocultured with tumoroids (HER2+ or HER2-) in complete tumoroid culture medium supplemented with 2% Matrigel, at a 3:1 (effector / target) ratio for 48 hours at 37°C. Tumoroids were pre- labelled with Cytotell blue (AAT Bioquest), as described above. After co-culture, cells were harvested and analyzed by flow cytometry using CytoFLEX LX 2020 (Beckman Coulter). The percentage of CytotellBlue+ events was reported as the percentage of phagocytosis. Data are presented as mean ± standard error of the wells in triplicate. Statistical significance between Mock, CAR-HER2-siCtrl and CAR-HER2-siFurin was calculated using ANOVA with multiple comparisons; ****P <0.0001; ***P <0.001; **P <0.01; *P <0.05; NS, not significant. MTS cell proliferation assay PBMC were isolated from the blood of healthy volunteers by Ficoll density gradient separation. The interface cells were washed three times with PBS-EDTA, cells were isolated by MACS depletion (Miltenyi Biotec). PBMC were labeled with microbeads using a pan T cell isolation kit and separated on magnetic columns in a LS column separator, according to the manufacturer’s recommendations (Miltenyi Biotec). Results promotes a pro-inflammatory profile. Using a transwell coculture set-up (Fig.1A), we investigated whether cancer cells could influence the expression of two PC enzymes, Furin and PC1 / 3, in human THP1 macrophages and primary blood monocyte-derived macrophages. Firstly, basal expression of Furin and PC1 / 3 has previously been demonstrated in THP1 macrophages (LaMendola, J., Martin, S. K. & Steiner, D. F. FEBS Lett. 404, 19–22 (1997); Cao, R. etal. J. Clin. Lab. Anal.34, (2020)).and we validated the expression of Furin in the primary macrophages by PCR (Fig. 1I). However, PC1 / 3 expression was not detected in theprimary macrophages (Fig.1I). Furin expression increased in the THP1 cells after coculture with human breast cancer cells (Fig.1B). A 7-fold and a 3-fold increase was observed after 24 and 48 hours of coculture, respectively. This effect was also observed in primary macrophages (Fig.1C), with a 7-fold increase after 24 hours of coculture. A slight increase in PC1 / 3 expression was observed in THP1 cells after 24 hours of coculture, although not significant (Fig. 1A). These results suggest that in order to elicit immune suppression, the cancercells induce an increase in the expression of PC enzymes in macrophages. To confirm that Furin and PC1 / 3 downregulation has the same effect in human macrophages, we have knocked down Furin or PC1 / 3 by using a pool of small interfering RNAs (siRNAs) in THP1 cells (Fig. 1D) and in primary macrophages (Fig. 1F).Macrophage activation status was assessed by measuring the mRNA expression of several pro- and anti-inflammatory markers by qPCR. In THP1 cells, an increase in theexpression of pro-inflammatory markers was measured following Furin knock-down (Fig. 1E). A 2-fold increase in the expression of TNF-α, IL-6 and iNOS was observed.No difference in expression was observed for IL-10 and CD206, two anti-inflammatory markers. Slight but insignificant changes in the expression of these markers were induced by PC1 / 3 knock-down in THP1 macrophages (Fig. 1E). In primary macrophages, a 1.5-fold increase in the expression of TNF-α and IL-6 was observed,while CD206 expression was reduced following furin knock-down (Fig. 1G). These results show that silencing furin in human macrophages can induce a pro-inflammatory phenotype, which could be a strategy to maintain the anti-tumor activities of macrophages. Macrophage polarization was also assessed by flow cytometry by measuring the number of CD86+and CD80+cells, two pro-inflammatory markers. While no difference was observed in the number of CD80+cells, a 2-fold increase in CD86+cells was observed after furin knock-down compared to control primary macrophages (Fig.1H). This pro- inflammatory state is accompanied by anti-tumor functions, as inhibition of PC1 / 3 and Furin in macrophages prevents migration and invasion of breast cancer cells (not shown). We then investigated the effect of PC1 / 3 and furin inhibition on the macrophage proteome. After trypsin digestion, proteins were analyzed by liquid chromatography coupled mass spectrometry (LC-MS). A total of 2393 proteins were identified (not shown). To identify proteins with the most prominent differences in expression profiles within transfected macrophages with siRNA PC1 / 3 and siRNA furin compared to siRNA control (siCtrl) or untransfected macrophages, we used an ANOVA test with a false discovery rate (FDR) of 5%. A total of 123 differentially expressed proteins wereidentified (not shown). The significantly up- and down-expressed proteins betweenconditions