Pyrazole-based inhibitors of DNA-dependent protein kinase and compositions and applications in gene editing

Pyrazole-based DNA-PK inhibitors address the inefficiencies of CRISPR/Cas9 systems by blocking the NHEJ pathway, thereby enhancing the HDR pathway for precise and efficient genome editing in eukaryotic cells, particularly in CRISPR-engineered CAR-T cells.

WO2025179188A1PCT designated stage Publication Date: 2025-08-28JUNO THERAPEUTICS INC
View PDF 16 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/016863
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-22
Filing Date
2025-02-21
Publication Date
2025-08-28

AI Technical Summary

Technical Problem

Current genome editing technologies, particularly CRISPR/Cas9 systems, face inefficiencies in precise genome modifications due to the predominant non-homologous end joining (NHEJ) pathway, which leads to errors and low efficiency of homology-directed repair (HDR), limiting the accuracy and effectiveness of gene editing in eukaryotic cells.

Method used

Development of pyrazole-based DNA-dependent protein kinase (DNA-PK) inhibitors that transiently block the NHEJ pathway, promoting the HDR pathway for more accurate and efficient genome editing by enhancing the insertion or deletion of specific sequences in cells.

Benefits of technology

The use of DNA-PK inhibitors increases the efficiency of HDR-mediated genome editing, improving the precision and effectiveness of CRISPR/Cas9 systems in modifying eukaryotic cells, such as CRISPR-engineered CAR-T cells, by reducing errors and enhancing targeted gene insertion or deletion.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025016863_28082025_PF_FP_ABST
    Figure US2025016863_28082025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure is directed to DNA-PK inhibitors having the Formula (I), or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, methods of preparing the forgoing, and compositions thereof, as well as methods of use for the compounds of Formula (I), in combination with a DNA cutting agent.
Need to check novelty before this filing date? Find Prior Art

Description

PYRAZOLE-BASED INHIBITORS OF DNA-DEPENDENT PROTEIN KINASE AND COMPOSITIONS AND APPLICATIONS IN GENE EDITING CROSS REFERENCE

[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No.63 / 556,621 filed on February 22, 2024, the entire contents of which are hereby incorporated by reference herein. FIELD

[0002] The present disclosure relates generally to compounds, compositions, methods, and kits for increasing genome editing efficiency by administering an inhibitor of DNA protein- kinase (DNA-PK) of general formula (I) and a genome editing system to a eukaryotic cell(s). The present disclosure further relates to compositions including the DNA-PK inhibitors of general formula (I), methods of inserting a polynucleotide of interest into the genome of a eukaryotic cell, and kits for inserting a gene of interest into the genome of a eukaryotic cell. The methods and kits can improve the efficiency of CRISPR / Cas-mediated polynucleotide insertion in cells, in particular in CRISPR-engineered CAR-T cells. INCORPORATION BY REFERENCE OF SEQUENCE LISTING

[0003] This application contains a Sequence Listing which has been submitted in .XML format via EFS-WEB and is hereby incorporated by reference in its entirety. Said .XML copy, created on January 30, 2025, is named 055920-635001WO.xml and is 74 KB in size. BACKGROUND

[0004] The development of cost-efficient and reliable methods for precise targeted alterations to the genome of living cells has been a long-standing goal. Genome editing has the potential to eliminate genes responsible for a particular disorder (i.e., a gene “knock-out”), or alternatively, provide a means for gene manipulation or insertion to correct a genetic deficiency or enhance a biological process via a gene “knock-in.” Genome editing can be applied for treatment of a multitude of disorders, including treatment of inherited disorders, hematological disorders and cancer, and in methods of immunotherapy. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR associated (Cas) systems are prokaryotic immune systems (Ishino et al., Journal of Bacteriology 169:5429-5433 (1987)), which provideimmunity against viruses and plasmids by targeting the nucleic acids of the viruses and plasmids in a sequence-specific manner (Soret et al., Nature Reviews Microbiology 6:181-186 (2008)). Since its original discovery, multiple groups have performed extensive research around potential applications of the CRISPR system in genetic engineering, including gene editing (Jinek et al., Science 337(6096):816-821 (2012); Cong et al, Science 339(6121):819- 823 (2013); and Mali et al., Science 339(6121):823-826 (2013)). The CRISPR-Cas9 gene editing system has been used successfully in a wide range of organisms and cell lines.

[0005] The Cas9 endonuclease generates a double-stranded DNA break at the target sequence, upstream of a protospacer adjacent motif (PAM). The target sequence can then be removed, or a sequence of interest can be inserted into the target sequence using an endogenous repair pathway of the cell. Endogenous DNA repair pathways include the Nonhomology Mediated End-Joining (NHEJ) pathway, Microhomology Mediated End-Joining (MMEJ) pathway, and the Homology Directed Repair (HDR) pathway.

[0006] NHEJ, MMEJ, and HDR pathways repair double-stranded DNA breaks, but repair of such double-stranded DNA breaks may result in insertions or deletions at the double stranded break site. In NHEJ, a homologous template is not required for repairing breaks in the DNA. NHEJ repair can be error-prone, although errors are decreased when the DNA break includes compatible overhangs. NHEJ and MMEJ are mechanistically distinct DNA repair pathways with different subsets of DNA repair enzymes involved in each of them. Unlike NHEJ, which can be precise in some cases, or error-prone in some cases, MMEJ is always error-prone and results in both deletion and insertions at the site under repair. MMEJ-associated deletions are due to the micro-homologies (2-10 base pairs) at both sides of a double-strand break. In contrast, HDR requires a homologous template to direct repair, but HDR repairs are typically high-fidelity and less error prone. HDR-driven repair of double-stranded DNA breaks is therefore preferable to NHEJ- or MMEJ-mediated repair; however, in many cell types HDR is limited by the activity of NHEJ at all cell cycle stages, and HDR is primarily utilized in the S / G2 phase of cell growth (Mao et al., Cell Cycle, 7:2902-2906 (2008)).

[0007] The ability to modify the genome of any cell at a precise location has improved with the recent discovery and implementation of CRISPR / Cas9 editing technology. However, the capacity to introduce specific directed changes at given loci is hindered by the fact that the major cellular repair pathway that occurs following Cas9-mediated DNA cleavage is the erroneous non-homologous end joining (NHEJ) pathway. Homology-directed recombination (HDR) is less efficient than NHEJ, reducing editing efficiencies in eukaryotic cells. While the achievement of insertion or deletions (indels) from NHEJ is up to 70% effective in somereports, the efficiency of HDR remains challenging, with rates at less than 1%. Accordingly, there is a need for increasing genome editing efficiency, in particular, HDR efficiency.

[0008] Studies have shown that reduced NHEJ activity in vivo results in increases in HDR activity, and this phenomenon can be exploited to increase the efficiency of HDR-mediated CRISPR / Cas9 precision genome engineering (Pierce et al. Genes Dev., 15, 3237–3242 (2001); Ma et al. RNA Biol., 13, 605–612 (2016); Maruyama, et al. Nat. Biotechnol., 33, 538–542 (2015); Robert et al. Genome Med., 7, 93 (2015)).

[0009] DNA-dependent protein kinase (DNA-PK) is a nuclear serine / threonine kinase that has been shown to be essential in DNA double stranded break repair machinery. In mammals, the predominant pathway for repair of double stranded DNA breaks is the non-homologous end joining (NHEJ) pathway which is functional regardless of the phase of the cell cycle and acts by removing non-ligatable ends and ligating ends of double strand breaks. There is a need for potent and selective DNA-PK inhibitors (DNA-PKi) that transiently block the NHEJ pathway to promote DNA repair via the desirable HDR pathway, therefore, improving the efficiency of CRISPR / Cas-mediated polynucleotide insertion in cells, such as CRISPR CAR- T cells. SUMMARY

[0010] A first aspect of the present disclosure relates to compounds of Formula (I)or a pharmaceutically acceptable salt thereof, wherein: A is a 5- or 6- membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the 5- or 6- membered heteroaryl or heterocycloalkyl is optionally substituted with one or more R3; R1is an aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S, and, wherein the aryl or heteroaryl is optionally substituted with one or more R4; R2is H, C1–C4alkyl, C1–C4alkoxy, C2–C4alkenyl, or C2–C4alkynyl, wherein the alkyl is optionally substituted with one or more halogen, OH, or -CN;each R3is independently selected from the group consisting of halogen, oxo, thioxo, C1–C4alkyl, CD3, CD2CD3, C1–C4 alkoxy, C1–C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl, and aryl; or two geminal R3, together with the intervening geminal carbon atom, form a C3-C5cycloalkyl; each R4is independently selected from the group consisting of halogen, oxo, NH2, OH, -CN, C(O)NHR6, C1-C4alkyl, C2-C4alkenyl, C2-C4alkynyl, CD3, CD2CD3, C1–C6alkoxy, C1– C6haloalkyl, C3-C6cycloalkyl, heterocycloalkyl, heteroaryl and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R5; each R5is independently selected from the group consisting of halogen, OH, oxo, NH2, CHO, C1-C4 alkyl, and C1–C6 alkoxy; each R6is independently H, or C1-C4 alkyl; and each R7is independently H, C1-C2alkyl, CF2H, CF3, halogen, or CN.

[0011] Another aspect of the present disclosure is directed to pharmaceutical compositions comprising a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof and a pharmaceutically acceptable carrier. The pharmaceutical acceptable carrier may further include an excipient, diluent, or surfactant.

[0012] Another aspect of the present disclosure is directed to a composition comprising (a) a DNA protein kinase inhibitor (DNA-PKI) and (b) a DNA cutting agent, wherein the DNA- PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0013] Another aspect of the present disclosure is directed to a method for targeted genome editing in a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0014] Another aspect of the present disclosure is directed to a method for repairing a double stranded DNA break in the genome of a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0015] Another aspect of the present disclosure is directed to a method for inhibiting or suppressing repair of a DNA break in a cell via a nonhomologous end joining (NHEJ) pathway, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0016] Another aspect of the present disclosure is directed to a method for targeted insertion of a donor DNA into the genome of a cell, comprising contacting the cell with a DNA cutting agent, the donor DNA, and a DNA-PKI, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0017] Another aspect of the present disclosure relates to compounds of Formula (I), and pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, tautomers, or pharmaceutical compositions thereof, for use in the manufacture of a medicament for cell therapy.

[0018] Another aspect of the present disclosure relates to the use of a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, tautomer, or pharmaceutical composition thereof, in the treatment of a cell.

[0019] In some aspects, the present disclosure provides a method of preparing a compound of the present disclosure.

[0020] In some aspects, the present disclosure provides a method of preparing a compound, comprising one or more steps described herein.

[0021] Other features and advantages of the disclosure will be apparent from the following detailed description and claims. BRIEF DESCRIPTION OF DRAWINGS

[0022] FIG.1 shows the effect of DNA-PK inhibitor compounds on cell viability 5 days after electroporation. Live cells are shown as a percentage of total cells.

[0023] FIG. 2 shows the effect of DNA-PK inhibitor compounds on T cell proliferation 5 days after electroporation. Total live cell counts (x10e6) are shown.

[0024] FIG.3 shows the effect of DNA-PK inhibitor compounds on CAR insertion into the TRAC locus 5 days after electroporation. Frequency of CAR+ T cells is shown as a percentage of total live cells.

[0025] FIG.4 shows the effect of DNA-PK inhibitor compounds on CAR insertion into the TRAC locus 5 days after electroporation. KI efficiency is shown as fold change over the untreated control condition (untreated is 1).

[0026] FIG.5 shows the effect of DNA-PK inhibitor compounds on total CAR+ cell yields 5 days after electroporation. Relative CAR+ yield is shown as fold change over the untreated control condition (untreated is 1). DETAILED DESCRIPTION Definitions

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In the specification, the singular forms also include the plural unless the context clearly dictates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference. The references cited herein are not admitted to be prior art to the claimed present disclosure. In the case of conflict, the present specification, including definitions, will control. In addition, the materials, methods and examples are illustrative only and are not intended to be limiting. In the case of conflict between the chemical structures and names of the compounds disclosed herein, the chemical structures will control.

[0028] The articles "a" and "an" are used in this disclosure to refer to one or more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0029] The term "and / or" is used in this disclosure to mean either "and" or "or" unless indicated otherwise.

[0030] The term “optionally substituted” is understood to mean that a given chemical moiety (e.g., an alkyl group) can (but is not required to) be bonded other substituents (e.g., heteroatoms). For instance, an alkyl group that is optionally substituted can be a fully saturated alkyl chain (i.e., a pure hydrocarbon). Alternatively, the same optionally substituted alkyl group can have substituents different from hydrogen. For instance, it can, at any point along the chain be bounded to a halogen atom, a hydroxyl group, or any other substituent described herein. Thus, the term “optionally substituted” means that a given chemical moiety has the potential to contain other functional groups but does not necessarily have any further functional groups. Suitable substituents used in the optional substitution of the described groups include, without limitation, halogen, oxo, -OH, -CN, -COOH, -CH2CN, -O-(C1-C6) alkyl, (C1-C6) alkyl, (C1-C6) alkoxy, (C1-C6) haloalkyl, (C1-C6) haloalkoxy, -O-(C2-C6) alkenyl, -O-(C2-C6) alkynyl,(C2-C6) alkenyl, (C2-C6) alkynyl, -OH, -OP(O)(OH)2, -OC(O)(C1-C6) alkyl, -C(O)(C1-C6) alkyl, -OC(O)O(C1-C6) alkyl, -NH2, -NH((C1-C6) alkyl), -N((C1-C6) alkyl)2, -NHC(O)(C1-C6) alkyl, -C(O)NH(C1-C6) alkyl, -S(O)2(C1-C6) alkyl, -S(O)NH(C1-C6) alkyl, and S(O)N((C1-C6) alkyl)2. The substituents can themselves be optionally substituted. “Optionally substituted” as used herein also refers to substituted or unsubstituted whose meaning is described below.

[0031] As used herein, the term “substituted,” means that any one or more hydrogen atoms on the designated atom is replaced with a selection from the indicated groups, provided that the designated atom’s normal valency is not exceeded, and that the substitution results in a stable compound. When a substituent is oxo or keto (i.e., ═O), then 2 hydrogen atoms on the atom are replaced. Keto substituents are not present on aromatic moieties. Ring double bonds, as used herein, are double bonds that are formed between two adjacent ring atoms (e.g., C═C, C═N or N═N). “Stable compound” and “stable structure” are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a RM, and formulation into an efficacious therapeutic agent. For example, an aryl substituted with a cycloalkyl may indicate that the cycloalkyl connects to one atom of the aryl with a bond or by fusing with the aryl and sharing two or more common atoms.

[0032] As used herein, the term “unsubstituted” means that the specified group bears no substituents.

[0033] As used herein, “Alkyl” refers to optionally substituted, straight and branched chain aliphatic groups having from 1 to 30 carbon atoms. “C1, C2, C3, C4, C5 or C6 alkyl” or “C1- C6 alkyl” is intended to include C1, C2, C3, C4, C5 or C6 straight chain (linear) saturated aliphatic hydrocarbon groups and C3, C4, C5 or C6 branched saturated aliphatic hydrocarbon groups. For example, C1-C6 alkyl is intends to include C1, C2, C3, C4, C5 and C6 alkyl groups. Examples of alkyl include, moieties having from one to six carbon atoms, such as, but not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, i-pentyl, or n- hexyl. In some embodiments, a straight chain or branched alkyl has six or fewer carbon atoms (e.g., C1-C6 for straight chain, C3-C6 for branched chain), and in another embodiment, a straight chain or branched alkyl has four or fewer carbon atoms. The term “heteroalkyl” as used herein contemplates an alkyl with one or more heteroatoms.

[0034] As used herein, the term “optionally substituted alkyl” refers to unsubstituted alkyl or alkyl having designated substituents replacing one or more hydrogen atoms on one or more carbons of the hydrocarbon backbone. Such substituents can include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl,aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety.

[0035] “Alkoxy” refers to a straight or branched chain saturated hydrocarbon containing 1– 12 carbon atoms containing a terminal “O” in the chain, i.e., -O(alkyl). Examples of alkoxy groups include without limitation, methoxy, ethoxy, propoxy, butoxy, t-butoxy, or pentoxy groups.

[0036] As used herein, the term “alkenyl” includes unsaturated or partially unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double bond. For example, the term “alkenyl” includes straight chain alkenyl groups (e.g., ethenyl, propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl), and branched alkenyl groups. In certain embodiments, a straight chain or branched alkenyl group has six or fewer carbon atoms in its backbone (e.g., C2-6 for straight chain, C3-6for branched chain). The term “C2-6” includes alkenyl groups containing two to six carbon atoms. The term “C3-6” includes alkenyl groups containing three to six carbon atoms.

[0037] As used herein, the term “optionally substituted alkenyl” refers to unsubstituted alkenyl or alkenyl having designated substituents replacing one or more hydrogen atoms on one or more hydrocarbon backbone carbon atoms. Such substituents can include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety.

[0038] As used herein, the term “alkynyl” includes unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but which contain at least one triple bond. For example, “alkynyl” includes straight chain alkynyl groups (e.g., ethynyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl, nonynyl, decynyl), and branched alkynyl groups. In certain embodiments, a straight chain or branched alkynyl group has six orfewer carbon atoms in its backbone (e.g., C2-6for straight chain, C3-6for branched chain). The term “C2-6” includes alkynyl groups containing two to six carbon atoms. The term “C3-6” includes alkynyl groups containing three to six carbon atoms.

[0039] As used herein, the term “optionally substituted alkynyl” refers to unsubstituted alkynyl or alkynyl having designated substituents replacing one or more hydrogen atoms on one or more hydrocarbon backbone carbon atoms. Such substituents can include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety.

[0040] Other optionally substituted moieties (such as optionally substituted cycloalkyl, heterocycloalkyl, aryl, or heteroaryl) include both the unsubstituted moieties and the moieties having one or more of the designated substituents. For example, substituted heterocycloalkyl includes those substituted with one or more alkyl groups, such as 2,2,6,6-tetramethyl- piperidinyl and 2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridinyl.

[0041] As used herein, the term “cycloalkyl” refers to a saturated or partially unsaturated hydrocarbon monocyclic or polycyclic (e.g., fused, bridged, or spiro) system having 3 to 30 carbon atoms (e.g., C3-12, C3-10, C3-8, or C3-6). Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, 1,2,3,4-tetrahydronaphthalenyl, and adamantyl. In the case of polycyclic cycloalkyl, only one of the rings in the cycloalkyl needs to be non- aromatic.

[0042] As used herein, the term “heterocycloalkyl” refers to a saturated or partially unsaturated 3-8 membered monocyclic or bicyclic, 7-12 membered bicyclic (fused, bridged, or spiro rings), or 11-14 membered tricyclic ring system (fused, bridged, or spiro rings) having one or more heteroatoms (such as O, N, S, P, or Se), e.g., 1 or 1-2 or 1-3 or 1-4 or 1-5 or 1-6 heteroatoms, or e.g., 1, 2, 3, 4, 5, or 6 heteroatoms, independently selected from the group consisting of nitrogen, oxygen and sulfur, unless specified otherwise. Examples of heterocycloalkyl groups include, but are not limited to, piperidinyl, piperazinyl, pyrrolidinyl,dioxanyl, tetrahydrofuranyl, isoindolinyl, indolinyl, imidazolidinyl, pyrazolidinyl, oxazolidinyl, isoxazolidinyl, triazolidinyl, oxiranyl, azetidinyl, oxetanyl, thietanyl, 1,2,3,6- tetrahydropyridinyl, tetrahydropyranyl, dihydropyranyl, pyranyl, morpholinyl, tetrahydrothiopyranyl, 1,4-diazepanyl, 1,4-oxazepanyl, 2-oxa-5-azabicyclo[2.2.1]heptanyl, 2,5-diazabicyclo[2.2.1]heptanyl, 2-oxa-6-azaspiro[3.3]heptanyl, 2,6-diazaspiro[3.3]heptanyl, 1,4-dioxa-8-azaspiro[4.5]decanyl, 1,4-dioxaspiro[4.5]decanyl, 1-oxaspiro[4.5]decanyl, 1- azaspiro[4.5]decanyl, 3′H-spiro[cyclohexane-1,1′-isobenzofurran]-yl, 7′H-spiro[cyclohexane- 1,5′-furo[3,4-b]pyridin]-yl, 3′H-spiro[cyclohexane-1,1′-furo[3,4-c]pyridin]-yl, 3- azabicyclo[3.1.0]hexanyl, 3-azabicyclo[3.1.0]hexan-3-yl, 1,4,5,6-tetrahydropyrrolo[3,4- c]pyrazolyl, 3,4,5,6,7,8-hexahydropyrido[4,3-d]pyrimidinyl, 4,5,6,7-tetrahydro-1H- pyrazolo[3,4-c]pyridinyl, 5,6,7,8-tetrahydropyrido[4,3-d]pyrimidinyl, 2- azaspiro[3.3]heptanyl, 2-methyl-2-azaspiro[3.3]heptanyl, 2-azaspiro[3.5]nonanyl, 2-methyl-2- azaspiro[3.5]nonanyl, 2-azaspiro[4.5]decanyl, 2-methyl-2-azaspiro[4.5]decanyl, 2-oxa- azaspiro[3.4]octanyl, 2-oxa-azaspiro[3.4]octan-6-yl, 5,6-dihydro-4H- cyclopenta[b]thiophenyl, and the like. In the case of multicyclic heterocycloalkyl, only one of the rings in the heterocycloalkyl needs to be non-aromatic (e.g., 1,3-dihydrobenzo[c]isoxazol- 3-yl).

[0043] As used herein, the term “optionally substituted heterocycloalkyl” refers to unsubstituted heterocycloalkyl having designated substituents replacing one or more hydrogen atoms on one or more carbon or heteroatom. Such substituents can include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety.

[0044] Unless otherwise specifically defined, the term “aryl” refers to cyclic, aromatic hydrocarbon groups that have 1 to 3 aromatic rings, including monocyclic or bicyclic groups such as phenyl, biphenyl, or naphthyl. Where containing two aromatic rings (bicyclic, etc.), the aromatic rings of the aryl group may be joined at a single point (e.g., biphenyl), or fused (e.g., naphthyl). The aryl group may be optionally substituted by one or more substituents, e.g., 1 to 5 substituents, at any point of attachment. Exemplary substituents include, but arenot limited to, —H, -halogen. —O—(C1-6) alkyl, (C1-6) alkyl, —O—(C2-6) alkenyl, —O—(C2-6) alkynyl, (C2-6) alkenyl, (C2-6) alkynyl, —OH, —OP(O)(OH)2, —OC(O)(C1-6) alkyl, — C(O)(C1-6) alkyl, —OC(O)O(C1-6) alkyl, —NH2, NH((C1-6) alkyl), N((C1-6) alkyl)2, — S(O)2—(C1-6) alkyl, —S(O)NH(C1-6) alkyl, and —S(O)N((C1-6) alkyl)2. The substituents can themselves be optionally substituted. Furthermore, when containing two or more fused rings, the aryl groups herein defined may have a saturated or partially unsaturated ring fused with a fully unsaturated aromatic ring Exemplary ring systems of these aryl groups include, but are not limited to, phenyl, biphenyl, naphthyl, anthracenyl, phenalenyl, phenanthrenyl, indanyl, indenyl, tetrahydronaphthalenyl, tetrahydrobenzoannulenyl, 10,11-dihydro-5H- dibenzo[a,d][7]annulenyl, and the like. Furthermore, when containing two or more fused rings, the aryl groups herein defined may have a saturated or partially unsaturated heterocyclic ring fused with a fully unsaturated aromatic ring. Exemplary ring systems of these aryl groups include, but are not limited to, benzo[d][1,3]dioxol-5-yl, 2,3-dihydrobenzo[b][1,4]dioxin-6- yl, benzo[d]isoxazol-3(2H)-on-6-yl, benzo[d]oxazol-2(3H)-on-6-yl, and benzo[d]oxazol- 2(3H)-on-5-yl.

