Artificial peptide synthesis

Abstract

Methods for the synthesis of artificial peptides and / or proteins are provided. The methods include the incorporation of several nonstandard amino acids into the sequence of the peptides and / or proteins, in some embodiments sequentially along the peptide and / or protein sequence. Techniques for the generation of mRNA display libraries of the peptides and / or proteins are also provided.

Description

[0001] Artificial Peptide Synthesis

[0002] CROSS REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of priority of U.S. provisional patent application 63 / 556,301, filed 21 February 2024, and U.S. provisional patent application 63 / 688,865, filed 29 August 2024, each of which is hereby incorporated by reference in its entirety, for all purposes.

[0004] SEQUENCE LISTING

[0005] The instant application contains a Sequence Listing which has been submitted electronically in XML format created on February 21, 2025, named 11490-1-PCT.xml is 2,513,000 bytes in size, and is hereby incorporated by reference in its entirety.

[0006] FIELD

[0007] Disclosed herein are methods for cell-free, ribosome-expressed synthesis of artificial peptides, and for the generation of libraries of such artificial peptides, using an artificial translation platform.

[0008] BACKGROUND

[0009] Since the discovery of insulin launched the field of peptide therapeutics, over 80 peptide drugs have been introduced to the market. These drugs treat a diverse set of diseases, including diabetes, cancer, HIV infection, chronic pain, and multiple sclerosis. While naturally occurring peptides play a critical role in drug discovery and drug development, they can often demonstrate poor chemical stability, poor physical stability, and / or can have a short half-life in a subject. Artificial peptide synthesis (APS), a process by which synthetic peptides and / or proteins can be synthesized outside of a living cell, is a real means of overcoming these shortcomings. APS allows for the engineering of peptides or proteins with more complex chemistries at targeted locations throughout the peptide chain, by, for example, incorporating nonstandard amino acids into engineered peptides.

[0010] APS is transforming peptide drug discovery. The technology can be used to identify metabolically stable peptide molecules that can be used as therapeutic agents, via the insertion of nonstandard amino acids and / or other synthetic elements into known peptide or protein sequences, to identify therapeutic candidates. When coupled with identification techniques, such as mRNA display, APS allows for high-throughput screening of a large number of artificial peptides or proteins, and thus the potential discovery of novel therapeutic candidates. While the molecular translation machinery has been manipulated to allow for the incorporation of noncanonical amino acids into engineered peptides, current methods suffer from severe limitations. Many existing APS platforms are capable of inserting only a single noncanonical amino acid into a nascent peptide or protein at a time. One known technique involves ribosomal peptide synthesis reactions in an environment devoid of one translational release factor (RF), resulting in the repurposing of a stop codon for insertion of a single noncanonical amino acid (see, e.g., Wais, etal., (2014) Frontiers in Chemistry, 2. doi:ARTN 15 10.3389 / fchem.2014.00015; Wang, et al., (2002) Chemical Communications (1), 1-11. doi:DOI 10.1039 / bl08185n). In these reduced translation reactions, synthetic aminoacyl- tRNA synthetases and their synthetic cognate tRNAs are employed to reassign a stop codon, allowing for the insertion of a noncanonical amino acid (e.g., RF1 removal allows reassignment of the amber stop codon) (Isaacs, et al., Science (2011), 333(6040), 348-353. doi: 10.1126 / science.1205822). While this strategy seems to work reasonably well, a stop codon may only be reassigned once per reaction. It is therefore only capable of the insertion of a single nonstandard amino acid or synthetic element into a nascent peptide or protein per mRNA codon, making its application extremely limited. Because the number of codons- -particularly stop codons— is limited, this approach caps the diversity of non-canonical amino acids that can be incorporated to a peptide.

[0011] For example, there is an increasingly strong need to get larger molecules with properties superior to known drugs, such as peptide macrocycles, into cells for a variety of applications and sufficient data has begun to foster the belief that this is a tractable problem. Recent evidence has suggested that there is an optimal size of a macrocyclic peptide for such purposes, of roughly 5-8 amino acids. Within this 5-8 amino acid range, modulating the number of hydrogen bond donors / acceptors and the hydrophobicity as inferred by calculated octanol-water partition coefficient (clogP) may assist in getting this class of compounds into cells. This concept comes with many challenges, however, because as the macrocycle ring gets smaller so does the diversity accessible through canonical amino acids. Additionally, at such smaller sizes the ring juncture begins to comprise a greater percentage of the molecule, making coordinated and intentional synthesis and diversification of such compounds challenging. Methods that can sustain high diversity in smaller ring libraries could have a significant impact. For instance, variations on mRNA display technology that begin to access more cell-permeable chemical space represent an opportunity for innovation and capitalization / commercialization. There is thus a need for improved APS techniques that allow for insertion of nonstandard amino acids and / or other synthetic elements into a nascent peptide and / or protein chain in greater numbers and in a coordinated, intentional manner. There is also a need for improved mRNA display techniques that can allow for the rapid, high-throughput screening of APS-derived peptide libraries.

[0012] SUMMARY

[0013] The present disclosure provides meaningful solutions to the problems associated with the prior art. In various aspects, technology provided by the present disclosure allows translational components to be precisely controlled during peptide synthesis, enabling the synthesis of not only non-natural sequences but also incorporation of nonstandard amino acids. This greatly expands the scope of ribosomal translation to create therapeutic agents which may be have improved drug properties compared to their natural counterparts.

[0014] In a first aspect, the present disclosure provides methods of synthesizing an artificial peptide, by creating a synthetic mRNA having at least first and second insertion sites in its coding sequence; translating the mRNA; inserting a first nonstandard amino acid into the first insertion site and a second nonstandard amino acid into the second insertion site; and terminating translation.

[0015] In embodiments, immobilizing the mRNA may occur before translation. Immobilizing can include hybridizing at least a portion of the mRNA to a linker oligonucleotide. Hybridizing can include base-pairing a sequence of the mRNA with a complimentary sequence in the linker oligonucleotide. The linker oligonucleotide can include a moiety selected from a biotin moiety, a puromycin moiety, and both a biotin moiety and a puromycin moiety. Alternatively, the linker includes a biotin moiety and the immobilization occurs via binding to a streptavidin-containing substrate. The substrate can be magnetic beads.

[0016] In embodiments, inserting a nonstandard amino acid includes pausing a ribosome before the at least first and second insertion sites during translation and inserting the first and second nonstandard amino acids after the pause; or pausing a ribosome after the at least first and second insertion sites during translation and inserting the nonstandard amino acids before the pause. In embodiments, pausing occurs by reassigning stop codons, wherein at least one of the first and second insertion sites is a stop codon. In other embodiments, pausing occurs via withholding of one or more amino acids during translation, where the one or more amino acids correspond to a codon located upstream or downstream of one or more of the first and second insertion sites. The one or more amino acids can each independently selected from alanine, histidine, leucine, methionine, and tyrosine. Alternatively, the one or more amino acids are each independently selected from arginine, isoleucine, and threonine.

[0017] In embodiments, pausing occurs via withholding of one or more tRNAs during translation, where the one or more tRNAs each independently comprise anticodons corresponding to one or more of the first and second insertion sites. In embodiments, the one or more tRNAs are each independently selected from a tRNA having an anticodon to a codon selected from GCU, GCC, GCA, GCG, CAU, CAC, CUU, CUC, CUA, CUG, AUG, UAU, and UAC. In other embodiments, the one or more tRNAs are each independently selected from a tRNA having an anticodon to a codon selected from CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, ACU, ACC, ACA, and ACG.

[0018] In embodiments, pausing occurs via withholding of one or more nonstandard amino acids.

[0019] In embodiments, the at least first and second insertion sites are nonsequential in the coding sequence. In other embodiments, the at least first and second insertion sites occur sequentially in the coding sequence.

[0020] In embodiments, the nonstandard amino acids are the same. In other embodiments, the nonstandard amino acids are different. In embodiments, each nonstandard amino acid is independently selected from canavanine, cucurbitine, albizziin, laminine, kainic acid, a- diamino acids, P-diamino acids, hydroxyproline, a,a-dialkyl glycines, and azacyclic amino acids. In other embodiments, each nonstandard amino acid is independently selected from p-azido-l-phenylalanine, 4-iodo-l-phenylalanine, 4-methyl-l-phenylalanine, 2-naphthyl-l- alanine, and O-methyl-tyrosine.

[0021] In embodiments, the coding sequence further comprises a third insertion site.

[0022] In embodiments, the method further includes, after the insertion and prior to termination, pausing the ribosome and inserting a puromycin-containing linker into the peptide. The linker can include puromycin, ethylene glycol, and a click chemistry element; and the mRNA comprises a moiety configured to react with the click chemistry element. In embodiments, the moiety is an azide; the click chemistry element is dibenzocyclooctyne - triethylene glycol (DBCO-TEG); and the DBCO-TEG reacts with the azide, covalently binding the peptide to the mRNA. In embodiments the method includes, after termination, reverse-transcribing the mRNA.

[0023] In a second aspect, the present disclosure provides methods of synthesizing an artificial peptide by creating a synthetic mRNA having a first insertion site and a second insertion site in its coding sequence with at least one non-insertion codon located between the first and second insertion sites; initiating translation of the mRNA and inserting a first nonstandard amino acid into the first insertion site; thereafter, pausing a translating ribosome at the non-insertion codon; resuming translation and inserting a second nonstandard amino acid into the second insertion site; and terminating translation.

[0024] In embodiments, immobilization can occur as noted above and otherwise herein.

[0025] In embodiments, inserting a nonstandard amino acid comprises inserting a nonstandard amino acid into the first and / or second insertion sites without pausing the translating ribosome. In embodiments, the initiation of translation and insertion of a nonstandard amino acid into the first insertion site occurs by contacting the mRNA with a first translation mix, where the first translation mix comprises the translating ribosome and the first nonstandard amino acid.

[0026] In embodiments, pausing occurs via withholding of an amino acid corresponding to the non-insertion codon. In embodiments, the resumption of translation and insertion of a nonstandard amino acid into the second insertion site occurs by contacting the mRNA with a second translation mix, where the second translation mix comprises the withheld amino acid and the second nonstandard amino acid.

[0027] In embodiments, the non-insertion codon codes for an amino acid selected from alanine, histidine, leucine, methionine, and tyrosine. In other embodiments, the noninsertion codon codes for an amino acid selected from arginine, isoleucine, and threonine.

[0028] In embodiments, the first translation mix is removed from contact with the mRNA before the mRNA is contacted with the second translation mix.

[0029] In embodiments, the first and second nonstandard amino acids are the same. In other embodiments, the first and second nonstandard amino acids are different. In embodiments, the first and second nonstandard amino acids are each independently selected from canavanine, cucurbitine, albizziin, laminine, kainic acid, a-diamino acids, P-diamino acids, hydroxyproline, a,a-dialkyl glycines, and azacyclic amino acids. In other embodiments, the first and second nonstandard amino acids are each independently selected from p-azido-1- phenylalanine, 4-iodo-l-phenylalanine, 4-methyl-l-phenylalanine, 2-naphthyl-l-alanine, and O-methyl-tyrosine.

[0030] In embodiments, the coding sequence further comprises a third insertion site located downstream from the second insertion site, and at least one non-insertion codon is located between the second and third insertion sites.

[0031] In embodiments, insertion of a puromycin-containing linker can occur as noted above and otherwise herein.

[0032] In a third aspect, the present disclosure provides methods of creating an artificial peptide library, by creating a synthetic mRNA having a first insertion site and a second insertion site in its coding sequence with at least one intervening codon located between the first and second insertion sites; initiating translation of a plurality of copies of the mRNA by contacting the copies with a first translation mix; inserting a first nonstandard amino acid into each first insertion site of each copy; thereafter, pausing a translating ribosome at the intervening codon of each copy; resuming translation of the plurality of copies by contacting the copies with a second translation mix; inserting a second nonstandard amino acid into each second insertion site of each copy; and terminating translation of the plurality of copies.

[0033] In embodiments, immobilization can occur as noted above and otherwise herein.

[0034] In embodiments, the first translation mix comprises a mixture of nonstandard amino acids; and inserting the first nonstandard amino acid comprises randomly inserting one of the nonstandard amino acids from the mixture into each of the first insertion sites without pausing the translating ribosome.

[0035] In embodiments, the mixture of nonstandard amino acids comprises canavanine, cucurbitine, albizziin, laminine, kainic acid, a-diamino acids, P-diamino acids, hydroxyproline, a,a-dialkyl glycines, and azacyclic amino acids. In embodiments, the mixture of nonstandard amino acids comprises p-azido-l-phenylalanine, 4-iodo-l- phenylalanine, 4-methyl-l-phenylalanine, 2-naphthyl-l-alanine, and O-methyl-tyrosine.

[0036] In embodiments, pausing occurs via withholding of an amino acid corresponding to each intervening codon and the first translation mixture is free of that amino acid. In embodiments, each intervening codon corresponds to an amino acid selected from alanine, histidine, leucine, methionine, and tyrosine. In embodiments, each intervening codon corresponds to an amino acid selected from arginine, isoleucine, and threonine.

[0037] In embodiments, the first translation mix is removed from contact with the copies of the mRNA before the copies are placed into contact with the second translation mix; and the second translation mix comprises the withheld amino acid. In embodiments, the first translation mix is not removed when the copies of the mRNA are placed into contact with the second translation mix; and the second translation mix comprises the withheld amino acid. In embodiments, the second translation mix comprises a mixture of nonstandard amino acids; and inserting the second nonstandard amino acid comprises randomly inserting one of the nonstandard amino acids from the second mixture into each of the first insertion sites without pausing the translating ribosome.

[0038] In embodiments, the mixture of nonstandard amino acids comprises canavanine, cucurbitine, albizziin, laminine, kainic acid, a-diamino acids, P-diamino acids, hydroxyproline, a,a-dialkyl glycines, and azacyclic amino acids. In embodiments, the mixture of nonstandard amino acids comprises p-azido-l-phenylalanine, 4-iodo-l- phenylalanine, 4-methyl-l-phenylalanine, 2-naphthyl-l-alanine, and O-methyl-tyrosine.

[0039] In embodiments, each intervening codon is a stop codon and pausing occurs by repurposing stop codons. In embodiments, each intervening codon is an amber stop codon and the first translation mix is free of release factor 1 (RF1); each intervening codon is an ochre stop codon and the first translation mix is free of RF1; or each intervening codon is an opal stop codon and the first translation mix is free of release factor 2.

[0040] In embodiments, the first translation mix is removed from contact with the copies of the mRNA before the copies are placed into contact with the second translation mix; the second translation mix comprises a synthetic tRNA comprising an anticodon to the stop codon; and the synthetic tRNA is configured to insert a natural or a nonstandard amino acid into the intervening codon.

[0041] In embodiments, the first translation mix is not removed when the copies of the mRNA are placed into contact with the second translation mix; the second translation mix comprises a synthetic tRNA comprising an anticodon to the stop codon; and the synthetic tRNA is configured to insert a natural or a nonstandard amino acid into the intervening codon.

[0042] In embodiments, the synthetic tRNA is configured to insert a natural amino acid selected from alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In embodiments, the synthetic tRNA is configured to insert a nonstandard amino acid selected from canavanine, cucurbitine, albizziin, laminine, kainic acid, a-diamino acids, P-diamino acids, hydroxyproline, a,a- dialkyl glycines, and azacyclic amino acids. In embodiments, the synthetic tRNA is configured to insert a nonstandard amino acid selected from p-azido-l-phenylalanine, 4- iodo-l-phenylalanine, 4-methyl-l-phenylalanine, 2-naphthyl-l-alanine, and O-methyl- tyrosine

[0043] In embodiments, insertion of a puromycin-containing linker can occur as noted above and otherwise herein.

[0044] In a fourth aspect, the present disclosure provides methods of synthesizing an artificial peptide, by creating a synthetic mRNA having a first insertion site and a second insertion site in its coding sequence with at least one non-insertion codon located before the first and second insertion sites; initiating translation of the mRNA; thereafter, pausing a translating ribosome at the non-insertion codon; resuming translation and inserting a first nonstandard amino acid into the first insertion site and a second nonstandard amino acid into the second insertion site; and terminating translation; wherein the first and second insertion sites occur sequentially in the coding sequence.

[0045] In embodiments, immobilization can occur as noted above and otherwise herein.

[0046] In embodiments, inserting a nonstandard amino acid comprises inserting a nonstandard amino acid into the first and / or second insertion sites after pausing the translating ribosome at the non-insertion codon. In embodiments, the initiation of translation and the pausing occurs by contacting the mRNA with a first translation mix. In embodiments, the first translation mix comprises one or more ribosomes and is free of an element required for translation of non-insertion codon.

[0047] In embodiments, pausing occurs via withholding of an amino acid corresponding to the non-insertion codon. In embodiments, the resumption of translation, insertion of a nonstandard amino acid into the second insertion site, and insertion of a nonstandard amino acid into the second insertion site occurs by contacting the mRNA with a second translation mix. In embodiments, the second translation mix comprises the withheld amino acid. The first nonstandard amino acid, and the second nonstandard amino acid.

[0048] In embodiments, the non-insertion codon codes for an amino acid selected from alanine, histidine, leucine, methionine, and tyrosine. In embodiments, the non-insertion codon codes for an amino acid selected from arginine, isoleucine, and threonine.

[0049] In embodiments, the first translation mix is removed from contact with the mRNA before the mRNA is contacted with the second translation mix. In embodiments, the first and second nonstandard amino acids are the same. In embodiments, the first and second nonstandard amino acids are different.

[0050] In embodiments, the first and second nonstandard amino acids are each independently selected from canavanine, cucurbitine, albizziin, laminine, kainic acid, a- diamino acids, P-diamino acids, hydroxyproline, a,a-dialkyl glycines, and azacyclic amino acids. In embodiments, the first and second nonstandard amino acids are each independently selected from p-azido-l-phenylalanine, 4-iodo-l-phenylalanine, 4-methyl-l-phenylalanine, 2-naphthyl-l-alanine, and O-methyl-tyrosine.

[0051] In embodiments, the coding sequence further comprises a third insertion site located downstream from the second insertion site. In embodiments, the first, second, and third insertion sites occur sequentially in the coding sequence.

[0052] In embodiments, insertion of a puromycin-containing linker can occur as noted above and otherwise herein.

[0053] In a fifth aspect, the present disclosure provides methods for reassignment of stop codons by immobilizing an mRNA, wherein the mRNA includes two or more stop codons; reacting the mRNA with a first reaction mixture to form a complex, wherein the first reaction mixture comprises a first nonstandard amino acid to be inserted at a position of a first stop codon in the mRNA; collecting the complex, wherein the complex comprises the immobilized mRNA, a peptide with the first nonstandard amino acid, and the paused ribosome; and reacting the complex with a second reaction mixture, wherein the second reaction mixture comprises a second nonstandard amino acid to be inserted at a position of a second stop codon in the mRNA.