are shown on a heatmap (Fig.2A). An enrichment analysis of the differentially expressed proteins was performed for each cluster indicated in the heatmap. The cluster of proteins up-expressed in macrophages transfected with siRNA Furin and siRNA PC1 / 3 (siFurin and siPC1 / 3 respectively, corresponding to cluster 2) was associated with RNA metabolism and immune response (e.g. phagocytosis and formation of immunological synapse, Fig.2B, 2F and 2G). The cluster of proteins up-expressed only in macrophages transfected with siRNA Furin (corresponding to clusters 1 and 3) was associated with cell communication related to strong activation of the immune response (e.g. phagocytosis, macrophage response, T-cell activation, antigen presentation and Toll-like receptor signalling, Fig.2C, 2F and 2G). Interestingly, TLR2 and CD14, a co- receptor of several TLR receptors, were found up-regulated after furin inhibition (not shown). Finally, the cluster of proteins up-expressed only in macrophages transfected with siRNA control (siControl, corresponding to cluster 5) was associated with signal transduction and metabolism (e.g. cell transformation, mRNA processing and neoplasia,Fig.2E, 2F and 2G). Cluster 4 contains proteins overexpressed in non-transfected THP1macrophages. Most of the proteins are shared with the siRNA control transfected macrophages (Fig.2A) and the same biological pathways were involved (Fig.2D). We also analyzed the proteins that were only present in one condition. 31, 20 and 41 proteins were specific for macrophages transfected with siRNA control, siRNA furin and siRNA PC1 / 3 respectively (Fig. 3A). Enrichment analysis showed an abundance of proteins related to cell communication and cell proliferation in macrophages transfectedwith siRNA control (Fig 3A, 3B and 3C). Enrichment analysis of the exclusive proteinsof siRNA-furin transfected macrophages confirmed the immune activation status of these cells, as reflected by their association with several processes involved in macrophage infiltration, monocyte activation and interleukin signaling, with IL1B for example beingfound in this group of proteins (Fig 3A, 3B and 3C). Enrichment analysis of exclusiveproteins of the siRNA-PC1 / 3 transfected macrophages also revealed a stronger immuneresponse (Fig 3A, 3B and 3C).In conclusion, the proteome of macrophages was profoundly altered after PC1 / 3 or furin inhibition, with the most pronounced effect on the pro-inflammatory immune activation of these cells. Since no PC1 / 3 expression was detected in primary macrophages and the effect of furin seems to be more important for the phenotypic control of macrophages, even in THP1 macrophages, we decided to focus on the role of furin in the following experiments. Furin silencing in CAR-M enhances their phagocytic activity.The application of CAR therapies to solid tumors remains challenging. Macrophages maybe inhibited in an immunosuppressive tumor environment and CAR-M may lose their anti-tumor activity. We have developed CAR-M targeting the HER2 antigen, which is overexpressed in a subtype of breast cancer. Both THP1 and human blood monocyte- derived macrophages were transduced with a first-generation anti-HER2 CAR construct with CD3ζ as the intracellular domain as described in Klichinsky et al, 2020 (not shown). The construct also contained a GFP sequence. The construct was transduced into THP1 macrophages using a lentiviral vector, resulting in more than 70% of the macrophagesexpressing the CAR molecule and GFP protein (Fig. 4A). Control (mock) macrophageswere transduced with a construct containing only the GFP sequence (Fig.4A). We havealso confirmed the expression of the CAR molecule on the surface of THP1macrophages by immunofluorescence (Fig.4B). We have shown that the expression is stable for at least 4 weeks (not shown). In primary macrophages, the construct wastransduced with an adenoviral vector, resulting in 30% of the macrophages expressingthe CAR molecule and GFP protein (Fig.4C). CAR expression on the surface of primarymacrophages was also confirmed by immunofluorescence (Fig.4D). To investigate the functions of these anti-HER2 CAR-M, we performed co-cultures with either HER2+or HER2- breast cancer cells to measure their phagocytic activity. CAR-THP1 specifically phagocytized HER2+cancer cells at every ratio tested from 24h of co-culture (as assessed by the number of cancer cells remaining after the co-culture, not shown). Nophagocytic activity was observed when CAR-THP1 were co-cultured with HER2- cancercells (not shown). Primary CAR-M or mock macrophages were co-cultured with HER2+ breast cancer cells (AU565) at a ratio of 3 effector cells to 1 target cell for 6 or 