[0045] Unless otherwise specifically defined, “heteroaryl” means a monovalent monocyclic or polycyclic aromatic radical of 5 to 24 ring atoms, containing one or more ring heteroatoms selected from N, O, S, P, Se, or B, the remaining ring atoms being C. Heteroaryl as herein defined also means a bicyclic heteroaromatic group wherein the heteroatom is selected from N, O, S, P, Se, or B. Heteroaryl as herein defined also means a tricyclic heteroaromatic group containing one or more ring heteroatoms selected from N, O, S, P, Se, or B. The aromatic radical is optionally substituted independently with one or more substituents described herein. Examples include, but are not limited to, furyl, thienyl, pyrrolyl, pyridyl, pyrazolyl, pyrimidinyl, imidazolyl, isoxazolyl, oxazolyl, oxadiazolyl, pyrazinyl, indolyl, thiophen-2-yl, quinolinyl, benzopyranyl, isothiazolyl, thiazolyl, thiadiazole, indazole, benzimidazolyl, thieno[3,2-b]thiophene, triazolyl, triazinyl, imidazo[1,2-b]pyrazolyl, furo[2,3-c]pyridinyl, imidazo[1,2-a]pyridinyl, indazolyl, pyrrolo[2,3-c]pyridinyl, pyrrolo[3,2-c]pyridinyl, pyrazolo[3,4-c]pyridinyl, thieno[3,2-c]pyridinyl, thieno[2,3-c]pyridinyl, thieno[2,3- b]pyridinyl, benzothiazolyl, indolyl, indolinyl, indolinonyl, dihydrobenzothiophenyl, dihydrobenzofuranyl, benzofuran, chromanyl, thiochromanyl, tetrahydroquinolinyl, dihydrobenzothiazine, quinolinyl, isoquinolinyl, 1,6-naphthyridinyl, benzo[de]isoquinolinyl, pyrido[4,3-b][1,6]naphthyridinyl, thieno[2,3-b]pyrazinyl, quinazolinyl, tetrazolo[1,5- a]pyridinyl, [1,2,4]triazolo[4,3-a]pyridinyl, isoindolyl, pyrrolo[2,3-b]pyridinyl, pyrrolo[3,4- b]pyridinyl, pyrrolo[3,2-b]pyridinyl, imidazo[5,4-b]pyridinyl, pyrrolo[1,2-a]pyrimidinyl,tetrahydro pyrrolo[1,2-a]pyrimidinyl, 3,4-dihydro-2H-1λ2-pyrrolo[2,1-b]pyrimidine, dibenzo[b,d] thiophene, pyridin-2-one, furo[3,2-c]pyridinyl, furo[2,3-c]pyridinyl, 1H- pyrido[3,4-b][1,4] thiazinyl, benzoxazolyl, benzisoxazolyl, furo[2,3-b]pyridinyl, benzothiophenyl, 1,5-naphthyridinyl, furo[3,2-b]pyridine, [1,2,4]triazolo[1,5-a]pyridinyl, benzo [1,2,3]triazolyl, imidazo[1,2-a]pyrimidinyl, [1,2,4]triazolo[4,3-b]pyridazinyl, benzo[c][1,2,5]thiadiazolyl, benzo[c][1,2,5]oxadiazole, 1,3-dihydro-2H-benzo[d]imidazol-2- one, 3,4-dihydro-2H-pyrazolo [1,5-b][1,2]oxazinyl, 4,5,6,7-tetrahydropyrazolo[1,5- a]pyridinyl, thiazolo[5,4-d]thiazolyl, imidazo[2,1-b][1,3,4]thiadiazolyl, thieno[2,3-b]pyrrolyl, 3H-indolyl, and derivatives thereof. Furthermore, when containing two or more fused rings, the heteroaryl groups defined herein may have one or more saturated or partially unsaturated ring fused with a fully unsaturated aromatic ring, e.g., a 5-membered heteroaromatic ring containing 1 to 3 heteroatoms selected from N, O, S, P, Se, or B, or a 6-membered heteroaromatic ring containing 1 to 3 nitrogens, wherein the saturated or partially unsaturated ring includes 0 to 4 heteroatoms selected from N, O, S, P, Se, or B, and is optionally substituted with one or more oxo. In heteroaryl ring systems containing more than two fused rings, a saturated or partially unsaturated ring may further be fused with a saturated or partially unsaturated ring described herein. Exemplary ring systems of these heteroaryl groups include, for example, indolinyl, indolinonyl, dihydrobenzothiophenyl, dihydrobenzofuran, chromanyl, thiochromanyl, tetrahydroquinolinyl, dihydrobenzothiazine, 3,4-dihydro-11H-isoquinolinyl, 2,3-dihydrobenzofuranyl, benzofuranonyl, indolinyl, oxindolyl, indolyl, 1,6-dihydro-7H- pyrazolo[3,4-c]pyridin-7-onyl, 7,8-dihydro-6H-pyrido[3,2-b]pyrrolizinyl, 8H-pyrido[3,2- b]pyrrolizinyl, 1,5,6,7-tetrahydrocyclopenta[b]pyrazolo[4,3-e]pyridinyl, 7,8-dihydro-6H- pyrido[3,2-b]pyrrolizine, pyrazolo[1,5-a]pyrimidin-7(4H)-only, 3,4-dihydropyrazino[1,2- a]indol-1(2H)-onyl, or benzo[c][1,2]oxaborol-1(3H)-olyl.

[0046] The cycloalkyl, heterocycloalkyl, aryl, or heteroaryl ring can be substituted at one or more ring positions (e.g., the ring-forming carbon or heteroatom such as N) with such substituents as described above, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkoxy, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, alkylaminocarbonyl, aralkylaminocarbonyl, alkenylaminocarbonyl, alkylcarbonyl, arylcarbonyl, aralkylcarbonyl, alkenylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylthiocarbonyl, phosphate, phosphonato, phosphinato, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl,sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety. Aryl and heteroaryl groups can also be fused or bridged with alicyclic or heterocyclic rings, which are not aromatic so as to form a multicyclic system (e.g., tetralin, methylenedioxyphenyl such as benzo[d][1,3]dioxole-5-yl).

[0047] When a bond to a substituent is shown to cross a bond connecting two atoms in a ring, then such substituent may be bonded to any atom in the ring. For example, in the structure, an R5substituent may replace any hydrogen attached to an atom in the ring, including hydrogens attached to atoms of the ring indicated by B. When a substituent is listed without indicating the atom via which such substituent is bonded to the rest of the compound of a given formula, then such substituent may be bonded via any atom in such formula. Forexample, the structureencompasses . Combinations of substituents and / or variables are permissible, but only if such combinations result in stable compounds.

[0048] When any variable (e.g., R) occurs more than one time in any constituent or formula for a compound, its definition at each occurrence is independent of its definition at every other occurrence. Thus, for example, if a group is shown to be substituted with 0-2 R moieties, then the group may optionally be substituted with up to two R moieties and R at each occurrence is selected independently from the definition of R. Also, combinations of substituents and / or variables are permissible, but only if such combinations result in stable compounds.

[0049] As used herein, the term “hydroxy” or “hydroxyl” includes groups with an —OH or —O—.

[0050] As used herein, the term “halo” or “halogen” refers to fluoro, chloro, bromo and iodo.

[0051] The term “haloalkyl” or “haloalkoxyl” refers to an alkyl or alkoxyl substituted with one or more halogen atoms. Examples of haloalkyl groups include, but are not limited to, trifluoromethyl, difluoromethyl, pentafluoroethyl, trichloromethyl, etc. Examples of haloalkoxy groups include, but are not limited to, trifluoromethoxy, difluoromethoxy, pentafluoroethoxy, trichloromethoxy, etc.

[0052] As used herein, the term “cyano” refers to a nitrile radical (e.g., —CN).

[0053] As used herein, the term “optionally substituted haloalkyl” refers to unsubstituted haloalkyl having designated substituents replacing one or more hydrogen atoms on one or more hydrocarbon backbone carbon atoms. Such substituents can include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety.

[0054] As used herein, the term “alkoxy” or “alkoxyl” includes substituted and unsubstituted alkyl, alkenyl and alkynyl groups covalently linked to an oxygen atom. Examples of alkoxy groups or alkoxyl radicals include, but are not limited to, methoxy, ethoxy, isopropyloxy, propoxy, butoxy and pentoxy groups. Examples of substituted alkoxy groups include halogenated alkoxy groups. The alkoxy groups can be substituted with groups such as alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, amino (including alkylamino, dialkylamino, arylamino, diarylamino, and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moieties. Examples of halogen substituted alkoxy groups include, but are not limited to, fluoromethoxy, difluoromethoxy, trifluoromethoxy, chloromethoxy, dichloromethoxy and trichloromethoxy.

[0055] As used herein, the term “solvate” means solvent addition forms that contain either stoichiometric or non-stoichiometric amounts of solvent. Some compounds have a tendency to trap a fixed molar ratio of solvent molecules in the crystalline solid state, thus forming a solvate. If the solvent is water the solvate formed is a hydrate, and if the solvent is alcohol, the solvate formed is an alcoholate. Hydrates are formed by the combination of one or more molecules of water with one molecule of the substance in which the water retains its molecular state as H2O.

[0056] As used herein, the term “isomerism” means compounds that have identical molecular formulae but differ in the sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another are termed “diastereoisomers,” and stereoisomers that are non-superimposable mirror images of each other are termed “enantiomers” or sometimes optical isomers. A mixture containing equal amounts of individual enantiomeric forms of opposite chirality is termed a “racemic mixture.” The compounds of Formula (I) may have one or more asymmetric carbon atom and may occur as racemates, racemic mixtures and as individual enantiomers or diastereomers.

[0057] As used herein, the term “tautomer” is one of two or more structural isomers that exist in equilibrium and is readily converted from one isomeric form to another. This conversion results in the formal migration of a hydrogen atom accompanied by a switch of adjacent conjugated double bonds. Tautomers exist as a mixture of a tautomeric set in solution. In solutions where tautomerization is possible, a chemical equilibrium of the tautomers will be reached. The exact ratio of the tautomers depends on several factors, including temperature, solvent and pH. The concept of tautomers that are interconvertible by tautomerizations is called tautomerism. In keto-enol tautomerism a simultaneous shift of electrons and a hydrogen atom occurs.

[0058] It is to be understood that the compounds of the present disclosure may be depicted as different tautomers. It should also be understood that when compounds have tautomeric forms, all tautomeric forms are intended to be included in the scope of the present disclosure, and the naming of the compounds does not exclude any tautomer form. It will be understood that certain tautomers may have a higher level of activity than others.

[0059] The present disclosure also contemplates isotopically-labelled compounds of Formula I (e.g., those labeled with2H and14C). Substitution with heavier isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements). Isotopically labelled compounds of Formula I can generally be prepared by following procedures analogous to those disclosed in the Schemes and / or in the Examples herein below, by substituting an appropriate isotopically labelled reagent for a non-isotopically labelled reagent.

[0060] The disclosure also includes pharmaceutical compositions comprising an effective amount of a disclosed compound and a pharmaceutically acceptable carrier.

[0061] As used herein, the term “pharmaceutically acceptable salts” refer to derivatives of the compounds of the present disclosure wherein the parent compound is modified by makingacid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines, alkali or organic salts of acidic residues such as carboxylic acids, and the like. The pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include, but are not limited to, those derived from inorganic and organic acids selected from 2-acetoxybenzoic, 2-hydroxyethane sulfonic, acetic, ascorbic, benzene sulfonic, benzoic, bicarbonic, carbonic, citric, edetic, ethane disulfonic, 1,2-ethane sulfonic, fumaric, glucoheptonic, gluconic, glutamic, glycolic, glycollyarsanilic, hexylresorcinic, hydrabamic, hydrobromic, hydrochloric, hydroiodic, hydroxymaleic, hydroxynaphthoic, isethionic, lactic, lactobionic, lauryl sulfonic, maleic, malic, mandelic, methane sulfonic, napsylic, nitric, oxalic, pamoic, pantothenic, phenylacetic, phosphoric, polygalacturonic, propionic, salicylic, stearic, subacetic, succinic, sulfamic, sulfanilic, sulfuric, tannic, tartaric, toluene sulfonic, and the commonly occurring amine acids, e.g., glycine, alanine, phenylalanine, arginine, etc.

[0062] In some embodiments, the pharmaceutically acceptable salt is a sodium salt, a potassium salt, a calcium salt, a magnesium salt, a diethylamine salt, a choline salt, a meglumine salt, a benzathine salt, a tromethamine salt, an ammonia salt, an arginine salt, or a lysine salt.

[0063] Other examples of pharmaceutically acceptable salts include hexanoic acid, cyclopentane propionic acid, pyruvic acid, malonic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo-[2.2.2]-oct-2-ene-1-carboxylic acid, 3- phenylpropionic acid, trimethylacetic acid, tertiary butylacetic acid, muconic acid, and the like. The present disclosure also encompasses salts formed when an acidic proton presents in the parent compound either is replaced by a metal ion, e.g., an alkali metal ion, an alkaline earth ion, or an aluminum ion, or coordinates with an organic base such as ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine, and the like. In the salt form, it is understood that the ratio of the compound to the cation or anion of the salt can be 1:1, or any ratio other than 1:1, e.g., 3:1, 2:1, 1:2, or 1:3.

[0064] It is to be understood that all references to pharmaceutically acceptable salts include solvent addition forms (solvates) or crystal forms (polymorphs) as defined herein, of the same salt.

[0065] A "patient" or “subject” is a mammal, e.g., a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, or non-human primate, such as a monkey, chimpanzee, baboon or rhesus.

[0066] An "effective amount" when used in connection with a compound is an amount effective for use in a cell therapy.

[0067] The term "carrier" as used in this disclosure, encompasses carriers, excipients, and diluents and means a material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting a pharmaceutical agent from one organ, or portion of the body, to another organ, or portion of the body of a subject.

[0068] The term "disorder" is used in this disclosure to mean, and is used interchangeably with, the terms disease, condition, or illness, unless otherwise indicated.

[0069] The term "administer", "administering", or "administration" as used in this disclosure refers to either directly administering a disclosed compound or pharmaceutically acceptable salt of the disclosed compound or a composition to a subject, or administering a prodrug derivative or analog of the compound or pharmaceutically acceptable salt of the compound or composition to the subject, which can form an equivalent amount of active compound within the subject's body.

[0070] The term "prodrug" as used in this disclosure, means a compound which is convertible in vivo by metabolic means (e.g., by hydrolysis) to a disclosed compound.

[0071] The present disclosure relates to compounds and compositions that are capable of inhibiting DNA-dependent protein kinase (DNA-PK) in a subject or in a biological sample.

[0072] The details of the present disclosure are set forth in the accompanying description below. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, illustrative methods and materials are now described. Other features, objects, and advantages of the present disclosure will be apparent from the description and from the claims. In the specification and the appended claims, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this present disclosure belongs. All patents and publications cited in this specification are incorporated herein by reference in their entireties.

[0073] In a first aspect of the present disclosure, the compounds of Formula (I) are described:pharmaceutically acceptable salts thereof, wherein A, R1, R2are described herein provided that A is a 5- or 6- membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the 5- or 6- membered heteroaryl or heterocycloalkyl is optionally substituted as described herein.

[0074] In some embodiments, R1is an aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S, and, wherein the aryl or heteroaryl is optionally substituted with one or more R4, each R4is independently selected from the group consisting of halogen, oxo, NH2, OH, -CN, C(O)NHR6, C1-C4alkyl, C2-C4alkenyl, C2-C4alkynyl, CD3, CD2CD3, C1–C6alkoxy, C1–C6haloalkyl, C3-C6cycloalkyl, heterocycloalkyl, heteroaryl and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R5.

[0075] In some embodiments, R1is a 6- to 10-membered aryl or 5- to 12-membered heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the aryl or heteroaryl is optionally substituted with one or more R4. In some embodiments, R1is a 6- to 10-membered aryl or 5- to 12-membered heteroaryl containing one to four heteroatoms selected from the group consisting of N, O, and S, wherein the aryl or heteroaryl is optionally substituted with one or more R4. In some embodiments, R1is a 6- to 10-membered aryl or 5- to 12-membered heteroaryl containing one to four heteroatoms selected from the group consisting of N, O, and S, wherein the aryl or heteroaryl is optionally substituted with one to four R4. In some embodiments, R1is a 6- to 10-memberred aryl or 5- to 12-membered heteroaryl containing one to three heteroatoms selected from the group consisting of N, O, and S, wherein the aryl or heteroaryl is optionally substituted with one to four R4. In some embodiments, R1is a 6- to 10-membered aryl or 6- to 12-membered heteroaryl containing one to three heteroatoms selected from the group consisting of N, O, and S, wherein the aryl or heteroaryl is optionally substituted with one to four R4.

[0076] In some embodiments, each R4is independently selected from the group consisting of halogen, oxo, NH2, OH, -CN, C(O)NHR6, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, CD3, CD2CD3, C1–C6alkoxy, C1–C6haloalkyl, C3-C6cycloalkyl, heterocycloalkyl, heteroaryl andaryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R5.

[0077] In some embodiments, each R5is independently selected from the group consisting of halogen, OH, oxo, NH2, CHO, C1-C4alkyl, and C1–C6alkoxy.

[0078] In some embodiments, each R6is independently H, or C1-C4 alkyl.

[0079] In some embodiments, each R7is independently H, C1-C2 alkyl, CF2H, CF3, halogen, or CN.

[0080] In some embodiments, R1is:, wherein B is a 5- or 6- membered aryl, heteroaryl, or heterocycloalkyl optionally substituted with one or more R4; and m is an integer from 0-3. In some embodiments, B is a 5- or 6- membered aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S; and m is an integer from 0 to 3. In some embodiments, B is a 5- or 6- membered heterocyclyl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S, and m is an integer from 0 to 3. In some embodiments, B is a 5- or 6-membered aryl, heterocyclyl, or heteroaryl, wherein the heterocyclyl or heteroaryl contains at least one heteroatom selected from the group consisting of N, O, and S; and m is an integer from 1 to 3. In some embodiments, B is a 5- or 6- membered aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S; and m is an integer from 1 to 3. In some embodiments, B is a 5- or 6- membered heterocyclyl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S; and m is an integer from 1 to 3. In some embodiments, at least one R4is methyl.

[0081] In some embodiments, R1is:, wherein B is a 5- or 6-membered aryl, heterocyclyl, or heteroaryl, wherein the heterocyclyl or heteroaryl contains at least one heteroatom selected from the group consisting of N, O, and S; and m is an integer from 0 to 3. In some embodiments, B is a 5- or 6- membered aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S; and m is an integer from 0 to 3. In some embodiments, B is a 5- or 6- membered heterocyclylor heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S; and m is an integer from 0 to 3. In some embodiments, B is a 5- or 6-membered aryl, heterocyclyl, or heteroaryl, wherein the heterocyclyl or heteroaryl contains at least one heteroatom selected from the group consisting of N, O, and S; and m is an integer from 1 to 3. In some embodiments, B is a 5- or 6- membered aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S; and m is an integer from 1 to 3. In some embodiments, B is a 5- or 6- membered heterocyclyl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S; and m is an integer from 1 to 3. In some embodiments, at least one R4is methyl.

[0082] In some embodiments, R1is selected from the group consisting of: , , ,wherein X1, X2, X3, X4and X5are each independently N, CH, or C(RX), wherein RXis independently H, C1-C4 alkyl, oxo, CHO, or C1-C4 alkoxy; and m is an integer from 1 to 3, as valency allows.

[0083] In some embodiments, R1is:.

[0084] In some embodiments, R1is selected from the group consisting of:

[0085] In some embodiments, R1is selected from the group consisting of: , ,wherein X1, X2, X3, X4and X5are each independently N, CH, or C(RX), wherein RXis independently H, C1-C4alkyl, oxo, CHO, or C1-C4alkoxy.

[0086] In some embodiments, R1is: R1is selected from the group consisting,

[0088] In some embodiments, A is a 5- or 6-membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R4. In some embodiments, A is 5- or 6-membered heteroaryl or heterocycloalkyl group containing at leastone heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one to three R4.

[0089] In some embodiments, A is a 5-membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R4. In some embodiments, A is a 5-membered heteroaryl or heterocycloalkyl group containing one or two heteroatoms selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R4. In some embodiments, A is a 5-membered heteroaryl or heterocycloalkyl group containing one or two heteroatoms selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R4. In some embodiments, A is a 5-membered heteroaryl or heterocycloalkyl group containing two heteroatoms selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R4. In some embodiments, A is a 5-membered heteroaryl or heterocycloalkyl group containing one heteroatom selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R4.

[0090] In some embodiments, A is a 6-membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R4. In some embodiments, A is a 6-membered heteroaryl or heterocycloalkyl group containing one or two heteroatoms selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R4. In some embodiments, A is a 6-membered heteroaryl or heterocycloalkyl group containing one or two heteroatoms selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R4. In some embodiments, A is a 6-membered heteroaryl or heterocycloalkyl group containing two heteroatoms selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R4. In some embodiments, A is a 6-membered heteroaryl or heterocycloalkyl group containing one heteroatom selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R4.

[0091] In some embodiments, R4is independently selected from the group consisting of halogen, oxo, thioxo, C1–C4 alkyl, C1–C4 alkoxy, and C1–C6 haloalkyl; or two geminal R4together with the intervening geminal carbon atom, form a C3-C6 cycloalkyl. In some embodiments, each R4is independently selected from the group consisting of halogen, oxo,thioxo, C1–C4alkyl, C1–C4alkoxy, and C1–C6haloalkyl; or two geminal R4, together with the intervening geminal carbon atom, form a cyclopropyl. In some embodiments, each R4is oxo, thioxo, or methyl, or two geminal R4, together with the intervening geminal carbon atom, form a cyclopropyl. In some embodiments, each R4is oxo, thioxo, or methyl. In some embodiments, two geminal R4, together with the intervening geminal carbon atom, form a cyclopropyl.

[0092] In some embodiments, R2is H, C1–C4 alkyl, C1–C4 alkoxy, C2–C4 alkenyl, or C2–C4 alkynyl, wherein the alkyl is optionally substituted with one or more halogen, OH, or CN. In some embodiments, R2is H. In some embodiments, R2is H, halogen, -(CH2)n-CN, –OH, - (CH2)n-O-C1-C4 alkyl, C1–C4 alkoxy, or C1–C4 haloalkyl. In some embodiments, R2is H, fluoro, -CN, -CH2-CN, -CH2-O-CH3, –OH, methoxy, or CF3. In some embodiments, R2is halogen, -(CH2)n-CN, –OH, -(CH2)n-O-C1-C4alkyl, C1–C4alkoxy, or C1–C4haloalkyl. In some embodiments, R2is fluoro, -CN, -CH2-CN, -CH2-O-CH3, –OH, methoxy, or CF3.

[0093] In some embodiments, R2is selected from the group consisting of:

[0094] In some embodiments, R3is selected from the group consisting of halogen, oxo, thioxo, C1–C4alkyl, CD3, CD2CD3, C1–C4alkoxy, C1–C6haloalkyl, C3-C6cycloalkyl, heterocycloalkyl, heteroaryl, and aryl. In some embodiments, two geminal R3, together with the intervening geminal carbon atom, form a C3-C5 cycloalkyl. In some embodiments, R3is H.

[0095] In some embodiments, each m is independently an integer from 0 to 3. In some embodiments, m is 0. In some embodiments, m is 1.

[0096] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ia-1):or a pharmaceutically acceptable salt, thereof.

[0097] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ia-2):or a pharmaceutically acceptable salt, thereof.

[0098] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ia-3):or a pharmaceutically acceptable salt, thereof.

[0099] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ia-4):or a pharmaceutically acceptable salt, thereof.

[0100] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ia-5):or a pharmaceutically acceptable salt, thereof.

[0101] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-1):or a pharmaceutically acceptable salt thereof, wherein m is an integer from 1 to 3.

[0102] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-2):or a pharmaceutically acceptable salt thereof, wherein m is an integer from 1 to 3.

[0103] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-3):or a pharmaceutically acceptable salt thereof, wherein m is an integer from 1 to 3.

[0104] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-4):or a pharmaceutically acceptable salt thereof, wherein m is an integer from 1 to 3.

[0105] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-5):or a pharmaceutically acceptable salt thereof, wherein m is an integer from 1 to 3; and X1, X2, X3, and X4are each independently N, CH, or C(RX).

[0106] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-6):or a pharmaceutically acceptable salt thereof, X5is N, CH, or C(RX); wherein m is an integer from 1 to 3; and p is an integer from 0 to 2.

[0107] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-7):or a pharmaceutically acceptable salt thereof, X5is N, CH, or C(RX); wherein m is an integer from 1 to 3; and p is an integer from 0 to 2.

[0108] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ic-1):or a pharmaceutically acceptable salt thereof.

[0109] In some embodiments of the foregoing, the compounds of Formula I are compounds or pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers thereof. In some embodiments of the foregoing, the compounds of Formula I are compounds or pharmaceutically acceptable salts, stereoisomers, or tautomers thereof. In some embodiments of the foregoing, the compounds of Formula I are compounds or pharmaceutically acceptable salts or stereoisomers thereof. In some embodiments of the foregoing, the compounds of Formula I are compounds or pharmaceutically acceptable salts thereof.

[0110] Table 1. Exemplary Compounds of Formula I

[0111] It should be understood that all isomeric forms are included within the present disclosure, including mixtures thereof. If the compound contains a disubstituted cycloalkyl, the cycloalkyl substituent may have a cis- or trans- configuration. All tautomeric forms are also intended to be included.

[0112] Compounds of the present disclosure, and pharmaceutically acceptable salts, hydrates, solvates, stereoisomers and prodrugs thereof may exist in their tautomeric form (for example, as an amide or imino ether). All such tautomeric forms are contemplated herein as part of the present disclosure.

[0113] The compounds of the present disclosure may contain asymmetric or chiral centers, and, therefore, exist in different stereoisomeric forms. It is intended that all stereoisomeric forms of the compounds of the present disclosure as well as mixtures thereof, including racemic mixtures, form part of the present disclosure. In addition, the present disclosure embraces all geometric and positional isomers. For example, if a compound of the present disclosure incorporates a double bond or a fused ring, both the cis- and trans-forms, as well as mixtures, are embraced within the scope of the present disclosure. Each compound herein disclosed includes all the enantiomers that conform to the general structure of the compound. The compounds may be in a racemic or enantiomerically pure form, or any other form in terms of stereochemistry. The assay results may reflect the data collected for the racemic form, the enantiomerically pure form, or any other form in terms of stereochemistry.

[0114] Diastereomeric mixtures can be separated into their individual diastereomers on the basis of their physical chemical differences by methods well known to those skilled in the art, such as, for example, by chromatography and / or fractional crystallization. Enantiomers can be separated by converting the enantiomeric mixture into a diastereomeric mixture by reaction with an appropriate optically active compound (e.g., chiral auxiliary such as a chiral alcohol or Mosher's acid chloride), separating the diastereomers and converting (e.g., hydrolyzing) the individual diastereomers to the corresponding pure enantiomers. Also, some of the compounds of the present disclosure may be atropisomers (e.g., substituted biaryls) and are considered as part of this present disclosure. Enantiomers can also be separated by use of a chiral HPLC column.

[0115] It is also possible that the compounds of the present disclosure may exist in different tautomeric forms, and all such forms are embraced within the scope of the present disclosure. Also, for example, all keto-enol and imine-enamine forms of the compounds are included in the present disclosure.