[0054] In a sixth aspect, the present disclosure provides methods of creating an mRNA displayed peptide, by immobilizing an mRNA to a support; translating the mRNA to create the peptide; and after translation, contacting the mRNA with a puromycin moiety for incorporation into the peptide; wherein: the puromycin moiety comprises means for attachment to the mRNA; and the contacting occurs after the peptide is created.

[0055] In embodiments, immobilizing comprises hybridizing the mRNA to a linker oligonucleotide. In embodiments, hybridizing comprises base-pairing a sequence of the mRNA with a complimentary sequence in the linker oligonucleotide.

[0056] In embodiments, the linker oligonucleotide comprises a biotin moiety. In embodiments, immobilization occurs via binding to a streptavidin-containing substrate. In embodiments, the substrate comprises magnetic beads. In embodiments, the puromycin moiety is part of a puromycin-containing linker molecule. In embodiments, the linker comprises puromycin, ethylene glycol, and a click chemistry element. In embodiments, the mRNA comprises a binding moiety configured to react with the click chemistry element. In embodiments, the binding moiety is an azide; the click chemistry element is dibenzocyclooctyne - triethylene glycol (DBCO-TEG); and the DBCO-TEG reacts with the azide, covalently binding the peptide to the mRNA.

[0057] In embodiments, the method further includes, after translation and after contact with the puromycin moiety, reverse-transcribing the mRNA.

[0058] DESCRIPTION OF DRAWINGS

[0059] Figures 1A, IB, and 1C depict varying embodiments of linker oligonucleotides that may be utilized to hybridize to an mRNA over at least a portion of its length in order to secure that mRNA to a support structure (Figs. 1 A and 1C), and / or to provide a puromycin- containing element for mRNA display purposes (Figs IB and 1C). In the depicted embodiments, the linker oligonucleotides are shown as dashed lines.

[0060] Fi ure 2 depicts an example of how a diverse library of peptides and / or proteins can be generated from a single synthetic mRNA in a cell-free translation system utilizing programmed ribosomal pausing for targeted amino acid incorporation, in accordance with embodiments provided by the present disclosure.

[0061] Figures 3 A, 3B, 3C, 3D, and 3E depict data supporting high efficiency ribosomal pause points. Reversible ribosomal pausing occurring on codons coding for these amino acids was found to be highly efficient.

[0062] Figures 4A, 4B, and 4C depict data supporting moderately efficient ribosomal pause points. Reversible ribosomal pausing occurring on codons coding for these amino acids was found to be reasonably efficient.

[0063] Figure 5 depicts one embodiment of a “late click” puromycin-containing linker for use in embodiments of mRNA display technology provided by the present disclosure. In embodiments, ethylene glycol is (CEkOH)?.

[0064] Figure 6 depicts the experimental design used to study pause and resumption of ribosomal peptide synthesis by observing change in fluorescence as GFP11 peptide synthesis occurred over time, as part of the proof-of-principle experiments provided herein.

[0065] Figures 7A, 7B, 7C, and 7D depict a solid-phase peptide synthesis system that relies on programmed ribosomal pausing and selective amino acid withholding and addition for custom peptide synthesis, as part of the proof-of-principle experiments provided herein. Fig. 7 A shows a modified GFP11 sequence (SEQ ID NO: 1) and the three different translation mixes employed to translate it. Fig. 7B is a schematic showing translation occurring from translation mix to translation mix, with a washing step in between mixes, to remove the previous mix. Fig. 7C depicts the fully translated peptides and their use to determine fluorescence. Fig. 7D provides fluorescence data for the peptides generated.

[0066] Figures 8A. 8B, 8C, and 8D depict the experiments performed, wherein synthesis of a peptide incorporating an nsAA utilizing reassignment of a stop codon and ribosomal pausing successfully occurred, as part of the proof-of-principle experiments provided herein. Fig. 8 A shows the engineered GFP11 amino acid sequence used for these experiments (SEQ ID NO: 2)

[0067] Fi ure 9 shows the GFP11 amino acid sequence (SEQ ID NO: 3) and corresponding translation mixes (Mix 1 and Mix 2) used to synthesize 7 unique GFP11 peptides, each incorporating a pair of unique nsAAs, all of which were translated using the same mRNA template, as part of Examples 4 and 5 provided herein.

[0068] Figure 10 is a gel electrophoresis picture showing confirmation of ligation of mRNA template to biotinylated DNA, as provided in Example 5 herein.

[0069] Figure 11 presents data from the experiment provided in Example 6.

[0070] DETAILED DESCRIPTION

[0071] Definitions

[0072] As used herein, the following terms shall have the following meanings unless the context clearly requires otherwise:

[0073] The terms “about,” “approximately,” etc., when used in relation to numerical limitations or ranges, mean that the recited limitation or range may vary by up to 10%. For example, “about 750” can mean as little as 675 or as much as 825, or any value therebetween. When used in relation to ratios or relationships between two or more numerical limitations or ranges, the terms “about,” “approximately,” etc. mean that each of the limitations or ranges may vary by up to 10%; for example, a statement that two quantities are “approximately equal” can mean that a ratio between the two quantities is as little as 0.9: 1.1 or as much as LEON (or any value therebetween), and a statement that a four-way ratio is “about 5:3: 1 : 1” can mean that the first number in the ratio can be any value of at least 4.5 and no more than 5.5, the second number in the ratio can be any value of at least 2.7 and no more than 3.3, and so on. A “nonstandard amino acid,” also referred to herein as an “nsAA,” is any amino acid-like compound that is not commonly found in naturally-occurring peptides and / or proteins, and / or that is not one or more of the twenty amino acids commonly found in naturally occurring proteins (Ala or A, Cys or C, Asp or D, Glu or E, Phe or F, Gly or G, His or H, He or I, Lys or K, Leu or L, Met or M, Asn or N, Pro or P, Gin or Q, Arg or R, Ser or S, Thr or T, Vai or V, Trp or W, Tyr or Y, as defined and listed in WIPO Standard ST.25 (2009), Annex C, Appendix 2, Table 3), but that can be incorporated into a peptide and / or protein via a ribosome. In some embodiments, a nonstandard amino acid is a natural amino acid with a modified side chain or backbone. In some embodiments, nonstandard amino acids share backbone structures and / or side chain structures of one or more natural amino acids, though the nonstandard amino acids contain one or more modified groups in the molecule. Suitable modified groups include, without limitation, substitution of an atom (such as N) for a related atom (such as S), addition of a group (such as methyl, or hydroxyl group, etc.) or an atom (such as Cl or Br, etc.), deletion of a group (supra), substitution of a covalent bond (single bond for double bond, etc.), or combinations thereof. Nonstandard amino acids may include a-hydroxy acids and P-amino acids.

[0074] In some embodiments, nonstandard amino acids are racemic. Nonstandard amino acids may either be naturally occurring or unnaturally occurring (e.g., synthesized). The side chains may be in either the (R) or the (S) configuration, or in the (D-) or (L-) configuration. As will be appreciated, any structure for which a set of rotamers is known or can be generated can be used as a nonstandard amino acid. In some embodiments, a salt of a nonstandard amino acid is used.

[0075] Preferably, the overall shape and size of a nonstandard amino acid are such that, upon being charged to (natural or re-designed) tRNAs by (natural or re-designed) aminoacyl-tRNA synthetases, the resulting analog-tRNA is a ribosomally accepted complex, z.e., the tRNA-nonstandard amino acid complex can be accepted by the prokaryotic or eukaryotic ribosomes in the cell-free, in vitro translation systems disclosed herein.

[0076] Suitable examples of nonstandard amino acids include:

[0077] Noncanonical amino acids, for example naturally occurring noncanonical amino acids such as selenocysteine, pyrrolysine, hydroxyproline, hydroxylysine, gammacarboxyglutamic acid, ornithine, desmosine, aminoadipic acid, 2-aminobutyric acid, N- acetylated amino acids (e.g., N-acetyl alanine, N-acetyl arginine, N-acetyl asparagine, N- acetyl aspartic acid, N-acetyl cysteine, N-acetyl glutamic acid, N-acetyl glutamine, N-acetyl glycine, N-acetyl histidine, N-acetyl isoleucine, N-acetyl leucine, N-acetyl lysine, N-acetyl methionine, N-acetyl phenylalanine, N-acetyl proline, N-acetyl serine, N-acetyl threonine, N-acetyl tryptophan, N-acetyl tyrosine, and N-acetyl valine), N-methylated amino acids (e.g., N-methyl alanine, N-methyl arginine, N-methyl asparagine, N-methyl aspartic acid, N-methyl cysteine, N-methyl glutamic acid, N-methyl glutamine, N-methyl glycine, N- methyl histidine, N-methyl isoleucine, N-methyl leucine, N-methyl lysine, N-methyl methionine, N-methyl phenylalanine, N-methyl proline, N-methyl serine, N-methyl threonine, N-methyl tryptophan, N-methyl tyrosine, and N-methyl valine). Artificial and synthetic noncanonical amino acids such as p-bromo-phenylalanine, azidohomoalanine, O- methyltyrosine, fluorescent amino acids (e.g., 7-Amino-4-methylcoumarin), benzoylphenylalanine, 2-naphthylalanine, tyr-NH2 (Amidated Tyrosine), L-citrulline, N- acylated Amino Acids (e.g., N-acetylmethionine), P-glutamate. Modified amino acids for protein engineering such as L-alpha-hydroxyglutamate, L-alpha-hydroxyproline, cysteine analogs (e.g., 2-amino-3-mercaptopropanoic acid), fluoroamino acids (e.g., 5- fluorotry ptophan) .

[0078] P-amino acid analogs such as cyclic P-amino acid analogues; P-alanine; (R)-P- phenylalanine; (R)-l,2,3,4-tetrahydro-isoquinolin-3-acetic acid; (R)-3-amino-4-(l- naphthyl) -butyric acid; (R)-3-amino-4-(2,4-di chlorophenyl) butyric acid; (R)-3-amino-4- (2-chlorophenyl) butyric acid; (R)-3-amino-4-(2-cy anophenyl) butyric acid; (R)-3-amino- 4-(2-fluorophenyl) butyric acid; (R)-3-amino-4-(2 -furyl) butyric acid; (R)-3-amino-4-(2- m ethylphenyl) butyric acid; (R)-3-amino-4-(2 -naphthyl) butyric acid; (R)-3-amino-4-(2- thienyl) butyric acid; (R)-3-amino-4-(2 -trifluoromethylphenyl) butyric acid; (R)-3-amino- 4-(3,4-dichlorophenyl) butyric acid; (R)-3-amino-4-(3,4-difluorophenyl) butyric acid; (R)- 3 -amino-4-(3 -benzothienyl) butyric acid; (R)-3-amino-4-(3 -chlorophenyl) butyric acid; (R)-3-amino-4-(3 -cyanophenyl) butyric acid; (R)-3-amino-4-(3 -fluorophenyl) butyric acid; (R)-3-amino-4-(3 -methylphenyl) butyric acid; (R)-3-amino-4 (3 -pyridyl) butyric acid; (R)- 3 -amino-4-(3 -thienyl) butyric acid; (R)-3-amino-4-(3 -trifluoromethylphenyl) butyric acid; (R)-3-amino-4-(4-bromophenyl) butyric acid; (R)-3-amino-4-(4-chlorophenyl) butyric acid; (R)-3-amino-4-(4-cy anophenyl) butyric acid; (R)-3-amino-4-(4-fluorophenyl) butyric acid; (R)-3-amino-4-(4-iodophenyl) butyric acid; (R)-3-amino-4- 4-methylphenyl) butyric acid; (R)-3-amino-4-(4-nitrophenyl) butyric acid; (R)-3-amino-4-(4-pyridyl) butyric acid; (R)-3-amino-4-(4-trifluorom ethylphenyl) butyric acid; (R)-3-amino-4-pentafluoro- phenylbutyric acid; (R)-3-amino-5-hexenoic acid; (R)-3-amino-5-hexinic acid; (R)-3- amino-5-phenylpentanoic acid; (R)-3-amino-6-phenyl-5-hexenoic acid; (S)-l,2,3,4- tetrahydro-isoquinolin-3-acetic acid; (S)-3-amino-4-(l-naphthyl)-butyric acid; (S)-3- amino-4-(2,4-di chlorophenyl) butyric acid; (S)-3-amino-4-(2-chlorophenyl) butyric acid; (S)-3-amino-4-(2-cyanophenyl) butyric acid; (S)-3-amino-4-(2 -fluorophenyl) butyric acid; (S)-3-amino-4-(2 -furyl) butyric acid; (S)-3-amino-4-(2 -methylphenyl) butyric acid; (S)-3- amino-4-(2-naphthyl)-butyric acid; (S)-3-amino-4-(2 -thienyl) butyric acid; (S)-3-amino-4- (2 -trifluoromethylphenyl) butyric acid; (S)-3-amino-4-(3,4-dichlorophenyl) butyric acid; (S)-3-amino-4-(3,4-difluorophenyl) butyric acid; (S)-3-amino-4-(3 -benzothienyl) butyric acid; (S)-3-amino-4-(3 -chlorophenyl) butyric acid; (S)-3-amino-4-(3 -cyanophenyl) butyric acid; (S)-3-amino-4-(3 -fluorophenyl) butyric acid; (S)-3-amino-4-(3 -methylphenyl) butyric acid; (S)-3-amino-4-(3 -pyridyl) butyric acid; (S)-3-amino-4-(3 -thienyl) butyric acid; (S)-3- amino-4-(3 -trifluoromethylphenyl) butyric acid; (S)-3-amino-4-(4-bromophenyl) butyric acid; (S)-3-amino-4-(4-chlorophenyl) butyric acid; (S)-3-amino-4-(4-cy anophenyl) butyric acid; (S)-3-amino-4-(4-fluorophenyl) butyric acid; (S)-3-amino-4-(4-iodophenyl) butyric acid; (S)-3-amino-4-(4-methylphenyl) butyric acid; (S)-3-amino-4-(4-nitrophenyl) butyric acid; (S)-3-amino-4-(4-pyridyl) butyric acid; (S)-3-amino-4-(4-trifluorom ethylphenyl) butyric acid; (S)-3-amino-4-pentafluoro-phenylbutyric acid; (S)-3-amino-5-hexenoic acid; (S)-3-amino-5-hexinic acid; (S)-3-amino-5-phenylpentanoic acid; (S)-3-amino-6-phenyl-5- hexenoic acid; l,2,5,6-tetrahydropyridine-3-carboxylic acid; l,2,5,6-tetrahydropyridine-4- carboxylic acid; 3-amino-3-(2-chlorophenyl) propionic acid; 3-amino-3-(2-thienyl) propionic acid; 3 -amino-3 -(3 -bromophenyl) propionic acid; 3-amino-3-(4-chlorophenyl) propionic acid; 3 -amino-3 -(4-m ethoxyphenyl) propionic acid; 3-amino-4,4,4- trifluorobutyric acid; 3 -aminoadipic acid; D-P-phenylalanine; P-leucine; L-P-homoalanine; y-benzyl ester of L-P-homoaspartic acid; L-P-homoglutamic acid 5-benzyl ester; L-P- isoleucine; L-P-homoleucine; L-P-homomethionine; L-P-homophenylalanine; L-P- homoproline; L-P-homotryptophan; L-P-homovalin; L-Nco-benzyloxycarbonyl-P- homolysin; Nco-L-P-homoarginine; O-benzyl-L-P-homohydroxyproline; O-benzyl-L-P- homoserine; O-benzyl-L-P-homotreonin; O-benzyl-L-P-homothyrosine; y-trityl-L-P- homoasparagin; (R)-P-phenylalanine; L-P-homoaspartic acid y-tert-butyl ether; L-P- homoglutamic acid 5-tert-butyl ether; L-Nco-P-homolysin; N5-trityl-L-P-homoglutamine; Nco-2,2,4,6,7-penta-dihydrobenzofuran-5-sulfonyl-L-P-homoarginine; O-tert-butyl-L-P- homohydroxy-proline; O-tert-butyl-L-P-homoserine; O-tert-butyl-L-P-homotreonin; O- tert-butyl-L-P-homothyrosine; 2-aminocyclopentane carboxylic acid; and 2- aminocyclohexanecarboxylic acid.

[0079] Analogs of alanine, valine, glycine or leucine such as a-methoxy glycine; a-allyl-L- alanine; a-aminoisobutyric acid; a-methyl leucine; P-(l-naphthyl)-D-alanine; P-(l- naphthyl)-L-alanine; P-(2-naphthyl)-D-alanine; P-(2-naphthyl)-L-alanine; P-(2-pyridyl)-D- alanine; P-(2-pyridyl)-L-alanine; P-(2-thienyl)-D-alanine; P-(2-thienyl)-L-alanine; P-(3- benzothienyl)-D-alanine; P-(3-benzothienyl)-L-alanine; P-(3-pyridyl)-D-alanine; P-(3- pyridyl)-L-alanine; P-(4-pyridyl)-D-alanine; P-(4-pyridyl)-L-alanine; P-chloro-L-alanine; P-cyano-L-alanine; P-cyclohexyl-D-alanine; P-cyclohexyl-L-alanine; P-cyclopenten-l-yl- alanine; P-cyclopentyl alanine; P-cyclopropyl-L-Ala-OH dicyclohexylammonium salt; P- tert-butyl-D-alanine; P-tert-butyl-L-alanine; y-aminobutyric acid; L-a, P-diaminopropionic acid; 2,4-dinitro-phenylglycine; 2,5-dihydro-D-phenylglycine; 2-amino-4,4,4- trifluorobutyric acid; 2-fluoro-phenylglycine; 3-amino-4,4,4-trifluorobutyric acid; 3 -fluorovaline; 4,4,4-trifluoro-valine; 4,5-dehydro-L-Leu-OH dicyclohexylammonium salt; 4- fluoro-D-phenylglycine; 4-fluoro-L-phenylglycine; 4-hydroxy-D-phenylglycine; 5.5,5- trifluoro-leucine; 6-aminohexanoic acid; cyclopentyl-D-Gly-OH dicyclohexylammonium salt; cyclopentyl-Gly-OH dicyclohexylammonium salt; D-a, P-diaminopropionic acid; D- a-aminobutyric acid; D-a-tert-butyl glycine; D-(2 -thienyl) glycine; D-(3 -thienyl) glycine; D-2-aminocaproic acid; D-2-indanylglycine; D-allylglycine dicyclohexylammonium salt; D-cyclohexylglycine; D-norvaline; D-phenylglycine; P-aminobutyric acid; P- aminoisobutyric acid; (2-bromophenyl) glycine; (2-methoxyphenyl) glycine; (2- m ethylphenyl) glycine; (2-thiazoyl) glycine; (2 -thienyl) glycine; 2-amino-3- (dimethylamino) propionic acid; L-a, P-diaminopropionic acid; L-a-aminobutyric acid; L- a-tert-butyl glycine; L-(3 -thienyl) glycine; L-2-amino-3 -(dimethylamino) propionic acid; dicyclohexyl ammonium salt of L-2-aminocaproic acid; L-2-indanylglycine; dicyclohexyl ammonium salt of L-allyl glycine; L-cyclohexylglycine; L-phenylglycine; L- propargylglycine; L-norvaline; N-a-aminomethyl-L-alanine; D-a,y-diaminobutyric acid; L- a,y-diaminobutyric acid; P-cyclopropyl-L-alanine; (N-P-(2,4-dinitrophenyl))-L-a,P- diaminopropionic acid; (N-P-l-(4,4-dimethyl-2,6-dioxocyclohex-l-ylidene) ethyl)-D-a,P- diaminopropionic acid; (N-P-l-(4,4-dimethyl -2,6-dioxocyclohex-l-ylidene) ethyl)-L-a,P- diaminopropionic acid; (N-P-4-methyltrityl)-L-a, P-diaminopropionic acid; (N-P- allyloxycarbonyl)-L-a, P-diaminopropionic acid; (N-y-l-(4,4-dimethyl-2,6-dioxocyclohex- 1-ylidene) ethyl)-D-a,y-diaminobutyric acid; (N-y-l-(4,4-dimethyl-2,6-dioxocyclohex-l- ylidene) ethyl)-L-a,y-diaminobutyric acid; (N-y-4-methyltrityl)-D-a,y-diaminobutyric acid; (N-y-4-methyltrityl)-L-a,y-diaminobutyric acid; (N-y-allyloxycarbonyl)-L-a,y- diaminobutyric acid; D-a -diaminobutyric acid; 4,5-dehydro-L-leucine; cyclopentyl-D- Gly-OH; cyclopentyl-Gly-OH; D-allyl glycine; D-homocyclohexylalanine; L-l- pyrenylalanine; L-2-aminocaproic acid; L-allyl glycine; L-homocyclohexylalanine; and N- (2-hydroxy-4-methoxy-Bzl)-Gly-OH.