24 hours. Phagocytic activity was assessed by flow cytometry as the percentage of double positive cells CAR-M GFP+ and AU565 CytotellBlue+ cells. After 6 hours of co-culture with mock macrophage, the percentage of double positive cells was approximately 0.5%, whereas more than 5% of CAR-M were GFP+ CytotellBlue+ (Fig. 4E). The difference was statistically significant (Fig. 4F). After 24 hours of co-culture, the percentage of phagocytosis increased with a significant difference between mock macrophages and CAR-M (Fig.4E and F). We have also confirmed by immunofluorescence that the cancer cells were internalized within the CAR-M (Fig.4G). The next step was to evaluate the anti-tumor functions of CAR-M, in which we inhibited furin. We first demonstrated furin activity on CAR-M by phagocytosis of HER2+beads. CAR-M were transfected with either siRNA control (CAR-siCtrl) or siRNA furin (CAR- siFurin) and co-cultured with HER2+beads or blank beads. The percentage of phagocytosis was assessed as the number of CAR-M that phagocytized at least one bead. Approximately 55% of CAR-siCtrl and 80% of CAR-siFurin phagocytized at least one HER2+bead (Fig.5A and 5B). CAR-siFurin have a significantly higher phagocytic activity against their target (Fig.5B). Interestingly, this effect is specific for the HER2antigen, as the phagocytic activity of the blank beads is much lower for both CAR-siCtrland CAR-siFurin. Furthermore, Furin inhibition does not increase the phagocytic activityof macrophages that do not express the CAR molecule (WT, Fig. 5B). The effect istherefore specific to CAR-M. We also showed that CAR-siFurin exhibited higher HER2- specific phagocytosis of cancer cells by immunofluorescence (Fig. 5C). CAR-siFurintended to phagocyte more than 2 cells per macrophage (not shown). We measured thepercentage of phagocytosis by flow cytometry as the percentage of double positive cells CAR-M GFP+ and AU565 CytotellBlue+ cells. After 6 hours of co-culture, no statistically significant difference was measured between CAR-siCtrl and CAR-siFurin. After 24 hours of co-culture, the difference in phagocytosis between CAR-siCtrl and CAR-siFurin was statistically significant (Fig.5E), with approximately 17% of CAR-siCtrl being double positive compared to 26% for CAR-siFurin (Fig.5D), confirming the results obtained with the beads. In conclusion, we have shown that the tumor killing capacity of CAR-M is significantly enhanced by furin inhibition. Furin silencing in CAR-M promotes a pro-inflammatory activation. A key feature of macrophages is their phenotypic plasticity to adapt to their local environment. Their phenotype can change in response to external signals. In tumors, the immunosuppressive environment can induce an anti-inflammatory macrophage phenotype. For CAR-M, this can lead to a reduction in their efficacy. To know whether furin inhibition can maintain the pro-inflammatory phenotype of CAR-M in the tumor microenvironment, we investigated the pro-inflammatory characteristics of macrophages after co-culture with tumor cells. First, cytokine secretion levels were measured using a cytokine array (Fig. 6A). Among the cytokines tested, seven showed significant differences in secretion profile between CAR-siCtrl and CAR siFurin: GRO (CXCL1, CXCL2 and CXCL3), GRO-α (CXCL1), CCL8, CCL7, CCL22, CXCL9 and CXCL15(Fig. 6B). CCL8 and CCL7 were significantly more secreted by CAR-siCtrl compared tomock macrophages and significantly more secreted by CAR-siFurin compared to CAR-siCtrl. GRO chemokines were significantly secreted by CAR-siFurin, and among these,GRO-α was secreted significantly more by CAR-siFurin than by CAR-siCtrl. CCL22, CXCL9 and CXCL15 were significantly more secreted by CAR-siFurin compared to CAR- siControl. All these factors have a chemoattractant role in the recruitment of other immune cells and some of them such as CXCL9 promote immune cell proliferation27. We then investigated the effect of furin inhibition on the CAR-M proteome after co-culture. We transduced macrophages with the CAR construct and 4 days later transfected them with siRNA control or siRNA furin.2 days after transfection, we added target cancer cells to the macrophages and maintained the co-culture for 24 hours before FACS sorting of CAR-M based on the GFP expression (Fig 7A). The sorted CAR-M were then lysed and proteins extracted before trypsin digestion and analysis by liquid chromatography coupled mass spectrometry (LC-MS). A total of 467 proteins were identified (not shown). To identify proteins with the most prominent differences in expression profiles within CAR-siFurin and CAR-siCtrl, we used a student t-test with a false discovery rate (FDR) of 5%. A total of 193 