[0116] All stereoisomers (for example, geometric isomers, optical isomers and the like) of the present compounds (including those of the salts, solvates, esters and prodrugs of the compounds as well as the salts, solvates and esters of the prodrugs), such as those which may exist due to asymmetric carbons on various substituents, including enantiomeric forms (which may exist even in the absence of asymmetric carbons), rotameric forms, atropisomers, and diastereomeric forms, are contemplated within the scope of this present disclosure, as are positional isomers (such as, for example, 4-pyridyl and 3-pyridyl). (For example, if a compound of Formula (I) incorporates a double bond or a fused ring, both the cis- and trans- forms, as well as mixtures, are embraced within the scope of the present disclosure. Also, for example, all keto-enol and imine-enamine forms of the compounds are included in the present disclosure). Individual stereoisomers of the compounds of the present disclosure may, for example, be substantially free of other stereoisomers, or may be admixed, for example, as racemates or with all other, or other selected, stereoisomers. The chiral centers of the present disclosure can have the S or R configuration as defined by the IUPAC 1974 Recommendations. The use of the terms “salt”, “solvate”, “ester,” “prodrug” and the like, is intended to equally apply to the salt, solvate, ester and prodrug of enantiomers, stereoisomers, rotamers, tautomers, positional isomers, racemates or prodrugs of the inventive compounds.

[0117] The compounds of Formula I may form salts which are also within the scope of this present disclosure. Reference to a compound of the Formula herein is understood to include reference to salts thereof, unless otherwise indicated.

[0118] The present disclosure is directed to compounds as described herein and pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, or tautomers thereof, and pharmaceutical compositions comprising one or more compounds as described herein, or pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, or tautomers thereof. Method of Synthesizing the Compounds

[0119] The compounds of the present disclosure can be prepared in a number of ways well known to those skilled in the art of organic synthesis. By way of example, compounds of the present disclosure can be synthesized using the methods described below, together with synthetic methods known in the art of synthetic organic chemistry, or variations thereon as appreciated by those skilled in the art. Standard synthetic methods and procedures for the preparation of organic molecules and functional group transformations and manipulations can be obtained from the relevant scientific literature or from standard textbooks in the field. Although not limited to any one or several sources, classic texts such as Smith, M. B., March, J., March’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 5th edition, John Wiley & Sons: New York, 2001; Greene, T. W., Wuts, P. G. M., Protective Groups in Organic Synthesis, 3rd edition, John Wiley & Sons: New York, 1999; R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); L. Fieser and M. Fieser, Fieser and Fieser’s Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed, Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), incorporated by reference herein, are useful and recognized reference textbooks of organic synthesis known to those in the art.

[0120] During the reaction sequences and synthetic schemes described herein, the order of certain steps may be changed, such as the introduction and removal of protecting groups. One of ordinary skill in the art will recognize that certain groups may require protection from the reaction conditions via the use of protecting groups. Protecting groups may also be used to differentiate similar functional groups in molecules. A list of protecting groups and how to introduce and remove these groups can be found in Greene, T. W., Wuts, P. G. M., Protective Groups in Organic Synthesis, 3rd edition. John Wiley & Sons. New York, 1999.

[0121] It is to be understood that the synthetic processes of the disclosure can tolerate a wide variety of functional groups, therefore various substituted starting materials can be used. The processes generally provide the desired final compound at or near the end of the overall process,although it may be desirable in certain instances to further convert the compound to a pharmaceutically acceptable salt thereof.

[0122] In the synthetic schemes described herein, compounds may be drawn with one particular configuration for simplicity. Such particular configurations are not to be construed as limiting the disclosure to one or another isomer, tautomer, regioisomer or stereoisomer, nor does it exclude mixtures of isomers, tautomers, regioisomers or stereoisomers, however, it will be understood that a given isomer, tautomer, regioisomer, or stereoisomer may have a higher level of activity than another isomer, tautomer, regioisomer or stereoisomer.

[0123] Methods include but are not limited to those methods described below. Compounds of the present disclosure can be synthesized by following the steps outlined in Schemes G1- G4, which comprise different sequences of assembling intermediates or compounds. Starting materials are either commercially available or made by known procedures in the reported literature or as illustrated below. Scheme G1 for the syntheses of compounds of Formula Ia-3.1—6

[0124] Exemplary formulae according to Formula Ia:

[0125] The amine G1-3 can be formed by displacement reactions of amine G1-2 with G1-1 in the presence a base such as DIPEA, Et3N or K2CO3via nucleophilic substitution. The bicyclic core G1-5 can be formed by hydrolysis of the ester group in G1-3 to the acid G1-3 using an aqueous base such as LiOH or NaOH, followed by Curtius rearrangement and in situ cyclization with DPPA under elevated temperature (such as 100-120 °C in dioxanes and DMA). The alkylated G1-6 can be formed from G1-5 with a halide in the presence of a base such as NaOH, NaH, K2CO3, etc. Installation of the aniline groups NH2Ar or NH2-HetAr can be performed with a Buchwald-Hartwig coupling using catalyst system such as Brett Phos G3 or Pd2(dba) and DCPF (1,1'-Bis(dicyclohexylphosphino)ferrocene), on the chloropyrimidine core G1-6 to synthesize the final product with general formula of Formula Ia-3.1—6 (Scheme G1).Scheme G2 for the syntheses of compounds of Formula Ia-3.1—6

[0126] Alternatively, the synthesis of compounds with general formula of Formula Ia-3.1— 6 can be initiated by displacing the chlorothioether G2-1 with amine G1-2. The thioether intermediate G2-6 can be obtained using similar sequences as that of G1-6 in Scheme G1. Oxidation of the thioether G2-6 to methyl sulfone G2-7 can be achieved with an oxidizing agent such as Oxone. To synthesize the final product with a general formula of Formula Ia- 3.1—6, the aniline groups NH2Ar or NH2-HetAr can be installed through a displacement reaction on the methylsulfone pyrimidine core G2-7 in the presence of a base such as LiHMDS in DMF (Scheme G2).Scheme G3 for the syntheses of compounds of Formula Ia-1—6

[0127] Reduction of the NO2 group in G3-3 to form amine G3-4 can be performed using either Fe or Zn in the presence of HOAc and EtOH under heating. Cyclization of G3-4 with imidazole and 1 1'-thiocarbonyldiimidazole can afford G3-5. The alkylated G3-6 can be formed from G3-5 with a halide in the presence of a base such as NaOH, NaH, K2CO3, etc. Installation of the aniline groups NH2Ar or NH2-HetAr can be performed with a Buchwald- Hartwig coupling using catalyst system such as Brett Phos G3 on the chloropyrimidine core G3-6 to synthesize the final product with Formula Ia-6.1—6.6 (Scheme G3).

[0128] Scheme G4 for the syntheses of compounds of Formula 1e-1

[0129] Amine G4-3 can be formed by displacement reactions of amine G4-1 with either 2,4- dichloro-5-nitropyrimidine followed by ethyl 2-haloacetate 2,4-dichloro-5-nitropyrimidine or with ethyl 2-haloacetate followed by 2,4-dichloro-5-nitropyrimidine in the presence a base such as Et3N or K2CO3via nucleophilic substitution. The bicyclic core G4-4 can be formed by reducing the nitro group to an amine using Fe or Zn in the presence of HOAc followed by in situ lactam formation under elevated temperature (such as 40-100 °C). The alkylated G4-5 can be formed from G4-4 with a halide in the presence of a base such as NaOH, NaH, K2CO3, etc. The aniline groups NH2Ar or NH2-HetAr can be installed using a Buchwald-Hartwig coupling with a catalyst system such as Brett Phos G3 on the chloropyrimidine core G4-5 to synthesize the final product with a general Formula of 1e-1-6 (Scheme G4).Scheme G5 for the syntheses of compounds of Formula Ig-1—6

[0130] Intermediate G5-2 can be obtained by the cyclopropanation of G5-1 with dibromoethane in the presence of a base such as NaH in DMF. Amine G5-3 can be formed by displacing amine G1-2 with G5-2 via nucleophilic substitution in the presence a base such as DIPEA, Et3N or K2CO3via nucleophilic substitution at an elevated temperature such as 100- 120 °C in DMA. Treatment of G5-3 with a strong base such as NaH can either result in the cyclized intermediate G5-5 or the hydrolysis of the ester group in G5-3. Ring closure of G5-4 can be achieved by using a coupling agent such as HATU in the presence a base such as DIPEA to afford G5-5. Oxidation of the thioether G5-5 to methyl sulfone G5-6 can be achieved with an oxidizing agent such as Oxone. To synthesize the final product with a general formula of Formula Ig-1—6, the aniline groups NH2Ar or NH2-HetAr can be installed through a displacement reaction on the methylsulfone pyrimidine core G2-6 in the presence of a base such as LiHMDS in DMF (Scheme G5).Scheme G6 for the syntheses of compounds of Formula Ih-1—2

[0131] The alcohol group in G6-1 can be protected with a PMB group. Amine G6-3 can be formed by displacing G6-2 with amine G1-2 via nucleophilic substitution in the presence a base such as DIPEA, Et3N or K2CO3via nucleophilic substitution at an elevated temperature such as 100-120 °C in a solvent such as isopropanol. The aniline groups NH2Ar or NH2-HetAr can be installed using a Buchwald-Hartwig coupling with a catalyst system such as Brett Phos G3 or Pd2(dba) and DCPF on the chloropyrimidine core G6-3 to synthesize the key intermediate G6-4. Removal of the PMB group followed by cyclization with CDI can afford the final product with a general formula of Formula Ih-1-2. Scheme G7 for the syntheses of compounds of Formula If.

[0132] A mixture of base (such as DIPEA), G7-1 and G7-2 in an appropriate solvent (such as THF) at low temperature such as (0 °C) can afford G7-3. C-N coupling reactions of G7-3 with various aryl or heteroaryl amines within the scope of this invention can be achieved in the presence of a suitable catalyst system (such as Brettphos Pd G3) and a base (such as cesium carbonate), which can generate the compounds of Formula If (Scheme 7).

[0133] Examples presented herein, unless otherwise stated, are synthesized according to the general procedure presented in Schemes G1-G7.Compositions

[0134] Another aspect of the present disclosure relates to compositions comprising a (a) a DNA protein kinase inhibitor (DNA-PKI) and (b) a DNA cutting agent, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the composition further comprises a cell. In some embodiments, the composition further comprises a donor DNA. In some embodiments, the composition further comprises a cell and a donor DNA.

[0135] In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is useful in adoptive cell therapy (ACT). In some embodiments, the cell is a stem cell. In some embodiments, the cell is a hematopoietic stem cell (HSC) or an induced pluripotent stem cell (iPSC). In some embodiments, the cell is an immune cell. In some embodiments, the immune cell is a leukocyte, or a lymphocyte (e.g., a T cell, a B cell, or an NK cell). In some embodiments, the immune cell is a lymphocyte. In some embodiments, the lymphocyte is a T cell. In some embodiments, the lymphocyte is a primary T cell. In some embodiments, the lymphocyte is a regulatory T cell. In some embodiments, the lymphocyte is an activated T cell. In some embodiments, the lymphocyte is a non-activated T cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is not a cancer cell.

[0136] In some embodiments, the donor DNA comprises a template comprising a sequence encoding a protein, a regulatory sequence, or a sequence encoding structural RNA.

[0137] In some embodiments, the DNA cutting agent is selected from a zinc finger nuclease, a TALE effector domain nuclease (TALEN), a CRISPR / Cas nuclease component, and combinations thereof.

[0138] In some embodiments, the DNA cutting agent comprises a CRISPR / Cas nuclease component and optionally a guide RNA component. In some embodiments, the DNA cutting agent is a CRISPR / Cas nuclease component and a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component comprises a Cas nuclease or an mRNA encoding the Cas nuclease. In some embodiments, the CRISPR / Cas nuclease component comprises or encodes a CRISPR / Cas nuclease that generates a double strand DNA break or single strand DNA break. In some embodiments, the CRISPR / Cas nuclease component comprises or encodes a CRISPR / Cas nuclease that generates a single strand DNA break.

[0139] In some embodiments, the DNA cutting agent is a CRISPR / Cas nuclease component and a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component comprises a Cas nuclease or an mRNA encoding the Cas nuclease. In some embodiments, the Cas nuclease is a Class 2, Type II Cas nuclease. In some embodiments, the Cas nuclease is aCas9 nuclease (e.g., a S. pyogenes Cas9 nuclease). In some embodiments, the Cas nuclease is a Class 2, Type V Cas nuclease. In some embodiments, the Cas nuclease is a Cas12a nuclease (e.g., a Acidaminococcus sp. Cas12a nuclease).

[0140] In some embodiments, the composition comprises a modified RNA.

[0141] In some embodiments, the guide RNA component is a guide RNA nucleic acid. In some embodiments, the guide RNA component is a guide RNA (gRNA). In some embodiments, the guide RNA nucleic acid is or encodes a dual-guide RNA (dgRNA). In some embodiments, the dual-guide RNA is composed of a crRNA and tracrRNA. In some embodiments, the guide RNA nucleic acid is or encodes a single-guide (sgRNA). In some embodiments, the gRNA is a modified gRNA.

[0142] In some embodiments, the DNA cutting agent is Cas9 or an mRNA encoding Cas9, and a modified gRNA comprising a modification at one or more of the first five nucleotides at the 5’ end. In some embodiments, the cutting agent is Cas12a or an mRNA encoding Cas12a, and a modified gRNA comprising a DNA / RNA hybrid molecule. In some embodiments, the modified gRNA comprises a modification at one or more of the last five nucleotides at the 3’ end.

[0143] In some embodiments, the DNA cutting agent is a Class 2, Type II or Class 2, Type V Cas nuclease and a guide RNA nucleic acid; and the molar ratio of the guide RNA to Cas nuclease is from about 4:1 to 1:4.

[0144] In some embodiments, the composition further comprises a vector. In some embodiments, the vector encodes the donor DNA. In some embodiments, the vector is a viral vector (e.g., an AAV). In some embodiments, the vector is a non-viral vector. In some embodiments, the vector is a non-viral vector comprising donor DNA having a linear, close end, circular, single strand, double strand format.

[0145] In some embodiments, the composition further comprises an inhibitor of the microhomology mediated end joining (MMEJ) pathway. In some embodiments, the inhibitor of the MMEJ pathway is a DNA polymerase theta (Pol^ or POLQ) inhibitor. In some embodiments, the inhibitor of the MMEJ pathway is a FEN1 inhibitor. In some embodiments, the inhibitor of the MMEJ pathway is selected from the group consisting of a PolQ inhibitor selected from the compounds described in J. Med. Chem 2023, 66, 6498 by Pismataro, M. C., et al. and references therein, for example, inhibitor of PolQ is ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), novobiocin (Dana-Farber Cancer Institute, Inc.)Compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof.

[0146] In some embodiments, the concentration of the DNA-PKI in the composition is about 10 μΜ or less. In some embodiments, the concentration of the DNA-PKI in the composition is from about 0.1 μΜ to about 10 μΜ. In some embodiments, the concentration of the DNA-PKI in the composition is from about 0.25 μΜ to about 5 μΜ. In some embodiments, the concentration of the DNA-PKI in the composition is from about 0.25 μΜ to about 10 μΜ. In some embodiments, the concentration of the DNA-PKI in the composition is from about 0.1 μΜ to about 5 μΜ. In some embodiments, the concentration of the DNA-PKI in the composition is from about 0.1 μΜ to about 0.25 μΜ. Methods of Use

[0147] Another aspect of the present disclosure is directed to a method for targeted genome editing in a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0148] Another aspect of the present disclosure is directed to a method for repairing a double stranded DNA break in the genome of a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the double stranded DNA break is a blunt end break. In some embodiments, the double stranded DNA break comprises paired single strand breaks (e.g., made by a combination of nickase nucleases).

[0149] Another aspect of the present disclosure is directed to a method for inhibiting or suppressing repair of a DNA break in a cell via a nonhomologous end joining (NHEJ) pathway, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA- PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the method further comprises contacting the cell with an inhibitor of the microhomology mediated end joining (MMEJ) pathway. In some embodiments, the inhibitor of the MMEJ pathway is a DNA polymerase theta (Pol^ or POLQ) inhibitor. In some embodiments, the inhibitor of the MMEJ pathway is a FEN1 inhibitor. In some embodiments, the inhibitor of the MMEJ pathway is selected from the group consisting of a PolQ inhibitor selected from the compounds described in J. Med. Chem 2023, 66, 6498 by Pismataro, M. C., et al. and references therein, for example,inhibitor of PolQ is ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), novobiocin (Dana-Farber Cancer Institute, Inc.) Compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof. Another aspect of the present disclosure is directed to a method for targeted insertion of a donor DNA into the genome of a cell, comprising contacting the cell with a DNA cutting agent, the donor DNA, and a DNA- PKI, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0150] In some embodiments of the methods disclosed herein, the method comprises growing the cell in a cell medium free of the DNA-PKI, and adding the DNA-PKI to the cell medium.

[0151] In some embodiments of the methods disclosed herein, the method comprises contacting the cell with the DNA cutting agent before contacting the cell with the DNA-PKI. In some embodiments, the method comprises contacting the cell with the DNA-PKI within about six hours of contacting the cell with the DNA cutting agent. In some embodiments, the methods comprise contacting the cell with the DNA-PKI within about three hours of contacting the cell with the DNA cutting agent. In some embodiments, the methods comprise contacting the cell with the DNA-PKI within about two hours of contacting the cell with the DNA cutting agent. In some embodiments, the methods comprise contacting the cell with the DNA-PKI between about 15 minutes and about 45 minutes of contacting the cell with the DNA cutting agent. In some embodiments, the methods comprise contacting the cell with the DNA-PKI about 30 minutes of contacting the cell with the DNA cutting agent.

[0152] In some embodiments, the methods comprise contacting the cell with the DNA cutting agent simultaneously with the DNA-PKI.

[0153] In some embodiments of the methods disclosed herein, the method comprises growing the cell in a cell medium comprising the DNA-PKI.

[0154] In some embodiments, the methods comprise contacting the cell with the DNA cutting agent after contacting the cell with the DNA-PKI. In some embodiments, the methods comprise contacting the cell with the DNA cutting agent within about three hours of contacting the cell with the DNA-PKI.

[0155] In some embodiments, contacting the cell with the DNA cutting agent comprises electroporating the cell to allow the DNA cutting agent to enter the cell. In some embodiments, contacting the cell with the DNA cutting agent comprises delivering the DNA cutting agent to the cell using other methods, e.g., microinjection or via a lipid nanoparticle, liposome,exosome, or gold nanoparticle. In some embodiments, the methods comprise contacting the cell with the DNA cutting agent and the donor DNA simultaneously.

[0156] In some embodiments of the methods disclosed herein, the method comprises contacting the cell with the DNA cutting agent and the DNA-PKI for at least about one day. In some embodiments, the method comprises contacting the cell with the DNA cutting agent and the DNA-PKI for about one day. In some embodiments, the method comprises contacting the cell with the DNA cutting agent and the DNA-PKI for between about one day and about two weeks. In some embodiments, the method comprises contacting the cell with the DNA cutting agent and the DNA-PKI for about two weeks.

[0157] In some embodiments of the methods disclosed herein, the method comprises contacting the cell with the DNA-PKI in a cell medium, wherein the concentration of the DNA- PKI in the cell medium is about 10 μΜ or less. In some embodiments, the method comprises contacting the cell with the DNA-PKI in a cell medium, wherein the concentration of the DNA- PKI in the cell medium is between about 0.1 μΜ and about 10 μΜ. In some embodiments, the method comprises contacting the cell with the DNA-PKI in a cell medium, wherein the concentration of the DNA-PKI in the cell medium is between about 0.25 μΜ and about 5 μΜ.

[0158] In some embodiments of the methods disclosed herein, the cell is a eukaryotic cell. In some embodiments, the cell is for use in adoptive cell therapy (ACT). In some embodiments, the cell is for use in autologous cell therapy. In some embodiments, the cell is for use in allogenic cell therapy. In some embodiments, the cell is a stem cell. In some embodiments, the cell is a hematopoietic stem cell (HSC) or an induced pluripotent stem cell (iPSC). In some embodiments, the cell is an immune cell. In some embodiments, the immune cell is a leukocyte, or a lymphocyte (e.g., a T cell, a B cell, or an NK cell). In some embodiments, the immune cell is a lymphocyte. In some embodiments, the lymphocyte is a T cell. In some embodiments, the lymphocyte is a primary T cell. In some embodiments, the lymphocyte is a regulatory T cell. In some embodiments, the lymphocyte is an activated T cell. In some embodiments, the lymphocyte is a non-activated T cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is not a cancer cell.

[0159] In some embodiments of the methods disclosed herein, the DNA cutting agent is selected from a zinc finger nuclease, a TALE effector domain nuclease (TALEN), a CRISPR / Cas nuclease component, and combinations thereof.

[0160] In some embodiments of the methods disclosed herein, the DNA cutting agent comprises a CRISPR / Cas nuclease component and optionally a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component comprises a Cas nuclease or anmRNA encoding the Cas nuclease. In some embodiments, the CRISPR / Cas nuclease component comprises or encodes a CRISPR / Cas nuclease that generates a double strand DNA break or single strand DNA break. In some embodiments, the CRISPR / Cas nuclease component comprises or encodes a CRISPR / Cas nuclease that generates a single strand DNA break.

[0161] In some embodiments of the methods disclosed herein, the DNA cutting agent is a CRISPR / Cas nuclease component and a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component comprises a Cas nuclease or an mRNA encoding the Cas nuclease. In some embodiments, the Cas nuclease is a Class 2, Type II Cas nuclease. In some embodiments, the Cas nuclease is a Cas9 nuclease (e.g., a S. pyogenes Cas9 nuclease). In some embodiments, the Cas nuclease is a Class 2, Type V Cas nuclease. In some embodiments, the Cas nuclease is a Cas12a nuclease (e.g., a Acidaminococcus sp. Cas12a nuclease).

[0162] In some embodiments of the methods disclosed herein, the methods further comprise contacting the cell with a modified RNA.

[0163] In some embodiments of the methods disclosed herein, the methods further comprise contacting the cell with a guide RNA component. In some embodiments, the guide RNA component is a guide RNA nucleic acid. In some embodiments, the guide RNA component is a guide RNA (gRNA). In some embodiments, the guide RNA nucleic acid is or encodes a dual- guide RNA (dgRNA). In some embodiments, the guide RNA nucleic acid is or encodes a single-guide (sgRNA). In some embodiments, the gRNA is a modified gRNA.

[0164] In some embodiments of the methods disclosed herein, the DNA cutting agent is Cas9 or an mRNA encoding Cas9, and a modified gRNA comprising a modification at one or more of the first five nucleotides at the 5’ end. In some embodiments, the cutting agent is Cas12a or an mRNA encoding Cas12a, and a modified gRNA comprising a DNA / RNA hybrid molecule. In some embodiments, the modified gRNA comprises a modification at one or more of the last five nucleotides at the 3’ end.

[0165] In some embodiments of the methods disclosed herein, the DNA cutting agent is a Class 2, Type II or Class 2, Type V Cas nuclease and a guide RNA nucleic acid; and the molar ratio of the guide RNA to Cas nuclease is from about 4:1 to 1:4.

[0166] In some embodiments of the methods disclosed herein, the DNA cutting agent interacts with a target sequence within the TRAC gene of a T cell.

[0167] In some embodiments of the methods disclosed herein, the methods comprise contacting the cell with at least two different DNA cutting agents targeting different loci.

[0168] In some embodiments, the methods comprise contacting the cell with a vector encoding the DNA cutting agent. In some embodiments, the vector encodes the DNA cutting agent and the donor DNA. In some embodiments, the methods comprise contacting the cell with a vector encoding the DNA cutting agent, and a second vector encoding the donor DNA.

[0169] In some embodiments, the vector is a viral vector (e.g., an AAV). In some embodiments, the vector is a non-viral vector. In some embodiments, the vector is a non-viral vector comprising donor DNA having a linear, close end, circular, single strand, double strand format.

[0170] In some embodiments of the methods disclosed herein, the DNA cutting agent interacts with a target sequence within the genome of the cell, resulting in a double stranded DNA break (DSB).

[0171] In some embodiments of the methods disclosed herein, the methods further comprise contacting the cell with a donor DNA. In some embodiments, the methods comprise contacting the cell with a vector comprising the donor DNA. In some embodiments, the vector encodes the donor DNA. In some embodiments, the donor DNA comprises a template comprising a sequence encoding a protein, a regulatory sequence, or a sequence encoding structural RNA. In some embodiments, the donor DNA comprises a template comprising an exogenous nucleic acid encoding a protein. In some embodiments, the protein is selected from a cytokine, an immunosuppressor, an antibody, a receptor, and an enzyme. In some embodiments, the protein is a receptor. In some embodiments, the receptor is selected from an immunological receptor, a T-cell receptor (TCR), and a chimeric antigen receptor. In some embodiments, the exogenous nucleic acid encodes a TCR chain of a TCR, e.g., a TCR alpha, beta, delta, or gamma chain, or any combination thereof. In some embodiments, the exogenous nucleic acid encodes a TCR alpha and / or TCR beta chain. In some embodiments, the template comprises a first homology arm and a second homology arm that are complementary to sequences located upstream and downstream of the cleavage site, respectively.

[0172] In some embodiments of the methods disclosed herein, the method results in a gene knockout. In some embodiments of the methods disclosed herein, the method results in a gene correction. In some embodiments of the methods disclosed herein, the method results in a gene insertion.

[0173] In some embodiments, the methods further comprise contacting the cell with an inhibitor of the microhomology mediated end joining (MMEJ) pathway. In some embodiments, the inhibitor of the MMEJ pathway is a DNA polymerase theta (Pol^ or POLQ) inhibitor. Insome embodiments, the inhibitor of the MMEJ pathway is a FEN1 inhibitor. In some embodiments, the inhibitor of the MMEJ pathway is selected from the group consisting of a PolQ inhibitor selected from the compounds described in J. Med. Chem 2023, 66, 6498 by Pismataro, M. C., et al. and references therein, for example, inhibitor of PolQ is ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), novobiocin (Dana-Farber Cancer Institute, Inc.) Compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof. Another aspect of the present disclosure relates to compounds of Formula (I), and pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, tautomers, or pharmaceutical compositions thereof, for use in the manufacture of a medicament for cell therapy.

[0174] Another aspect of the present disclosure relates to the use of a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, tautomer, or pharmaceutical composition thereof, in the treatment of a cell.

[0175] In one embodiment, the subject is a mammal.

[0176] In one embodiment, the mammal is a human.