[0080] Analogs of arginine or lysine such as citrulline; L-2-amino-3-guanidinopropionic acid; L-2-amino-3-ureidopropionic acid; L-citrulline; Lys (Me)2-0H; Lys (Ns)-OH; N5- benzyloxycarbonyl-L-ornithine; Nco-nitro-D-arginine; Nco-nitro-L-arginine; a-methyl- ornithine; 2,6-diaminopimelic acid; L-ornithine; (N5-1- (4,4-dimethyl-2,6-dioxo-cyclohex- 1-ylidene) ethyl)-D-ornithine; (N5-l-(4,4-dimethyl-2,6-dioxo-cyclohex-l-ylidene) ethyl)- L-ornithine; (N5-4-methyltrityl)-D-ornithine; (N5-4-methyltrityl)-L-ornithine; D-ornithine; L-ornithine; Arg (Me)(Pbf)-OH; Arg (Me)2-0H (asymmetric); Arg (Me)2-0H (symmetric); Lys (ivDde)-OH; Lys (Me)2-0H hydrochloride; Lys (Me3)-0H chloride; Nco-nitro-D- arginine; and Nco-nitro-L-arginine.

[0081] Analogs of aspartic or glutamic acids such as a-methyl-D-aspartic acid; a-methyl glutamic acid; a-methyl-L-aspartic acid; y-methylene-glutamic acid; (N-y-ethyl)-L- glutamine; [N-a-(4-aminobenzoyl)]-L-glutamic acid; 2,6-diaminopimelic acid; L-a- aminosuberic acid; D-2 aminoadipic acid; D-a-aminosuberic acid; a-aminopimelic acid; iminodiacetic acid; L-2-aminoadipic acid; threo-P-methyl-aspartic acid; y-carboxyl-D- glutamic acid y,y-di-tert-butyl ether; y,y-di-tert-butyl ester of y-carboxyl-L-glutamic acid; Glu (OAll)-OH; L-Asu (OtBu)-OH; and pyroglutamic acid.

[0082] Analogs of cysteine and methionine such as Cys(farnesyl)-OH, Cys(famesyl)-OMe, a-methyl-methionine, Cys(2-hydroxyethyl)-OH, Cys(3-aminopropyl)-OH , 2-amino-4- (ethylthio) butyric acid, butionine, butionine sulfoximine, ethionine, methyl sulfonyl methionine chloride, selenomethionine, cysteic acid, [2- (4-pyridyl) ethyl] -DL- penicillamine, [2-(4-pyridylamine )ethyl]-L-cysteine, 4-methoxybenzyl-D-penicillamine, 4-methoxybenzyl-L-penicillamine, 4-methylbenzyl-D-penicillamine, 4-methylbenzyl-L- penicillamine, benzyl-D-cysteine, benzyl-L-cysteine, benzyl-DL-homocysteine, carbamoyl-L-cysteine, carboxyethyl-L-cysteine, carboxymethyl-L-cysteine, diphenylmethyl-L-cysteine, ethyl-L-cysteine, methyl-L-cysteine, tert-butyl-D-cysteine, trityl-L- homocysteine, trityl-D-penicillamine, cystathionine, homocystine, L-homocystine, (2-aminoethyl)-L-cysteine, seleno-L-cystine, cystathionine, Cys(StBu)-OH and acetamidomethyl-D-penicillamine.

[0083] Analogs of phenylalanine and tyrosine such as P-methyl-phenylalanine, P- hydroxyphenylalanine, a-methyl-3 -methoxy -DL-phenylalanine, a-methyl-D- phenylalanine, a-methyl-L-phenylalanine, 1,2, 3, 4-tetrahydroisoquinoline-3 -carboxylic acid, 2,4-dichloro-phenylalanine, 2-(trifluoromethyl)-D-phenylalanine, 2-(trifluoromethyl)-

[0084] L-phenylalanine, 2-bromo-D-phenylalanine, 2-bromo-L-phenylalanine, 2-chloro-D- phenylalanine, 2-chloro-L-phenylalanine, 2-cyano-D-phenylalanine, 2-cyano-L- phenylalanine, 2-fluoro-D-phenylalanine, 2-fluoro-L-phenylalanine, 2-methyl-D- phenylalanine, 2-methyl-L-phenylalanine, 2-nitro-D-phenylalanine, 2-nitro-L- phenylalanine, 2,4,5-trihydroxy-phenylalanine, 3,4,5-trifluoro-D-phenylalanine, 3,4,5- trifluoro-L-phenylalanine, 3,4-dichloro-D-phenylalanine, 3,4-Dichloro-L-phenylalanine,

[0085] 3,4-difluoro-D-phenylalanine, 3,4-difluoro-L-phenylalanine, 3,4-dihydroxy-L- phenylalanine, 3,4-dimethoxy-L-phenylalanine, 3,5,3'-triiodo-L-tyronine, 3,5-diiodo-D- tyrosine, 3,5-diiodo-L-tyrosine, 3,5-diiodo-L-tyronine, 3-(trifluoromethyl)-D- phenylalanine, 3-(trifluoromethyl)-L-phenylalanine, 3-amino-L-tyrosine, 3-bromo-D- phenylalanine, 3-bromo-L-phenylalanine, 3-chloro-D-phenylalanine, 3-chloro-L- phenylalanine, 3-chloro-L-tyrosine, 3-cyano-D-phenylalanine, 3-cyano-L-phenylalanine, 3- fluoro-D-fenylalanine, 3-fluoro-L-phenylalanine, 3 -fluoro-tyrosine, 3-iodine-D- phenylalanine, 3-iodine-L-phenylalanine, 3-iodine-L-tyrosine, 3 -methoxy -L-tyrosine, 3- methyl-D-phenylalanine, 3-methyl-L-phenylalanine, 3-nitro-D-phenylalanine, 3-nitro-L- phenylalanine, 3-nitro-L-tyrosine, 4-(trifluoromethyl)-D-phenylalanine, 4-

[0086] (trifluoromethyl)-L-phenylalanine, 4-amino-D-phenylalanine, 4-amino-L-phenylalanine, 4- benzoyl-D-phenylalanine, 4-benzoyl-L-phenylalanine, 4-bis(2-chloroethyl)amino L- phenylalanine, 4-bromo-D-phenylalanine, 4-bromo-L-phenylalanine, 4-chloro-D- phenylalanine, 4-chloro-L-phenylalanine, 4-cyano-D-phenylalanine, 4-cyano-L- phenylalanine, 4-fluoro-D-phenylalanine, 4-fluoro-L-phenylalanine, 4-iodo-D- phenylalanine, 4-iodo-L-phenylalanine, homophenylalanine, thyroxine, 3,3-difenilalanine, thyronine, tyrosine and ethyl-methyl-tyrosine.

[0087] Analogs of proline such as 3,4-dehydro-proline, 4-fluoro-proline, cis-4-hydroxy- proline, thiazolidine-2-carboxylic acid, and trans-4-fluoro-proline.

[0088] Analogs of serine and threonine such as 3-amino-2-hydroxy-5-methylhexanoic acid, 2-amino-3-hydroxy-4-methylpentanoic acid, 2-amino-3-ethoxybutanoic acid, 2- amino-3- methoxybutanoic acid, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-amino-3- benzyl oxy propionic acid, 2-amino-3 -benzyl oxy propionic acid, 2-amino-3 -ethoxypropionic acid, 4-amino-3 -hydroxybutanoic acid and a-methylserine.

[0089] Analogs of tryptophan such as a-methyl tryptophan; P-(3-benzothienyl)-D-alanine; P-(3-benzothienyl)-L-alanine; 1 -methyltryptophan; 4-methyltryptophan; 5- benzyloxytryptophan; 5 -bromo-tryptophan; 5-chloro-tryptophan; 5 -fluoro-tryptophan; 5- hydroxy -tryptophan; 5 -hydroxy -L-tryptophan; 5-methoxytryptophan; 5 -methoxy -L- tryptophan; 5 -methyltryptophan; 6-bromo-tryptophan; 6-chloro-D-tryptophan; 6-chloro- tryptophan; 6-fluoro-tryptophan; 6-methyltryptophan; 7-benzyloxytryptophan; 7-bromo- tryptophan; 7-methyltryptophan; D- 1,2, 3, 4-tetrahydro-norgarman-3 -carboxylic acid; 6- methoxy-l,2,3,4-tetrahydronorgarman-l-carboxylic acid; 7-azatri ptophan; L-1,2,3,4- tetrahydro-norgarman-3-carboxylic acid; 5-methoxy-2-methyl-tryptophan; and 6-chloro-L- try ptophan.

[0090] In some embodiments, each nonstandard amino acid is independently selected from canavanine, cucurbitine, albizziin, laminine, kainic acid, a-diamino acids, P-diamino acids, hydroxyproline, a,a-dialkyl glycines, and azacyclic amino acids. In some embodiments, each nonstandard amino acid is independently selected from p-azido-l-phenylalanine, 4- iodo-l-phenylalanine, 4-methyl-l-phenylalanine, 2-naphthyl-l-alanine, and O-methyl- tyrosine.

[0091] Generally speaking, the present disclosure provides methods for synthesizing artificial peptides and / or proteins, translated in a cell-free system from cDNA or mRNA. Each of the synthesized peptides and / or proteins can have multiple nonstandard amino acids and / or other synthetic elements inserted into their amino acid sequence via the disclosed cell-free translation system, in some embodiments sequentially (e.g., back-to-back) within a single peptide or protein. The present disclosure therefore provides methods and systems capable of producing engineered peptides having complex chemistries at targeted locations throughout the peptide chain, via the introduction of one or more nsAAs into a peptide and / or protein during translation. In some embodiments, the disclosed methods are coupled to an in vitro mRNA display technique, making the peptides or proteins generated from the disclosed methods suitable for screening as potential drug candidates, therapeutic adjuvants, and / or the like. Thus, in some embodiments, the present disclosure provides methods and systems capable of cell-free introduction of nsAAs and / or other synthetic elements into peptides and / or proteins suitable for use in mRNA display.

[0092] In various aspects, methods provided by the present disclosure take advantage of the concepts of ribosomal pausing and repurposing of stop codons, particularly in the context of cell-free translation, in order to regulate and intentionally modify peptide synthesis by pausing and restarting ribosome activity during translation. Pausing and modification can occur by any number of ways; in some embodiments, ribosomal pausing and modification of peptide synthesis occurs via selective deprivation of amino acids during cell-free translation. In some embodiments, ribosomal pausing and modification of peptide synthesis occurs via selective deprivation of release factors during cell-free translation. In some embodiments, ribosomal pausing and modification of peptide synthesis occurs via both selective deprivation of amino acids and selective deprivation of release factors during cell- free translation. In some embodiments, the present disclosure provides methods that modulate the translational machinery during peptide synthesis by pausing and restarting ribosomal peptide synthesis in methods involving mRNA display techniques.

[0093] Methods provided by the present disclosure also take advantage of orthogonal translation systems, in that synthetic tRNAs and their corresponding aminoacyl-tRNA synthetases can be designed to be orthogonal to natural translation machinery. This allows for precise incorporation of a plurality of nsAAs into a single peptide and / or protein without otherwise interfering with normal or natural protein synthesis.

[0094] Cell-free ribosomal translation is a method useful for the synthesis of peptides and / or proteins outside of living cells. This process is commonly utilized in research and biotechnological applications, for example protein expression, synthetic biology, and drug development. The present disclosure provides systems and methods for the introduction of multiple nsAAs and / or other synthetic elements into peptides or proteins via the use of engineered mRNAs and tRNAs, ribosomal pausing, repurposing stop codons, and combinations of any of the foregoing. The ability to incorporate a plurality of nsAAs into a single peptide and / or protein via the disclosed methods and systems presents significant advantages for protein engineering. Using methods provided by the present disclosure, peptides and / or proteins can be created that display new chemical functionalities, for example fluorescent groups, photocrosslinking sites, post-translational modifications (e.g., phosphorylation or glycosylation), and other functionalities can now be intentionally directly into peptides and / or proteins at specific sites. Methods and systems provided by the present disclosure allow for expansion of the genetic code in a way that has not been seen before. The intentional introduction of multiple nsAAs into peptides and / or proteins allows for the study of novel chemical reactivity, protein folding, interactions, immunogenicity, and function. Methods provided by the present disclosure can be used to label proteins with novel chemical tags for imaging, detection, or purification purposes; create new proteinaceous materials such as enzymes with tailored properties such as enhanced stability, catalysis, or binding properties.

[0095] The disclosed methods and systems also have applications in drug discovery. By intentionally and selectively introducing a plurality of nsAAs with unique functional groups, researchers can design and screen libraries of proteins that bind to or otherwise effect specific targets with greater precision, as more than one modification can be made to each peptide and / or protein at a time. The disclosed methods and systems therefore have use in drug discovery and targeted therapeutics, especially for the creation of proteins and / or peptides that can bind to specific molecules or cells.

[0096] The disclosed methods and systems overcome many limitations associated with known cell-free translation systems. For example, until the filing of this application it was not known that cell-free translation systems could be used to insert more than one nonstandard amino acid per codon into a single peptide and / or protein, much less that it was possible to do so in an intentional, planned manner. Additionally, inserting any one nsAA via known cell-free translation systems is often much more inefficient than the insertion of standard amino acids, particularly in more complex organisms or large-scale systems. In contrast, the disclosed methods and systems can be used to efficiently create mutant peptides and / or proteins that incorporate one or a series of nsAAs in a coordinated manner.

[0097] Artificial Peptide Synthesis

[0098] The present disclosure is drawn, inter alia, to novel methods and systems related to cell-free introduction of multiple nsAAs into a single peptide and / or protein via the use of cell-free translation techniques. The disclosed methods and systems include cell-free pausing and unpausing of a ribosome during a translation reaction.

[0099] Methods provided by the present disclosure generally include the cell-free translation of a synthetic mRNA, where the mRNA contains one, two, or multiple codon sites for insertion of an nsAA and / or other synthetic element into the sequence of a peptide and / or protein of interest. The ribosome can pause before, after, between, and / or at each insertion site / codon during translation to facilitate introduction of an nsAA, or the nsAA can be inserted during translation without pausing via the use of one or more synthetic tRNAs. Unlike other known methods for artificial peptide synthesis, the disclosed methods do not require the ribosome to pause each and every time insertion of any amino acid, or nsAA, occurs. Instead, translation occurs as expected, with the ribosome placed into contact with enough components to facilitate the uninterrupted translation of the mRNA up to a desired point. That desired point may be, but does not have to be, a codon site for insertion of an nsAA. Ribosomal pausing is used as a means of removing cell-free translation mixes and replacing them with new mixes that contain different components for continued translation. In some embodiments, the ribosome is paused on an insertion site for an nsAA. In some embodiments, the ribosome is paused on an insertion site for a synthetic element. In some embodiments, the ribosome is paused simply to allow for the exchange of cell-free translation mixes, facilitating the introduction of a first series of components into the peptide and / or protein via a first translation mix which is removed at the pause, followed by the introduction of a second series of components into the peptide and / or protein via a second translation mix that is placed into contact with the ribosome after removal of the first. The ribosome can be paused numerous times during translation of a single mRNA, thereby allowing for intermittent contact with a variety of cell-free translation mixes, facilitating the introduction of numerous nsAAs into a single peptide and / or protein as well as the creation of a large number of protein or peptide variants from a single synthetic mRNA. Large libraries of synthetic variants can be created for screening.

[0100] The disclosed methods generally include: the creation of a synthetic mRNA having a coding sequence with at least one, two three or more codons serving as insertion sites for nsAAs or other synthetic elements; contacting the mRNA with a first translation mix and initiating translation; pausing the ribosome at least one time during translation in order to remove the first mix and replace it with a second translation mix; and completing translation and separating the peptide and / or protein from the ribosome and final tRNA. nsAAs are incorporated into the peptide and / or protein at each insertion site. Optionally, the mRNA may be immobilized to a solid support during performance of the methods, to facilitate the removal and replacement of mixes. Optionally, the ribosome may be paused at the conclusion of translation in order to incorporate a synthetic element capable of linking the peptide and / or protein translated from the mRNA with the mRNA itself, thereby creating an mRNA display product. In one aspect, the present disclosure provides a peptide and / or protein incorporating multiple nsAAs into its sequence, in some instances sequentially, that is synthesized by reassigning stop codons introduced into a synthetic mRNA molecule. In some embodiments, a peptide and / or protein incorporating multiple nsAAs that is synthesized by reassigning stop codons multiple times in a single peptide and / or protein is provided. In some embodiments, such peptide is a therapeutic peptide. In another aspect, the present disclosure provides an mRNA molecule for use in reassignment of a stop codon multiple times to incorporate multiple unique nsAAs in a single peptide.