differentially expressed proteins were identified (not shown).The significantly up- and down-expressed proteins between the two conditions areshown on a heatmap (Fig.7B). An enrichment analysis was performed for the cluster 2 proteins indicated in the heatmap, corresponding to proteins over-expressed in CAR- siFurin macrophages. The main biological pathways enriched are related to antigen processing and presentation, immune response, infection, phagocytosis and protein synthesis (Fig.7C). As examples of proteins involved in antigen presentation, PSMB10, a member of the immunoproteasome, ACTG1, an actin remodeling protein and PML, a protein known to induce the expression of genes related to MHC class I antigen presentation, were overexpressed in CAR-M siFurin. As examples of proteins involved in phagocytosis, CTSZ, a lysosomal cysteine protease, and Rac1, a member of the Rho family GTPases, were overexpressed in CAR-M siFurin. Taken together, these resultsdemonstrate that Furin inhibition not only promotes the phagocytic activity of CAR-M, butalso maintains a pro-inflammatory phenotype in contact with cancer cells, which is critical for maintaining therapeutic efficacy over time. The increased expression of antigen- presenting proteins and secretion of chemokines by CAR-M may also promote T-cell recruitment and activation to enhance anti-tumor activity. Depletion in CAR-M reduces the growth of breast cancer tumoroids. We then sought to evaluate the anti-tumor activity of furin-inhibited CAR-M in a more complex tumor model. We have established 3D tumoroids made from human primary breast cancer biopsies, as we have previously published (Raffo-Romero, A. et al. BMCBiol.21, 1–19 (2023)). Tumoroids made from two different breast cancer subtypes wereused to test the efficacy of CAR-M. We first checked the HER2 expression status of the tumoroids before starting the co-culture using flow cytometry. More than 99% of the cells in the HER2+ tumoroids expressed the HER2 protein, while only 5.9% of the cells in theHER2- tumoroids expressed it (Fig. 8A). We then set up a co-culture system oftumoroids with CAR-M in a non-adhesive plate, in the complete tumoroid mediumcontaining 2% Matrigel. Prior to co-culture, macrophages were transduced with the CARor the mock construct and 4 days later, they were harvested and co-cultured with the tumoroids at a ratio of 3 macrophages to 1 tumor cell during 48 hours. Light sheet microscopy was then performed on cleared tumoroids to assess macrophage infiltration into the whole tumoroids. Representative images are shown in Fig.8B, where we can clearly see CAR-M and mock macrophage infiltration in HER2+and HER2- tumoroids. Interestingly, the HER2+tumoroids appeared disorganized in the presence of CAR-M compared to mock macrophages. We confirmed these observations by quantifying tumoroid size in all conditions (Fig.8C). A reduction in the size of HER2+ tumoroids wasonly observed when they were co-cultured with CAR-M. This was not the case for HER-tumoroids. We next investigated the effect of furin silencing on CAR-M phagocytosis in tumoroid models. After transduction of the macrophages as described above, they were transfected with either siRNA control or siRNA furin. One day later, they were harvested and co-cultured with the tumoroids for 48 hours at a ratio of 3 macrophages to 1 tumor cell. CAR-M activity was assessed by FACS (Fig.8D). The percentage of cytotoxicity forCAR-M siFurin was 40% compared to 27% for CAR-M siControl (Fig. 8D). Thisincreased cytotoxicity of CAR-M siFurin is correlated with the reduced number of tumorcells stained with Cytotell Blue after the co-culture (Fig.8D, 25% of residual tumor cellsfor CAR-M siFurin compared to 43% for CAR-M siControl). Finally, we wanted to evaluate the ability of CAR-M siFurin to activate other immune cells, such asT lymphocytes, in order to induce a synergistic effect. To do this, we culturedT lymphocytes for 48 hours with conditioned medium from CAR-M and tumoroid co-cultures and measured their proliferation (Fig.8E). As a positive control, we culturedT lymphocytes with CD3 / CD28 beads and as a negative control we culturedT lymphocytes in RPMI medium. We were able to confirm that the factors secreted byCAR-M siFurin induced a higher proliferation of T lymphocytes than those secreted by CAR-M siControl or mock macrophages (Fig. 8F). Taken together, these results confirmed in a complex model that furin-inhibited CAR-M phagocyte tumoroids more efficiently than control CAR-M and can potentially activate other immune cells. Discussion In this study, we have investigated the role of the two enzymes furin and PC1 / 3 in the pro-inflammatory polarization of human macrophages. Two models were studied, THP1- derived macrophages and primary blood monocytes-derived macrophages. While both enzymes were expressed by THP1 macrophages, only furin was expressed by primary macrophages. PC1 / 3 was originally thought to be expressed exclusively in theneuroendocrine system (Seidah, N. G. & Prat, A. Nat. Rev. Drug Discov. 