[0177] Administration of the disclosed compounds may also be accomplished via any mode of administration for therapeutic agents. These modes include systemic or local administration such as oral, nasal, parenteral, transdermal, subcutaneous, vaginal, buccal, rectal or topical administration modes.

[0178] Depending on the intended mode of administration, the disclosed compositions can be in solid, semi-solid or liquid dosage form, such as, for example, injectables, tablets, suppositories, pills, time-release capsules, elixirs, tinctures, emulsions, syrups, powders, liquids, suspensions, or the like, sometimes in unit dosages and consistent with conventional pharmaceutical practices. Likewise, they can also be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous or intramuscular form, and all using forms well known to those skilled in the pharmaceutical arts.

[0179] Illustrative pharmaceutical compositions are tablets and gelatin capsules comprising a compound of the present disclosure and a pharmaceutically acceptable carrier, such as a) a diluent, e.g., purified water, triglyceride oils, such as hydrogenated or partially hydrogenated vegetable oil, or mixtures thereof, corn oil, olive oil, sunflower oil, safflower oil, fish oils, such as EPA or DHA, or their esters or triglycerides or mixtures thereof, omega-3 fatty acids or derivatives thereof, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, sodium, saccharin, glucose and / or glycine; b) a lubricant, e.g., silica, talcum, stearic acid, its magnesium or calcium salt, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodiumacetate, sodium chloride and / or polyethylene glycol; for tablets also; c) a binder, e.g., magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, magnesium carbonate, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tragacanth or sodium alginate, waxes and / or polyvinylpyrrolidone, if desired; d) a disintegrant, e.g., starches, agar, methyl cellulose, bentonite, xanthan gum, algic acid or its sodium salt, or effervescent mixtures; e) absorbent, colorant, flavorant and sweetener; f) an emulsifier or dispersing agent, such as Tween 80, Labrasol, HPMC, DOSS, caproyl 909, labrafac, labrafil, peceol, transcutol, capmul MCM, capmul PG-12, captex 355, gelucire, vitamin E TGPS or other acceptable emulsifier; and / or g) an agent that enhances absorption of the compound such as cyclodextrin, hydroxypropyl-cyclodextrin, PEG400, PEG200.

[0180] Liquid, particularly injectable, compositions can, for example, be prepared by dissolution, dispersion, etc. For example, the disclosed compound is dissolved in or mixed with a pharmaceutically acceptable solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like, to thereby form an injectable isotonic solution or suspension. Proteins such as albumin, chylomicron particles, or serum proteins can be used to solubilize the disclosed compounds.

[0181] The disclosed compounds may be also formulated as a suppository that can be prepared from fatty emulsions or suspensions; using polyalkylene glycols such as propylene glycol, as the carrier.

[0182] The disclosed compounds may also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids, containing cholesterol, stearylamine or phosphatidylcholines. In some embodiments, a film of lipid components is hydrated with an aqueous solution of drug to a form lipid layer encapsulating the drug, as described in U.S. Pat. No.5,262,564 which is hereby incorporated by reference in its entirety.

[0183] Disclosed compounds may also be delivered by the use of monoclonal antibodies as individual carriers to which the disclosed compounds are coupled. The disclosed compounds can also be coupled with soluble polymers as targetable drug carriers. Such polymers can include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropylmethacrylamide-phenol, polyhydroxyethylaspanamidephenol, or polyethyleneoxidepolylysine substituted with palmitoyl residues. Furthermore, the Disclosed compounds can be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters,polyacetals, polydihydropyrans, polycyanoacrylates and cross-linked or amphipathic block copolymers of hydrogels. In one embodiment, disclosed compounds are not covalently bound to a polymer, e.g., a polycarboxylic acid polymer, or a polyacrylate.

[0184] Parenteral injectable administration is generally used for subcutaneous, intramuscular or intravenous injections and infusions. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions or solid forms suitable for dissolving in liquid prior to injection.

[0185] Another aspect of the present disclosure is directed to pharmaceutical compositions comprising a compound of Formula (I) and a pharmaceutically acceptable carrier. The pharmaceutical acceptable carrier may further include an excipient, diluent, or surfactant. In some embodiments, the pharmaceutical composition can further comprise an additional pharmaceutically active agent.

[0186] In one embodiment, the pharmaceutical acceptable carrier further comprises an excipient, diluent, surfactant, or any combination thereof.

[0187] In one embodiment, the pharmaceutical composition further comprises at least one additional therapeutic agent.

[0188] Another aspect of the present disclosure is directed to pharmaceutical compositions for use in cell therapy comprising a compound of Formula (I), or a pharmaceutically acceptable salt thereof.

[0189] Compositions can be prepared according to conventional mixing, granulating or coating methods, respectively, and the present pharmaceutical compositions can contain from about 0.1% to about 99%, from about 5% to about 90%, or from about 1% to about 20% of the disclosed compound by weight or volume.

[0190] In one embodiment, the composition comprises about 1 mg to about 2000 mg of the compound.

[0191] In one embodiment, the composition is administered to the subject twice daily, once daily, once every other day, or once weekly. EXAMPLES

[0192] The disclosure is further illustrated by the following examples and synthesis schemes, which are not to be construed as limiting this disclosure in scope or spirit to the specific procedures herein described. It is to be understood that the examples are provided to illustrate certain embodiments and that no limitation to the scope of the disclosure is intended thereby.It is to be further understood that resort may be had to various other embodiments, modifications, and equivalents thereof which may suggest themselves to those skilled in the art without departing from the spirit of the present disclosure and / or scope of the appended claims.

[0193] The compounds of the present disclosure may be prepared by use of known chemical reactions and procedures. Nevertheless, the following general preparative methods are presented to aid the reader in synthesizing the compounds with specific details provided below in the experimental section to illustrate working examples.

[0194] All variable groups of these methods are as described in the generic description if they are not specifically defined below.

[0195] It is recognized that compounds of the disclosure with each claimed optional functional group may not be prepared by each of the below-listed methods. Within the scope of each method, optional substituents may appear on reagents or intermediates which may act as protecting or otherwise non-participating groups. Utilizing methods well known to those skilled in the art, these groups are introduced and / or removed during the course of the synthetic schemes which provide the compounds of the present disclosure. Acronyms and Abbreviations

[0196] Table 2 provides a list of acronyms and abbreviations used in this specification, along with their meanings.Analytical Procedures NMR

[0197] The following conditions were used for obtaining proton nuclear magnetic resonance (NMR) spectra: NMR spectra were taken in either 400 MHz or 500 MHz. Bruker instrument using either DMSO-d6 or CDCl3 as solvent and internal standard. The crude NMR data was analyzed by using either ACD Spectrus version 2015-01 by ADC Labs or MestReNova software.

[0198] Chemical shifts are reported in parts per million (ppm) downfield from internal tetramethylsilane (TMS) or from the position of TMS inferred by the deuterated NMR solvent. Apparent multiplicities are reported as: singlet-s, doublet-d, triplet-t, quartet-q, or multiplet- m. Peaks that exhibit broadening are further denoted as br. Integrations are approximate. It should be noted that integration intensities, peak shapes, chemical shifts and coupling constants can be dependent on solvent, concentration, temperature, pH, and other factors. Further, peaks that overlap with or exchange with water or solvent peaks in the NMR spectrum may not provide reliable integration intensities. In some cases, NMR spectra may be obtained using water peak suppression, which may result in overlapping peaks not being visible or having altered shape and / or integration.Liquid chromatography

[0199] The following preparative and / or analytical (LC / MS) liquid chromatography methods were used.

[0200] Method A: Column: XBridge C18, 2.1 mm x 50 mm, 1.7 μm particles; Mobile Phase A: ACN / H2O (5:95) with 10 mM AA; Mobile Phase B: ACN / H2O (95:5) with 10 mM AA; Temperature: 50 °C; Gradient: 0-100 %B (0.0-3.0 min), 100 %B (3.0-3.5 min); Flow: 1.0 mL / min; Detection: UV (220 nm) and MS (ESI +).

[0201] Method B: Column: XBridge C18, 2.1 mm x 50 mm, 1.7 μm particles; Mobile Phase A: ACN / H2O (5:95) with 0.05 % TFA; Mobile Phase B: ACN / H2O (95:5) with 0.05 % TFA; Temperature: 50 °C; Gradient: 0-100 %B (0.0-3.0 min), 100 %B (3.0-3.5 min); Flow: 1.0 mL / min; Detection: UV (220 nm) and MS (ESI +).

[0202] UPLCMS Method C: Column: Aquity BEH C18 (50 x 3.0)mm, 1.7 μm, Mobile Phase: A: 0.1% TFA in Water, Mobile Phase: B: 0.1% TFA in ACN, Flow Rate: 0.7 ml / min; Time (min) / Grad (%B): 0 / 20, 1.5 / 98, 2 / 98. Detection: MS and UV (254 nm).

[0203] UPLCMS Method D: Column: Aquity BEH C18 (50 x 3.0)mm, 1.7 μm, Mobile Phase: A: 5mm Ammonium formate pH 3.3: ACN (98:02), Mobile Phase B: ACN: Buffer (98:02), Flow Rate: 0.7 ml / min; Time (min) / Grad (%B): 0 / 20, 1.5 / 98, 2 / 98. Detection: MS and UV (254 nm).

[0204] UHPLC Method E: Column: Waters Acquity BEH C18 2.1 x 50 mm 1.7 μm particles; Mobile Phase A: 95:5 acetonitrile: water with 0.05% TFA; Mobile Phase B: 95:5 acetonitrile: water with 0.05% TFA; Temperature: 50 °C; Gradient: 0 %B to 100 %B over 1.5 min, then a 0.50 min hold at 100 %B; Flow: 1.0 mL / min; Detection: MS and UV (254 nm).

[0205] LCMS method F: Column: Kinetex XB-C18 (75x3mm) 2.6 μm; Mobile phase: A :0.1% TFA in H2O; Mobile phase: B: 0.1% TFA in ACN; Flow Rate: 1.0 mL / min. Time / Gradient: 5% B to 95 %B in 2.5 min, then hold at 95 %B for 2 min hold at 95 %B.

[0206] LCMS method G: Column: Kinetex XB-C18 (75x3mm) 2.6 μm; 5mm Ammonium formate pH 3.3: ACN (98:02); Mobile Phase: B: ACN: Buffer (98:02); Flow Rate: 1.0 mL / min. Time / Gradient: 0% B to 100 %B in 4.0 min, then hold at 100 %B for 0.6 min (1.5 mL / min).

[0207] LCMS method H: Column: Kinetex XB-C18 (75x3mm) 2.6 μm; Mobile phase: A :0.1% TFA in H2O; Mobile phase: B: 0.1% TFA in ACN; Flow Rate: 1.0 mL / min. Time / Gradient: 5% B to 95 %B in 2.5 min, then hold at 95 %B for 2 min hold at 95 %B.

[0208] LCMS Method I: Column: XSELECT CSH C18 (50x4.6mm) 3.5 μm, Mobile phase A: 10 mm AA in H2O, Mobile phase B: ACN, Flow Rate:1.0ml / min, Time(min) / Grad (%B): 5% B to 95 %B in 2.5 min, then hold at 95 %B for 2 min hold at 95 %B.

[0209] Analytical HPLC A: Column: Kinetex Biphenyl (100X4.6) mm, 2.6μm, Mobile phase: A: 0.05% TFA in water: ACN; Mobile phase: B: 0.05% TFA in ACN : water; Flow: 1.0 mL / min; Time (min) / Gradient (%B): 0 / 10, 9 / 60, 11 / 100, 11.1 / 100 (1.5 mL / min), 12.5 / 100 (1.5 mL / min), 13 / 10, 15 / 10.

[0210] Analytical HPLC B: Column: Kinetex EVO C18 (100x4.6) mm, 2.6 μm, Mobile phase: A: 0.05% TFA in water: ACN (95:5), Mobile phase: B: ACN: 0.05%TFA in water (95:5); Flow: 1.0 mL / min; Time (min) / Grad (%B): 0 / 10, 1 / 30, 9 / 80, 11 / 100, 11.1 / 100 (1.5 mL / min), 12.5 / 100 (1.5 mL / min), 13 / 10, 15 / 10.

[0211] Analytical HPLC C: Column:Xselect CSH C18 (150X4.6) mm, 3.5μm, Mobile phase A: 10mM Ammonium acetate; Mobile phase B: ACN, Flow: 1.0 mL / min, Time (min) / Grad (%B): 0 / 10,9 / 60, 11 / 100, 11.1 / 100 (1.5 ml / min),12.5 / 100 (1.5 ml / min), 13 / 10, 15 / 10.

[0212] Analytical HPLC D: Column:X-Bridge C8(150X4.6)mm,3.5μm, Mobile phase A:10 mm Ammonium Acetate in Water, Mobile phase:B:ACN:100 %Flow: 1.0 mL / min, Time (min) / Grad (%B): 0 / 10, 9 / 60, 11 / 100, 11.1 / 100 (1.5 ml / min), 12.5 / 100 (1.5 ml / min), 13 / 10, 15 / 10.

[0213] Example I1: Preparation of the amine intermediates Synthesis of 4-methyl-6-(1-methyl-1H-pyrazol-4-yl) pyridin-3-amine

[0214] To a stirred solution of 6-bromo-4-methylpyridin-3-amine (700 mg, 3.74 mmol), 1- methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (1557 mg, 7.49 mmol) in dioxane (21 mL) and water (4.2 mL) was added potassium phosphate tribasic (2383 mg, 11.23 mmol). The reaction mixture was purged with nitrogen over a period of 5 mins. To it then [1,1'- Bis(di-tert-butylphosphino) ferrocene] dichloropalladium(II) (244 mg, 0.374 mmol) was added. The resulting reaction mixture was further purged with nitrogen over a period of 5 minsand stirred at 100 °C for 16 h. The reaction mixture was filtered through celite bed. The celite bed was washed with ethyl acetate. The combined filtrate was washed with water (50 mL), dried over anhydrous sodium sulphate, filtered, and concentrated under reduced pressure till dryness to afford the crude compound. It was purified by silica gel flash column chromatography eluting with 2-3% methanol in DCM to give 4-methyl-6-(1-methyl-1H- pyrazol-4-yl)pyridin-3-amine (700 mg, 3.48 mmol, 93 % yield) as a brown solid. LCMS: RT=1.543 min; m / z: 189.2 [M+H]+; (LCMS Method H).1HNMR (400 MHz, DMSO-d6): δ 7.986 (s, 1H), 7.852 (s, 1H), 7.762 (s, 1H), 7.216 (s, 1H), 4.981 (s, 2H), 3.835 (s, 3H), 2.090 (s, 3H). Synthesis of 5-fluoro-2-methyl-4-(oxazol-5-yl) aniline

[0215] To a stirred solution of 4-bromo-5-fluoro-2-methylaniline (160 mg, 0.784 mmol), 5- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)oxazole (214 mg, 1.098 mmol) in dioxane (4 mL) and Water (0.8 mL) was added potassium phosphate tribasic (499 mg, 2.352 mmol). The reaction mixture was purged with nitrogen over a period of 5 mins and then [1,1'-Bis(di-tert- butylphosphino)ferrocene]dichloropalladium(II) (51.1 mg, 0.078 mmol) was added. The resulting reaction mixture was further purged with nitrogen over a period of 5 mins and stirred at 100 °C for 16 h. The reaction mixture was filtered through celite bed. The celite bed was washed with 20 ml of ethyl acetate. The combined filtrate was washed with water (15 mL), dried over anhydrous sodium sulphate, filtered, and concentrated under reduced pressure till dryness to afford crude compound. The crude compound was purified by silica gel flash column chromatography eluting with 20-25% ethyl acetate in pet ether to 5-fluoro-2-methyl-4-(oxazol- 5-yl)aniline (140 mg, 0.709 mmol, 90 % yield) as a pale yellow solid. LCMS: RT=2.459 min; m / z: 193.2 [M+H+; (Method G).1HNMR (400 MHz, DMSO-d6): δ 8.34 (s, 1H), 7.29 (d, J = 8.4 Hz, 1H), 7.17 (d, J = 3.60 Hz, 1H), 6.49 (d, J = 13.60 Hz, 1H), 5.56 (s, 2H), 2.07 (s, 3H).Synthesis of 4-methyl-6-(oxazol-5-yl) pyridin-3-amine

[0216] To a stirred solution of 6-bromo-4-methylpyridin-3-amine (160 mg, 0.855 mmol), 5- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)oxazole (250 mg, 1.283 mmol) in dioxane (4 mL) and water (0.8 mL) was added potassium phosphate tribasic (545 mg, 2.57 mmol). The reaction mixture was purged with nitrogen over a period of 5 mins. To it then [1,1'-Bis(di-tert- butylphosphino)ferrocene]dichloropalladium(II) (55.8 mg, 0.086 mmol). The resulting reaction mixture was further purged with nitrogen over a period of 5 mins and stirred at 100 °C for 16 h. The reaction mixture was filtered through celite bed. The celite bed was washed with ethyl acetate. The combined filtrate was washed with water (15 ml), dried over anhydrous sodium sulphate, filtered, and concentrated under reduced pressure till dryness to afford the crude. It was purified by silica gel flash column chromatography eluting with 55-60% ethyl acetate in petroleum ether to get 4-methyl-6-(oxazol-5-yl)pyridin-3-amine (150 mg, 0.849 mmol, 99 % yield) as an off white solid. LCMS: RT=1.358 min; m / z: 176.2 [M+H]+(Method G) .1HNMR (400 MHz, DMSO-d6): δ 8.330 (s, 1H), 7.948 (s, 1H), 7.408 (s, 1H), 7.357 (s, 1H), 5.443 (s, 2H), 2.128 (s, 3H). Synthesis of 7-methylquinolin-6-amine

[0217] Step 1: Synthesis of N-(7-methylquinolin-6-yl)-1,1-diphenylmethanimine (I.2). A stirred solution of 6-bromo-7-methylquinoline (1g, 4.50 mmol), diphenylmethanimine (1.224 g, 6.75 mmol) and caesium carbonate (2.93 g, 9.01 mmol) in toluene (10 mL) was purged with nitrogen over a period of 5 min. To it then RuPhos Pd G3 (0.565 g, 0.675 mmol) was added. The resulting reaction mixture was further purged with nitrogen over a period of 5 mins and stirred at 100 °C for 16 h. The reaction mixture was filtered through celite bed. The celite bedwas washed with 20 mL of ethyl acetate. The combined filtrate was concentrated under reduced pressure till dryness to afford crude compound. The crude compound was purified by silica gel flash column chromatography eluting with 10-25% ethyl acetate in pet ether to afford N-(7- methylquinolin-6-yl)-1,1-diphenylmethanimine (1.4 g, 3.78 mmol, 84 % yield) as yellow semisolid. LCMS: RT=2.974, m / z: 323.6 [M+H]+(MethodG).1HNMR (400 MHz, DMSO-d6): δ 8.65-8.67 (m, 1H), 7.97-7.99 (m, 1H), 7.73-7.76 (m, 3H), 7.51-7.58 (m, 3H), 7.25-7.32 (m, 4H), 7.19-7.21 (m, 2H), 6.91 (s, 1H), 2.37 (s, 3H).

[0218] Step 2: Synthesis of 7-methylquinolin-6-amine. To a stirred solution of N-(7- methylquinolin-6-yl)-1,1-diphenylmethanimine (1.4 g, 4.34 mmol) in THF (10 mL) was added 1.5N HCl solution (15 mL). The resulting reaction mixture was stirred at 25 °C for 1h. The reaction mixture was extracted with ethyl acetate (2 x 10) ml. Then the aqueous layer was basified with NaHCO3 solution and further extracted with ethyl acetate (2 x 30) ml. The combined organic layer was dried over anhydrous sodium sulphate, filtered and concentrated under reduced pressure till dryness to afford 7-methylquinolin-6-amine (620 mg, 3.80 mmol, 88 % yield) as a pale pink solid. LCMS: RT = 0.91 min, m / z: 159.2 [M+H]+(Method G).1HNMR (400 MHz, DMSO-d6): δ 8.44-8.46 (m, 1H), 7.90 (d, J = 8 Hz, 1H), 7.60 (s, 1H), 7.20- 7.23 (m, 1H), 6.86 (s, 1H), 2.29 (s, 3H). Synthesis of 7-methylquinoxalin-6-amine

[0219] To a stirred solution of 6-bromo-7-methylquinoxaline (1.5 g, 6.72 mmol), diphenylmethanimine (1.828 g, 10.09 mmol) in toluene (15 mL) was added caesium carbonate (4.38 g, 13.45 mmol). The resulting reaction mixture was further purged with nitrogen over a period of 5 min. To it then RuPhos Pd G3 (0.562 g, 0.672 mmol) was added. The resulting reaction mixture was further purged with nitrogen over a period of 5 mins and stirred at 100 °C for 16 h. The reaction mixture was filtered and concentrated under reduce pressure to afford the crude compound. The crude compound was purified by silica gel flash column chromatography eluting with 10-15% ethyl acetate in pet ether to get 1.5 g of 2 [N-(7- methylquinoxalin-6-yl)-1,1-diphenylmethanimine] as yellow solid. The solid obtained was dissolved in 30 ml of THF. The resulting reaction mixture was acidified with 1.5 N HCl, stirredfor 1h at 25oC and extracted with ethyl acetate (2 x 20 mL). The aqueous layer was basified with aq. NaHCO3 solution and extracted with ethyl acetate (3 x 20 mL). The combined organic layer was dried sodium sulphate, filtered, and concentrated under reduced pressure to afford 7- methylquinoxalin-6-amine (820 mg, 5.14 mmol, 76 % yield) as yellow solid. LCMS: RT=1.627 min; m / z: 160.2 [M+H]+(Method G).1HNMR (400 MHz, DMSO-d6): δ 8.56 (d, J = 4 Hz, 1H), 8.44 (d, J = 4 Hz, 1H), 7.64 (s, 1H), 7.013 (s, 1H), 5.85 (s, 2H), 2.31 (s, 3H). Synthesis of 6-methylbenzo[c][1,2,5]oxadiazol-5-amineStep 1: Synthesis of 6-bromo-5-methylbenzo[c][1,2,5]oxadiazole 1-oxide

[0220] A stirred solution of 4-bromo-5-methyl-2-nitroaniline (2 g, 8.66 mmol) in EtOH (20 mL) was cooled at 0oC. To it a solution of potassium hydroxide (5.4 g, 43.3 mmol) in 5 ml of water was added. Then to the reaction mixture sodium hypochlorite (16.03 mL, 26.0 mmol) was added at 0oC. The resulting reaction mixture was stirred at 25 °C for 2 h. The reaction mixture was filtered. The yellow solid obtained was washed with water. The reaction mixture was extracted with ethyl acetate (3 x 20 mL). The combined organic layer was dried over sodium sulfate, filtered, and concentrated under reduce pressure to afford the crude compound. It was purified by silica gel flash column chromatography eluting with 10-15% ethyl acetate in pet ether to get 6-bromo-5-methylbenzo[c][1,2,5]oxadiazole 1-oxide (840 mg, 3.63 mmol, 41.9 % yield) as a yellow solid. LCMS: RT=2.86 min; m / z: 228.0 (Method G).1H-NMR (400 MHz, DMSO-d6): δ 8.22 (s, 1H), 7.71 (s, 1H), 2.42 (s, 3H). Step 2: Synthesis of 5-bromo-6-methylbenzo[c][1,2,5]oxadiazole

[0221] To a stirred solution of 6-bromo-5-methylbenzo[c][1,2,5]oxadiazole 1-oxide (840 mg, 3.24 mmol) in ethanol (8 mL) was added triethyl phosphite (0.840 mL, 4.85 mmol). The resulting reaction mixture was stirred at 75 °C for 20 h. The reaction mixture was quenched with water. The solid precipitated out was filtered and dried under vacuum to afford 5-bromo- 6-methylbenzo[c][1,2,5]oxadiazole (480 mg, 2.141 mmol, 66.1 % yield) as a yellow solid.1HNMR (400 MHz, DMSO-d6): δ 8.57 (s, 1H), 8.080-8.088 (m, 1H), 2.49 (s, 3H). Step 3: Synthesis of 6-methylbenzo[c][1,2,5]oxadiazol-5-amine.To a stirred solution of 5-bromo-6-methylbenzo[c][1,2,5]oxadiazole (480 mg, 2.253 mmol) and Copper(I) oxide (64.5 mg, 0.451 mmol) in NMP (4.8 mL) was added aq. ammonium solution (2.9 mL). The resulting reaction mixture was stirred at 150 °C for 1 h under microwave. The reaction mixture was quenched with ice-cold water and extracted with ethyl acetate (3 x 20 mL). The combined organic layer was dried over sodium sulfate, filtered, and concentrated under reduce pressure to afford the crude compound. The crude compound was purified by silica gel flash column chromatography eluting with 0-20% ethyl acetate in pet ether to 6-methylbenzo[c][1,2,5]oxadiazol-5-amine (110 mg, 0.713 mmol, 31.6 % yield) as a yellow solid. LCMS: RT: 1.929 min; m / z: 150.2 [M+H]+(Method H).1HNMR (400 MHz, DMSO-d6): δ 7.628 (d, J = 0.4 Hz, 1H), 6.47 (s, 1H), 6.19 (s, 1H), 2.27 (s, 3H).

[0222] Synthesis of 7-methylcinnolin-6-amine Step 1: Synthesis of Methyl 2-bromo-5-(tert-butoxycarbonyl) amino)-4-methylbenzoate

[0223] To a stirred solution of methyl 5-amino-2-bromo-4-methylbenzoate (10 g, 41.0 mmol) in EtOH (100 mL) was added di-tert-butyl dicarbonate (35.8 g, 164 mmol). The resulting reaction mixture was stirred at 25 °C for 48 h. The reaction mixture was concentrated under reduced pressure, diluted with ethyl acetate (100 mL) and washed with water (50 ml). The aqueous layer was re-extracted with ethyl acetate (2 x 50 mL). The combined organic layer was dried over sodium sulfate, filtered, and concentrated under reduce pressure to afford the crude compound. The crude compound was purified by silica gel flash column chromatography eluting with 20-25% ethyl acetate in pet ether to afford methyl 2-bromo-5-((tert- butoxycarbonyl)amino)-4-methylbenzoate (12.4 g, 36.0 mmol, 88 % yield) as a white solid. LCMS: RT=3.587 min; m / z: 344 [M+H]+(Method G).1HNMR (400 MHz, DMSO-d6): δ 8.74 (s, 1H), 7.88 (s, 1H), 7.58 (d, J = 0.4 Hz, 1H), 3.84 (s, 3H), 2.24 (s, 3H), 1.47 (s, 9H).