[0101] In one aspect, the disclosure is drawn to methods for reassignment of a stop codon to incorporate nsAAs into a single peptide and / or protein. In some embodiments, one or more methods for reassignment of a stop codon multiple times to incorporate multiple unique nsAAs into a single peptide and / or protein are provided. In certain embodiments, some or all of the incorporated nsAAs are unique, while in other embodiments a non-unique nsAA is incorporated at multiple targeted sites in a peptide. In one embodiment, a stop codon may be reassigned at least one or more times to incorporate multiple unique nsAAs in a residue-specific manner in a single peptide and / or protein. In another embodiment, a stop codon may be reassigned at least one or more times to incorporate multiple unique nsAAs in a site-specific manner in a single peptide and / or protein. In some embodiments, more than one type of stop codon may be reassigned at least one or more times each to incorporate multiple unique nsAAs in a residue-specific manner in a single peptide and / or protein. In some embodiments, more than one type of stop codon may be reassigned at least one or more times each to incorporate multiple unique nsAAs in a site-specific manner in a single peptide and / or protein. In certain embodiments, a method of reassignment of amber stop codons at one or more sites for targeted incorporation of multiple unique nsAAs into a peptide and / or protein is provided. In such a method, repeated amber stop codon suppression may be used to synthesize multiple unique nsAA-containing peptides from a single mRNA template. In certain embodiments, a method of reassignment of an amber stop codon at one or more sites for targeted incorporation of multiple unique nsAAs into a therapeutic peptide is provided. In such a method, repeated amber stop codon suppression may be used to synthesize multiple unique nsAA-containing therapeutic peptides from a single mRNA template. Embodiments of the present disclosure are also directed to reassignment of sense codons to incorporate multiple nsAAs in a single peptide. In each of the foregoing embodiments, “unique” nsAAs are any of those provided herein. A description of the disclosed methods follows. Not all of the following steps are necessarily required for the successful performance of the disclosed methods.

[0102] Preparation of mRNA

[0103] The disclosed systems and methods begin with the creation of messenger RNA (mRNA) that encode a peptide or protein of interest. The mRNA can either be synthesized chemically or transcribed from a plasmid or other DNA template using RNA polymerase in vitro. The platform technology described herein can be used to translate any mRNA sequence, natural or synthetic. As such, it is not limited to any single mRNA sequence; while the Examples below provide information on proof-of-concept systems, the systems and methods disclosed herein are fully operational and functional with any mRNA sequence input.

[0104] Without limiting the generality of the foregoing, suitable mRNA for use in the disclosed methods can include a 5' untranslated region, a coding sequence containing insertion sites for two or more nsAAs, and a 3' untranslated region, among other things. The coding sequence is that portion of the mRNA that codes for the peptide and / or protein of interest, and which will contain one or more insertion sites. An insertion site in the coding region of an mRNA is a site where a tRNA (natural or synthetic) will insert an nsAA into the peptide and / or protein being translated from the mRNA. In that regard, the mRNA can be designed to include one, two, three or more specific codons within its coding region that correspond to the anticodon of a tRNA that has been charged with an nsAA. As described in greater detail below, that tRNA will insert the nsAA into the nascent peptide and / or protein being translated, at the engineered insertion site. This insertion occurs precisely at the engineered insertion site, using typical cell-free translation components, for example via the use of naturally occurring ribosomes, albeit in a cell-free manner.

[0105] In some embodiments, suitable mRNA for use in the disclosed methods include a coding sequence containing a single insertion site for a single nsAA. In some embodiments the coding sequence contains two insertion sites for insertion of two nsAAs, which may be the same or may be different. In some embodiments the coding sequence contains three insertion sites for insertion of three nsAAs, which may all be the same or each may independently be the same as, or different from, any of the others. In some embodiments the coding sequence contains four insertion sites for insertion of four nsAAs, which may all be the same or each may independently be the same as, or different from, any of the others. In some embodiments the coding sequence contains five insertion sites for insertion of five nsAAs, which may all be the same or each may independently be the same as, or different from, any of the others. In some embodiments the coding sequence contains six insertion sites for insertion of six nsAAs, which may all be the same or each may independently be the same as, or different from, any of the others. In some embodiments the coding sequence contains seven insertion sites for insertion of seven nsAAs, which may all be the same or each may independently be the same as, or different from, any of the others. In some embodiments the coding sequence contains eight insertion sites for insertion of eight nsAAs, which may all be the same or each may independently be the same as, or different from, any of the others. In some embodiments the coding sequence contains nine insertion sites for insertion of nine nsAAs, which may all be the same or each may independently be the same as, or different from, any of the others. In some embodiments the coding sequence contains ten insertion sites for insertion of ten nsAAs, which may all be the same or each may independently be the same as, or different from, any of the others. The foregoing pattern can continue, with the total number of insertion sites increasing to suit any desired mRNA sequence. For example., the coding sequence may contain 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more insertion sites in a single mRNA. In various aspects, during translation of each mRNA using the disclosed methods, a ribosome may pause at each insertion site in order to facilitate the insertion of an nsAA, or it may proceed normally by inserting an nsAA into an insertion site without pausing.

[0106] In some embodiments, suitable mRNA for use in the disclosed methods include a coding sequence that may be conceptually separated into more than one section, each section independently containing a single insertion site for insertion of a single nsAA into each section, which may all be the same or each may independently be the same as, or different from, any of the others. In some embodiments, the coding sequence is separated into two sections, each section independently containing one, two, three, four, or more insertion sites for insertion of nsAAs into each section; the nsAAs may all be the same, they may all be different, or each may independently be the same as, or different from, any of the others. In some embodiments, the coding sequence is separated into three sections, each section independently containing one, two, three, four, or more insertion sites for insertion of nsAAs into each section; the nsAAs may all be the same, they may all be different, or each may independently be the same as, or different from, any of the others. This patter may continue, with each mRNA conceptually separated into as many sections as desired in order to achieve the desired sequence of nsAA insertion into the final peptide and / or protein. With respect to use of the term “conceptually” in these embodiments, by way of example an mRNA coding sequence may include a total of five nsAA insertion sites (for example, five repurposed stop codons); translation of this mRNA may proceed via ribosome as described herein, with the ribosome pausing at each nsAA insertion site for the insertion of an nsAA. Each pause site represents the conceptual end of a section of the coding sequence, such that in this example, the coding sequence would have a total of five sections, each culminating at an nsAA insertion site. In some embodiments, the ribosome is intentionally paused at the end of each section, for example for the insertion of an nsAA into an insertion site. In that regard, the pause may occur at an engineered insertion site, at a stop codon, or at a site for insertion of a regular amino acid. Pausing may occur, for example, via selective deprivation of amino acids and / or selective deprivation of release factors.

[0107] Preparation of Cell-Free Mix

[0108] Once the mRNA is synthesized, it can be translated outside of a cellular system by placing it into contact with a cell-free translation mix. A cell-free translation mix is exactly what the name implies - a mixture of components that are needed in order to cause translation to occur, in a medium that will allow for ribosomal assembly and operation as if in a cellular environment. Cell-free translation mixes can be derived from the cytoplasm of a number of cells. Suitable cells include E. coll. but other systems like rabbit reticulocyte lysates, wheat germ mixes, or other mammalian cells can be used. Many cell-free systems are commercially available (e.g., from Thermo Fisher Scientific, Inc., Waltham, MA, USA) and could be suitable for use in the context of the present disclosure. More preferably, however, the present disclosure utilizes custom cell-free translation mixes that withhold some element, in order to facilitate ribosomal pausing. In some embodiments, a cell-free translation mix withholds a single amino acid, thereby facilitating ribosomal pausing at a codon encoding that amino acid. In some embodiments, a cell-free translation mix withholds more than one amino acid, thereby facilitating ribosomal pausing at a codon encoding each withheld amino acid. In some embodiments, a cell-free translation mix withholds release factors, thereby facilitating ribosomal pausing at a stop codon that would otherwise rely on the withheld release factors in order to disassociate the ribosome from the mRNA.

[0109] The mix typically contains ribosomes, transfer RNAs (tRNAs), amino acids, and other essential translation machinery, in a medium that mimics the cellular environment or conditions, to facilitate translation. The mix is typically prepared by breaking open the cells, followed by centrifugation to remove cellular debris, leaving the soluble proteins, enzymes, ribosomes, and other necessary components in the supernatant.

[0110] In some embodiments, a cell-free translation mix suitable for use in the disclosed methods and with the disclosed systems contains all of the cellular components needed to translate the complete mRNA coding sequence into a peptide or protein. In some embodiments, a cell-free translation mix suitable for use in the disclosed methods and with the disclosed systems contains all of the cellular components needed to translate the complete mRNA coding sequence into a peptide or protein, with the exception of a single amino acid and / or tRNA-charged with that amino acid; in this way, when placed into contact with the mRNA, the mix will allow for translation of the mRNA until such time as the amino acid is needed for insertion into the peptide or protein, at which point the ribosome will pause and remain in place on the mRNA until such time as the withheld amino acid is put into contact with the ribosome. Translation will then resume as normal. In some embodiments, the mix does not contain two amino acids and / or two tRNA-charged with those amino acids, resulting in ribosomal pausing at two codons during translation. In some embodiments, the mix does not contain three amino acids and / or three tRNA-charged with those amino acids, resulting in ribosomal pausing at three codons during translation.

[0111] In some embodiments, a cell-free translation mix suitable for use in the disclosed methods and with the disclosed systems contains all of the cellular components needed to translate the complete mRNA coding sequence into a peptide or protein, but is lacking the release factors that would cause the ribosome to release from the mRNA upon encountering a stop codon. When a ribosome encounters a stop codon during protein synthesis, a release factor binds to the codon and triggers the release of the completed peptide or protein from the last tRNA molecule. When release factors are not present in the mix, the ribosome is reversibly prevented from doing so. In this way, when placed into contact with the mRNA, the mix that is lacking release factors will allow for translation of the mRNA until such time as the ribosome encounters a stop codon, at which point the ribosome will pause and remain in place on the mRNA until such time as some further action is taken, such as contacting the ribosome with a tRNA containing an anticodon to the stop codon that is charged with an nsAA or other synthetic element, at which point translation resumes as normal, incorporating the nsAA or synthetic element into the peptide or protein. If the ribosome is then contacted with the proper release factors, it will disassociate from the mRNA, terminating translation. There are three types of known stop codons: UAA, the ochre stop codon; UAG, the amber stop codon; and UGA, the opal or umber stop codon. In bacteria, these three stop codons are recognized by two different sets of release factors: release factor 1 (RF1) recognizes both the ochre and amber stop codons; whereas RF2 recognizes the opal or umber stop codon. In eukaryotic cells, a single release factor (eRFl) recognizes all three stop codons. Depending on the origin of the ribosomes in the mix (e.g., bacterial or eukaryotic), and depending upon the sequence of the mRNA being translated, withholding a release factor will cause the ribosome to pause on a specific type of stop codon. For example, if the mRNA contains an amber stop codon in its coding sequence that is intended to be the site for insertion of an nsAA, but the coding sequence also terminates at an opal stop codon, then contacting that mRNA with an mix that contains bacterial ribosomes and that is devoid of RF1 - but includes RF2 - will cause the ribosome to pause at the amber stop codon for insertion of the nsAA. After insertion, the ribosome will complete translation and, upon encountering the opal stop codon, release the peptide or protein from the ribosome and tRNA.

[0112] In some embodiments, a cell-free translation mix suitable for use in the disclosed methods and with the disclosed systems contains all of the cellular components needed to translate the complete mRNA coding sequence into a peptide or protein, but is lacking RF1. In some embodiments, a cell-free translation mix suitable for use in the disclosed methods and with the disclosed systems contains all of the cellular components needed to translate the complete mRNA coding sequence into a peptide or protein, but is lacking RF2.

[0113] In some embodiments, a cell-free translation mix suitable for use in the disclosed methods and with the disclosed systems contains all of the cellular components needed to translate the complete mRNA coding sequence into a peptide or protein, but is lacking eRFl.

[0114] Immobilization

[0115] Optionally, the synthetic mRNA can be immobilized prior to translation, in order to facilitate the removal of one or more translation mixes. The manner in which the mRNA is immobilized can vary to suit many translation situations. For example, in some embodiments the synthetic mRNA is secured directly or indirectly to a support to immobilize it. The mRNA may be attached by way of hybridizing to an immobilization or linker oligonucleotide which is in turn directly or indirectly attached to a support. Alternatively, the mRNA itself may be attached directly or indirectly (e.g., via a linker) to a support surface. In some embodiments, an immobilization oligonucleotide is used that is configured to hybridize to a portion of the mRNA and also to bind to a support.

[0116] In such embodiments, a linker oligonucleotide is utilized that is configured to hybridize to the mRNA over at least a portion of its length and also to bind to a support structure of some form. The linker can be DNA- or RNA-based, however greater stability can be gained via the use of a DNA-based linker molecule. In such embodiments, the linker oligonucleotide has a nucleic acid sequence that is complimentary and / or that will base-pair with a portion of the sequence of the mRNA. In that regard, the linker oligonucleotide has a sequence that hybridizes to a sequence of the mRNA based on Watson-crick base pairing between a fixed region within the mRNA and a complimentary sequence within the linker oligonucleotide, under conventional hybridization conditions, in some embodiments under stringent conditions (see, e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual, 3. Ed. (2001) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). This way, the linker oligonucleotide forms a double-stranded duplex structure with the mRNA over a portion of its 3’ length. The length of the double-stranded duplex can vary to suit varying translation conditions. In some embodiments, the length of the double-stranded duplex is about 10 - about 20 nucleotides in length, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides in length.

[0117] In some embodiments, the linker oligonucleotide may be a “universal” oligonucleotide in that it is configured to hybridize to a sequence of the mRNA that is present in all mRNA sequences presented, for example in a setting where a multitude of mRNA sequences are presented for the generation of a library, as provided herein. In some embodiments the mRNA is synthesized to include adapter sequences that allow for immobilization to magnetic beads. In such embodiments, mRNA libraries are prepared by using biotinylated adapter sequences to hybridize with mRNAs for on-bead translation (see Fig. 1 A). In the embodiment depicted in Fig. 1 A, the linker oligonucleotide is shown as a dashed line and the mRNA as a sold line, to clearly depict a region of double-stranded overlap with a small region of DNA that is complementary to a section near the 3 ’-end of the library mRNA. The biotin linker is depicted as “B” bound to a solid magnetic bead. In some embodiments, mRNA libraries are prepared for mRNA display upon completion of translation by ligating a puromycin linker (P -linker) with a small region of DNA that is complementary to a section near the 3 ’-end of the library mRNA (see Fig. IB). In the Fig. IB embodiment, puromycin is shown as “P” bound via a polyethylene ((C2H4)„) and nucleotide-containing sequence via a ligation site (open circle). In Y-ligation, a linker oligonucleotide having a Y-shaped structure is used to efficiently hybridize to the mRNA via one arm of the Y-shaped structure, while containing some means for connecting to magnetic beads via the other arm of the Y shaped structure. In this regard, the mRNA becomes connected to a magnetic bead which, in turn, provides a solid surface to perform translation on, allowing for easy separation and purification of translation mixes and the final, translated peptide and / or protein. In the depicted embodiment, the Y-ligation approach makes use of a puromycin linker (P-linker) with a small region of DNA that is complementary to a section near the 3 ’-end of the library mRNA; this complementarity scaffolds a ligation between the library and the P-linker (Fig. 1C). Biotin (B) is included near the 5’-end of the P-linker during synthesis, allowing streptavidin capture after Y- ligation in preparation for controlled translation (Fig. 1C). This design leaves puromycin free to access the ribosome in mRNA display techniques, as provided herein.

[0118] In some embodiments the mRNA is synthesized to include adapter sequences that allow for immobilization to magnetic beads. In such embodiments, mRNA libraries are prepared by using biotinylated adapter sequences to hybridize with mRNAs for on-bead translation. In such embodiments, mRNA is immobilized by its 3 ’-end using a biotinylated (B) primer (see Fig. 1 A). In the depicted embodiment, the linker oligonucleotide approach makes use of a biotinylated linker with a small region of DNA that is complementary to a section near the 3 ’-end of the library mRNA; this complementarity scaffolds a ligation between the library and the biotinylated linker. Biotin allows streptavidin capture after ligation in preparation for controlled translation.

[0119] To hybridize the mRNA to the linker oligonucleotide, the two are incubated together under conditions sufficient for the engineered 3’ portion of the mRNA to hybridize to the linker oligonucleotide. The conditions that will result in successful hybridization can vary between reactions. Typical RNA-DNA hybridization conditions usually involve a hybridization temperature of about 50° C - about 110° C in a solution containing moderate salt concentration and often include a denaturing agent like formamide to facilitate strand separation, allowing for specific binding between complementary RNA and DNA sequences. In some embodiments, hybridization occurs by heating a mixture of the mRNAs and the linker oligonucleotides to at least about 80° C, e.g. 85° C, 86° C, 87° C, 88° C, 89° C, 90° C, 91° C, 92° C, 93° C, 94° C, 95° C, 96° C, 97° C, 98° C, 99° C, or 100° C for at least about 10 seconds, 15 second, 20 seconds, 25 seconds, 30 seconds, 45 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, or more. The method may further comprise cooling the hybridized mRNA-linker oligonucleotide to a temperature lower than about 20° C, 15° C, 10° C, 9° C, 8° C, 7° C, 6° C, 5° C, 4° C or lower. In some embodiments, the temperature is reduced to the target temperature immediately by quenching, for example in ice. In some embodiments, the temperature is dropped incrementally, for example via 5° C increments, until the target temperature is reached.

[0120] Hybridization is typically carried out prior to immobilization of the mRNA-linker complex to the support, though this is not required. In an alternative embodiment, the linker oligonucleotide is attached to the support prior to hybridization of the mRNA.

[0121] In some embodiments, the hybridized mRNA-linker complex may be modified for attachment to a support surface other than a magnetic bead. For example, the linker oligonucleotide may be attached to a solid support via a silane linkage. Alternatively or in addition, the linker oligonucleotide may be succinylated so that it will attach to aminophenyl or aminopropyl-derivatized glass. In some embodiments, the linker oligonucleotide comprises an NH2 modification so that it will attach to epoxy silane or isothiocyanate coated glass. In some embodiments, the linker oligonucleotide is hydrazide-modified in order to attach to an aldehyde or epoxide molecule.

[0122] In some embodiments, the linker is synthesized to include a means for easy removal from the support. For example, the linker may include a restriction endonuclease site that allows it to be cleaved away from the support readily.

[0123] Preparation of Synthetic tRNAs

[0124] In some embodiments, a synthetic tRNA is generated for the incorporation of an nsAA or other synthetic element into a peptide or protein during translation. In such embodiments, a ribosome can be contacted with the synthetic tRNA in order to allow incorporation of the nsAA or other synthetic element into the peptide or protein via the ribosome. Creation of a synthetic tRNA is a multi-step process, including designing the tRNA, modifying its structure, and introducing it into the translation system.