11, 367–383(2012), but studies have shown that it is also expressed in immune organs (Lansac, G.et al. J. Neuroimmunol. 171, 57–71 (2006)). PC1 / 3 expression and trafficking can bemodulated by TLR ligands such as CpG-ODN (Duhamel, M. et al. Sci. Rep. 6, 1–13(2016)) and LPS (Gagnon, H. et al. PLoS One 8, (2013)) in mouse and rat macrophages.We can expect PC1 / 3 expression to be induced by TLR ligands in human macrophages as well, but as our aim is to develop a therapeutic strategy, we wanted to study the basalexpression of PC enzymes or in a tumor context. On the contrary, furin has a moreubiquitous expression (Seidah, N. G. & Prat, A. Nat. Rev. Drug Discov. 11, 367–383(2012)). Its expression has been detected in basal state human macrophages and we have shown for the first time that co-culture of macrophages with cancer cells results in increased furin expression in human macrophages. Furin is known to have an anti- inflammatory role, promoting Arg1 expression in mouse macrophages and production ofthe anti-inflammatory cytokine TGF-β1 (Cordova, Z. M. et al. Oncotarget 7, 54392–54404 (2016)). Furin is also involved in the regulation of T cell phenotype, as its deletion inT cells results in an overproduction of cytokines, autoantibodies and mice that developinflammatory diseases (Pesu, M. et al. Nature 455, 246–250 (2008) ; Ojanen, M. J. T. etal. Eur. J. Immunol. 53, (2023)). Therefore, we believe that cancer cells hijack the anti-tumor activity of macrophages by inducing the anti-inflammatory furin expression, which may be a new escape strategy for cancer cells. Indeed, we have shown that furininhibition in THP1 macrophages and primary macrophages triggers their pro-inflammatory activation. In addition, furin inhibition appears to induce more functional macrophages, as evidenced by increased expression of proteins involved in phagocytosis and co-stimulatory molecules required for antigen presentation, such as CD86. Furin inhibition may therefore be used as a therapeutic strategy to reactivate anti- tumor immunity. However, an effective immunotherapeutic strategy cannot be based on furin inhibition alone. As shown, furin inhibition perpetuates a pro-inflammatory state and may therefore be of interest for combination with other immunotherapeutic strategies aimed at restoring the anti-tumor function of immune cells, such as CAR therapies. CAR-T cell therapies have revolutionized the field of cellular immunotherapy for the treatment of hematological cancers. Many challenges limit their efficacy in solid tumors. CAR-M have emerged to overcome these limitations, as they are the majority of immune cells that infiltrate the tumor environment. A first clinical trial in patients has recently started to demonstrate theefficacy of CAR-M in detecting and eliminating solid tumors (Reiss, K. A. et al.https: / / doi.org / 10.1200 / JCO.2022.40.16_suppl.2533 40, 2533–2533 (2022); Abdou, Y.et al. https: / / doi.org / 10.1200 / JCO.2023.41.16_suppl.TPS2666 41, TPS2666–TPS2666(2023)) (CT-0508 Phase 1 first-in-human study). The challenge now is to developsecond-generation CAR-M to make them even more effective, because we know thatonce macrophages infiltrate the tumor, they can differentiate into anti-inflammatorymacrophages and lose their anti-tumor function. In this context, inhibiting furin in CAR- M is a way to enhance their anti-tumor activity. Indeed, our findings reveal that furin inhibition in CAR-M not only promotes the phagocytic activity of CAR-M against breast cancer cells, but also maintains a pro-inflammatory phenotype in contact with cancer cells which is critical for maintaining therapeutic efficacy over time. We were also able todemonstrate a higher phagocytic activity against tumoroids derived from the tumors ofbreast cancer patients. In addition, by eliminating tumor cells, CAR-M may open the door in the solid TME to other immune cells, including T lymphocytes. This collaborative strategy could be the key to making immunotherapy a fearsome force in the treatment of solid tumours. We showed here that CAR-M can activate T cell proliferation and furin inhibition amplify this phenomenon. In conclusion, our results have shown that we cangenerate a second generation of CAR-M with a durable pro-inflammatory and anti-tumorphenotype, which represents a promising approach for CAR immune cell therapy.