[0224] Step 2: Synthesis of tert-butyl (4-bromo-5-(hydroxymethyl)-2-methylphenyl) carbamate:

[0225] A stirred solution of methyl 2-bromo-5-((tert-butoxycarbonyl)amino)-4- methylbenzoate (5 g, 14.53 mmol) in DCM (50 mL) was cooled at -78oC. To it Diisobutylaluminum hydride solution in THF (131 mL, 131 mmol) was added. The resulting reaction mixture was stirred at -78 °C for 3 h. The reaction mixture was quenched with 10 of methanol. The reaction mixture was acidified with 50 mL of 1.5 M HCl and extracted with diethyl ether (2 x 50 mL). The combined organic layer was dried over sodium sulfate, filtered and concentrated under reduce pressure to afford tert-butyl (4-bromo-5-(hydroxymethyl)-2- methylphenyl)carbamate (3.9 g, 11.91 mmol, 82 % yield) as an off-white solid. LCMS: RT=2.37 min; m / z: 314 [M-H]- (Method G).1HNMR (400 MHz, DMSO-d6): δ 8.56 (s, 1H), 7.52 (s, 1H), 7.36 (s, 1H), 5.35 (t, J = 5.6 Hz, 1H), 4.43 (d, J = 5.6 Hz, 2H), 2.16 (s, 3H), 1.45 (s, 9H).

[0226] Step 3: Synthesis of tert-butyl (4-bromo-5-formyl-2-methylphenyl)carbamate:

[0227] A stirred solution of tert-butyl (4-bromo-5-(hydroxymethyl)-2- methylphenyl)carbamate (3.9 g, 11.77 mmol) in DCM (40 mL) was cooled at 0oC. To it DMP (7.44 g, 17.54 mmol) was added. After complete addition the reaction mixture was gradually brought to 25oC. The resulting reaction mixture was stirred at 25 °C for 2 h. The reaction mixture was quenched with sodium bicarbonate solution and extracted with DCM (2 x 50 ml). The combined organic layer was dried over sodium sulfate, filtered and concentrated under reduce pressure to afford the crude compound. The crude compound was purified by silica gel flash column chromatography eluting with 10-15% ethyl acetate in pet ether to afford tert-butyl (4-bromo-5-formyl-2-methylphenyl)carbamate (3.1 g, 9.44 mmol, 80 % yield) as off white solid. LCMS: RT=2.21 min; m / z: 312 [M-H]- (Method G).1H-NMR (400 MHz, DMSO-d6): δ 10.13 (s, 1H), 8.80 (s, 1H), 7.95 (s, 1H), 7.64 (s, 1H), 2.29 (s, 3H), 1.48 (s, 9H).

[0228] Step 4: Synthesis of tert-butyl (Z)-(4-bromo-5-(2-bromovinyl)-2-methylphenyl) carbamate:

[0229] A stirred solution of (Bromomethyl)triphenylphosphonium bromide (9.66 g, 22.15 mmol) in THF (60 mL) was cooled at -78oC. To it potassium tert-butoxide (2.486 g, 22.15mmol) was added portionwise. Then to it a solution of tert-butyl (4-bromo-5-formyl-2- methylphenyl) carbamate (5.8 g, 18.46 mmol) in THF (5 mL) was added dropwise at -78oC. The resulting reaction mixture was gradually brought to 25 °C and stirred for 16 h. The reaction mixture was quenched with water and extracted with ethyl acetate (3 x 50 mL). The combined organic layer was dried over sodium sulfate, filtered and concentrated under reduce pressure to afford the crude compound. The crude compound was purified by silica gel flash column chromatography eluting with 10-15% ethyl acetate in pet ether to afford tert-butyl (Z)-(4- bromo-5-(2-bromovinyl)-2-methylphenyl)carbamate (4.3 g, 10.44 mmol, 56.6 % yield) as off white solid. LCMS: RT=3.52 min and 3.81 min; m / z: 389.9 and 390 [M-H]- (Method G).1H- NMR (400 MHz, DMSO-d6): δ 8.64 (s, 1H), 7.74 (s, 1H), 7.51 (s, 1H), 7.19-7.24 (m, 1H), 6.87 (d, J = 8 Hz, 1H), 2.17 (s, 3H), 1.46 (s, 9H).

[0230] Step 5: Synthesis of diethyl 6-((tert-butoxycarbonyl)amino)-7-methylcinnoline- 1,2-dicarboxylate:

[0231] To a stirred solution of tert-butyl (Z)-(4-bromo-5-(2-bromovinyl)-2- methylphenyl)carbamate (3.5 g, 8.95 mmol) in dioxane (10 mL) were added potassium carbonate (3.09 g, 22.37 mmol) and diethyl 1,2-hydrazinedicarboxylate (2.365 g, 13.42 mmol) at 25oC. The resulting reaction mixture was purged with nitrogen over a period of 5 min. To the reaction mixture N,N-dimethylethylenediamine (0.394 g, 4.47 mmol) and copper(I) iodide (0.426 g, 2.237 mmol) were added. The resulting reaction mixture was further purged with nitrogen over a period of 5 mins and stirred at 100 °C for 18 h. The reaction mixture was diluted with water (20 mL) and extracted with ethyl acetate (3 x 50 mL). The combined organic layer was dried over sodium sulfate, filtered, and concentrated under reduce pressure to afford the crude compound. The crude compound was purified by silica gel flash column chromatography eluting with 8-10% ethyl acetate in pet ether to afford diethyl 6-((tert-butoxycarbonyl)amino)- 7-methylcinnoline-1,2-dicarboxylate (1.2 g, 2.90 mmol, 32.4 % yield) as white solid. LCMS: RT=2.18 min; m / z: 406.2. (Method G).1H-NMR (400 MHz, DMSO-d6): δ 8.57 (s, 1H), 7.24 (s, 1H), 7.18 (s, 1H), 7.1 (s, 1H), 6.29 (d, J = 6.8 Hz, 1H), 4.12-4.21 (m, 4H), 2.21 (s, 3H), 1.46 (s, 9H), 1.15-1.24 (m, 6H).Step 6: Synthesis of tert-butyl (7-methylcinnolin-6-yl) carbamate:

[0232] To a stirred solution of diethyl 6-((tert-butoxycarbonyl)amino)-7-methylcinnoline- 1,2-dicarboxylate (700 mg, 1.726 mmol) in Ethanol (8 mL) was added 2M aq. NaOH solution (2 mL) at 25oC. The resulting reaction mixture was stirred at 25oC over a period of 18 h. The reaction mixture was concentrated under reduced pressure, diluted with saturated solution of sodium bicarbonate solution and extracted with ethyl acetate (3 x 50 mL). The combined organic layer was dried over sodium sulfate, filtered, and concentrated under reduce pressure to afford the crude compound. The crude compound was purified by silica gel flash column chromatography eluting with 0-50% ethyl acetate in petroleum ether to afford tert-butyl (7- methylcinnolin-6-yl)carbamate (350 mg, 1.309 mmol, 76 % yield) as a brown solid. LCMS: RT: 2.07 min; m / z: 260.2. (Method G).1H-NMR (400 MHz, DMSO-d6): δ 9.19 (d, J = 5.6 Hz, 1H), 8.9 (s, 1H), 8.23 (d, J = 8.8 Hz, 2H), 8.09 (d, J = 6 Hz, 1H), 2.54 (s, 3H), 1.53 (s, 9H). Step 7: Synthesis of 7-methylcinnolin-6-amine

[0233] To a stirred solution of tert-butyl (7-methylcinnolin-6-yl)carbamate (350 mg, 1.350 mmol) in MeOH (10 mL) was added 5 mL of 4M HCl in dioxane at 25oC. The resulting reaction mixture was stirred at 25oC over a period of 16 h. The reaction mixture was concentrated under reduced pressure. The crude obtained was triturated with diethyl ether and dried under vacuum. The solid obtained was dissolved in 20 ml of DCM and neutralized with saturated solution of sodium bicarbonate solution. DCM layer was separated, and aqueous layer was re-extracted with DCM (2 x 15 mL). The combined organic layer was dried over sodium sulfate, filtered, and concentrated under reduced pressure to afford 7-methylcinnolin-6-amine (219 mg, 1.343 mmol, 100 % yield) as a yellow solid. LCMS: RT=1.92 min; m / z: 160.1 [M+H]+(Method I).1H-NMR (400 MHz, DMSO-d6): δ 8.82 (d, J = 6 Hz, 1H), 7.96 (s, 1H), 7.63 (d, J = 6 Hz, 1H), 6.72 (s, 1H), 6.17 (s, 2H), 2.34 (s, 3H).Synthesis of 7-methylquinazolin-6-amine

[0234] Step 1: Synthesis of 5-chloroquinazolin-6-amine

[0235] To a stirred solution of quinazolin-6-amine (2 g, 13.78 mmol) in DCM (20 mL) was added NCS (1.840 g, 13.78 mmol). Then the reaction mixture was stirred under 25 °C for 16 h. The reaction mixture was quenched with 20 mL of water and extracted with DCM (2 x 30 mL). The combined organic layer was dried over sodium sulfate, filtered, and reduced under pressure to get the crude product. It was purified by silica gel flash column chromatography eluting with 20-25% ethyl acetate in petroleum ether to afford 5-chloroquinazolin-6-amine (2.3 g, 11.53 mmol, 84 % yield) as a yellow solid.1H-NMR (400 MHz, DMSO-d6): δ 9.41 (d, J = 0.40 Hz, 1H), 9.03 (s, 1H), 7.75 (d, J = 9.20 Hz, 1H), 7.60 (d, J = 9.20 Hz, 1H), 6.28 (s, 2H).

[0236] Step 2: Synthesis of 7-bromo-5-chloroquinazolin-6-amine

[0237] To a stirred solution of 5-chloroquinazolin-6-amine (1.5 g, 8.35 mmol) in DCM (20 mL) was added NBS (1.556 g, 8.74 mmol). Then the reaction mixture was stirred under 25 °C for 16 h. The reaction mixture was quenched with 20 ml of water and extracted with DCM (2 x 30 mL). The combined organic layer was dried over sodium sulphate, filtered and reduced under pressure to get the crude product. The crude product was purified by silica gel flash column chromatography eluting with 20-25% ethyl acetate in petroleum ether to afford 7- bromo-5-chloroquinazolin-6-amine (250 mg, 0.890 mmol, 10.65 % yield) as a brown solid. LCMS: RT: 1.51 min, m / z: 260 [M+H]+(Method G).1H-NMR (400 MHz, DMSO-d6): δ 9.49 (d, J = 0.80 Hz, 1H), 9.1 (s, 1H), 8.25 (s, 1H), 6.28 (s, 2H).

[0238] Step 3: Synthesis of 5-chloro-7-methylquinazolin-6-amine

[0239] To a stirred solution of 7-bromo-5-chloroquinazolin-6-amine (250 mg, 0.967 mmol) in THF (8 mL) were added potassium carbonate (267 mg, 1.934 mmol) and trimethylboroxine in THF (1.637 mL, 5.80 mmol). Then the reaction mixture was purged with nitrogen over a period of 5 mins. To it then tetrakis(triphenylphosphine)palladium(0) (101 mg, 0.087 mmol) was added. The reaction mixture further purged with nitrogen over a period of 5 min and stirred at 80 °C for 18 h. The reaction mixture was quenched with 20 mL of water and extracted with ethyl acetate (2 x 30 mL). The combined organic layer was dried over sodium sulfate, filtered, and reduced under pressure to get the crude product. The crude product was purified by silica gel flash column chromatography eluting with 20-25% ethyl acetate in petroleum ether to afford 5-chloro-7-methylquinazolin-6-amine (190 mg, 0.916 mmol, 95 % yield) as a brown solid. LCMS: RT: 1.31 min, m / z: 194.0 [M+H]+(Method G).1H-NMR (400 MHz, DMSO- d6): δ 9.38 (d, J = 0.80 Hz, 1H), 9.023 (s, 1H), 7.69 (s, 1H), 6.01 (s, 2H), 2.43 (s, 3H).

[0240] Step 4: Synthesis of 7-methylquinazolin-6-amine.

[0241] To a stirred solution of 5-chloro-7-methylquinazolin-6-amine (75 mg, 0.387 mmol) in DMF (7.5 mL) was added sodium formate (263 mg, 3.87 mmol). Then the reaction mixture was purged with nitrogen over a period of 5 min. To it then [1,1-bis(diphenylphosphino)ferrocene]dichloropalladium(II), complex with dichloromethane (190 mg, 0.232 mmol) was added. The resulting reaction mixture was further purged with nitrogen over a period of 5 min and stirred at 100 °C for 48 h. The reaction mixture was quenched with 20 ml of water and extracted with ethyl acetate (2 x 30 mL). The combined organic layer was dried over sodium sulphate, filtered and reduced under pressure to get the crude product. It was purified by silica gel flash column chromatography eluting with 80-90% ethyl acetate in petroleum ether to afford 7-methylquinazolin-6-amine (27 mg, 0.129 mmol, 33.3 % yield) as a brown solid. LCMS: RT=2.18 min, m / z: 160.2 [M+H]+(Method G).1H-NMR (400 MHz, DMSO-d6): δ 9.15 (s, 1H), 8.87 (s, 1H), 7.63 (s, 1H), 6.97 (s, 1H), 5.71 (s, 2H), 2.34 (s, 3H). Example 1. 3-[1-(2,2-Difluoroethyl)-1H-pyrazol-4-yl]-5-({7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6- yl}amino)-2H,3H-[1,3]oxazolo[4,5-d]pyrimidin-2-one (Compound 17)

[0242] Step 1: Synthesis of 2,4-Dichloro-5-((4-methoxybenzyl)oxy)pyrimidine (1.2).

[0243] To a stirred solution of 2,4-dichloropyrimidin-5-ol (1.0 g, 6.06 mmol) in acetone (15 mL) was added potassium carbonate (2.094 g, 15.15 mmol) followed by the addition of 4- methoxybenzyl chloride (1.228 mL, 9.09 mmol) and sodium iodide (0.091 g, 0.606 mmol). The resulting reaction mixture was stirred at 25 °C for 16 h. The reaction mixture was filtered through Buchner funnel. The solid obtained was washed with ethyl acetate (25 mL). The filtrate was concentrated under vacuum. The crude compound obtained was purified by silica gel (60- 120 mesh) flash column chromatography eluting with 0-20% ethyl acetate in petroleum ether to get 2,4-dichloro-5-((4-methoxybenzyl)oxy)pyrimidine (1.3 g, 4.29 mmol, 70.7% yield) as a white solid. LCMS: RT = 1.49 min, m / z: 285 [M+H]+(UPLCMS Method C);1H NMR (400 MHz, DMSO-d6) ^ 8.73 (s, 1H), 7.41 (d, J = 8Hz, 2H), 6.98 (d, J=8Hz, 2H), 5.28 (s, 2H), 3.77 (s, 3H).

[0244] Step 2: Synthesis of 2-chloro-N-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5-((4- methoxybenzyl)oxy)pyrimidin-4-amine (1.3).

[0245] In a 20-ml glass vial, 2,4-dichloro-5-((4-methoxybenzyl)oxy)pyrimidine (200 mg, 0.701 mmol) was taken and to it 1-(2,2-difluoroethyl)-1H-pyrazol-4-amine (114 mg, 0.772 mmol) and 2-propanol (3 mL) was added. To the reaction mixture was added DIPEA (0.368 mL, 2.104 mmol). The reaction mixture was stirred 100 °C for 16 h. After cooling, the reaction mixture was concentrated under vacuum. The resulting crude was purified by column chromatography using silica gel (60-120 mesh) and 0-70% of ethyl acetate / cyclohexane. Upon concentrating the pure fractions gave the desired compound (240 mg, 76% yield). LCMS: RT = 1.27 min, m / z: 396 [M+H]+(UPLCMS Method D).1H NMR (400 MHz, DMSO-d6): 8.10 (s, 1H), 7.91 (s, 1H), 7.83 (s, 1H), 7.46 (d, J = 8Hz, 2H), 6.97 (d, J=8Hz, 2H), 6.34 (tt, J=, 1H), 5.22 (s, 2H), 4.64 (t,d, J = Hz, 2H), 3.76 (s, 3H).

[0246] Step 3: Synthesis of N4-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5-((4- methoxybenzyl)oxy)-N2-(7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl)pyrimidine-2,4- diamine (1.4).

[0247] To a solid mixture of 2-chloro-N-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5-((4- methoxybenzyl)oxy)pyrimidin-4-amine (50 mg, 0.126 mmol) and 7-methyl- [1,2,4]triazolo[1,5-a]pyridin-6-amine (28.1 mg, 0.189 mmol) was added BrettPhos Pd G3 (22.90 mg, 0.025 mmol) and cesium carbonate (103 mg, 0.316 mmol) followed by 1,4-dioxane (4 mL). The resultant reaction mixture was purged with nitrogen gas for 5 min and capped. The resulting reaction mixture was heated at 100°C for 8 h. It was concentrated under vacuum andpurified with silica gel column chromatography using 60-120 silica gel mesh and 0-10% MeOH / DCM. The pure fractions were concentrated to give N4-(1-(2,2-difluoroethyl)-1H- pyrazol-4-yl)-5-((4-methoxybenzyl)oxy)-N2-(7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6- yl)pyrimidine-2,4-diamine (30 mg, 44.9 % yield). LC-MS: RT = 0.92 min, m / z: 508.2 [M+H]+(UPLCMS Method D).

[0248] Step 4: Synthesis of 4-((1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)amino)-2-((7- methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl)amino)pyrimidin-5-ol, TFA (1.5).

[0249] To a 0 °C cooled stirred solution of N4-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5- ((4-methoxybenzyl)oxy)-N2-(7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl)pyrimidine-2,4- diamine (30 mg, 0.059 mmol) in DCM (3 mL) was added TFA (0.1 mL, 1.298 mmol). The resulting reaction mixture was stirred at 25 °C for 2 h. It was concentrated under vacuum to get crude 4-((1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)amino)-2-((7-methyl-[1,2,4]triazolo[1,5- a]pyridin-6-yl)amino)pyrimidin-5-ol, TFA (50 mg, 0.044 mmol, 74.2 % yield) which was used for the next step without further purification. LC-MS: RT = 0.56 min, m / z: 388.2 [M+H]+(UPLCMS Method D).

[0250] Step 4: Synthesis of 3-[1-(2,2-Difluoroethyl)-1H-pyrazol-4-yl]-5-({7-methyl- [1,2,4]triazolo[1,5-a]pyridin-6-yl}amino)-2H,3H-[1,3]oxazolo[4,5-d]pyrimidin-2-one (Compound 17)

[0251] To a stirred solution of 2, 4-((1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)amino)-2-((7- methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl)amino)pyrimidin-5-ol, TFA (50 mg, 0.100 mmol) in THF (3 mL) was added DIPEA (0.087 mL, 0.499 mmol) followed by CDI (24.26 mg, 0.150 mmol). The resulting reaction mixture was stirred at 65 °C for 3 h. The reaction mixture was purified by RP PREP HPLC purification. Prep HPLC purification method: Diluent: THF: water: ACN (40:20:40), Column: X-Select C18(19 x150) mm, 5 micron, Temperature: Ambient, Mobile phase A: 5mM Ammonium Formate in water, Mobile phase B: CH3CN, Flow: 15 mL / min, Time / Grad: 0 / 20 ,12 / 60. The pure fractions were concentrated to afford 3- (1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5-((7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6- yl)amino)oxazolo[4,5-d]pyrimidin-2(3H)-one (13.85 mg, 0.033 mmol, 32.7 % yield) was obtained as a white solid. LCMS: RT = 1.55 min; m / z: 414.0 [M+H]+(LCMS method G). HPLC Purity: 97.39 %, RT = 3.88 min (Analytical HPLC A).1H NMR (400 MHz, DMSO-d6): δ 9.15 (s, 1H), 9.07 (s, 1H), 8.41 (s, 1H), 8.33 (d, J = 6.40 Hz, 2H), 8.03 (d, J = 0.40 Hz, 1H), 7.74 (s, 1H), 6.41 (br t, J = 54.40 Hz, 1H), 4.68-4.77 (m, 2H), 2.38 (s, 3H).Example 2. 3-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5-((6-methylbenzo[c][1,2,5]thiadiazol-5- yl)amino)oxazolo[4,5-d]pyrimidin-2(3H)-one (Compound 18)(Compound 18)

[0252] Example 2 was obtained using procedures similar to those employed in Example 1. LC-MS: RT = 2.71 min, m / z: 431.0 [M+H]+(LCMS Method G). HPLC purity: 97.9 %, RT = 7.17 min (Analytical HPLC A).1H NMR (400 MHz, DMSO-d6): δ 9.06 (s, 1H), 8.47 (s, 1H), 8.45 (s, 1H), 8.39 (s, 1H), 8.13 (s, 1H), 7.95 (s, 1H), 6.42 (tt, J =54.8, 3.6 Hz, 1H), 4.73 (dt, J = 15.2, 3.6 Hz, 2H) (One CH3peak overlapping with solvent residue). Example 3. 9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7-methyl-2-((7-methyl-[1,2,4] triazolo [1,5-a] pyridin-6-yl)amino)-7,9-dihydro-8H-purin-8-one (Compound 19)(Compound 19)

[0253] Step 1: Synthesis of ethyl 2-chloro-4-((1-(2,2-difluoroethyl)-1H-pyrazol-4-yl) amino) pyrimidine-5-carboxylate (3.3)

[0254] To a stirred solution of ethyl 2,4-dichloropyrimidine-5-carboxylate (300 mg, 1.357 mmol) in acetonitrile (25 mL) was added DIPEA (711 µL, 4.07 mmol). The resulting reaction mixture was stirred at 25 °C for 5 min followed by the addition of 1-(2,2-difluoroethyl)-1H- pyrazol-4-amine (180 mg, 1.222 mmol). The resulting reaction mixture was stirred at 25 °C for 16 h. The reaction was diluted with water (10 mL) and extracted with EtOAc (2 x 25 mL). The combined organic fractions was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to afford the crude product which was purified by flash chromatography using silica gel using EtOAc in petroleum ether as a mobile phase (20% to 25%) to afford ethyl 2-chloro-4-((1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)amino)pyrimidine-5-carboxylate (346 mg, 0.960 mmol, 70.7% yield) as a pale pink solid. LCMS: RT = 2.29 min; m / z: 332.1 [M+H]+(LCMS Method G).1H NMR (400 MHz, DMSO-d6): δ 10.14 (s, 1H), 8.75 (s, 1H), 8.19 (s, 1H), 7.87 (s, 1H), 6.36 (tt, J = 54.8, 3.6 Hz, 1H), 4.67 (dt, J = 15.2, 3.6 Hz, 2H), 4.38 (q, J = 7.2 Hz, 2H), 1.36 (t, J = 6.8 Hz, 3H).

[0255] Step 2: Synthesis of 2-chloro-4-((1-(2,2-difluoroethyl)-1H-pyrazol-4- yl)amino)pyrimidine-5-carboxylic acid (3.4).

[0256] To a stirred solution of ethyl 2-chloro-4-((1-(2,2-difluoroethyl)-1H-pyrazol-4- yl)amino)pyrimidine-5-carboxylate (346 mg, 1.043 mmol) in THF (4 mL) and Water (2 mL) was added lithium hydroxide monohydrate (109 mg, 2.61 mmol). The resulting reaction mixture was stirred at 25 °C for 3 h. The reaction mixture was concentrated under reduced pressure. The resulting reaction mixture was diluted with 3 mL of water and acidified with 1.5 N HCl till pH 2. The solid obtained was filtered through Buchner funnel, washed with water and dried under vacuum to get the crude. The solid was triturated with pet ether and dried under vacuum to afford 2-chloro-4-((1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)amino)pyrimidine-5- carboxylic acid (280 mg, 0.821 mmol, 79% yield) as white solid. LCMS: RT = 2.08 min; m / z: 304.0 [M+H]+(LCMS Method G).1HNMR (400 MHz, DMSO-d6): δ 14.01 (s, 1H), 10.36 (s, 1H), 8.71 (s, 1H), 8.19 (s, 1H), 7.84 (s, 1H), 6.36 ( tt, J = 3.6 Hz, J = 55.20 Hz, 1H), 4.66 (dt, , J = 4 Hz, J = 15.2 Hz, 2H).

[0257] Step 3: Synthesis of 2-chloro-9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7,9- dihydro-8H-purin-8-one (3.5).

[0258] To a stirred solution of 2-chloro-4-((1-(2,2-difluoroethyl)-1H-pyrazol-4- yl)amino)pyrimidine-5-carboxylic acid (50 mg, 0.165 mmol) in 1,4-dioxane (1 mL) was added TEA (0.025 mL, 0.181 mmol). The reaction mixture was stirred at 25oC for 5 min followed by the addition of Diphenyl phosphoryl azide (0.036 mL, 0.165 mmol). The resulting reaction mixture was stirred at 100oC over a period of 16 h. The reaction mixture was concentrated under reduced pressure and the residue obtained was purified by flash silica gel chromatography using EtOAc in petroleum ether as a mobile phase (0% to 80%) to afford 2- chloro-9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7,9-dihydro-8H-purin-8-one (28 mg, 0.079 mmol, 48.1 % yield) as off white solid. LCMS: RT = 0.886 min; m / z: 299 [M-H]- (UPLCMS Method D).