[0125] Generation of an Anticodon Sequence: the first step is to design the anticodon of the synthetic tRNA which will base-pair with the desired codon in the mRNA. To introduce an nsAA, the anticodon may correspond to a codon that is not typically used for a native amino acid, or it may be a reassigned codon (e.g., a stop codon or a codon normally coding for an existing amino acid). The mRNA codon in the coding sequence that is the desired location for insertion of an nsAA may be chosen based on the specificity of the tRNA anticodon. In some embodiments, an nsAA is inserted into an mRNA that has been engineered with a stop codon via the use of a synthetic tRNA that contains the nsAA and that contains the anticodon to the particular stop codon engineered into the mRNA.

[0126] Once the anticodon is chosen, the full-length tRNA sequence is constructed. This includes generation of the acceptor stem where the nsAA is attached, as well as the D-loop, T-loop, and anticodon loop, containing the target anticodon.

[0127] The synthetic tRNA is then charged with the nsAA or other synthetic element. This typically involves an aminoacyl-tRNA synthetase that is specific for the nsAA or synthetic element. In some embodiments, the tRNA is engineered to be recognized by a modified or engineered aminoacyl-tRNA synthetase that can charge the synthetic tRNA with the nonstandard amino acid. If the aminoacyl-tRNA synthetase for the nsAA doesn't exist, it can be engineered by mutating an existing synthetase to accept the nsAA. Alternatively, orthogonal systems (e.g., pyrrolysyl-tRNA synthetase, flexizymes, and the like) can be used to avoid crosstalk with endogenous tRNAs and aminoacyl-tRNA synthetases (see, e.g., Ohuchi et al., Curr Opin Chem Biol. (2007); 11(5): 537-42; Wan et al., Biochim Biophys Acta. (2014); 1844(6): 1059-70).

[0128] Synthetic tRNAs, and their corresponding aminoacyl-tRNA synthetases, can then be added to a cell-free translation mix for insertion into a peptide or protein at a desired location along an engineered mRNA. allowing for incorporation of the nsAA during translation.

[0129] Addition o f Components

[0130] Once the mRNA is synthesized and the cell-free mix is prepared in the desired manner (e.g., withholding those items that will facilitate the insertion of an nsAA into the peptide and / or protein), the mRNA, ribosomes, desired tRNAs and their corresponding aminoacyl-tRNA synthetases or orthogonal systems, amino acids, and optionally one or more nsAAs are put into contact with each other. An energy source (e.g., ATP and GTP) is typically also added. Translation can then occur in a suitable buffer.

[0131] The temperature of the translation reaction can vary. In some embodiments, the temperature of the translation reaction occurs at room or ambient temperature, for example at a temperature of about 18°C - about 25°C. In some embodiments, translation occurs at a temperature below room or ambient temperature, for example at a temperature of about 0°C - about 15°C. In some embodiments, the temperature of the translation reaction is modified at one or more points, to account for and optimize different processes that occur. In some embodiments, those portions of the translation reaction that rely on the operation of one or more enzymes occur at a temperature optimized for the enzyme(s), for example at about 35°C - about 40°C, in some embodiments about 37°C. In some embodiments, during a pause in the translation reaction and / or during those times in which translation mixes are being removed and reintroduced, the temperature of the paused translation reaction is reduced well below room or ambient temperature, for example at about -5°C - about 10°C.

[0132] Translation

[0133] Translation starts when the ribosomes bind to the mRNA and encounter the start codon (e.g., AUG). This typically relies upon the assistance of initiation factors, which are present in the cell-free mix. Ribosomal subunits (large and small) assemble on the mRNA at the start codon, with the help of initiation factors and the initiator tRNA, which carries the anticodon for the start codon (e.g., UAC). In some embodiments, the cell-free mix includes a synthetic tRNA having the anticodon to the start codon, but that has been charged with an nsAA. In such embodiments, the nsAA will be inserted at the first position of the peptide and / or protein instead of methionine.

[0134] After initiation, the ribosome starts translating the mRNA into a peptide and / or protein by reading the codons on the mRNA and linking the appropriate amino acids. The ribosome moves along the mRNA, one codon at a time, and with the help of elongation factors, it adds the corresponding amino acids to the growing polypeptide chain. tRNAs bring specific amino acids, nsAAs, and / or other synthetic elements to the ribosome, where the ribosome catalyzes the formation of peptide bonds between the amino acids, nsAAs and / or synthetic elements. The ribosome shifts along the mRNA, a process called translocation, and new amino acids are continuously added to the chain.

[0135] Ribosomal Pausing

[0136] A limitation of promiscuous orthogonal aminoacyl-tRNA synthetases (ORSs), whether natural or engineered, is that they require a user to pre-select a single defined ORS / nsAA pair in a translation reaction. Similarly, the use of aa-tRNAs that have been previously charged with nsAAs via the flexizyme system (a ribozyme that catalyzes aminoacylation of tRNA with amino acids) is limited to pre-specified codon / anti codon pairs. Prior to the filing of the instant application, there was no way to change and re-define enzyme specificity (enzyme-substrate interaction) in situ during a translation reaction. The present disclosure provides methods that overcome this limitation.

[0137] In various aspects, the present disclosure provides methods of controlling and redefining the specificity of ribosomal translation. In some embodiments, the methods include overcoming enzyme-specificity limitations present upstream of the ribosome during a translation reaction. In some embodiments, methods directed to pausing and unpausing the activity of a ribosome during the process of translation include controlling and redefining enzyme specificity for substrates in reactions upstream of the ribosome during the translation process. In some embodiments, such enzymes are aminoacyl-tRNA synthetase enzymes (aaRS). In some embodiments, such enzymes are orthogonal aminoacyl-tRNA synthetases. In some embodiments, such enzymes are promiscuous orthogonal aminoacyl-tRNA synthetases. In some embodiments, such substrates are tRNAs and / or amino acids. In some embodiments, such substrates are tRNAs that have been charged with nsAAs, in some embodiments via flexizyme systems. In some embodiments, enzyme and substrate pairing may be controlled and switched multiple times during a single translation reaction to introduce multiple distinct nsAAs to the same codon in the same peptide.

[0138] By way of example, in natural systems the high affinity of an aaRS for its cognate amino acid (substrate) ensures high fidelity in translation. However, natural aaRSs can also be promiscuous, exhibiting the ability to aminoacylate tRNAs with non-cognate amino acids. An affinity for non-cognate amino acids is often considered sub-optimal - a “bug” that leads to “misincorporation” of amino acids. The present disclosure takes advantage of this promiscuity in order to provide methods of coordinating the synthesis of artificial peptides and / or proteins that incorporate one, two, three, or more nsAAs into their sequences. In essence, the present disclosure provides methods that convert this “bug” into a highly desirable feature. In some embodiments, one or more methods directed to pausing and unpausing activity of a ribosome during translation comprise exploiting promiscuity of natural aaRSs by controlling delivery of natural and nonstandard amino acids. In some embodiments, the methods comprise synthesizing a peptide by pausing and unpausing activity of a ribosome during translation to exploit promiscuity of natural aaRS by controlling delivery of one or more of natural and / or nonstandard amino acids specific to certain segments of the mRNA sequence.

[0139] In various aspects, the present disclosure is drawn to methods for pausing and unpausing activity of a ribosome during the process of translation. In some embodiments, the ribosome is paused during translation by withholding supply of amino acids. In some embodiments, the ribosome is reversibly paused during translation by withholding supply of amino acids. In some embodiments, the ribosome is paused at a desired location on the coding sequence of an mRNA by withholding supply of the amino acid necessary for that location of the mRNA.

[0140] Reversibly pausing and unpausing ribosomes is achieved during translation. In some embodiments, the ribosome is paused at a desired location on a mRNA by withholding supply of the amino acid necessary for that location on the mRNA and the reversing or rescuing of a paused ribosome is achieved by introducing the withheld amino acid for the location ribosome has stalled upon. In other embodiments, the ribosome is paused at a desired location on a mRNA by withholding supply of the amino acid necessary for that location of the mRNA and the reversing or rescuing of a paused ribosome is achieved by introducing an nsAA or some component other than the amino acid which is necessary for the location the ribosome has stalled upon. In some embodiments, the ribosome is paused and the pause is reversed or rescued to incorporate natural amino acids in a peptide. In some embodiments, the ribosome is paused and the pause is reversed or rescued to incorporate nsAAs into a peptide and / or protein. In certain embodiments, the ribosome is paused and the pause is reversed or rescued multiple times during synthesis of a single peptide and / or protein sequence. In some embodiments, the ribosome is paused and the pause is reversed or rescued multiple times during synthesis of a single peptide sequence to incorporate natural amino acids into the peptide and / or protein. In some embodiments, the ribosome is paused and the pause is reversed or rescued repeatedly during synthesis of a single peptide sequence to incorporate nsAAs in the peptide and / or protein.

[0141] Therefore, at desired points during the translation of the mRNA, reversible ribosomal pausing is utilized. Ribosomal pausing refers to a temporary halt in the translation process, during which the ribosome stops moving along the mRNA strand during protein synthesis, without disengaging from the mRNA. In the disclosed methods and systems, pausing is intentional and is used to regulate artificial protein synthesis.

[0142] Synthetic peptides can thus be synthesized in a highly intentional manner using a cell-free translation system. By omitting a specific amino acids and / or tRNAs from the translation reaction, a translating ribosome can be paused on a targeted codon. Upon addition of the missing amino acid or tRNA, the correctly charged tRNA will enter the A- site of the ribosome, translation will continue, and the amino acid will be added to the growing peptide and / or protein chain. By altering the amino acid and / or tRNA composition of the translation mix, a diverse peptide library can be generated from a single mRNA template. Fig. 2 depicts an example of how a diverse library of peptides and / or proteins can be generated from a single synthetic mRNA in a cell-free translation system utilizing programmed ribosomal pausing for targeted amino acid incorporation. In the depicted embodiments, an nsAA (of any kind) is inserted into the sequence of a nascent peptide at four different locations. In this embodiment, the peptide sequence (and the mRNA it is derived from) is the same among the four shown, with the difference being the nsAA shown in solid black circles.

[0143] The manner in which ribosomal pausing occurs can vary. During translation, aminoacyl-tRNAs (aa-tRNAs) and an mRNA transcript are translocated through the ribosome allowing for codon dependent synthesis of a peptide and / or protein. When an aa- tRNA corresponding to the next codon is unavailable, uncharged tRNAs accumulate in the ribosome and translation reversibly pauses. Upon encountering the correct aa-tRNA, translation can resume. By deliberately delaying the recruitment of aa-tRNAs to the ribosome in a highly purified, reconstituted cell-free translation system it is possible to program ribosomal pausing and utilize this intentional pausing as a means of generating a highly varied library of peptides and / or proteins.

[0144] In some embodiments, ribosomal pausing occurs by amino acid deprivation. Here, deprivation occurs by withholding any one or more of the twenty amino acids commonly found in naturally occurring proteins (Ala or A, Cys or C, Asp or D, Glu or E, Phe or F, Gly or G, His or H, He or I, Lys or K, Leu or L, Met or M, Asn or N, Pro or P, Gin or Q, Arg or R, Ser or S, Thr or T, Vai or V, Trp or W, Tyr or Y). In that regard, a translation mix is put into contact with a ribosome that lacks a specific amino and and / or tRNA for that amino acid. When the ribosome encounters the codon for that amino acid, it is unavailable for incorporation into the nascent peptide and / or protein, so the ribosome stops the translation reaction. This pausing is reversible in that, once the missing amino acid is put into contact with the ribosome, it will incorporate the amino acid into the nascent peptide and / or protein and resume translation.

[0145] In natural systems release factors (RF1, RF2, eRFl) allow for termination of translation in the presence of a stop codon (amber, ochre, opal). In some embodiments, one or more methods directed to pausing and unpausing activity of a ribosome during translation comprise withholding release factors during translation to allow for repurposing of a stop codon. When the translating ribosome encounters a stop codon, it will pause at the stop instead of disassociating and terminating translation, because the release factors corresponding to that stop codon have been withheld. Then, a synthetic tRNA containing an anticodon to the stop codon on which the ribosome has paused can be introduced. As described herein, such a synthetic tRNA can be engineered to provide any natural amino acid, any nsAA, or another synthetic element int the ribosome at the stop codon, thereby allowing translation to continue instead of the stop codon terminating translation.

[0146] Surprisingly, the present inventors have determined that ribosomal pausing does not occur with equal efficiency across all amino acid codons. Some codons are highly efficient pause points for a ribosome, some are moderately efficient, and others are display low efficiency. In this context, the efficiency of pausing is referenced with respect to codons coding for the insertion of any one or more of the twenty amino acids commonly found in naturally occurring proteins. Those amino acid codons found by the present inventors to be highly efficient ribosomal pause points include codons coding for alanine (GCU, GCC, GCA, GCG), histidine (CAU, CAC), leucine (CUU, CUC, CUA, CUG), methionine (AUG), and tyrosine (UAU, UAC) (see, Figs. 3A - 3E). Reversible ribosomal pausing at any one or more of these amino acid codons is highly efficient, as supported by the depicted fluorescence rescue data. Here efficiency refers to the degree to which the amino acid in question was incorporated into the nascent peptide after pausing. As such, the foregoing codons represent sites within an mRNA coding sequence where nsAAs and / or synthetic elements may be inserted into a nascent peptide and / or protein with a high degree of success.

[0147] Those amino acid codons found by the present inventors to be reasonably moderate ribosomal pause points include codons coding for arginine (CGU, CGC, CGA, CGG), isoleucine (AUU, AUC, AUA, AUG), and threonine (ACU, ACC, ACA, ACG) (see, Figs. 4A, 4B, and 4C). Reversible ribosomal pausing at any one or more of these amino acid codons is reasonably efficient, as shown by the fluorescence rescue data. While pausing on these amino acids may not be as readily reversed as with the amino acids depicted in Figs. 3A - 3E, the resumption of pausing with these amino acids is still quite efficient and therefore useful in the disclosed methods. As such, the foregoing codons represent sites within an mRNA coding sequence where nsAAs and / or synthetic elements may be inserted into a nascent peptide and / or protein with a reasonable degree of success, albeit with lower success than those recited in the preceding paragraph. The remaining 12 amino acids (asparagine, aspartate, cysteine, glutamine, glutamate, glycine, lysine, phenylalanine, proline, serine, tryptophan, valine) all demonstrate a lower level of ribosomal pausing efficiency than those recited above. These 12 may still be used as insertion sites, however the efficiency at which codons for these amino acids incorporate nsAAs and synthetic elements into a nascent peptide and / or protein may be lower than those disclosed hereinabove.

[0148] In some embodiments, ribosomal pausing occurs by deprivation of any one or more of the amino acids having side chains that are positively charged at neutral pH: arginine, lysine, histidine. In some embodiments, ribosomal pausing occurs by deprivation of any one or more of the amino acids having side chains that are negatively charged at neutral pH: aspartate, glutamate. In some embodiments, ribosomal pausing occurs by deprivation of any one or more of the amino acids having side chains that are polar and uncharged: serine, threonine, asparagine, glutamine. In some embodiments, ribosomal pausing occurs by deprivation of any one or more of the amino acids having side chains that are hydrophobic: tyrosine.

[0149] In some embodiments, ribosomal pausing occurs by deprivation of any one or more of alanine, histidine, leucine, methionine, and / or tyrosine. In some embodiments, ribosomal pausing occurs by deprivation of a tRNA having an anticodon to any one or more of GCU, GCC, GCA, GCG, CAU, CAC, CUU, CUC, CUA, CUG, AUG, UAU, and / or UAC. In some embodiments, ribosomal pausing occurs by deprivation of any one or more of arginine, isoleucine, and / or threonine. In some embodiments, ribosomal pausing occurs by deprivation of a tRNA having an anticodon to any one or more of CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, ACU, ACC, AC A, and / or ACG.

[0150] In some embodiments, ribosomal pausing occurs by deprivation of an nsAA (as defined herein) for which a codon has been engineered into the mRNA coding sequence. Ribosomal pausing in this manner occurs much in the same way as deprivation of any other amino acid, and translation may be resumed the same way.

[0151] In some embodiments, ribosomal pausing occurs by placing the ribosome into contact with a translation mix that is free of RF1, RF2, and / or eRFl. In this regard, when the ribosome encounters a stop codon (be it ochre, amber, or opal / umber), it will pause at the stop codon without disassociating from the mRNA. Withholding a release factor for a specific type of stop codon will cause the ribosome to pause on that stop codon. This pausing is reversible in much the same way as above, such that when a tRNA containing the anticodon to the stop codon on which the ribosome is paused is put into contact with the ribosome, it will incorporate the tRNA payload into the nascent peptide and / or protein as if it were any other amino acid. Translation may then resume as normal, with the stop codon having been reassigned as an insertion site, rather than a site on which translation stops. In some embodiments, ribosomal pausing occurs by tRNA pooling and withholding of one form of orthogonal tRNAs. Pausing is therefore induced when the ribosome encounters a codon that is specific to one tRNA ortholog that has been withheld from the translation mix. Most amino acids can be translated and inserted into a peptide and / or protein by multiple tRNAs. One form of tRNA interacts exclusively with its form of aminoacyl- tRNA synthetase in order to insert an amino acid, nsAA, or other synthetic element into a nascent peptide and / or protein. The same amino acid, nsAA, or other synthetic element can also be inserted by way of an ortholog tRNA that interacts with its own, different, aminoacyl-tRNA synthetase. These tRNA orthologs can insert at the same codon, or at different codons, depending on the level of specificity desired. Each orthogonal tRNA can be synthesized accordingly. In this embodiment, pools of mutually orthogonal tRNAs are created in order to induce pausing. By withholding a pool of one ortholog, the ribosome will pause either because it encounters a codon specific to an orthogonal tRNA, or because the orthogonal tRNA having the anticodon to the codon presently encountered by the ribosome is not present in the translation mix. Regardless of the manner in which tRNA pooling induces pausing, it is reversible in the same manner as other methods - by placing the withheld tRNA ortholog into contact with the ribosome.

[0152] In some embodiments, ribosomal pausing is utilized to insert an nsAA into the peptide and / or protein being translated. In some embodiments, ribosomal pausing is utilized to pause translation so that one translation mix, containing a specific subset of amino acids and nsAAs, can be removed from contact with the ribosome (e.g., washed away) and replaced with a new translation mix containing a different subset of amino acids and nsAAs.