Claims

CLAIMS1. A pharmaceutical composition comprising an effective amount of activated furin-inhibited human macrophages expressing a Chimeric Antigen Receptor (CAR- M).

2. A method for treating a solid tumor in a patient in need thereof, comprising thestep of administering to said patient the pharmaceutical composition as defined in claim 1.

3. The method of claim 2, comprising the steps of:a) Obtaining human macrophages that can be administered to a patient,b) Transfecting in said macrophages a vector encoding a CAR moleculethat recognizes an antigen expressed by a solid tumor, said CARmolecule being operatively linked to a promoter that is functional inmacrophages, so as to obtain CAR-expressing macrophages (CAR-M), c) Inhibiting the expression or activity of furin in said macrophages,d) If need be, activating the thus obtained macrophages,e) Administering an effective amount of the furin-inhibited CAR-Mobtained in step c) or d) into the patient.

4. The method of claim 3, wherein the macrophages of step a) originate from asample obtained from said patient, and the CAR molecule of step b) recognizes an antigen expressed by the solid tumor of said patient.

5. The method of claims 2-4, wherein furin inhibition is obtained by means of achemical or oligonucleotide inhibitor specifically preventing the expression or activity of furin in human macrophages.

6. The method of claim 5, wherein said inhibitor is a shRNA or a siRNA, preferablycarried by a viral vector, for example a lentiviral vector.

7. The method of claims 2-6, wherein said tumor is a HER2+ solid tumor selectedfrom: breast cancer ovarian cancer, sarcoma, glioblastoma, and the CARmolecule contains the variable parts of the light and heavy chains of an antibodytargeting the HER2 protein.

8. The method of claims 3-7, wherein said vector is from an adenovirus or from alentivirus.

9. The method of claims 2-8, wherein said furin-inhibited human CAR-Mmacrophages induce a strong cytotoxic effect and T cell proliferation within the solid tumor.

10. The method of claims 2-9, wherein said furin-inhibited human CAR-Mmacrophages keep a pro-inflammatory phenotype once in the solid tumor.

11. A method to generate furin-inhibited CAR-M cells, said method comprising thesteps of: a) Obtaining allogenic or autologous human macrophages,b) In vitro transfecting in said macrophages a vector encoding a CARmolecule that recognizes an antigen expressed by a solid tumor, saidCAR molecule being operatively linked to a promoter that is functional in macrophages, so as to obtain CAR-expressing macrophages (CAR- M), c) In vitro inhibiting the expression or activity of furin in said CAR-Mmacrophages, preferably by transducing in the CAR-M macrophages a vector carrying the sequence of an interfering oligonucleotide inhibiting the expression of furin. d) Optionally, activating the macrophages.

12. The method of claim 11, wherein step a) contains the steps:a1) Withdrawing and isolating of monocytes precursors or pluripotent stem cells from blood or bone marrow or umbilical cord, from a patient in need thereof or from an healthy donor, a2) In vitro culturing these cells under appropriate conditions so as to obtain amacrophage population.

13. A pharmaceutical composition comprising an effective amount of activated furin-inhibited human macrophages expressing a Chimeric Antigen Receptor (CAR- M), for use for treating a solid tumor.

14. In vitro use of a furin inhibitor, for increasing the phagocytic capacity of CAR-Mmacrophages.

15. An in vitro method for increasing the phagocytic capacity of CAR-Mmacrophages, said method comprising the step of contacting said CAR-M macrophages with a specific furin inhibitor.

16. In vitro use of a furin inhibitor, for inducing and / or maintaining a pro-inflammatoryphenotype in CAR-M macrophages.

17. An in vitro method for inducing and / or maintaining a pro-inflammatory phenotypein CAR-M macrophages, said method comprising the step of contacting saidCAR-M macrophages with a specific furin inhibitor.

Images