[0259] Step 4: Synthesis of 2-chloro-9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7- methyl-7,9-dihydro-8H-purin-8-one (3.6)

[0260] To a stirred solution of 2-chloro-9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7,9- dihydro-8H-purin-8-one (50 mg, 0.166 mmol) in THF (4 mL) and water (2 mL) was added sodium hydroxide (19.95 mg, 0.499 mmol) followed by methyl iodide (0.031 mL, 0.499 mmol). The resulting reaction mixture was stirred at 25 °C for 4 h. The reaction mixture was diluted with water (5 mL) and extracted with EtOAc (2 x 10 mL). The combined organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to afford the crude 2-chloro-9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7-methyl-7,9-dihydro- 8H-purin-8-one (50 mg, 0.132 mmol, 79 % yield) as a brown solid. LCMS: RT=0.97 min; m / z: 315.0 [M+H]+(UPLCMS Method D).

[0261] Step 5: Synthesis of 9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7-methyl-2-((7- methyl-[1,2,4] triazolo [1,5-a] pyridin-6-yl)amino)-7,9-dihydro-8H-purin-8-one (Compound 19)

[0262] To a stirred solution of 2-chloro-9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7-methyl- 7,9-dihydro-8H-purin-8-one (25 mg, 0.079 mmol) in 1,4-dioxane (1 mL) were added 7-methyl- [1,2,4]triazolo[1,5-a]pyridin-6-amine (17.66 mg, 0.119 mmol) and caesium carbonate (64.7 mg, 0.199 mmol). The resulting reaction mixture was degassed with a stream of nitrogen gas over a period of 5 min. To the resulting reaction mixture Pd2(dba)3 (14.55 mg, 0.016 mmol) and 1,1'-bis(dicyclohexylphosphino)ferrocene (9.19 mg, 0.016 mmol) were added. The reaction mixture was further degassed with a stream of nitrogen gas for 5 min and stirred at 100 °C for 2 h under microwave. The reaction mixture was purified by preparative HPLC. RP PREP HPLC conditions: Column: XBridge-C18 (150x19) mm, 5 micron, Diluent: THF: H2O:ACN (40:10:40), Temperature: ambient, Mobile phase A: 5mM ammonium formate in H2O, Mobile phase B: acetonitrile, Flow rate: 15mL / min, Time / Grad: 0 / 20, 7 / 60. The pure fractions were collected and concentrated under reduced pressure to afford 9-(1-(2,2- difluoroethyl)-1H-pyrazol-4-yl)-7-methyl-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6- yl)amino)-7,9-dihydro-8H-purin-8-one (8.8 mg, 0.020 mmol, 25.5 % yield) as an off-white solid. LCMS: RT = 1.66 min; m / z: 448.2 [M+H]+(UPLCMS Method C). HPLC Purity: 98.2 %, RT = 5.128 min (Analytical HPLC A).1H NMR (400 MHz, DMSO-d6): δ 9.16 (s, 1H), 8.8 (s, 1H), 8.37 (d, J = 10.00 Hz, 2H), 8.22 (s, 1H), 8.10 (s, 1H), 7.72 (s, 1H), 6.39 (tt, J = 3.6 Hz, J = 56 Hz, 1H), 4.67 (dt, J = 3.6 Hz, J = 15.2 Hz 2H), 3.38 (s, 3H), 2.40 (s, 3H).

[0263] Examples 4-6 were obtained using procedures similar to those employed in Example 3.Example 7. -(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7-methyl-2-((7-methylquinoxalin-6-yl)amino)- 7,9-dihydro-8H-purin-8-one (Compound 23)

[0264] Step 1: Synthesis of Ethyl 4-((1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)amino)-2- (methylthio) pyrimidine-5-carboxylate (7.3): To a stirred solution of ethyl 4-chloro-2- (methylthio)pyrimidine-5-carboxylate (1.0 g, 4.30 mmol) in acetonitrile (25 mL) was added DIPEA (2.252 mL, 12.89 mmol) followed by the addition of 1-(2,2-difluoroethyl)-1H-pyrazol- 4-amine (0.632 g, 4.30 mmol). The resulting reaction mixture was stirred at 25 °C for 16 h. The reaction mixture was concentrated under reduced pressure till dryness to afford the crude which was purified by silica gel flash column chromatography using ethyl acetate in petroleum ether (0-80%) as a mobile phase to afford ethyl 4-((1-(2,2-difluoroethyl)-1H-pyrazol-4- yl)amino)-2-(methylthio)pyrimidine-5-carboxylate (760 mg, 2.201 mmol, 51.2% yield) as an off-white solid. LCMS: RT = 2.76 min; m / z: 344 [M+H]+(Method G).1H NMR (400 MHz, DMSO-d6): δ 10.03 (s, 1H), 8.67 (s, 1H), 8.19 (s, 1H), 7.84 (d, J = 0.4 Hz, 1H), 6.36 (tt, J = 54.8, 3.6 Hz, 1H), 4.63 (dt, J = 15.2, 3.6 Hz 2H), 4.35 (q, J = 7.20 Hz, 2H), 2.55 (s, 3H), 1.34 (t, J = 7.20 Hz, 3H).

[0265] Step 2: Synthesis of 4-((1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)amino)-2- (methylthio)pyrimidine-5-carboxylic acid (7.4). To a stirred solution of ethyl 4-((1-(2,2- difluoroethyl)-1H-pyrazol-4-yl)amino)-2-(methylthio)pyrimidine-5-carboxylate (760 mg, 2.213 mmol) in THF (5 mL) and H2O (5 mL) was added Lithium hydroxide monohydrate (186 mg, 4.43 mmol). The resulting reaction mixture was stirred at 25 °C for 6 h. The reaction mixture was concentrated under reduced pressure to remove THF. The resulting mixture was acidified with 1.5 N HCl. The solid obtained was filtered through Buchner funnel, washed with 5 mL of water and dried under vacuum to get 4-((1-(2,2-difluoroethyl)-1H-pyrazol-4- yl)amino)-2-(methylthio)pyrimidine-5-carboxylic acid (630 mg, 1.986 mmol, 90 % yield) as a white solid. LCMS: RT=1.731 min; m / z: 316.0 [M+H]+(Method H).1HNMR (400 MHz, DMSO-d6): δ 13.58 (s, 1H), 10.27 (s, 1H), 8.64 (s, 1H), 8.19 (s, 1H), 7.82 (s, 1H), 6.35 (tt, J = 54.8, 3.6 Hz, 1H), 4.63 (dt, J = 15.2, 3.6 Hz, 2H), 2.55 (s, 3H).

[0266] Step 3: Synthesis of 9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-2-(methylthio)- 7,9-dihydro-8H-purin-8-one (7.5). To a stirred solution of 4-((1-(2,2-difluoroethyl)-1H- pyrazol-4-yl)amino)-2-(methylthio)pyrimidine-5-carboxylic acid (630 mg, 1.998 mmol) in 1,4-dioxane (15 mL) was added triethylamine (0.334 mL, 2.398 mmol). The reaction mixture was then added diphenyl phosphoryl azide (605 mg, 2.198 mmol). The resulting reaction mixture was stirred at 25 °C for 1 h followed by stirring at 100 °C over a period of 16 h. The reaction mixture was concentrated under vacuum and purified by RP purification [Diluent: THF: Acetonitrile (50:50), Column: Redisep 150 g C18, 20-40 micron, Mobile phase A: 5mM Ammonium formate in water, Mobile phase B: Acetonitrile, Teledyne Isco-Combi flash, Compound elution (%) 40%Acetonitrile / 5mM Ammonium formate in water Flow Rate: 60ml / min ] to get 9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-2-(methylthio)-7,9-dihydro-8H- purin-8-one (550 mg, 1.714 mmol, 86 % yield) as a white solid. LCMS: RT = 1.46 min; m / z: 313.2 [M+H]+(Method G).1HNMR (400 MHz, DMSO-d6): δ: 11.31 (s, 1H), 8.41 (s, 1H), 8.21 (s, 1H), 8.15 (d, J = 0.8 Hz, 1H), 6.41 (tt, J = 54.8, 4.0 Hz, 1H), 4.75 (dt, J = 14.8, 4.0 Hz, 2H), 2.54 (s, 3H).

[0267] Step 4: Synthesis of 9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7-methyl-2- (methylthio)-7,9-dihydro-8H-purin-8-one (7.6). To a stirred solution of 9-(1-(2,2- difluoroethyl)-1H-pyrazol-4-yl)-2-(methylthio)-7,9-dihydro-8H-purin-8-one (200 mg, 0.640 mmol) in THF (3 mL) and Water (2 mL) was added sodium hydroxide (128 mg, 3.20 mmol) followed by the addition of iodomethane (0.200 mL, 3.20 mmol). The resulting reaction mixture was stirred at 25 °C for 5 h. The reaction mixture was concentrated under reduced pressure to remove THF. Solid formed was collected by filtration through Buchner funnel anddried under vacuum to afford 9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7-methyl-2- (methylthio)-7,9-dihydro-8H-purin-8-one (170 mg, 0.518 mmol, 81 % yield) as a white solid. LCMS: RT = 1.91 min; m / z: 327 [M+H]+(Method G).1H NMR (400 MHz, DMSO-d6): δ: 8.41 (s, 2H), 8.13 (s, 1H), 6.41 (tt, J = 54.8, 4.0 Hz, 1H), 4.75 (dt, J = 15.2, 3.6 Hz, 2H), 3.40 (s, 3H), 2.55 (s, 3H).

[0268] Step 5: Synthesis 9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7-methyl-2- (methylsulfonyl)-7,9-dihydro-8H-purin-8-one (7.7): To stirred solution of 9-(1-(2,2- difluoroethyl)-1H-pyrazol-4-yl)-7-methyl-2-(methylthio)-7,9-dihydro-8H-purin-8-one (170 mg, 0.521 mmol) in THF (3 mL) and water (3 mL) at 0 °C was added Oxone, and monopersulfate compound (961 mg, 1.563 mmol). The reaction mixture was warmed to 25 °C and stirred 3 h. The reaction mixture was filtered through Buchner funnel to collect the solid formed. The solid obtained was washed with 30 mL of 10% MeOH / DCM. The combined filtrate was concentrated under vacuum and purified by RP purification [Diluent: THF:Water:ACN(50:20:30), Column: Redisep 80g C18, 20-40 micron, Mobile phase A: 5mM Ammonium formate in water, Mobile phase B: acetonitrile, Teledyne Isco-Combi flash, Compound elution (%): 28% acetonitrile / 5 mM Ammonium formate in water Flow Rate: 40ml / min] to afford 9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7-methyl-2-(methylsulfonyl)- 7,9-dihydro-8H-purin-8-one (140 mg, 0.386 mmol, 74.1% yield) as an off-white solid. LCMS: RT = 0.99 min; m / z: 359.0 [M+H]+(Method G).1H NMR (400 MHz, DMSO-d6): δ 8.73 (s, 1H), 8.45 (s, 1H), 8.15 (s, 1H), 6.43 (tt, J = 54.8, 3.6 Hz, 1H), 4.79 (dt, J = 15.2, 3.6 Hz, 2H), 3.42 (s, 3H) (one methyl peak is merged in the solvent peak).

[0269] Step 6: Synthesis of 9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7-methyl-2-((7- methylquinoxalin-6-yl)amino)-7,9-dihydro-8H-purin-8-one (Compound 23). A stirred solution of 9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7-methyl-2-(methylsulfonyl)-7,9- dihydro-8H-purin-8-one (40 mg, 0.112 mmol) and 7-methylquinoxalin-6-amine (19.55 mg, 0.123 mmol) in 1,4-dioxane (4 mL) 0 °C was added Lithium bis(trimethylsilyl)amide solution in THF (0.279 ml, 0.279 mmol). The resulting reaction mixture was stirred at 25 °C for 1 h. The reaction mixture was purified by RP PREP HPLC purification. [Diluent: THF: ACN: WATER (50:30:20), Column: Agilent C18 (50 x 21.2) mm, 5 micron, Temperature: Ambient, Mobile phase A:5mM Ammonium Formate in water (pH = 3.3), Mobile phase B: acetonitrile, Flow: 15mL / min, Time / Grad : 0 / 20,12 / 50] to afford 3.1 mg of 9-(1-(2,2-difluoroethyl)-1H- pyrazol-4-yl)-7-methyl-2-((7-methylquinoxalin-6-yl)amino)-7,9-dihydro-8H-purin-8-one (3.1 mg, 6.74 µmol, 6.04 % yield). LCMS: RT = 2.00 min; m / z: 438.0 [M+H]+(Method G). HPLC: RT = 5.32 min, HPLC (purity) = 95.07% (HPLC Method B).1H NMR (400 MHz, DMSO-d6):δ 8.81 (d, J = 2.0 Hz, 2H), 8.762 (d, J = 2.0 Hz, 1H), 8.67 (s, 1H), 8.46 (s, 1H), 8.35 (s, 1H), 8.23 (s, 1H), 7.93 (s, 1H), 6.42 (tt, J = 55.2, 3.6 Hz, 1H), 4.72 (dt, J = 14.8, 4.0 Hz, 2H), 3.43 (s, 3H), 2.59 (s, 3H).

[0270] Examples 8-11 were obtained using procedures similar to those employed in ExampleExample 12. -(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5-methyl-2-((7-methyl-[1,2,4]triazolo[1,5- a]pyridin-6-yl)amino)-7,8-dihydropteridin-6(5H)-one (Compound 2)(Compound 2)Step 1: Synthesis of Ethyl (1-(2,2-difluoroethyl)-1H-pyrazol-4-yl) glycinate (12.3)

[0271] To a stirred solution of 1-(2,2-difluoroethyl)-1H-pyrazol-4-amine hydrochloride (400 mg, 2.179 mmol) in acetonitrile (5 mL) were added ethyl 2-bromoacetate (364 mg, 2.179 mmol) and K2CO3 (753, 5.45 mmol). To it then KI (362 mg, 2.179 mmol) was added and stirred at 100 °C for 2 h. The resulting reaction mixture was diluted with 80 mL of water and extracted with ethyl acetate (2 x 90 mL). The combined organic fraction was washed with brine, dried over sodium sulfate, filtered, and concentrated under reduced pressure to afford ethyl (1-(2,2- difluoroethyl)-1H-pyrazol-4-yl) glycinate (350 mg, 0.870 mmol, 39.9 % yield) as a brown gum. Crude taken for next step. LCMS: RT=0.64 min; m / z: 234.0 [M+H]+(Method D).Step 2: Synthesis of ethyl N-(2-chloro-5-nitropyrimidin-4-yl)-N-(1-(2,2-difluoroethyl)-1H- pyrazol-4-yl) glycinate (12.5)

[0272] To a stirred solution of 2,4-dichloro-5-nitropyrimidine (350 mg, 1.083 mmol) in acetonitrile (5 mL) was added DIPEA (0.378 mL, 2.165 mmol). To it then ethyl (1-(2,2- difluoroethyl)-1H-pyrazol-4-yl)glycinate (252 mg, 1.083 mmol) at 0oC. The resulting reaction mixture was stirred at 25 °C for 1 h. The reaction mixture was diluted with 80 mL of water and extracted with ethyl acetate (2 x 100 mL). The combined organic fraction was washed with brine, dried over sodium sulfate, filtered, and concentrated under reduced pressure to afford the crude product. The crude product was purified by silica gel flash column chromatography eluting with 30 % EtOAc in petroleum ether to afford ethyl N-(2-chloro-5-nitropyrimidin-4- yl)-N-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)glycinate (400 mg, 1.013 mmol, 94 % yield) as a brown gum. LCMS: RT=3.023 min; m / z 391.0 [M+H]+(Method G).

[0273] Step 3: Synthesis of 2-chloro-9-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7,9- dihydro-8H-purin-8-one (12.6)

[0274] To a stirred solution of ethyl N-(2-chloro-5-nitropyrimidin-4-yl)-N-(1-(2,2- difluoroethyl)-1H-pyrazol-4-yl)glycinate (400 mg, 1.024 mmol) in acetic Acid (8 mL) was added iron (172 mg, 3.07 mmol). The resulting reaction mixture was stirred at 90oC over a period of 4.5 h. The reaction mixture was concentrated under vacuum. The resulting reaction mixture was diluted with 70 mL of water, neutralized with 10% NaHCO3solution and filtered through celite. The filtrate was extracted with ethyl acetate (2 x 80 mL), washed with brine, dried over sodium sulfate, filtered, and concentrated under reduced pressure to afford the crude product. It was purified by RP purification [Diluent: THF:Water:ACN(50:20:30) Column: Redisep 40gm C18, 20-40 micron, Mobile phase A: 5mM Ammonium formate in water;Mobile phase B : Acetonitrile; Instrument 1D: Teledyne Isco-Combi flash. Compound elution (%) : 40% Acetonitrile / 5mM Ammonium formate in water Flow Rate: 40 ml / min] to afford 2- chloro-8-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7,8-dihydropteridin-6(5H)-one (260 mg, 0.818 mmol, 80 % yield) as an off-white solid. LCMS: RT=1.001 min; m / z: 315 [M+H]+(Method G).

[0275] Step 4: Synthesis of 2-chloro-8-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5- methyl-7,8-dihydropteridin-6(5H)-one (12.7)

[0276] To a stirred solution of 2-chloro-8-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7,8- dihydropteridin-6(5H)-one (260 mg, 0.826 mmol) in DMF (4 mL) was added potassium carbonate (285 mg, 2.066 mmol). The reaction mixture was cooled to 0oC and to it methyl iodide (0.155 mL, 2.479 mmol) was added. The resulting reaction mixture was stirred at 25 °C for 16 h. The reaction mixture was diluted with water (50 mL) and extracted with EtOAc (2 x 80 mL). The combined organic layer was dried over sodium sulfate, filtered and concentrated under reduced pressure to afford the crude. It was purified by RP purification [Diluent: THF:Water:ACN(50:20:30) Column: Redisep 40gm C18, 20-40 micron, Mobile phase A : 5mM Ammonium formate in water;Mobile phase B: Acetonitrile; Instrument 1D: Teledyne Isco-Combi flash. Compound elution (%): 65% Acetonitrile / 5mM Ammonium formate in water, Flow Rate: 40 ml / min to afford 2-chloro-8-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5- methyl-7,8-dihydropteridin-6(5H)-one (220 mg, 0.616 mmol, 74.5 % yield) as an off-white solid. LCMS: RT=1.35 min; m / z: 329.0 [M+H]+(Method G).

[0277] Step 5: Synthesis of 8-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5-methyl-2-((7- methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl)amino)-7,8-dihydropteridin-6(5H)-one (Compound 2). To a stirred solution of 2-chloro-8-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5-methyl-7,8-dihydropteridin-6(5H)-one (60 mg, 0.183 mmol) in dioxane (4 mL) were added Cs2CO3 (149 mg, 0.456 mmol) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-amine (27.0 mg, 0.183 mmol). The resulting reaction mixture was degassed with nitrogen over a period of 5 mins. To it then BrettPhos Pd G3 (33.1 mg, 0.037 mmol) was added. The resulting reaction mixture was further degassed with nitrogen over a period of 5 min and stirred at 100 °C for 16 h. The reaction mixture was filtered through celite bed. The celite bed was washed with ethyl acetate (2 x 200 mL). The combined filtrate was concentrated under reduced pressure to afford the crude. It was purified by preparative HPLC. Prep HPLC condition: Diluent: THF: WATER: ACN (30:20:50), Column: X-Select C18(150 x19) mm, 5 micron, Temperature: Ambient, Mobile phase A: 5mM Ammonium formate in water, Mobile phase B: Acetonitrile, Flow :15mL / min, Time / Grad : 0 / 20,12 / 50. The pure fractions were collected and concentrated under reduced pressure to afford 8-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5-methyl-2-((7- methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl)amino)-7,8-dihydropteridin-6(5H)-one (10 mg, 0.022 mmol, 12.04 % yield) as an off-white solid. LCMS: RT=1.452 min; m / z: 441.2 [M+H]+(Method H). HPLC: RT=3.639 min, HPLC purity: 96.83%; (HPLC Method A).1H NMR (400 MHz, DMSO-d6): δ 9.06 (s, 1H), 8.54 (s, 1H), 8.39 (s, 1H), 8.07 (s, 1H), 7.87 (s, 1H), 7.84 (s, 1H), 7.73 (s, 1H), 6.24 (tt, J = 54.8, 3.6 Hz, 1H), 4.74 (s, 2H), 4.41 (dt, J=14.8, 3.6 Hz, 2H), 3.26 (s, 3H), 2.37 (s, 3H).

[0278] Examples 13-21 were obtained using procedures similar to those employed in Example 12.Example 22. Synthesis of 8-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5-(methyl-d3)-2-((7-methyl- [1,2,4]triazolo[1,5-a]pyridin-6-yl)amino)-7,8-dihydropteridin-6(5H)-one (Compound 11)

[0279] Step 1: Synthesis of 2-chloro-8-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5- (methyl-d3)-7,8-dihydropteridin-6(5H)-one (22.2)

[0280] To a stirred mixture of 2-chloro-8-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-7,8- dihydropteridin-6(5H)-one (150 mg, 0.477 mmol) in 5 ml of DMF was added K2CO3(165 mg, 1.192 mmol). The reaction mixture was cooled to 0oC and to it iodomethane-d3 (104 mg, 0.715 mmol) was added. The reaction mixture was stirred at 25oC over a period of 16 h. The resultant reaction mixture was diluted with water (40 mL) and extracted with EtOAc (2 x 70 mL). The combined organic layer was dried over sodium sulfate, filtered and concentrated under reduced pressure to afford the crude. The crude compound was dissolved in 10 mL of ethyl acetate and then to it 40 mL of petroleum ether was added. The solid obtained was filtered and dried to afford 2-chloro-8-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5-(methyl-d3)-7,8-dihydropteridin-6(5H)-one (120 mg, 0.271 mmol, 56.9 % yield) as a brown solid. LCMS: RT=1.91 min; m / z: 332.3 [M+H]+(Method H).

[0281] Step 2: Synthesis of 8-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5-(methyl-d3)-2- ((7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl)amino)-7,8-dihydropteridin-6(5H)-one (Compound 11)

[0282] To a stirred solution of 2-chloro-8-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-5- (methyl-d3)-7,8-dihydropteridin-6(5H)-one (50 mg, 0.151 mmol) in dioxane (5 mL) were added Cs2CO3 (123 mg, 0.377 mmol) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-amine (29.0 mg, 0.196 mmol). The resulting reaction mixture was degassed with nitrogen over a period of 5 min. To it then BrettPhos Pd G3 (27.3 mg, 0.030 mmol) was added. The resulting reaction mixture was further degassed with nitrogen over a period of 5 min and stirred at 100 °C for 16 h. The reaction mixture was filtered through celite bed. The celite bed was washed with ethyl acetate (2 x 38 mL). The combined filtrate was concentrated under reduced pressure to afford the crude product. The crude compound was purified by preparative HPLC. Prep HPLC condition: Diluent: THF: ACN: water (50:30:20), Column: X Bridge C18 (150 x19) mm, 5micron, Temperature: Ambient, Mobile phase A: 5mM Ammonium formate, Mobile phase B: acetonitrile, Flow :15mL / min, Time / Grad: 0 / 5 ,12 / 40. The pure fractions were collected and concentrated under reduced pressure to afford 8-(1-(2,2-difluoroethyl)-1H- pyrazol-4-yl)-5-(methyl-d3)-2-((7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl)amino)-7,8- dihydropteridin-6(5H)-one (7.2 mg, 0.016 mmol, 10.38 % yield) as an off-white solid. LCMS: RT=2.183 min; m / z: 444.1 [M+H]+(Method I). HPLC: RT=6.384 min, HPLC purity: 96.44 % (HPLC Method D).1H NMR (400 MHz, DMSO-d6): 9.07 (s, 1H), 8.60 (s, 1H), 8.40 (s, 1H), 8.08 (s, 1H), 7.87 (s, 2H), 7.75 (s, 1H), 6.26 (tt, J = 54.8, 3.6 Hz, 1H), 4.48 (s, 2H), 4.40 (dt, J= 14.8, 3.6 Hz, 2H), 2.38 (s, 3H).

[0283] Examples 23-27 were obtained using procedures similar to those employed in Example 22.Example 28. 7'-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-2'-((7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6- yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidin]-6'(7'H)-one (Compound 28)

[0284] Step 1: Synthesis of Ethyl 1-(4-((1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)amino)-2- (methylthio)pyrimidin-5-yl)cyclopropane-1-carboxylate (28.3): To a stirred solution of ethyl 1-(4-chloro-2-(methylthio)pyrimidin-5-yl)cyclopropane-1-carboxylate (1.0 g, 3.67 mmol) in N,N-dimethylacetamide (10 mL) were added 1-(2,2-difluoroethyl)-1H-pyrazol-4- amine (0.809 g, 5.50 mmol) and DIPEA (3.20 mL, 18.33 mmol). The resulting reaction mixturewas stirred at 120 °C for 16 h. The reaction mixture was diluted with water (40 mL) and extracted with ethyl acetate (2 x 70 mL). The combined organic fraction was washed with brine, dried over sodium sulfate, filtered and concentrated under reduced pressure to afford the crude product. The resultant crude was purified by RP column purification [Diluent : THF: Acetonitrile (50:50) Column: Redisep 50 g C18, 20-40 micron; Mobile phase A: 5 mM Ammonium formate in water Mobile phase B: Acetonitrile; Teledyne Isco-Combi flash; Compound elution (%) 50% Acetonitrile / 5 mM Ammonium formate in water; Flow Rate : 30 mL / min to afford ethyl 1-(4-((1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)amino)-2- (methylthio)pyrimidin-5-yl)cyclopropane-1-carboxylate (0.300 g, 0.712 mmol, 19.42 % yield) as a brown solid. LCMS: RT=1.14 min; m / z: 384.2 [M+H]+(Method D).