[0153] Washing a translation mix away while maintaining the ribosome at a paused location along the mRNA can occur via any number of suitable means. In some embodiments, washing is a simple as sequestering the ribosome-mRNA complex and removing a translation mix from it. In some embodiments, maintenance of the ribosome-mRNA complex while washing occurs. In such embodiments, washing away a translation mix occurs under very cold conditions and may utilize high salt concentration washing solutions, in order to maintain the ribosome in place on the mRNA. For example, in some embodiments washing occurs via the use of ice-cold, high magnesium buffer. In such embodiments, the temperature of the ribosome-mRNA complex itself is also kept ice-cold. Ice cold temperatures in such embodiments are sub-zero to slightly above zero degrees C. In some embodiments, the ice cold temperature is about -5° C - about 10° C, in some embodiments about -5° C - about 5° C, in some embodiments about -5° C - about 0° C, and in some embodiments about 0° C. Suitable high salt buffers include high magnesium concentration buffers, high sodium chloride concentration buffers, high concentration TRIS-HC1 buffers, and the like. Washing may also occur in the dark in order to maintain the integrity of the paused ribosome-mRNA complex.

[0154] In one aspect, the present disclosure expands the diversity of libraries that can be produced via the disclosed methods, in some embodiments using mRNA display and in other embodiments without the use of mRNA display, by modulating the translation machinery using pausing to allow switching between genetic code reprogramming cocktails and / or translation mixes. In the current state of technology, genetic code reprogramming efforts within the context of artificial peptide synthesis - both with or without the incorporation of mRNA display technology - are constrained by available codons and compatibility of reprogramming machineries. The present disclosure provides systems and methods that overcome this limitation by pausing and restarting the translation process, wherein the same codons are reused upon unpausing / resumption of translation to incorporate nsAAs or other synthetic elements. In some embodiments, the present disclosure provides a one-pause system that is capable of creating binary diversity between two sections of the mRNA, and the resultant peptide and / or protein, enabling combinations not currently seen in display libraries. In some embodiments, the present disclosure provides a two-pause system, in some embodiments a three-pause system, in some embodiments a four-pause system, in some embodiments a five-pause system, in some embodiments a six- pause system, in some embodiments a seven-pause system, in some embodiments an eightpause system, in some embodiments a nine-pause system, in some embodiments a ten-pause system, and in some embodiments systems capable of containing more than ten pauses, all along the same synthetic mRNA molecule. Each pause presents an opportunity to insert an nsAA or other synthetic element, and / or to switch between translation mixes in order to introduce new translation components into a nascent peptide and / or protein.

[0155] In some embodiments, artificial peptide synthesis utilizing ribosomal pausing allows for diversifying the initiator (e.g., start) position. In the current state of the art, known cyclization methodology typically requires that the initiator tRNA and amino acid next to the N-terminal chloride be held constant. This limits the diversity of libraries that may be generated using artificial peptide synthesis, with our without mRNA display technology. The present disclosure overcomes this limitation by allowing for variety at the initiation, or start, codon. For example, in some embodiments a mix of initiators may be presented to a large number of the same mRNA sequence, followed by pausing and adding an elongation mix. The mix of initiators may include synthetic tRNAs having start anticodons that are charged with a variety of nsAAs, allowing for insertion of a variety of different nsAAs into the first position of a peptide and / or protein, enabling diversity where there typically is none. In some embodiments, N-acetylated variants of amino acids (e.g., N-acetyl aspartic acid, N- acetyl cysteine, N-acetyl glutamic acid, N-acetyl glutamine, N-acetyl glycine, N-acetyl histidine, N-acetyl isoleucine, N-acetyl leucine, N-acetyl lysine, N-acetyl methionine, N- acetyl phenylalanine, N-acetyl proline, N-acetyl serine, N-acetyl threonine, N-acetyl tryptophan, N-acetyl tyrosine, and N-acetyl valine) can be used as initiators of translation. In some embodiments, N-acetylated variants of any nsAA can be used as a to initiate translation.

[0156] In some embodiments, the present disclosure allows for novel cyclization partners. In the current state of the art, cyclization platforms rely on a fixed cysteine residue for formation of a thioether macrocycle (e.g., Goto, et al., Acc. Chem. Res. (2021), 54: 18, p. 3604-3617). The present disclosure overcomes such limitations, by pausing the translation process before this cyclization residue. With such a pause, a diverse set of thiol groups or even alternative nucleophiles can be included into the peptide and / or protein, enabling novel and greatly expanded cyclization chemistries (e.g, amide, C-C, or alkene metathesis).

[0157] Another advantage to the systems and methods provided by the present disclosure is decreased competition for amino acids and / or translation factors. The selective and intentional pausing and unpausing of translation can result in improved incorporation fidelity and efficiency for some challenging to incorporate amino acids, nsAAs, and / or synthetic elements. Pausing the translation process allows switching between sets of amino acids, tRNAs, and synthetases at the attendant codon set. Thus, in one embodiment, a smaller, more defined and focused pool of amino acids is used during the translation of defined sequences to improve efficiency of incorporation of amino acids, nsAAs, and / or synthetic elements. In another embodiment, initiation or elongation factor concentrations are altered at different pause steps to facilitate initiation of translation and / or nsAA insertion, while not incurring a concentration cost for the remainder of the translation.

[0158] In another aspect, the disclosed methods and systems allow for the creation of new reactions to be incorporated into APS libraries (with or without mRNA display technology) by enabling the use of novel peptide and / or protein components. By reducing competition, it is possible to load nsAAs capable of undergoing nsAA reactions within the ribosomal peptidyl transferase center (PTC) of the ribosome. In one embodiment, nucleophiles other than the natural amino group or an amino acid are induced to react with acyl-tRNA esters to form novel linkages, such as carbon-carbon bonds. These reactions are facilitated at high concentrations of the unnatural ester and slower translation rate (ie., before pausing the translation).

[0159] In another aspect, the disclosed methods and systems allow for generic code expansion in the context of creating a peptide library by intermittent pausing of ribosome activity during translation process by selective amino acid deprivation, codon reassignment, stop codon reassignment, and the like.

[0160] In another aspect, the disclosed methods and systems allow for maximizing incorporation yields by tuning the conditions for amino acid incorporation between translation pauses, rather than across the entire peptide and / or protein sequence. This improves APS (with or without mRNA display technology) library performance from the standpoint of reproducibility and increases confidence that non-hits are due to lack of selection and not failed synthesis.

[0161] In embodiments that involve mRNA display technology, mRNA display selections are typically iterated over multiple rounds of selection to go from large, high quality, and high diversity libraries to highly potent hits. In one aspect of the present disclosure, single round selections, as is common with DNA-encoded libraries, suffices for identifying potent binders, when paired with deep sequencing and machine learning models.

[0162] Termination

[0163] Translation continues until the ribosome encounters a stop codon (UAA, UAG, or UGA) on the mRNA and the translation mix presently in contact with ribosome contains the proper release factors corresponding to the stop codon encountered (RF1, RF2, and / or eRFl). At this point, the release factors enter the ribosome and trigger the release of the newly synthesized peptide and / or protein containing multiple nsAAs. The ribosome disassembles, and the protein is freed from the mRNA. The newly synthesized peptide and / or protein may then undergo folding and post-translational modifications, depending on the experimental conditions.

[0164] Once translation is complete, the synthesized peptide and / or protein can be recovered from the reaction mixture. In a typical lab setting, the protein is purified by various methods such as affinity chromatography, size exclusion, or other protein purification techniques. mRNA Display

[0165] Optionally, prior to termination, the peptide and / or protein translated as above via APS can be coupled to the mRNA from which it was translated via mRNA display techniques. An mRNA display library is a powerful tool that can be used to study protein function, interactions, evolution, and many other properties by linking proteins to their encoding mRNA in a way that allows for the selection of specific peptides or proteins from large libraries. It is commonly used in the fields of drug discovery, antibody development, and directed evolution of proteins.

[0166] The first step in mRNA display in the context of the present disclosure is to create a synthetic mRNA having a coding sequence that will encode a diverse set of proteins or peptides via the introduction of various nsAAs and / or synthetic elements into the amino acid sequence, as described herein. Multiple copies of this mRNA may be synthesized and translated at any given time, with varying nsAAs inserted into each insertion site in such a way as to create a library of peptides and / or proteins having different chemistries to test and select from. The mRNA is then translated in a disclosed cell-free translation system, with intermittent ribosomal pausing, as described herein, to produce a corresponding pool of peptides and / or proteins.

[0167] In some embodiments, prior to termination of translation, a step of covalently attaching the peptide and / or protein to the mRNA occurs. This can be achieved by introducing a puromycin-containing synthetic element into the cell-free translation system at the appropriate time, or by synthesizing the mRNA to include a sequence or tag puromycin at its 3' end.

[0168] In some embodiments, translation is paused on the final stop codon and a puromycin- containing linker is placed in contact with the ribosome. That contact causes translation to resume, with the incorporation of the puromycin-containing linker into the nascent peptide and / or protein. In such embodiments, the puromycin-containing linker is engineered such that its other end is capable of covalently binding to an engineered element in the mRNA that can covalently link the protein to the mRNA. Puromycin is a nucleoside covalently bound to an amino acid that mimics the 3' end of aminoacylated tRNAs that participate in delivery of amino acids to elongating ribosomes. The addition of a puromycin-containing element into the ribosome facilitates the creation of a covalent bond between the now translated peptide / protein and the mRNA. In some embodiments, the other end of the puromycin-containing linker includes an element that is capable of binding the linker to a free amino group in the mRNA by way of click chemistry. This linkage ensures that each protein remains physically associated with its corresponding mRNA, effectively creating a mRNA-protein complex.

[0169] Click chemistry is a term used to describe a group of chemical reactions that are highly efficient, selective, and reliable, enabling easy and quick bonding between molecules. The reactions contemplated by this definition are considered to “click” in place and / or to be "clickable" because they are simple, fast, and produce minimal byproducts. This makes click chemistry highly useful in the disclosed methods.

[0170] As noted above, in some embodiments the disclosed methods provide for the immobilization of mRNA onto a support in order to facilitate translation via a Y-ligation approach (Fig. 1C). Such methods provide a means for mRNA display via the use of non- protein-based linkage mediated by a small molecule, puromycin (P). Puromycin is an analogue of the 3 '-end of aminoacyl-tRNA and attacks a nascent peptide and / or protein in the ribosome. Therefore, only the attachment of the puromycin linker to mRNA is required for producing a robust polypeptide / mRNA complex. In addition to the Y-ligation approach, several known mRNA display techniques rely on the use of linker oligonucleotides that not only facilitate immobilization of the mRNA to a support, but that also provide a puromycin in the linker oligonucleotide, so that the peptide and / or protein can be covalently bound to the mRNA from which it was translated. The TRAP system is one such linker system (Ishizawa, etal., J Am. Chem. Soc. (2013), 135, p. 5433-5440).

[0171] There are drawbacks to the use of this type of linker molecule. In all such linkers, puromycin is always present during translation. Depending on the reaction conditions, the puromycin could be incorporated into the nascent peptide and / or protein prematurely. Should that happen, translation would be terminated early, the nascent peptide and / or protein will not be fully translated, and the library being generated will lose one of its screening candidates.

[0172] The present disclosure provides means for overcoming this deficiency. In some embodiments, the present disclosure provides methods that utilize non-puromycin containing linker oligonucleotides to secure the mRNA to a support for translation. Such methods also utilize ribosomal pausing, specifically stop codon repurposing, in order to pause the ribosome on the terminal stop codon (e.g., by withholding the appropriate release factors, thereby preventing the ribosome from disassociating from the mRNA). In such methods, when the ribosome is paused at the terminal stop codon, a puromycin-containing synthetic element is provided that has the means of covalently connecting the translated peptide and / or protein with the mRNA (Fig. 5). The puromycin causes the ribosome to reinitiate translation, incorporating the puromycin-containing linker into the peptide and / or protein. The linker also contains a click chemistry element that serves to connect the linker to the mRNA, completing the mRNA display technique.

[0173] In some embodiments, this “late click” incorporated linker is a puromycin - oligonucleotide - click chemistry element linker molecule. The oligonucleotide may be DNA- or RNA-based, however for added stability DNA-based oligonucleotides are preferred. In some embodiments, this “late click” incorporated linker is a puromycin - ethylene glycol - click chemistry element linker molecule. The click chemistry element can be any that will react with an element engineered into the mRNA sequence. For example, in some embodiments the mRNA sequence is engineered so that it has a free azide group and the linker’s click chemistry element is a dibenzocyclooctyne (DBCO) and a tri ethylene glycol (TEG) element typically used in copper-free click reactions (Fig. 5). The DBCO- TEG portion of the linker readily reacts with the free azide on the mRNA, thereby covalently binding the peptide and / or protein to the mRNA from which it was translated.

[0174] After translation, and optionally after “late click” incorporation of a linker molecule, the mRNA can be optionally reverse-transcribed into complementary DNA (cDNA) using reverse transcriptase.

[0175] After translation, and optionally after “late click” incorporation of a linker molecule, a library of mRNA-peptide / protein complexes that are physically linked to each other is generated. To select specific protein sequences or functionalities from this library, affinitybased selection methods can be employed, for example ligand-binding and / or target binding techniques. Once a suitable peptide and / or protein is found, the mRNA (or cDNA if the mRNA was reverse transcribed) is PCR-amplified to generate a large quantity of the specific mRNA / cDNA sequence that encodes the protein of interest.

[0176] Generation of Artificial Peptides

[0177] The following disclosures are proof-of-principle examples of the generation of peptides and / or proteins using the disclosed methods and systems. They are presented as examples of what may be done and are in no way intended to limit the disclosure, which provides platform technology capable of generating synthetic peptides and / or proteins from any mRNA synthesized in the manner provided herein.

[0178] By way of example, a 19-amino acid artificial peptide containing a single nsAA can be prepared using the disclosed methods. The coding sequence of the mRNA for this peptide contains a single codon for histidine, none of the remaining 18 codons encode histidine. In order to pause the ribosome at this histidine codon, histidine could be withheld from the translation mix. The translation mix can include all of the amino acids (and tRNAs specific to those amino acids coming before the histidine, or it may optionally contain all of the remaining 19 amino acids excluding histidine. Translation would proceed normally until the ribosome encountered the codon for histidine, at which point it would pause. At a desired timepoint after pausing, histidine itself could be added to the translation mix, at which point translation would resume and terminate as expected. Alternatively, when the ribosome is paused an nsAA and its corresponding synthetic tRNA could be added, the tRNA having an anticodon corresponding to the histidine codon. Translation would then resume when the ribosome encounters the synthetic tRNA, at which point the nsAA would be incorporated into the nascent peptide instead of histidine. Because the other amino acids following histidine would be present or supplied with histidine, the ribosome could then translate the rest of the peptide.

[0179] Similarly, a 19-amino acid artificial peptide containing two nsAAs can be prepared using the disclosed methods. The coding sequence of the mRNA for this peptide could contain a single codon for histidine and also a single codon for tryptophan, none of the remaining 17 codons would encode histidine or tryptophan. In order to ensure ribosomal pausing at both histidine and tryptophan, histidine and tryptophan would both be withheld from the translation mix - which would include all of the other 18 natural amino acids. The pausing and restarting situation would then proceed as described above. The ribosome would pause first at the histidine codon, at which point a first nsAA could be inserted into the nascent peptide, translation would resume and it would continue until such time as the ribosome encountered the tryptophan codon, when the ribosome would pause for a second time. Similar to the histidine scenario, a second nsAA could then be inserted into the peptide at the tryptophan codon. The ribosome would then translate the entire rest of the peptide since the remaining amino acids would already be present in the mixture. The resulting peptide would include two nsAAs, which could be the same nsAA or different. In some embodiments, insertion of an nsAA can occur before a ribosomal pause point via the tailoring of a translation mix. For example, translation of an mRNA can begin by placing the ribosome into contact with a translation mix containing one or more nsAAs, and the related tRNAs needed to insert them into one or more specific sites along the coding region of the mRNA. That translation mix would also withhold an amino acid downstream from the insertion sites of the one or more nsAAs. Translation would occur normally, with the one or more nsAAs being inserted into a position within the mRNA coding region upstream from the pause point. In that regard, the one or more nsAAs can be inserted at the location of a stop codon engineered into the coding sequence (in which case the translation mix would also exclude the release factors specific to that stop codon) via the use of synthetic tRNAs having anticodons to the stop codon. Alternatively, the nsAAs could be inserted into positions in the coding region at codons that would ordinarily code for an amino acid. In this latter case, the translation mix would also withhold those amino acids that would compete with the nsAAs for insertion along the coding sequence, allowing synthetic tRNAs configured to insert the one or more nsAAs into the coding sequence at those amino acid locations to insert the nsAAs instead. After the forgoing occurs, the ribosome would encounter the codon for the originally withheld amino acid, at which point it would pause. This pausing would occur after the insertion of one or more nsAAs into a nascent peptide and would allow for the translation mix to be washed away, so that translation of the rest of the mRNA can occur. In this embodiment, there is no limit to the total number of nsAAs that can be inserted into a peptide prior to a ribosomal pause point. This embodiment allows for the insertion of one, two, three, four, five, six., seven, eight, none, ten, or more nsAAs into a nascent peptide chain, in some embodiments sequentially.

[0180] In some embodiments, insertion of an nsAA can occur after a ribosomal pause point via the tailoring of a translation mix. For example, translation of an mRNA can begin by placing the ribosome into contact with a translation mix containing 19 of the 20 amino acids. Translation will occur as expected until such time as the ribosome encounters the codon for the withheld amino acid, at which point it will pause. This pausing occurs before the insertion of any nsAAs into a nascent peptide and allows for the 19 amino acidcontaining translation mix to be washed away. Thereafter, a second translation mix is placed into contact with the mRNA, this mix containing the originally withheld amino acid, and also one or more nsAAs, and the related tRNAs needed to insert them into one or more specific sites along the coding region of the mRNA. Translation would then resume, with the one or more nsAAs being inserted into a position within the mRNA coding region downstream from the pause point. In that regard, the one or more nsAAs can be inserted at the location of a stop codon engineered into the coding sequence (in which case the translation mix would also exclude the release factors specific to that stop codon) via the use of synthetic tRNAs having anticodons to the stop codon. Alternatively, the nsAAs could be inserted into positions in the coding region at codons that would ordinarily code for an amino acid. In this latter case, the translation mix would also withhold those amino acids that would compete with the nsAAs for insertion along the coding sequence, allowing synthetic tRNAs configured to insert the one or more nsAAs into the coding sequence at those amino acid locations to insert the nsAAs instead. After the forgoing occurs, the ribosome would complete translation as expected, typically by encountering a stop codon and disassociating from the mRNA. If desired, the mRNA can then be covalently bound to the peptide, creating an mRNA display product. In this embodiment, there is no limit to the total number of nsAAs that can be inserted into a peptide after a ribosomal pause point. This embodiment allows for the insertion of one, two, three, four, five, six., seven, eight, none, ten, or more nsAAs into a nascent peptide chain, in some embodiments sequentially.

[0181] In some embodiments, insertion can occur without the need to pause the ribosome at all. Using the same 19-amino acid containing peptide example, insertion of one or more nsAAs can occur without pausing by tailoring the translation mix to contain the desired nsAAs and their corresponding synthetic tRNAs. The coding sequence of the mRNA for this peptide could contain a single codon for histidine and also a single codon for tryptophan, none of the remaining 17 codons would encode histidine or tryptophan. In addition to withholding both of histidine and tryptophan, the translation mix that translates the mRNA would also contain a first nsAA + synthetic tRNA combination, where the tRNA is engineered to have the anticodon for the histidine site, and a second nsAA + synthetic mRNA combination where the tRNA is engineered to have the anticodon for the tryptophan site. In this regard, when the ribosome encounters the histidine codon it will not pause even though histidine has been withheld from the translation mix. Instead, the ribosome will encounter the first nsAA + synthetic tRNA combination, having the anticodon for the histidine site, and will insert the first nsAA into the peptide and / or protein in place of histidine. The ribosome will do so without pausing; it will not need to, as the translation mix contains everything the ribosome needs to insert the first nsAA and continue translation. The same situation will occur when the ribosome encounters the tryptophan site. Instead of pausing, the ribosome will insert the second nsAA into the peptide at the histidine site. Translation will then continue to the end of the peptide, which will then terminate with both nsAAs inserted into two specific, intentional loci in the sequence of the peptide.

[0182] In one aspect, then, the present disclosure provides methods suitable for the intentional synthesis of artificial peptides by tailoring translation mixes to provide one or more nsAAs (and their synthetic tRNA compliments) before, during, or after the point at which the ribosome encounters a codon during translation. This provides a means for great flexibility in the translation of any mRNA. For example, in some embodiments a group of synthetic tRNAs can be generated that all contain the same anticodon, but will correspond to different nsAAs. By providing these tRNAs + the varying nsAAs they correspond to in a single translation mix, when the ribosomes encounter the codon at issue, the translation mix will randomly insert an nsAA at that codon. This flexibility allows for the creation of a library of synthetic peptides and / or proteins without the need to ever pause a ribosome.

[0183] In some embodiments, tailored translation mixes plus strategic pausing can be used to insert a variety of nsAAs into a single peptide sequence, without the need to pause at each codon of interest. Continuing with the 19-amino acid example, the mRNA for the peptide can include two of the same codon, in two distinct sections of the coding sequence, for example two histidine codons in the coding sequence, separated by at least one non-histidine codon. Translation can then begin with a first translation mix containing all of the amino acids, including the nsAA to be inserted at the first histidine codon, but withholding the amino acid at the codon between the histidine sites. Translation will occur as expected until such time as the ribosome encounters the codon for the withheld amino acid, at which point it will pause. The first translation mix can then be removed from contact with the ribosome and replaced with a second translation mix that contains the withheld amino acid, plus the nsAA to be inserted at the second histidine codon. Translation will then resume, inserting the withheld amino acid and the second nsAA. There is no limit to the number of times this pattern can be performed for any mRNA.

[0184] Ribosome pausing reversal may be further improved or modified by introducing various concentrations of one or more of elongation factors, translation factors, other proteins involved in protein transcription / translation process, or other chemicals (for example, antibiotics).

[0185] The above principles have been utilized to synthesize artificial peptides and prove that the principles provided in the instant disclosure work. Studies were carried out to pause and resume ribosomal peptide synthesis at various amino acid residues. A split green fluorescent protein (GFP) reporter system that reassembles from recombinant GFP1-10 and the short GFP 11 peptide to form a chromophore was produced (see, Kitagawa, et al., DNA Res (2005), 12(5), p. 291-299, Romei and Boxer, Ann Rev Biophys, (2019), 48, p. 19-44) using a commercially available translation mix (PURExpress, New England Biolabs, Ipswich, MA). In a cell-free GFP 11 peptide synthesis reaction containing recombinant GFP1-10 and custom amino acid mixtures, time course fluorescence data was measured. Fig. 6 depicts the schematic of experiment used to study pause and resumption of ribosomal peptide synthesis by observing change in fluorescence as GFP 11 peptide synthesis occurred over time. As illustrated, the amino acid residue at which peptide synthesis is to be paused is withheld when translation begun, and was introduced after about 90 minutes’ translation time.

[0186] Each reaction was initially supplied with 19 amino acids. When specific amino acids were withheld from the reaction, fluorescence drastically reduced compared to a positive control. After a 90-minute incubation the withheld amino acid was added to the reaction and fluorescence drastically improved, indicating that GFP 11 peptide synthesis was rescued. The synthesized GFP 11 peptides were analyzed by mass spectrometry to further confirm that peptide synthesis was rescued after the withheld amino acid was reintroduced.

[0187] Figs. 3 and 4 depict time course fluorescence data for all of the individual amino acids that were withheld from in the initial translation mix and then supplied after a 90- minute translation time. All 20 amino acids were added to the positive control (the top curve in all displayed examples), and a reaction devoid of amino acids was carried out as negative control (the bottom, flat line in all displayed examples). The middle curves in all of the depicted examples confirm that, once a withheld amino acid is reintroduced into a translation reaction, fluorescence consistently improved over time, indicating that GFP 11 peptide synthesis was rescued. These data provide proof that the principle of operation of the disclosed methods works; withholding an amino acid from a translation mix results in reversible ribosomal pausing.

[0188] Delaying amino acid availability to the ribosome was leveraged for custom peptide synthesis. Figs. 7A - 7D depict a solid-phase peptide synthesis system that relies on programmed ribosomal pausing and selective amino acid withholding and addition for custom peptide synthesis. The solid phase in the depicted embodiment is magnetic beads. Fig. 7A shows the GFP11 peptide sequence (SEQ ID NO: 1), with each of the three individual translation mixes used in the experiment noted as “Mix I,” “Mix II,” and “Mix III,”. Fig. 7B provides a schematic of the overall experiment. The mRNA encoding GFP11 was immobilized to a magnetic bead by ligating it to a DNA linker (shown as the double stranded hairpin) which is covalently linked to biotin handle (B). The biotin is bound to a streptavidin-coated magnetic bead (large circles) that was immobilized using a magnet. Ribosomes were loaded onto the mRNA in the presence of a cell-free reaction mixture and translation Mix I containing only the first five amino acids of the peptide (depicted as open circles) was placed into contact with the ribosome. Translation began, but then paused at the leucine codon (L). The immobilized mRNA and ribosomes were washed with buffer to remove translation mix Mix I. The paused ribosomes were then supplied with only leucine (depicted as a patterned circle) in a second cell-free translation mix (Mix II); translation resumed, but only to insert leucine (L) into the nascent peptide. The ribosome then paused at the histidine (H) codon. The wash step was repeated and a translation mix containing all of the remaining ten amino acids (depicted as striped circles, Mix III) was placed into contact with the ribosomes, allowing GFP11 peptide synthesis to be completed. Once translation was complete, as shown in Fig. 7C, the synthesized GFP11 peptide was isolated from the immobilized mRNA, mixed with recombinant GFP1-10, and incubated at 37° C. Using a fluorescence plate reader, time course data was collected monitoring chromophore maturation as evidenced by fluorescent emission at 528nm every three minutes (Fig. 7D). The fluorescence output demonstrated that translation was paused at the targeted codons by selectively withholding an amino acid, and that translation successfully resumed when the withheld amino acid was supplied resulting in controlled synthesis of a functional peptide. Fig. 7D also confirms that only when the translation mixes were presented in the order of Mix I first, then Mix II, then Mix III, did a complete GFP reporter system become created. Mix I by itself did not produce any fluorescence that was statistically different from the negative control, nor did the combination of Mixes I and II only, nor did a situation where the order of Mixes was reversed (III first, followed by II, then I). These data provide proof that the principle of operation described herein in the disclosed methods works well.

[0189] Next, experiments designed to confirm that solid-phase synthesis utilizing programmed ribosomal pausing is compatible with nsAA translation machinery were performed. Figs. 8A - 8C illustrate the experiments performed, wherein synthesis of a peptide incorporating an nsAA utilizing reassignment of a stop codon and ribosomal pausing successfully occurred. To measure peptide synthesis rapidly and accurately, a split GFP reporter system that reassembles from recombinant GFP1-10 and the short GFP11 peptide to form a chromophore was used see, Kitagawa, et al., DNA Res (2005), 12(5), p. 291-299, Romei and Boxer, Ann Rev Biophys, (2019), 48, p. 19-44).

[0190] Fig. 8 A shows the engineered GFP11 amino acid sequence used for these experiments (SEQ ID NO: 2). The first four amino acids (MKKK) are the N-terminal translational ramp. The amino acid placeholder depicted as an X is the site of incorporation of an nsAA which, in this experiment, occurred via the repurposing of stop codons as described herein. In this set of experiments, an amber stop codon was coded into the synthetic mRNA at the depicted location. The three amino acids following the X (SSA) are a linker region preceding the complete GFP11 amino acid sequence, which follows the SSA sequence. The peptide synthesis reaction was performed in two cycles using a “Mix 1” (depicted as open circles) and a “Mix 2” (depicted as a black circle X, striped circles, and dashed line circles) (Fig. 8A).

[0191] Fig. 8B shows the mechanics of solid-phase synthesis of GFP11 using repurposed stop codons and programmed ribosomal pausing. Solid-phase synthesis of the GFP11 peptide with programmed ribosomal pausing was performed by first immobilizing a GFP11 mRNA containing an internal amber stop codon to a magnetic bead. The mRNA encoding GFP11 (single-stranded dark line) was ligated to a DNA linker (shown as the double stranded hairpin) which was covalently linked to a biotin handle (B). The biotin is bound to a streptavidin coated magnetic bead (large circles) which was immobilized using a magnet. This complex was then loaded with ribosomes in the presence of a cell-free reaction mixture devoid of Release Factor 1 (RF1), and an amino acid mix comprising only the first four amino acids necessary to initiate synthesis of the peptide. Translation successfully began, pausing at the amber stop codon (corresponding to X), and the immobilized mRNA / ribosome / peptide complex was washed with buffer to remove Mix 1. Because Mix

[0192] 1 was devoid of any release factors that would have allowed the ribosome to release form the mRNA at the amber stop codon and stop translation, the ribosome merely paused at this location, remaining in place. The paused ribosomes were then supplied with amino acid Mix

[0193] 2 which included the nsAA, a phenylalanine derivative p-azidophenylalanine (pAzF), cell- free components devoid of RF1, and recombinantly expressed and purified pAzF aminoacyl tRNA synthetase and pAzF tRNA. Translation resumed, with the ribosome continuing along the mRNA until it reached an opal stop codon (recognized by RF2), where GFP11 peptide synthesis was completed. As shown in Fig. 8C, the synthesized pAzF containing GFP11 peptide was isolated from the immobilized mRNA and mixed with recombinant GFP1-10.

[0194] Fig. 8D is a plot of fluorescence emitted over time following the peptide synthesis reaction utilizing Mix 1 followed by Mix 2. Fluorescence was measured over time using a fluorescence plate reader and time course data was collected for peptide synthesis reactions in the presence of recombinant GFP1-10. Emission at 528 nm was collected every three minutes. Fig. 8D shows data for four different peptide synthesis reactions utilizing Mix 1 and Mix 2 in varying combinations, as well as a negative control. Only the reaction which began with Mix 1 followed by Mix 2 (which comprised the nsAA) showed an increase in fluorescence over time, indicating synthesis of the desired peptide. The reaction which included introducing Mix 1 followed by a version of Mix 2 that did not include the nsAA did not yield any fluorescence. A translation experiment that began with Mix 2 followed by Mix 1 similarly did not yield any fluorescence. A significant fluorescence output was obtained only in the reaction described above, which included Mix 1 and Mix 2 with the desired nsAA, demonstrating synthesis of a functional peptide incorporating an nsAA utilizing targeted stop codon reassignment and programmed ribosomal pausing.

[0195] Fig. 9 shows the GFP11 amino acid sequence (SEQ ID NO: 3) and corresponding translation mixes (Mix 1 and Mix 2) used to synthesize 7 unique GFP11 peptides, each incorporating a pair of unique nsAAs, all of which were translated using the same mRNA template. The amino acid depicted as X was the site for incorporation of nsAAs by reassignment of an amber stop codon, as described above. The peptide synthesis reaction was performed in two cycles using a “Mix 1” and a “Mix 2,” as shown. The translating ribosome was placed into contact with Mix 1 and translation was allowed to begin. The ribosome paused at the histidine (H) codon, as Mix 1 was devoid of the amino acid histidine. Mix 1 was them washed away and the ribosome was placed into contact with Mix 2, which allowed translation to resume.

[0196] As depicted herein, the present disclosure provides methods allowing for the use of new peptide and / or chemistries useful for the creation of peptide and / or protein libraries which, in some embodiments, can be mRNA display libraries. Quantification systems can be used to measure efficiency for peptide synthesis using controlled translation (pausing / unpausing ribosome activity for selective incorporation of amino acids and / or nsAAs) under conditions of decreased competition. Translation yields can then be quantified relative to those needed for library screening. In embodiments, yield optimization for peptides synthesized utilizing immobilization on a solid support may be easier than for the translation of free peptides in solution, as yields may be more readily quantified by qPCR and / or series of next generation sequencing (NGS) experiments.

[0197] The methods disclosed herein, which in some embodiments include novel mRNA display platforms, represent significant advances in the technology for in vitro selection of novel peptides against a target of interest. Both model targets and investigational targets may be simultaneously pursued utilizing the disclosed methods.

[0198] As described herein, the disclosed methods of performing APS, which in some embodiments includes methods for mRNA display, can be used to identify lead macrocycles against a small set of protein targets. For these efforts, a custom codon-reprogrammed library that utilizes orthogonal and engineered nsAAs + their corresponding tRNAs / AARSs may be used.

[0199] EXAMPLES

[0200] Example 1. Preparing on-resin mRNA display using a series of designed P-link sequences

[0201] To control translation by ribosome pausing and unpausing, for instance, achieved by allowing cycles of amino acid deprivation, a system to immobilize the mRNA during translation is developed. To this end, a biotin tether is incorporated into a P-linker sequence, used to cross-link mRNA to peptide. Based on the art, this on-resin mRNA display is feasible; however, it is preferred to identify a position for a biotin tether that is compatible with current Y-ligation strategies (or other such practice) and allows efficient translation and fusion. Therefore, a series of P-linkers involving different designer incorporations of the biotin tether are prepared. Primers that incorporate biotin at the 5’- end of the mRNA are prepared and tested. All designs are validated in standard, solution display conditions before being incorporated in on-resin conditions. The on-resin designs are prepared and tested for translation / fusion efficiency by heat elution from monomeric streptavidin, HA purification, and followed by qPCR of fusions.

[0202] Example 2. Intermittent pausing / unpausing during on-resin mRNA display of a single, defined peptide sequence

[0203] Intermittent pausing / unpausing of activity of a ribosome during the process of translation is carried out on an on-resin mRNA display, using the optimized immobilization / elution conditions developed in Example 1. P-linked and immobilized mRNAs are translated under conditions of single or multiple amino acid deprivation to induce temporary stalling of ribosome at an amino acid deficient codon. Amino acid and translation mixes are then removed by washing and then reintroduced to reinitiate translation-elongation process and eventual crosslink. Peptide-mRNA fusions are eluted and quantified by qPCR and benchmarked against standards from Example 1 experiments. Automation of washing steps is achieved using an automated bead washer. Depending on yields, as determined by qPCR, additional troubleshooting is undertaken.

[0204] Example 3. Intermittent pausing / unpausing during on-resin mRNA display of a focused peptide library

[0205] The methods and processes of Example 2 are repeated in a focused display library context. Deep sequencing is used to investigate any obvious sequence dependency of pausing / unpausing of ribosome activity during translation.

[0206] Example 4. Reassignment of Stop Codons at Two Locations for Incorporating Multiple Unique Nonstandard Amino Acids at Targeted Positions in a GFP11 peptide from a Single mRNA

[0207] A two-cycle peptide synthesis reaction was performed to incorporate two different nsAAs into a single GFP11 peptide. Fig. 9 shows a schematic for reassignment of an amber stop codon at two sites for targeted incorporation of two unique nsAAs into a single GFP11 peptide using a single mRNA template.

[0208] New GFP11 mRNA was synthesized having a first amber stop codon (X) following an N-terminal translation ramp (MKKK) and a second amber stop codon (X), downstream from the first. In the original GFP11 sequence, the location of the second stop codon X is a tyrosine codon. This was changed to an amber stop codon in the engineered mRNA molecule, to facilitate nsAA insertion. Fig. 9 depicts the portion of peptide synthesized in first cycle of the reaction (Mix 1) utilizing reassignment of the first amber stop codon (X) with pAzF and the portion of peptide synthesized in second cycle of the reaction (Mix 2) utilizing reassigning of the second, downstream amber stop codon (X) also with pAzF in the same peptide. Pausing occurred at the histidine residue indicated (arrow). During the first cycle of peptide synthesis, ribosomes were loaded onto this double amber stop codon containing gfpl 1 mRNA. Mix 1, a cell-free reaction mixture devoid of RF1, but containing pAzF aaRS and pAzF tRNA, was added to the immobilized mRNA. Translation commenced. The translating ribosome was paused at the histidine (H) codon because Mix 1 was devoid of any histidine. The immobilized mRNA and ribosomes were washed with buffer to remove the components of Mix 1. A second cycle was performed using similar components as in cycle one, however the amino acid mixture was changed to Mix II. Translation was allowed to run to completion, with the resulting peptide containing pAzF in two locations, each corresponding to the amber stop codon in the mRNA sequence.

[0209] Six different peptide synthesis reactions were then performed using the same systems and methods, in biological triplicate. The resulting peptides synthesized contained the nsAA pairs shown in Fig. 9. A negative control was also performed without any amino acids, which showed no increase in fluorescence over time. Four peptide synthesis reactions which involved using Mix I and Mix II in various configurations (ie., with insertion of two pAzFs, insertion of two 4-iodo-l-phenylalanines (IFs), or insertion of pAzf then IF / insertion of IF then pAzf) show a significant increase in fluorescence over time. In each of these four reactions different combinations of pAzF and / or IF were utilized.

[0210] This method allowed for reassignment of one type of stop codon at multiple positions in a single mRNA template with multiple unique nsAAs resulting in synthesis of seven distinct nsAA containing peptides from a single mRNA template. Insertion of an nsAA occurred both before, and after, a ribosomal pause point. For instance, in the same mRNA template, the amber stop codon was reassigned to incorporate pAzF at one position and IF at another position resulting in a single peptide with two unique nsAAs. A separate experiment where Mix 1 and Mix 2 contained only natural amino acids, without any nsAAs, was performed. No fluorescence increase was observed over time with this experiment, demonstrating that successful peptide synthesis reactions (those in which pAzF and / or IF were supplied) contain the nonstandard phenylalanine derivatives.

[0211] These data confirm that nsAAs can be inserted intentionally, at specific, desired locations within a peptide, both before and after a ribosomal pause point. These proof-of- principle data confirm that any number of nsAA insertions can occur within a single mRNA coding sequence, either before or after a pause point. There is no limit to the total number of insertions that can occur.