[0285] Step 2: Synthesis of 7'-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-2'- (methylthio)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidin]-6'(7'H)-one (28.4): A stirred solution of ethyl 1-(4-((1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)amino)-2- (methylthio)pyrimidin-5-yl)cyclopropane-1-carboxylate (300 mg, 0.782 mmol) in THF (20 mL) was cooled to 0oC. To it LiHMDS (1.565 mL, 1.565 mmol) was added. The resulting reaction mixture was stirred at 25 °C for 30 min. The reaction mixture was cooled to 0oC and quenched with water (40 mL) and extracted with ethyl acetate (2 x 90 mL). The combined organic fraction was washed with brine, dried over sodium sulfate, filtered and concentrated under reduced pressure to afford the crude product. The crude obtained was purified by RP column purification [Diluent: THF: Acetonitrile (50:50) Column: Redisep 50g C18, 20-40 micron; Mobile phase A: 5mM Ammonium formate in water Mobile phase B: Acetonitrile; Teledyne Isco-Combi flash; Compound elution (%) 35% acetonitrile / 5mM Ammonium formate in water; Flow Rate: 30ml / min] to afford 7'-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)- 2'-(methylthio)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidin]-6'(7'H)-one (220 mg, 0.593 mmol, 76 % yield) as an off-white solid. LCMS: RT = 1.13 min; m / z: 338.2 [M+H]+(Method D).

[0286] Step 3: Synthesis of 7'-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-2'- (methylsulfonyl) spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidin]-6'(7'H)-one (28.5): A stirred solution of 7'-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-2'- (methylthio)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidin]-6'(7'H)-one (220 mg, 0.652 mmol) in THF (10 mL) and H2O (10 mL) was cooled to 0oC. To it oxone (1002 mg, 1.630 mmol) was added. The resulting reaction mixture was stirred at 25 °C for 16 h. The reaction mixture was quenched with aq. solution of sodium bisulphite and extracted with ethyl acetate (2 x 80 mL). The combined organic fraction was washed with brine, dried over sodium sulfate,filtered and concentrated under reduced pressure to afford the crude product. The crude obtained was purified by RP column purification [Diluent : THF: Acetonitrile (50:50) Column: Redisep 50g C18, 20-40 micron; Mobile phase A : 5 mM Ammonium formate in water, Mobile phase B: Acetonitrile; Teledyne Isco-Combi flash; Compound elution (%) 50% Acetonitrile / 5mM Ammonium formate in water; Flow Rate: 30 mL / min to afford to afford 7'-(1-(2,2- difluoroethyl)-1H-pyrazol-4-yl)-2'-(methylsulfonyl)spiro[cyclopropane-1,5'-pyrrolo[2,3- d]pyrimidin]-6'(7'H)-one (170 mg, 0.446 mmol, 68.5 % yield) as an off-white solid. LCMS: RT=1.329 min; m / z: 370.0 [M+H]+(Method D).

[0287] Step 4: Synthesis of 7'-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-2'-((7-methyl- [1,2,4]triazolo[1,5-a]pyridin-6-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3- d]pyrimidin]-6'(7'H)-one (Compound 28): To a stirred solution of 7'-(1-(2,2-difluoroethyl)- 1H-pyrazol-4-yl)-2'-(methylsulfonyl)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidin]- 6'(7'H)-one (40 mg, 0.108 mmol) and 7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-amine (20.86 mg, 0.141 mmol) in THF (6 mL) was added LiHMDS (0.433 mL, 0.433 mmol) at 25 °C. The resulting reaction mixture was stirred at 25 °C for 1 h. The reaction mixture was diluted with water (20 mL) and extracted with ethyl acetate (2 x 50 mL). The combined organic fraction was washed with brine, dried over sodium sulfate, filtered and concentrated under reduced pressure to afford the crude product. It was purified by preparative HPLC. Prep HPLC condition: Diluent: THF: water: ACN (40:20:40) Column : x-select C18 (19 x150)mm, 5micron; Temperature : Ambient, Mobile phase A: 5mM Ammonium Formate in water, Mobile phase B: ACN, Flow: 15 mL / min Time / Grad: 0 / 2010 / 60. The pure fractions were collected and concentrated under reduced pressure to afford 7'-(1-(2,2-difluoroethyl)-1H- pyrazol-4-yl)-2'-((7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl)amino)spiro[cyclopropane-1,5'- pyrrolo[2,3-d]pyrimidin]-6'(7'H)-one (8.2 mg, 0.019 mmol, 17.14 % yield) as a pale yellow solid. LCMS: RT=1.745 min; m / z: 438.2 [M+H]+(Method H). HPLC: RT=3.841 min, HPLC (purity) = 99.02% (HPLC Method B).1H NMR (400 MHz, DMSO-d6): δ 9.11 (s, 1H), 9.05 (s, 1H), 8.41 (s, 1H), 8.36 (s, 1H), 8.11 (s, 1H), 8.02 (s, 1H), 7.75 (s, 1H), 6.36 (tt, J = 54.8, 3.6 Hz, 1H), 4.65 (dt, J = 15.2, 3.6 Hz, 2H), 2.39 (s, 3H), 1.77-1.80 (m, 2H), 1.62-1.65 (m, 2H).

[0288] Examples 29-32 were obtained using procedures similar to those employed in Example 28.Example 33. 1-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-3-methyl-N-(7-methyl-[1,2,4]triazolo[1,5- a]pyridin-6-yl)-1H-pyrazolo[3,4-d]pyrimidin-6-amine (Compound 33)

[0289] Step 1: Synthesis of 1-(2,2-difluoroethyl)-4-hydrazineyl-1H-pyrazole (33.2): A stirred solution of 1-(2,2-difluoroethyl)-1H-pyrazol-4-amine (50 mg, 0.340 mmol) in 0.1 ml of conc. HCl was cooled to 0oC. To it then solution of Sodium nitrite (35.2 mg, 0.510 mmol) in 0.5 ml of H2O was added. Then the resulting reaction mixture was stirred for 2 h at 25oC. The reaction mixture was again cooled to 0oC and to it a solution of Tin(II) chloride dihydrate (192 mg, 0.850 mmol) in 0.2 mL of conc. HCl was added. The reaction mixture was further stirred at 25oC for 2 h. The resulting reaction mixture was concentrated under vacuum to afford crude 250 mg of 1-(2,2-difluoroethyl)-4-hydrazineyl-1H-pyrazole as a pale-yellow solid. The crude was used as it is for next step. LCMS: RT: 0.453, m / z: 163.1 [M+H]+(Method H).

[0290] Step 2: Synthesis of 6-chloro-1-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-3- methyl-1H-pyrazolo[3,4-d]pyrimidine (33.4): To a stirred solution of 2-(1-(2,2- difluoroethyl)-1H-pyrazol-4-yl)hydrazin-1-ium chloride (250 mg, 0.252 mmol) in DMF (3 mL) was added DIPEA (0.132 ml, 0.755 mmol). The reaction mixture was cooled to 0oC. Then to it a solution of 1-(2,4-dichloropyrimidin-5-yl)ethan-1-one (48.1 mg, 0.252 mmol) in 0.5 mL of DMF was added dropwise. The resulting reaction mixture was stirred at 25oC over a period of 16 h. The reaction mixture was concentrated under vacuum and purified by silica gel flash column chromatography eluting with 0-50% of ethyl acetate in pet ether to afford 52 mg of 6- chloro-1-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-3-methyl-1H-pyrazolo[3,4-d]pyrimidine as a yellow solid. LCMS: RT=2.12 min, m / z: 299.0 [M+H)]+(Method G).

[0291] Step 3: Synthesis of 1-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)-3-methyl-N-(7- methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl)-1H-pyrazolo[3,4-d]pyrimidin-6-amine (Compound 33). To a stirred solution of 6-chloro-1-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)- 3-methyl-1H-pyrazolo[3,4-d]pyrimidine (40 mg, 0.134 mmol) in dioxane (3 mL) were added 7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-amine (19.84 mg, 0.134 mmol), BrettPhos Pd G3 (24.28 mg, 0.027 mmol) and cesium carbonate (109 mg, 0.335 mmol). The resulting reaction mixture was purged with nitrogen over a period of 5 mins and stirred at 100oC for 6 h. The reaction mixture was purified by RP PREP HPLC purification. Prep HPLC method: Diluent: water: THF: ACN (30:30:40), Column: X-Bridge C18 (250 x 19) mm, 5 μm, Temperature: Ambient, Mobile phase A: 5 mM Ammonium Formate, Mobile phase B: acetonitrile, Flow: 15 mL / min, Time / Grad: 0 / 20, 12 / 60. The pure fractions were concentrated to get 1-(1-(2,2- difluoroethyl)-1H-pyrazol-4-yl)-3-methyl-N-(7-methyl-[1,2,4]triazolo[1,5-a]pyridin-6-yl)- 1H-pyrazolo[3,4-d]pyrimidin-6-amine (10.07 mg, 0.023 mmol, 17.22 % yield) as a white solid. LCMS: RT=1.84 min, m / z: 411.0 [M+H]+(Method G). HPLC: RT=6.11 min, HPLC (purity) = 93.98 % (HPLC Method A).1H NMR (400 MHz, DMSO-d6): δ 9.45 (s, 1H), 9.22 (s, 1H), 9.04 (s, 1H), 8.43 (s, 1H), 8.21 (s, 1H), 7.95 (s, 1H), 7.78 (s, 1H), 6.38 (tt, J = 55.2, 4.0 Hz, 1H), 4.63 (dt, J = 14.8, 3.6 Hz, 2H), 2.41 (s, 3H), Three CH3protons are merged with the solvent peak. Examples 34-37 were obtained using procedures similar to those employed in Example 33.Biological Examples DNA-PK Biochemical Assay

[0292] Assay carried out using Reaction Biology’s HotSpot Kinase Assay Protocol:

[0293] Reagent: Base Reaction buffer; 20 mM Hepes (pH 7.5), 10 mM MgCl2, 1 mM EGTA, 0.01% Brij35, 0.02 mg / ml BSA, 0.1 mM Na3VO4, 2 mM DTT, 1% DMSO Required cofactors are added individually to each kinase reaction.

[0294] Reaction Procedure: Substrate was prepared in freshly prepared Reaction Buffer. To the substrate solution above, any required cofactors were delivered. The kinase was then delivered to the substrate solution and gently mixed. The compounds were then delivered in 100% DMSO into the kinase reaction mixture by Acoustic technology (Echo550; nanoliter range), and then incubated for 20 min at room temperature.33P-ATP was then added into the reaction mixture to initiate the reaction and then incubate for 2 hours at room temperature. Kinase activity was then detected and analyzed by a P81 filter-binding method.

[0295] HotSpot Reference: Anastassiadis T, et al. Comprehensive assay of kinase catalytic activity can provide characterization of features of kinase inhibitor selectivity. (See Nat Biotechnol.2011 Oct 30;29(11):1039-45. doi: 10.1038 / nbt.2017).Activity Data

[0296] Various compounds were evaluated in the DNA-PK biochemical assay and one or more of the kinase counter-screen assays shown above, for example, ATM, PI3Kα, PI3Kβ, and PI3Kδ biochemical Assays.

[0297] Table 3. Activity Data

[0298] T Cell Cytotoxicity Assay - CD3 Glo Proliferation Assay: Frozen vials of CD3 T cells were thawed in assay media (RPMI 1640, 5% HI FBS, 1x L / G, 1X NEAA, 1X Sodium Pyruvate, 1X P / S (Gibco, Waltham MA), and viable cells counted using the Moxi V cell counter (Orflo, Ketchum ID). Thawed T cells were collected by centrifugation at 1600 rpm for 10 mins at room temperature. T cell pellets were resuspended in 10 ml of assay media in 50 ml conical tube and allowed to rest in 37 °C incubator for 1 hour. T cell suspension was removed from 37 °C incubator and diluted to 5e5 cells per ml. T cells were then stimulated using an anti-CD3 / anti-CD28 stimulatory reagent prepared using an oligomeric streptavidin mutein reagent produced as described in WO 2018 / 197949 (see also Poltorak et al., Scientific Reports (2020)) at 4 ug per 1 million T cells for 24 hours at 37 °C. The next day, compound plates were prepared by ten, 3-fold serial dilutions in 100% DMSO with top concentration at 3 mM. All compound dilutions were done on Echo-qualified 384w plates (Beckman, Indianapolis IN) before 200 nanoliters were acoustically transferred to Corning 384w tissue culture treated plates (Catalog #353988, Corning, Tewksbury MA) using an ECHO 650 acoustical liquid handler (Beckman, Indianapolis IN). To neutralize anti-CD3 / anti-CD28 stimulatory reagent- mediated T cell activation, 50 mM D-Biotin was added to anti-CD3 / anti-CD28 stimulatory reagent-activated T cell cultures at 1:50 dilution and incubated for 10 minutes at 37 °C. Forty microliters of neutralized T cell culture or assay media control was dispensed per well on corning assay plates pre-printed with 200 nanoliters of compound in DMSO using a multidrop liquid handler (ThermoFisher, Waltham MA). Plates were incubated for 3 days at which point 10 ul per well of Celltiter Glo reagent (Promega, Madison WI) was added, incubated at room temperature for 10 minutes then read on an Envision plate reader (Perkin-Elmer, Waltham MA). The concentration where 50% reduction in Celltiter Glo signal from well containing only DMSO (CC50) was calculated using a four-parameter logistic equation.

[0299] T cell media and thaw

[0300] CD4+ and CD8+ T cells were isolated from healthy donor T cells and combined at a 1:1 ratio of CD4 to CD8 T cells in a serum free T cell media (TCM) containing recombinant cytokines as follows: 100 IU / mL IL-2, 1500 IU / mL IL-7, 19 IU / mL IL-15.

[0301] T cell activation

[0302] For T cell stimulation, an anti-CD3 / anti-CD28 stimulatory reagent was prepared using an oligomeric streptavidin mutein reagent produced as described in WO 2018 / 197949 (see also Poltorak et al., Scientific Reports (2020)). The oligomeric streptavidin mutein reagent had an average hydrodynamic radius of 90-120 nm and contained an average of 2000-2800 tetramers of a streptavidin mutein (Strep-Tactin® m2, SEQ ID NO: 6). The oligomeric streptavidin mutein reagent was mixed at room temperature with (i) an anti-CD3 Fab fragment individually fused at the carboxy-terminus of its heavy chain to a streptavidin-binding peptide sequence (Twin-Strep-tag®, SEQ ID NO: 16) and (ii) an anti-CD28 Fab fragment also individually fused at the carboxy-terminus of its heavy chain to a streptavidin-binding peptide sequence (Twin-Strep-tag®, SEQ ID NO: 16). The peptide-tagged Fab fragments were recombinantly produced (see International Patent App. Pub. Nos. WO 2013 / 011011 and WO 2013 / 124474). The anti-CD3 Fab fragment was derived from the CD3 binding monoclonal antibody produced by the hybridoma cell line OKT3 (ATCC® CRL-8001™; see also U.S. Patent No.4,361,549) and contained the heavy chain variable domain (SEQ ID NO: 31) and light chain variable domain (SEQ ID NO: 32) of the anti-CD3 antibody OKT3 described in Arakawa et al., J. Biochem. 120, 657-662 (1996). The anti-CD28 Fab fragment was derived from antibody CD28.3 (deposited as a synthetic single chain Fv construct under GenBank Accession No. AF451974.1; see also Vanhove et al., BLOOD, 15 July 2003, Vol.102, No.2, pages 564-570) and contained the heavy chain variable domain (SEQ ID NO: 33) and the light chain variable domain (SEQ ID NO: 34) of the anti-CD28 antibody CD28.3. To prepare the anti-CD3 / anti-CD28 stimulatory reagent, 0.3 mg of oligomeric streptavidin mutein reagent, 0.5 µg of peptide-tagged anti-CD3 Fab fragments, and 0.5 µg of peptide-tagged anti-CD28 Fab fragment was used.

[0303] Isolated T cells described above were suspended at a density of about 3x106cells / mL and the anti-CD3 / anti-CD28 stimulatory reagent was added to the cells in a media supplemented with 100 IU / mL IL-2, 1500 IU / mL IL-7, 19 IU / mL IL-15. Cells were cultured in 6 well plates (Corning 351146) and incubated at 37 °C for 48 hours.

[0304] T cell engineering

[0305] 48 hours post-activation, T cells were counted and resuspended in buffer at a density of 5x107cells / mL.

[0306] For introducing a genetic disruption at the endogenous TCRα constant region (TRAC) locus by CRISPR / Cas9-mediated gene editing, ribonucleoprotein (RNP) composed of Cas9 protein (Aldevron) and TRAC-targeted single guide RNA (sgRNA) with targeting domain sequence GAGAAUCAAAAUCGGUGAAU (SEQ ID NO: 28; targeting within exon 1 of the endogenous TRAC gene) was added to the resuspended T cells to achieve a final concentration of 2 µM of RNP. The T cell / RNP solution was transferred into electroporation cuvettes, 100 µL / cuvette (Lonza P3 Primary Cell 4D-Nucleofector X Kit L V4XP-3024) and electroporated using a Lonza 4D-Nucleofector X Unit (Lonza) with pulse code DN-100 / P3. Immediately following electroporation, 600 µL of TCM was added per electroporation cuvette and cells were rested in cuvettes at 37oC for 15 minutes. Electroporated cells were pooled and transferred into 96 well flat bottom recovery plates (Corning 351172) containing AAV encoding an exemplary homology directed repair template for insertion of an exemplary anti- BCMA CAR into the TRAC locus at a MOI of 5x103viral genomes / cell, DNA-PK inhibitors at the indicated concentrations, 1 mM d-biotin, 100 IU / mL IL-2, 1500 IU / mL IL-7, and 19 IU / mL IL-15 in a final volume of 210 µL TCM / well and a final cell density (based on pre- electroporation counts) of 5x105T cells / well. The anti-BCMA CAR is described in WO2019 / 090003.

[0307] The exemplary anti-BCMA CAR (SEQ ID NO: 198, encoded by SEQ ID NO: 197) included a human IgG-kappa signaling sequence, a human anti-BCMA scFv (Table 4); a modified IgG4-hinge CH2-CH3 (SEQ ID NO: 184, encoded by SEQ ID NO: 183) spacer (which spacer may in some instances be referred to as “LS”; a human CD28 transmembrane domain (SEQ ID NO: 186, encoded by SEQ ID NO: 185); a human 4-1BB-derived intracellular co-signaling sequence (SEQ ID NO: 188, encoded by SEQ ID NO: 187); and a human CD3- zeta derived intracellular signaling domain (SEQ ID NO: 190, encoded by SEQ ID NO: 189).

[0308] The exemplary human anti-BCMA scFv contained an scFv with the following sequences:

[0309] The general structure of the exemplary homology directed repair template polynucleotide was as follows: [5’ homology arm (SEQ ID NO: 191)]-[promoter (SEQ ID NO: 187)]-[transgene sequence encoding the anti-BCMA CAR ((SEQ ID NO: 193)]-[3’ homology arm (SEQ ID NO: 192)]. The homology arms included approximately 600 bp of nucleic acid sequences homologous to sequences surrounding the target integration site in exon 1 of the human TCRα constant region (TRAC) gene. The sequence of the entire homology directed repair template polynucleotide that was used is given in SEQ ID NO: 194.

[0310] Control samples were engineered as described above with the omission of DNA-PK inhibitor treatment (untreated) or AAV (TRAC KO only) in the corresponding wells of the recovery plate.

[0311] T cell expansion

[0312] 24 hours after electroporation, T cells were transferred into 24 well GREX plates (Wilson Wolf 80192M) in a final volume of 3 mL TCM / well supplemented with 100 IU / mL IL-2, 1500 IU / mL IL-7, and 19 IU / mL IL-15. Cells were expanded in GREX plates for a total of 5 days post-electroporation with cytokine replenishment every 2-3 days (final volume of 4 mL / well at 5 days post-electroporation). At day 5 post-electroporation the cell viability and count were measured using AOPI staining (Nexcelom CS2-0106) and the CellacaMX automated cell counter (Nexcelom Bioscience). CAR knock-in efficiency was measured by flow cytometry as described below.

[0313] Flow cytometry

[0314] Following T cell engineering and 5 days of expansion, cells were characterized for TRAC knock-out and CAR knock-in by flow cytometry. Briefly, 2-5x105 cells / well were transferred to 96 well U-bottom plates (Corning 351177) for staining with LIVE / DEAD Fixable near-IR (ThermoFisher L34993) according to the manufacturers protocol, followed by a cocktail of antibodies targeting CD3 (BioLegend, UCHT1), CD4 (BioLegend, OKT4), CD8 (BD Horizon, RPA-T8), and anti-idiotypic antibody (which binds to the extracellular portion of the exemplary anti-BCMA CAR; see WO2021 / 113776) diluted in cell staining buffer(BioLegend D5RE-01386-1) for 30 minutes at 4oC. Following staining, cells were washed, resuspended in 100uL cell staining buffer / well, and analyzed using a FACSymphony A5 cytometer (BD Biosciences) using the high throughput plate reader to collect 20,000 live cells / well. Data analysis was performed using FlowJo 10.8.1 (BD Biosciences) and JMP 15.2.0 (SAS Institute Inc.). Total CAR+ T cells were calculated by multiplying %CAR+ by total cell count, and then normalized to the untreated condition by dividing total CAR+ T cells of DNA PK inhibitor treated conditions by the average of three untreated conditions, subtracting 1, and multiplying by 100 to get the total CAR+ cell yield as a percent change relative to the untreated control.

[0315] FIG.1 shows the effect of DNA-PK inhibitor compounds (e.g. Compound 1, Example 12) at 0.25 ^M, 1.25 ^M, and 2.5 ^M on cell viability 5 days after electroporation with two donors (donor 1 shown in dark grey bar and donor 2 in light grey bar). Live cells are shown as a percentage of total cells.

[0316] FIG.2 shows the effect of DNA-PK inhibitor compound on T cell proliferation 5 days after electroporation. Total live cell counts (x10e6) are shown.

[0317] FIG. 3 shows the effect of DNA-PK inhibitor compound on CAR insertion into the TRAC locus 5 days after electroporation. Frequency of CAR+ T cells is shown as a percentage of total live cells.

[0318] FIG. 4 shows the effect of DNA-PK inhibitor compound on CAR insertion into the TRAC locus 5 days after electroporation. KI efficiency is shown as fold change over the untreated control condition (untreated = 1).

[0319] FIG. 5 shows the effect of DNA-PK inhibitor compound on total CAR+ cell yields 5 days after electroporation. Relative CAR+ yield is shown as fold change over the untreated control condition (untreated = 1). Table 5. Exemplary SequencesENUMERATED EMBODIMENTS Enumerated Embodiment 1. A compound of Formula (I):or a pharmaceutically acceptable salt thereof, wherein: A is a 5- or 6- membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the 5- or 6- membered heteroaryl or heterocycloalkyl is optionally substituted with one or more R3; R1is an aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S, and, wherein the aryl or heteroaryl is optionally substituted with one or more R4; R2is H, C1–C4 alkyl, C1–C4 alkoxy, C2–C4 alkenyl, or C2–C4 alkynyl, wherein the alkyl is optionally substituted with one or more halogen, OH, or -CN; each R3is independently selected from the group consisting of halogen, oxo, thioxo, C1–C4alkyl, CD3, CD2CD3, C1–C4 alkoxy, C1–C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl, and aryl; ortwo geminal R3, together with the intervening geminal carbon atom, form a C3-C5cycloalkyl; each R4is independently selected from the group consisting of halogen, oxo, NH2, OH, -CN, C(O)NHR6, C1-C4alkyl, C2-C4alkenyl, C2-C4alkynyl, CD3, CD2CD3, C1–C6alkoxy, C1– C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R5; each R5is independently selected from the group consisting of halogen, OH, oxo, NH2, CHO, C1-C4 alkyl, and C1–C6 alkoxy; each R6is independently H, or C1-C4alkyl; and each R7is independently H, C1-C2alkyl, CF2H, CF3, halogen, or CN. Enumerated Embodiment 2. The compound of enumerated embodiment 1 or a pharmaceutically acceptable salt thereof, wherein R1is, wherein B is a 5- or 6- membered aryl, heteroaryl, or heterocycloalkyl optionally substituted with one or more R4; and m is an integer from 0-3. Enumerated Embodiment 3. The compound of enumerated embodiment 1 or a pharmaceutically acceptable salt thereof, wherein R1is selected from the group consisting of:wherein: X1, X2, X3, X4and X5are each independently N, CH, or C(RX); each instance of RXis independently H, C1-C4alkyl, oxo, CHO, or C1-C4alkoxy; and m is an integer from 1 to 3. Enumerated Embodiment 4. The compound of enumerated embodiment 1 or a pharmaceutically acceptable salt thereof, wherein R2is:Enumerated Embodiment 5. The compound of any one of enumerated embodiments 1-4, wherein the compound is of Formula (Ia-1):or a pharmaceutically acceptable salt thereof. Enumerated Embodiment 6. The compound of any one of enumerated embodiments 1-4, wherein the compound is of Formula (Ia-2):or a pharmaceutically acceptable salt thereof. Enumerated Embodiment 7. The compound of any one of enumerated embodiments 1-4, wherein the compound is of Formula (Ia-3):or a pharmaceutically acceptable salt thereof. Enumerated Embodiment 8. The compound of any one of enumerated embodiments 1-4, wherein the compound is of Formula (Ia-4):or a pharmaceutically acceptable salt thereof. Enumerated Embodiment 9. The compound of any one of enumerated embodiments 1-4, wherein the compound is of Formula (Ia-5):or a pharmaceutically acceptable salt thereof. Enumerated Embodiment 10. The compound of any one of enumerated embodiments 1-4, wherein the compound is of Formula (Ib-1):or a pharmaceutically acceptable salt thereof; wherein m is an integer from 1 to 3. Enumerated Embodiment 11. The compound of any one of enumerated embodiments 1-4, wherein the compound is of Formula (Ib-2):or a pharmaceutically acceptable salt thereof; wherein m is an integer from 1 to 3. Enumerated Embodiment 12. The compound of any one of enumerated embodiments 1-4, wherein the compound is of Formula (Ib-3):or a pharmaceutically acceptable salt thereof; wherein m is an integer from 1 to 3. Enumerated Embodiment 13. The compound of any one of enumerated embodiments 1-4, wherein the compound is of Formula (Ib-4):or a pharmaceutically acceptable salt thereof; wherein m is an integer from 1 to 3. Enumerated Embodiment 14. The compound of any one of enumerated embodiments 1-4, wherein the compound is of Formula (Ib-5):or a pharmaceutically acceptable salt thereof; wherein m is an integer from 1 to 3; X1, X2, X3, and X4are each independently N, CH, or C(RX); and each instance of RXis independently H, C1-C4alkyl, oxo, CHO, or C1-C4alkoxy. Enumerated Embodiment 15. The compound of any one of enumerated embodiments 1-4, wherein the compound is of Formula (Ib-6):or a pharmaceutically acceptable salt thereof; wherein X5is N, CH, or C(RX);each instance of RXis independently H, C1-C4alkyl, oxo, CHO, or C1-C4alkoxy; m is an integer from 1 to 3; and p is an integer from 0 to 2. Enumerated Embodiment 16. The compound of any one of enumerated embodiments 1-4, wherein the compound is of Formula (Ib-7):or a pharmaceutically acceptable salt thereof wherein X5is N, CH, or C(RX); each instance of RXis independently H, C1-C4alkyl, oxo, CHO, or C1-C4alkoxy; m is an integer from 1 to 3; and p is an integer from 0 to 2. Enumerated Embodiment 17. The compound of any one of enumerated embodiments 1-4, wherein the compound is of Formula (Ic-1):or a pharmaceutically acceptable salt thereof. Enumerated Embodiment 18. The compound of enumerated embodiment 1, wherein the compound is selected from the group consisting of:or a pharmaceutically acceptable salt thereof. Enumerated Embodiment 19. The compound of Enumerated Embodiment 1, wherein the compound is selected from the group consisting of:, or a pharmaceutically acceptable salt thereof. Enumerated Embodiment 20. A pharmaceutically acceptable composition comprising the compound according to any one of enumerated embodiments 1-19, and a pharmaceutically acceptable carrier. Enumerated Embodiment 21. A composition comprising: a) a DNA protein kinase inhibitor (DNA-PKI); and b) a DNA cutting agent; wherein the DNA-PKI is a compound according to any one of enumerated embodiments 1-19. Enumerated Embodiment 22. The composition of enumerated embodiment 21, further comprising a cell.Enumerated Embodiment 23. The composition of enumerated embodiment 21 or 22, further comprising a donor DNA. Enumerated Embodiment 24. The composition of any one of enumerated embodiments 21-23, wherein the concentration of the DNA-PKI in the composition is about 10 μΜ or less. Enumerated Embodiment 25. The composition of any one of enumerated embodiments 21-23, wherein the concentration of the DNA-PKI in the composition is from about 0.1-10 μΜ. Enumerated Embodiment 26. The composition of enumerated embodiment 25, wherein the concentration of the DNA-PKI in the composition is from about 0.25-5 μΜ. Enumerated Embodiment 27. The composition of any one of enumerated embodiments 22-26, wherein the cell is a eukaryotic cell. Enumerated Embodiment 28. The composition of any one of enumerated embodiments 22-26, wherein the cell is useful in adoptive cell therapy (ACT). Enumerated Embodiment 29. The composition of enumerated embodiment 28, wherein the cell is a stem cell. Enumerated Embodiment 30. The composition of enumerated embodiment 29 wherein the stem cell is a hematopoietic stem cell (HSC) or an induced pluripotent stem cell (iPSC). Enumerated Embodiment 31. The composition of any one of enumerated embodiments 28-30, wherein the cell is an immune cell. Enumerated Embodiment 32. The composition of enumerated embodiment 31, wherein the immune cell is a leukocyte or a lymphocyte. Enumerated Embodiment 33. The composition of enumerated embodiment 32, wherein the immune cell is a lymphocyte. Enumerated Embodiment 34. The composition of enumerated embodiment 33, wherein the lymphocyte is a T cell, a B cell, or an NK cell. Enumerated Embodiment 35. The composition of enumerated embodiment 33, wherein the lymphocyte is a T cell. Enumerated Embodiment 36. The composition of enumerated embodiment 35, wherein T cell is a primary T cell. Enumerated Embodiment 37. The composition of enumerated embodiment 35, wherein T cell is a regulatory T cell.Enumerated Embodiment 38. The composition of any one of enumerated embodiments 35-37, wherein the lymphocyte is an activated T cell. Enumerated Embodiment 39. The composition of any one of enumerated embodiments 35-37 wherein the lymphocyte is a non-activated T cell. Enumerated Embodiment 40. The composition of any one of enumerated embodiments 21-39, wherein the cell is a human cell. Enumerated Embodiment 41. The composition of any one of enumerated embodiments 21-40, wherein the DNA cutting agent comprises a CRISPR / Cas nuclease component and optionally a guide RNA component. Enumerated Embodiment 42. The composition of any one of enumerated embodiments 21-40, wherein the DNA cutting agent comprises a CRISPR / Cas nuclease that generates a double strand DNA break or single strand DNA break. Enumerated Embodiment 43. The composition of any one of enumerated embodiments 21-40, wherein the DNA cutting agent is selected from a zinc finger nuclease, a TALE effector domain nuclease (TALEN), a CRISPR / Cas nuclease component, and combinations thereof. Enumerated Embodiment 44. The composition of enumerated embodiment 41, wherein the DNA cutting agent is a CRISPR / Cas nuclease component and a guide RNA component. Enumerated Embodiment 45. The composition of enumerated embodiment 44, wherein the CRISPR / Cas nuclease component comprises a Cas nuclease or an mRNA encoding the Cas nuclease. Enumerated Embodiment 46. The composition of enumerated embodiment 44, wherein the CRISPR / Cas nuclease component comprises the Cas nuclease. Enumerated Embodiment 47. The composition of enumerated embodiment 45 or 46, wherein the Cas nuclease is a Class 2, Type II Cas nuclease. Enumerated Embodiment 48. The composition of enumerated embodiment 47, wherein the Cas nuclease is a Cas9 nuclease. Enumerated Embodiment 49. The composition of enumerated embodiment 48, wherein the Cas nuclease is a S. pyogenes Cas9 nuclease. Enumerated Embodiment 50. The composition of enumerated embodiment 45 or 46, wherein the Cas nuclease is a Class 2, Type V Cas nuclease. Enumerated Embodiment 51. The composition of enumerated embodiment 45 or 46, wherein the Cas nuclease is a Cas12a nuclease.Enumerated Embodiment 52. The composition of enumerated embodiment 51, wherein the Cas nuclease is a Acidaminococcus sp. Cas12a nuclease. Enumerated Embodiment 53. The composition of any one of enumerated embodiments 45-52, wherein the Cas nuclease generates a single strand DNA break. Enumerated Embodiment 54. The composition of any one of enumerated embodiments 21-53, comprising a modified RNA. Enumerated Embodiment 55. The composition of any one of enumerated embodiments 41-54, wherein the guide RNA component is a guide RNA nucleic acid. Enumerated Embodiment 56. The composition of enumerated embodiment 55, wherein the guide RNA nucleic acid is a guide RNA (gRNA). Enumerated Embodiment 57. The composition of enumerated embodiment 55 or 56 wherein the guide RNA nucleic acid is or encodes a dual-guide RNA (dgRNA) composed of a crRNA and tracrRNA. Enumerated Embodiment 58. The composition of enumerated embodiment 55 or 56, wherein the guide RNA nucleic acid is or encodes a single-guide (sgRNA). Enumerated Embodiment 59. The composition of any one of enumerated embodiments 56-58, wherein the gRNA is a modified gRNA. Enumerated Embodiment 60. The composition of enumerated embodiment 59, wherein the cutting agent is Cas9 and the modified gRNA comprises a modification at one or more of the first five nucleotides at the 5’ end. Enumerated Embodiment 61. The composition of enumerated embodiment 59, wherein the cutting agent is Cas12a and the modified gRNA comprises a DNA / RNA hybrid molecule. Enumerated Embodiment 62. The composition of enumerated embodiments 59-61, wherein the modified gRNA comprises a modification at one or more of the last five nucleotides at the 3’ end. Enumerated Embodiment 63. The composition of any one of enumerated embodiments 21-62 wherein the composition comprises a guide RNA nucleic acid and a Class 2, Type II or Class 2, Type V Cas nuclease; and the molar ratio of the guide RNA to Cas nuclease is from about 4:1 to 1:4. Enumerated Embodiment 64. The composition of any one of enumerated embodiments 21-63, wherein the donor DNA comprises a template comprising a sequence encoding a protein, a regulatory sequence, or a sequence encoding structural RNA.Enumerated Embodiment 65. The composition of any one of enumerated embodiments 21-64, further comprising a vector. Enumerated Embodiment 66. The composition of enumerated embodiment 65, wherein the vector encodes the donor DNA. Enumerated Embodiment 67. The composition of enumerated embodiment 65 or 66, wherein the vector is a viral vector. Enumerated Embodiment 68. The composition of enumerated embodiment 65 or 66, wherein the vector is a non-viral vector. Enumerated Embodiment 69. The composition of enumerated embodiment 67, wherein the vector is an AAV. Enumerated Embodiment 70. The composition of enumerated embodiment 22, wherein the cell is not a cancer cell. Enumerated Embodiment 71. The composition of any one of enumerated embodiments 21-70, further comprising an inhibitor of the microhomology mediated end joining (MMEJ) pathway. Enumerated Embodiment 72. A method for targeted genome editing in a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of enumerated embodiments 1-29. Enumerated Embodiment 73. A method of repairing a double stranded DNA break in the genome of a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of enumerated embodiments 1-29. Enumerated Embodiment 74. A method of inhibiting or suppressing repair of a DNA break in a cell via a nonhomologous end joining (NHEJ) pathway, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of enumerated embodiments 1-29. Enumerated Embodiment 75. The method of enumerated embodiment 74 further comprising contacting the cell with an inhibitor of the microhomology mediated end joining (MMEJ) pathway. Enumerated Embodiment 76. A method of targeted insertion of a donor DNA into the genome of a cell, comprising contacting the cell with a DNA cutting agent, the donor DNA, and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of enumerated embodiments 1-29.Enumerated Embodiment 77. The method of any one of enumerated embodiments 72- 76, comprising growing the cell in a cell medium free of the DNA-PKI and adding the DNA-PKI to the cell medium. Enumerated Embodiment 78. The method of any one of enumerated embodiments 72- 77, comprising contacting the cell with the DNA cutting agent before contacting the cell with the DNA-PKI. Enumerated Embodiment 79. The method of enumerated embodiment 78 comprising contacting the cell with the DNA-PKI within about six hours of contacting the cell with the DNA cutting agent. Enumerated Embodiment 80. The method of enumerated embodiment 79, comprising contacting the cell with the DNA-PKI within about three hours of contacting the cell with the DNA cutting agent. Enumerated Embodiment 81. The method of any one of enumerated embodiments 72- 77, comprising contacting the cell with the DNA cutting agent simultaneously with the DNA-PKI. Enumerated Embodiment 82. The method of any one of enumerated embodiments 72- 77 comprising contacting the cell with the DNA cutting agent after contacting the cell with the DNA-PKI. Enumerated Embodiment 83. The method of any one of enumerated embodiments 72- 82, wherein contacting the cell with the DNA cutting agent comprises electroporation. Enumerated Embodiment 84. The method of enumerated embodiment 82 or 83, comprising contacting the cell with the DNA cutting agent within about three hours of contacting the cell with the DNA-PKI. Enumerated Embodiment 85. The method of any one of enumerated embodiments 82- 84, comprising growing the cell in a cell medium comprising the DNA-PKI. Enumerated Embodiment 86. The method of any one of enumerated embodiments 82- 85, wherein the cell is contacted with the DNA cutting agent and the DNA-PKI for at least about one day. Enumerated Embodiment 87. The method of enumerated embodiment 86 wherein the cell is contacted with the DNA cutting agent and the DNA-PKI for about one day to about two weeks. Enumerated Embodiment 88. The method of enumerated embodiment Enumerated Embodiment 86, wherein the cell is contacted with the DNA cutting agent and the DNA-PKI for about two weeks.Enumerated Embodiment 89. The method of any one of enumerated embodiments 72- 88, wherein the cell is contacted with the DNA-PKI in a cell medium, wherein the concentration of the DNA-PKI in the cell medium is about 10 μΜ or less. Enumerated Embodiment 90. The method of any one of enumerated embodiments 72- 89 wherein the cell is contacted with the DNA-PKI in a cell medium, wherein the concentration of the DNA-PKI in the cell medium is from about 0.1-10 μΜ. Enumerated Embodiment 91. The method of enumerated embodiment 90, wherein the concentration of the DNA-PKI in the cell medium is from about 0.25-5 μΜ. Enumerated Embodiment 92. The method of any one of enumerated embodiments 72- 91, wherein the cell is a eukaryotic cell. Enumerated Embodiment 93. The method of any one of enumerated embodiments 72- 92, wherein the cell is for use in adoptive cell therapy (ACT). Enumerated Embodiment 94. The method of enumerated embodiments 93, wherein the cell is for use in autologous cell therapy. Enumerated Embodiment 95. The method of enumerated embodiments 93, wherein the cell is for use in allogeneic cell therapy. Enumerated Embodiment 96. The method of any one of enumerated embodiments 72- 92, wherein the cell is a stem cell. Enumerated Embodiment 97. The method of enumerated 96, wherein the stem cell is a hematopoietic stem cell (HSC). Enumerated Embodiment 98. The method of enumerated embodiment 96, wherein the cell is an induced pluripotent stem cell (iPSC). Enumerated Embodiment 99. The method of enumerated embodiment 93 or 94, wherein the cell is an immune cell. Enumerated Embodiment 100. The method of enumerated embodiment 99, wherein the immune cell is a leukocyte or a lymphocyte. Enumerated Embodiment 101. The method of enumerated embodiment 100, wherein the immune cell is a lymphocyte. Enumerated Embodiment 102. The method of enumerated embodiment Enumerated Embodiment 101, wherein the lymphocyte is a T cell, a B cell, or an NK cell. Enumerated Embodiment 103. The method of enumerated embodiment 102, wherein the lymphocyte is a T cell. Enumerated Embodiment 104. The method of enumerated embodiment 103, wherein T cell is a primary T cell.Enumerated Embodiment 105. The method of enumerated embodiment 103, wherein T cell is a regulatory T cell. Enumerated Embodiment 106. The method of any one of enumerated embodiments 102-105, wherein the lymphocyte is an activated T cell. Enumerated Embodiment 107. The method of any one of enumerated embodiments 102-105, wherein the lymphocyte is a non-activated T cell. Enumerated Embodiment 108. The method of any one of enumerated embodiments 72- 107 wherein the cell is a human cell. Enumerated Embodiment 109. The method of any one of enumerated embodiments 72- 108, wherein the DNA cutting agent is selected from a zinc finger nuclease, a TALE effector domain nuclease (TALEN), a CRISPR / Cas nuclease component, and combinations thereof. Enumerated Embodiment 110. The method of enumerated embodiment 109, wherein the DNA cutting agent is a CRISPR / Cas nuclease component. Enumerated Embodiment 111. The method of enumerated embodiment 110, wherein the CRISPR / Cas nuclease component comprises a Cas nuclease or an mRNA encoding the Cas nuclease. Enumerated Embodiment 112. The method of enumerated embodiment 111, wherein the CRISPR / Cas nuclease component comprises an mRNA encoding the Cas nuclease. Enumerated Embodiment 113. The method of enumerated embodiment 111 or 112, wherein the Cas nuclease is a Class 2, Type II Cas nuclease. Enumerated Embodiment 114. The method of enumerated embodiment 111 or 112, wherein the Cas nuclease is a Class 2, Type V Cas nuclease. Enumerated Embodiment 115. The method of enumerated embodiment Enumerated Embodiment 113, wherein the Cas nuclease is a Cas9 nuclease. Enumerated Embodiment 116. The method of enumerated embodiment Enumerated Embodiment 115, wherein the Cas nuclease is a S. pyogenes Cas9 nuclease. Enumerated Embodiment 117. The method of enumerated embodiment 114, wherein the Cas nuclease is a Cas12a nuclease. Enumerated Embodiment 118. The method of any one of enumerated embodiments 72- 117, further comprising contacting the cell with a modified RNA. Enumerated Embodiment 119. The method of any one of enumerated embodiments 72- 118, further comprising contacting the cell with a guide RNA nucleic acid.Enumerated Embodiment 120. The method of enumerated embodiment 119, wherein the guide RNA nucleic acid is a gRNA. Enumerated Embodiment 121. The method of enumerated embodiment 119 or 120, wherein the guide RNA nucleic acid is or encodes a dual-guide RNA (dgRNA). Enumerated Embodiment 122. The method of enumerated embodiment 119 or 120 wherein the guide RNA nucleic acid is or encodes a single-guide (sgRNA). Enumerated Embodiment 123. The method of any one of enumerated embodiments 120-122, wherein the gRNA is a modified gRNA. Enumerated Embodiment 124. The method of enumerated embodiment 123, wherein the modified gRNA comprises a modification at one or more of the first five nucleotides at the 5’ end. Enumerated Embodiment 125. The method of enumerated embodiment 123 or 124, wherein the modified gRNA comprises a modification at one or more of the last five nucleotides at the 3’ end. Enumerated Embodiment 126. The method of any one of enumerated embodiments 119-125, wherein the DNA cutting agent is a Class 2, Type II Cas nuclease or Class 2, Type V Cas nuclease mRNA; and the ratio of the guide RNA nucleic acid to Cas nuclease is from about 4:1 to 1:4 by molar ratio. Enumerated Embodiment 127. The method of any one of enumerated embodiments 72- 126, further comprising contacting the cell with a donor DNA. Enumerated Embodiment 128. The method of enumerated embodiment Enumerated Embodiment 127, comprising contacting the cell with a vector comprising the donor DNA. Enumerated Embodiment 129. The method of enumerated embodiment 127 or 128, wherein the donor DNA comprises a template comprising a sequence encoding a protein, a regulatory sequence, or a sequence encoding structural RNA. Enumerated Embodiment 130. The method of 129, wherein the template sequence is integrated into the genome of the cell via homology directed repair (HDR). Enumerated Embodiment 131. The method of any one of enumerated embodiments 72- 130, further comprising contacting the cell with a vector. Enumerated Embodiment 132. The method of Enumerated Embodiment 131, wherein the vector encodes the DNA cutting agent. Enumerated Embodiment 133. The method of enumerated embodiment 131 or 132, wherein the vector encodes a donor DNA.Enumerated Embodiment 134. The method of any one of enumerated embodiment 131- 133, wherein the vector is a viral vector. Enumerated Embodiment 135. The method of any one of enumerated embodiments 131-133, wherein the vector is a non-viral vector. Enumerated Embodiment 136. The method of enumerated embodiment 134, wherein the vector is an AAV. Enumerated Embodiment 137. The method of any one of enumerated embodiments 72- 136, wherein the DNA cutting agent interacts with a target sequence within the genome of the cell, resulting in a double stranded DNA break (DSB). Enumerated Embodiment 138. The method of any one of enumerated embodiments 72- 137, wherein the method results in a gene knockout. Enumerated Embodiment 139. The method of any one of enumerated embodiments 72- 138, wherein the method results in a gene correction. Enumerated Embodiment 140. The method of any one of enumerated embodiments 72- 139, wherein the method results in a gene insertion. Enumerated Embodiment 141. The method of any one of enumerated embodiments 129-140, wherein the donor DNA comprises a template comprising an exogenous nucleic acid encoding a protein. Enumerated Embodiment 142. The method of Enumerated Embodiment 141, wherein the protein is selected from the group consisting of a cytokine, an immunosuppressor, an antibody, a receptor, and an enzyme. Enumerated Embodiment 143. The method of Enumerated Embodiment 142, wherein the protein is a receptor. Enumerated Embodiment 144. The method of Enumerated Embodiment 142 or 143, wherein the receptor is selected from the group consisting of an immunological receptor, a T-cell receptor (TCR), and a chimeric antigen receptor. Enumerated Embodiment 145. The method of enumerated embodiment 144, wherein the receptor is an immunological receptor. Enumerated Embodiment 146. The method of enumerated embodiment 144, wherein the receptor is a TCR. Enumerated Embodiment 147. The method of enumerated embodiment 141, wherein the exogenous nucleic acid encodes a TCR alpha chain and / or a TCR beta chain. Enumerated Embodiment 148. The method of enumerated embodiment Enumerated Embodiment 144, wherein the receptor a chimeric antigen receptor.Enumerated Embodiment 149. The method of any one of enumerated embodiments 129-148, wherein the DNA cutting agent interacts with a target sequence within the TRAC gene of the T-cell. Enumerated Embodiment 150. The method of Enumerated Embodiment 149, comprising contacting the cell with at least two different DNA cutting agents that target different loci. Enumerated Embodiment 151. The method of any one of enumerated embodiments 141-150, wherein the template comprises a first homology arm and a second homology arm that are complementary to sequences located upstream and downstream of the cleavage site, respectively. EQUIVALENTS

[0320] The details of one or more embodiments of the disclosure are set forth in the accompanying description above. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred methods and materials are now described. Other features, objects, and advantages of the disclosure will be apparent from the description and from the claims. In the specification and the appended claims, the singular forms include plural referents unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. All patents and publications cited in this specification are incorporated by reference. The foregoing description has been presented only for the purposes of illustration and is not intended to limit the disclosure to the precise form disclosed, but by the claims appended hereto.

Claims

CLAIMS What is claimed is:

1. A compound of Formula (I):or a pharmaceutically acceptable salt thereof, wherein: A is a 5- or 6- membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the 5- or 6- membered heteroaryl or heterocycloalkyl is optionally substituted with one or more R3; R1is an aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S, and, wherein the aryl or heteroaryl is optionally substituted with one or more R4; R2is H, C1–C4 alkyl, C1–C4 alkoxy, C2–C4 alkenyl, or C2–C4 alkynyl, wherein the alkyl is optionally substituted with one or more halogen, OH, or -CN; each R3is independently selected from the group consisting of halogen, oxo, thioxo, C1–C4alkyl, CD3, CD2CD3, C1–C4 alkoxy, C1–C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl, and aryl; or two geminal R3, together with the intervening geminal carbon atom, form a C3-C5cycloalkyl; each R4is independently selected from the group consisting of halogen, oxo, NH2, OH, -CN, C(O)NHR6, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, CD3, CD2CD3, C1–C6 alkoxy, C1– C6haloalkyl, C3-C6cycloalkyl, heterocycloalkyl, heteroaryl and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R5; each R5is independently selected from the group consisting of halogen, OH, oxo, NH2, CHO, C1-C4alkyl, and C1–C6alkoxy; each R6is independently H, or C1-C4 alkyl; and each R7is independently H, C1-C2alkyl, CF2H, CF3, halogen, or CN.

2. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R1is, wherein B is a 5- or 6- membered aryl, heteroaryl, or heterocycloalkyl optionally substituted with one or more R4; and m is an integer from 0-3.

3. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R1is selected from the group consisting of:wherein: X1, X2, X3, X4and X5are each independently N, CH, or C(RX); each instance of RXis independently H, C1-C4 alkyl, oxo, CHO, or C1-C4 alkoxy; and m is an integer from 1 to 3.

4. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R2is:

5. The compound of any one of claims 1-4, wherein the compound is of Formula (Ia-1), (Ia-2), (Ia-3), (Ia-4), or (Ia-5):or a pharmaceutically acceptable salt thereof.

6. The compound of any one of claims 1-4, wherein the compound is of Formula (Ib-1), (Ib-2), (Ib-3), (Ib-4), (Ib-5), (Ib-6), or (Ib-7):or a pharmaceutically acceptable salt thereof; wherein X1, X2, X3, X4, and X5are each independently N, CH, or C(RX); each instance of RXis independently H, C1-C4alkyl, oxo, CHO, or C1-C4alkoxy; each instance of m is an integer from 1 to 3; and each instance of p is an integer from 0 to 2.

7. The compound of any one of claims 1-4, wherein the compound is of Formula (Ic-1):or a pharmaceutically acceptable salt thereof.

8. The compound of claim 1, wherein the compound is selected from the group consisting of:, or a pharmaceutically acceptable salt thereof.

9. The compound of claim 1, wherein the compound is selected from the group consisting of:, ,, or a pharmaceutically acceptable salt thereof.

10. A pharmaceutically acceptable composition comprising the compound according to any one of claims 1-9, and a pharmaceutically acceptable carrier.

11. A composition comprising: a) a DNA protein kinase inhibitor (DNA-PKI); and b) a DNA cutting agent; wherein the DNA-PKI is a compound according to any one of claims 1-9.

12. The composition of claim 11, further comprising a cell.

13. The composition of claim 11 or 12, further comprising a donor DNA.

14. The composition of any one of claims 11-13, wherein the DNA cutting agent comprises a CRISPR / Cas nuclease component and optionally a guide RNA component.

15. The composition of any one of claims 11-13, further comprising a vector.

16. The composition of any one of claims 11-15, further comprising an inhibitor of the microhomology mediated end joining (MMEJ) pathway.

17. A method for targeted genome editing in a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1-9.

18. A method of repairing a double stranded DNA break in the genome of a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1-9.

19. A method of inhibiting or suppressing repair of a DNA break in a cell via a nonhomologous end joining (NHEJ) pathway, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1-9.

20. A method of targeted insertion of a donor DNA into the genome of a cell, comprising contacting the cell with a DNA cutting agent, the donor DNA, and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1-9.

Citation Information

Patent Citations

  • Complement-fixing monoclonal antibody to human T cells, and methods of preparing same

    US4361549A

  • Sulfinic acid adducts of organo nitroso compounds useful as retroviral inactivating agents anti-retroviral agents and anti-tumor agents

    US5262564A

  • Method of reversibly staining a target cell

    WO2013011011A2

  • Chromatographic isolation of cells and other complex biological materials

    WO2013124474A2

  • Oligomeric particle reagents and methods of use thereof

    WO2018197949A1