[0212] Example 5. Synthesis of tRNAs

[0213] Standard (for natural amino acids) E. coli tRNAs were obtained from a commercial source (New England Biolabs, Ipswich, MA, USA). For synthesizing tRNA specific to pAzF, first a DNA template for the in vitro transcription of pAzF tRNA was synthesized. A set of partially complementary oligonucleotides for this DNA template was designed using standard molecular biology techniques (see, e.g., Sambrook et al., supra). These oligonucleotides were annealed and extended by PCR technique using dNTPs (New England Biolabs), Q5 Polymerase Buffer (New England Biolabs), and Q5 High-Fidelity DNA Polymerase (New England Biolabs). The reaction was carried out as follows: 98° C for 30 seconds, 25 cycles of 15 seconds at 98° C, 30 seconds at 50° C, and 30 seconds at 72° C. The reaction was finalized by incubating for 2 minutes at 72° C. The extended product was purified using a commercially available PCR purification kit as per manufacturer’s protocol and the DNA was eluted using nuclease-free water. The purified DNA was used as the template in an in vitro transcription reaction using a commercially available RNA synthesis kit as per the manufacturer’ s protocol, to generate the p AzF tRNA. The remaining DNA template was digested using DNase I (New England Biolabs). Finally, the synthesized tRNA was purified using standard molecular biology techniques (see, e.g., Sambrook et al., supra). Purification of an Aminoacyl tRNA Synthetase

[0214] The pET15b (Novagen, Madison, WI, USA) expression vector was linearized. Separately, pAzF amino acyl tRNA synthetase (pAzFRS) coding sequence was amplified from Addgene plasmid 73546 (Addgene, Inc., Watertown, MA, USA) using standard molecular biology techniques (see, e.g., Sambrook et al., supra). The amplified pAzFRS coding sequence was cloned into the linearized pET15b vector using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) following the manufacturer’s guidelines. The completed reaction mixture was diluted in nuclease-free water and was used to sub-clone into NEBa cells (New England Biolabs) using a heat shock transformation. Positive clones were identified via Sanger sequencing and the correct plasmid was sub-cloned into E. coli BL21 (DE3) cells (New England BioLabs).

[0215] A single colony of E. coli BL21 (DE3) cells harboring the pET15b-pAzFRS vector was used to inoculate Luria-Bertani (LB) liquid medium. This culture was grown and then harvested using centrifugation at 5000 X g for 30 minutes at 4° C. The cell pellet was flash frozen in liquid nitrogen and stored at -80° C.

[0216] The cell pellet was thawed on ice and resuspended in binding buffer (containing

[0217] Tris-HCl, P-mercaptoethanol, NaCl, imidazole, glycerol, and phenylmethyl sulfonyl fluoride (PMSF)). Cells were lysed by adding lysozyme, following which sodium deoxycholate was added and the mixture incubated for 30 min at 4° C. The lysate was subjected to sonication, and then was cleared by centrifugation for 1 hour at 20,000 X g at 4° C. The cleared cell lysate was filtered using a 0.22 pM filter and applied to a His Trap Fast Flow column (Cytiva, Inc., Marlborough, MA, USA) equilibrated with the binding buffer using an AKTApure chromatography system (GE, USA). The protein was eluted from the column using Tris-HCl, P-mercaptoethanol, NaCl, imidazole, and glycerol. Finally, peak fractions were injected onto a Superdex Increase 75 column (Sigma Aldrich) using the AKTApure chromatography system for further purification and the buffer exchanged. The peak fractions were concentrated, pooled, flash frozen and stored at -80° C.

[0218] Aminoacylation of tRNA with nsAA

[0219] Aminoacylation of pAzF tRNA with pAzF was carried out in situ using the PURExpress kit (New England Biolabs).

[0220] Design and Synthesis of mRNA template

[0221] A plasmid encoding a modified gfpl 1 mRNA transcriptionally controlled by a T7 promoter and terminator was synthesized by cloning a modified gfpl l sequence into pUCIDT-Kan (Integrated DNA Technologies, Coralville, IA, USA). This plasmid allowed for the expression of the GFP11 peptide (Fig. 9) with first amber stop codon (X) following the N-terminal translation ramp (MKKK) and a second amber stop codon (X) at what was the tyrosine codon position in the original sequence translationally regulated with a Shine- Dalgarno sequence.

[0222] A modified GFP11 gene sequence containing two amber stop codons was designed: GCGCTAATACGACTCACTATAGGGAATTACAATACAAATAGAGGAGACGGA CAATGAAGAAGAAGTAGTCGTCGGCGATGCGCGATCACATGGTTCTGCACG AGTAGGTCAATGCCGCTGGGATTACATGAGAATTCGAGCTCCGTCGACAGGA CGGGGGGCGGCGGGGAAA (SEQ ID NO: 4).

[0223] This sequence was amplified by PCR using:

[0224] GCGCTAATACGACTCACTATAGGG (SEQ ID NO: 5) and mUmUTTCCCCGCCGCCCCCCGTCCTGTCGACGGAGCTCGAATTCTCATGTAA TCCCAGCGGCA (SEQ ID NO: 6) as PCR primers, dNTPs (New England Biolabs), 1 x Q5 Polymerase Buffer (New England Biolabs), modified-GFPl l-pUCIDT-Kan vector, and Q5 High-Fidelity DNA Polymerase (New England Biolabs). The PCR reaction was carried out as follows: 98° C for 30 seconds, 25 cycles of 15 seconds at 98° C, 30 seconds at 50° C, and 30 seconds at 72° C. The reaction was finalized by incubating for 2 minutes at 72° C. The extended product was purified using a commercially available PCR purification kit as per manufacturer’s protocol and the DNA was eluted using nuclease-free water. The purified DNA was used as the template in an in vitro transcription reaction using the Hi Scribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs) as per the manufacturer’s guidelines, to generate the gfpl l mRNA. The remaining DNA template was digested using DNase I (New England Biolabs). Finally, the synthesized mRNA was purified using standard molecular biology techniques (see, e.g., Sambrook et al., supra).

[0225] The purified mRNA was dephosphorylated in a reaction containing IX rCutSmart Buffer (New England Biolabs), RNase Inhibitor (New England Biolabs), Quick CIP (New England Biolabs) and nuclease-free water at 37° C for 9 hours. The dephosphorylated mRNA was purified using standard molecular biology techniques (see, e.g., Sambrook et al., supra).

[0226] Preparation of Amino Acid Mixtures

[0227] Amino acid mixtures (Mix I and Mix II) were prepared as outlined in Caschera et al., Biotechniques 58.1 (2015): 40-43. For example, Mix I comprised amino acids M, K, S, A, M, R, D and the specific nsAA (pAzF or IF) to be incorporated at the first stop codon location. pAzF and / or IF were resuspended using the same method as disclosed in the same reference for L-phenylalanine.

[0228] Ligation of Phosphorylated / Biotinylated DNA to mRNA Template

[0229] Dephosphorylated gfpl 1 mRNA was ligated to a phosphorylated and biotinylated DNA oligonucleotide as disclosed in Biyani et al. (Nucleic Acids Res (2006), 34(20), el40. doi: 10.1093 / nar / gkl771) using T4 RNA Ligase I (New England Biolabs). The dephosphorylated gfpl l RNA was mixed with biotinylated DNA oligonucleotide in a reaction mixture containing IX T4 RNA Ligase Buffer (New England Biolabs), ATP (New England Biolabs), and PEG 8000 (New England Biolabs). The reaction mixture was heated and slow-cooled to allow annealing. T4 RNA Ligase I (New England Biolabs), and RNase Inhibitor (New England Biolabs) were added to the cooled mixture and further incubated for 3 hours at 25° C.

[0230] Upon reaction completion, the ligation reaction efficiency was assessed by analyzing the reaction components on a 15 % 8 M urea-PAGE stained with a commercially available DNA stain and quantifying the level of disappearance of the DNA-biotin band around 50nt in the completed ligation reaction mixture as compared to a sample taken from the reaction mixture before T4 RNA Ligase I was added, using densitometry.

[0231] Fig. 10 is a gel electrophoresis picture showing confirmation of ligation of mRNA template to biotinylated DNA. Lane contents are as follows: (1) low range ssRNA ladder (New England BioLabs); (2) dephosphorylated gfpl l mRNA; (3) biotinylated DNA linker; (4) reaction mixture, after adding T4 RNA Ligase I; (5) reaction mixture, before adding T4 RNA Ligase I and RNase Inhibitor. Ligation efficiency was calculated by quantifying decrease in the DNA-biotin band after ligation reaction completion (see bands in box).

[0232] Binding Biotinylated mRNA Template to Magnetic Beads

[0233] The Streptavidin Magnetic Bead suspension (New England Biolabs) was vortexed in the manufacturers bottle to resuspend the beads and added to a 1.5 ml microcentrifuge tube. The microcentrifuge tube was placed into a magnetic tube holder to remove the supernatant liquid from the magnetic beads. The beads were then washed by adding 2 X wash buffer followed by vortexing for about 5 seconds and putting in the magnetic tube holder to remove the liquid from the beads. This wash step was repeated two more times. The ligation reaction mixture containing the biotinylated mRNA template was added to the washed beads. The resulting reaction mixture was incubated at room temperature while agitating in a tube holder at 400 rpm for 15 minutes and then was placed into a magnetic tube holder to remove the liquid from the beads. Beads were washed with 2X wash buffer, followed by vortexing for about 5 seconds and returned to the magnetic tube holder to remove the liquid from the beads. This wash step was repeated. Washed beads were resuspended in water and PURExpress Buffer A (New England Biolabs) for the solidphase peptide synthesis reaction.

[0234] Solid-Phase Peptide Synthesis with Reassignment of an Amber Stop Codon More Than Once to Incorporate Multiple Unique nnAAs in a GFP11 Peptide

[0235] Magnetic beads loaded with gfpl 1 mRNA were distributed into thin walled 200 pl tubes on ice. pAzF tRNA was folded using a thermal cycler. A first reaction mixture comprising Buffer B (PURExpress, New England Biolabs), 70S ribosomes, RF2, RF3, pAzFRS, pAzF tRNA and E. coli. tRNA (for natural amino acids) and water was added to magnetic beads. Amino acid Mix I containing pAzF was added to the first reaction mixture. The composition of this reaction mixture varied depending on the targeted incorporation of nsAAs at specific sites. For instance, in this example, pAzF and its corresponding translation machinery were included in Mix I and the first reaction mixture, respectively, while IF and its corresponding translation machinery were included in Mix II and the second reaction mixture, respectively, and so forth. The resulting mixture was incubated at 37° C. Separately, control mixtures (for example, mixtures without any amino acids) were placed at 4° C after the incubation.

[0236] After incubation, the resulting mixture was chilled in a 104-well magnetic plate. The liquid was removed from the tube and discarded. Magnetic beads were resuspended in appropriate buffer. The tube containing the beads was transferred to the adjacent well, then back again five times to wash the beads. The liquid was removed from the tube and discarded. Now, the next reaction mixture (for example, the second reaction mixture for the second cycle translation machinery corresponding to IF) was added to the tubes containing the washed magnetic beads. The beads were resuspended and mixed with the second reaction mixture by pipetting up and down. Amino acid Mix II with IF was added to the resuspended beads and the resulting mixture was incubated at 37° C in a thermocycler. Any controls that were previously placed at 4° C were also now incubated at 37° C in a thermocycler. All mixtures were incubated for 5 minutes at 37° C. Tubes containing magnetic beads were removed from the thermocycler and placed on a chilled magnetic block. An aliquot was removed from each tube and placed in a 384-well plate for peptide characterization. Recombinantly expressed and purified GFP1-10 was added to each well of the 384-well plate. Mixtures were pipetted up and down to mix. A GFP assay was conducted by placing the 384-well plate in a plate reader at 37° C and emission was recorded at 528 nm, while exciting at 488 nm.

[0237] Recycling and Reuse of mRNA Loaded Magnetic Beads

[0238] After the completed peptide synthesis reaction, the immobile fraction was removed and the gfpl 1 mRNA-bead complex was washed for reuse. First, 100 pL ice-cold 2 M urea that has been sterilized by passage through a 0.22 pm filter was added to the mRNA-beads. The solution was pipetted up and down to resuspend the magnetic beads into a homogenous solution. The resuspended beads were then transferred to a sterile 1.5 mL microcentrifuge tube. To ensure all beads were transferred an additional 100 pL 2 M urea was added to the tube, the solution was pipetted up and down and then transferred to the 1.5 mL microcentrifuge tube. After all mRNA-beads were added to the 1.5 mL microcentrifuge tube, the tube was placed in a magnetic tube holder for one minute. The 2 M urea was removed from the immobilized magnetic beads by pipette, the tube was removed from the magnetic rack, and 750 pL of fresh 2 M urea was added to the beads. The beads were resuspended by gently pipetting the mixture up and down and the tube was placed back onto the magnet rack for one minute. The wash step was repeated two times. Subsequently, the wash was repeated two additional times with a high salt buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA, 2 MNaCl), and, finally, once with HKM 10 buffer (50 mM HEPES pH 7.6, 100 mM KC1, 10 mM MgC12). The washed beads- gfpl 1 mRNA complex, free of cell free reaction mixture, was resuspended in NEB Buffer A and nuclease-free water to ensure that the final concentration of Buffer A in the first cycle of the APS reaction is IX. The mRNA-bead mixture was gently pipetted up-and-down to ensure a homogenous solution so that the beads were redistributed and ready for reuse.

[0239] Example 6. Reassignment of Stop Codons at Two Locations for Incorporating Multiple Unique Nonstandard Amino Acids at Targeted Positions in a Teduglutide Peptide from a Single mRNA

[0240] In certain embodiments, a method of reassignment of amber stop codon at two or more sites for targeted incorporation of multiple unique nsAAs into a peptide is provided. In such a method, repeated amber stop codon suppression may be used to synthesize multiple unique nsAA-containing peptides from a single mRNA template. In one such example, a two-cycle peptide synthesis reaction was performed to incorporate two different nsAAs into a single Gattex peptide.

[0241] A new Gattex mRNA was synthesized containing two amber stop codons replacing the wildtype methionine and asparagine codons, respectively. This mRNA was translated in two stages, using two separate translation mixes. The first cycle of the reaction utilized reassignment of the first amber stop codon in order to insert 4-iodo-phenylalanine (IF) at the wildtype methionine site. The second cycle of the reaction utilized reassignment of the second amber stop codon in order to insert 4-azido-phenylalanine (pAzF) at the wildtype asparagine site in the same peptide, using the same mRNA.

[0242] During the first cycle of peptide synthesis, ribosomes were loaded onto this double amber stop codon containing Gattex mRNA. A first cell-free reaction mixture devoid of RF1 and the amino acid leucine, but containing IF and IF tRNA, was added to the immobilized mRNA. Translation was initiated. The translating ribosome was paused at a leucine (L) codon located downstream from the first amber stop codon, but upstream from the second. The immobilized mRNA and paused ribosomes were washed with buffer to remove the components of cycle one. A second cell-free reaction mixture was introduced using similar components as in cycle one, still devoid of RF1, but which comprised leucine as well as pAzF and pAzF tRNA. Translation resumed upon introduction of the leucine into the nascent peptide and was allowed to continue to completion.

[0243] Three negative controls were included: (1) no amino acids added, (2) only the first cell-free reaction mixture added, and (3) both the first and second cell-free reaction mixtures, but without any ns A As. All negative controls showed minimal to no increase in luminescence compared to the APS reaction. In contrast, the reactions incorporating both nsAAs via the first and second cell-free reaction mixtures showed a significant increase in luminescence over time, demonstrating successful peptide synthesis and confirming the presence of the nsAAs in the final, translated Gattex peptide. This method allowed for the reassignment of one type of stop codon at multiple positions within a single mRNA template, resulting in the synthesis of a unique nsAA-containing Gattex peptide.

[0244] To quantify the peptide synthesis reactions a standard curve was generated by titrating chemically synthesized HiBiT peptide. This curve was analyzed using a four- parameter logistic model, allowing for the interpolation of the quantity of Gattex fusion peptide produced in the APS reactions. Fig. 11 presents data from a single experiment, where biological triplicates were performed. The average yield from these triplicates was 6.73 ± 0.26 nM.

[0245] Example 7. Generation of a “Late Click” mRNA Display Construct

[0246] A synthetic mRNA construct was created to include an azide handle covalently attached toward the 3’ end of its sequence. This mRNA was bound to a biotinylated, DNA adapter sequence by base-pair hybridizing the DNA adapter to a portion of the 3’ end of the mRNA for on-bead translation (see Fig. 1 A). The mRNA-DNA-biotin construct was then conjugated to streptavidin-containing magnetic beads (New England Biolabs, Ipswich, MA, USA).

[0247] Beads were prepared as follows: the beads will bind greater than 1000 pmol of free biotin per mg and greater than 500 pmol of single-stranded 25 bp biotinylated oligonucleotide per mg. Based on this, 62.5 pL beads were used in this APS reaction, at a concentration of 4 mg / mL. The beads were added to microcentrifuge tube and washed 2X with 500 pL IX high salt buffer (10 mM HEPES pH 7.6, 1 mM EDTA, 2 M NaCl), then IX with 500 pL IX HKMio buffer (50 mM HEPES pH 7.6, 100 mM KC1, 10 mM MgCh), and centrifuged to pellet. The pelleted beads were resuspended in 250 pL IX HKMio buffer with an RNase inhibitor.

[0248] To conjugate the mRNA-DNA-biotin construct to the beads, all of the liquid was removed from the beads, 50 pL of the construct was added and maintained at ambient temperature for 30 minutes while rotating. All liquid was separated from the magnetic beads, which were then washed 2 X with 500 pL high salt buffer with RNase Inhibitor, then 1 X with 250 pL HKMio buffer with RNase Inhibitor.

[0249] APS was then initiated and performed in two phases, with a single pause point (a two-cycle reaction). This APS reaction was performed in the dark, all reagents and reaction tubes were kept away from light, using foil to do so where necessary.

[0250] The first cycle of APS proceeded as follows: 24.8 pL of a first translation mix (4.8 pL buffer, 7.2 pL 70S ribosome subunits, 0.8 pL RNAI, 8.0 pL SI, qs with water) was combined with 4.0 pL amino acid mixture and incubated at 37° C for 30 min. The amino acid mixture was free of a single amino acid, to induce a pause during translation of the mRNA.

[0251] Removal of the first translation mix required very cold, highly stringent washing conditions. The construct-ribosome-beads mixture was washed with 100 pL ice-cold high magnesium buffer three times. Washing occurred in the dark.

[0252] The second cycle of APS proceeded as follows: 40.0 pL of a second translation mix (12.8 pL buffer, 0.8 pL RNAI, 4.0 pL tRNA, 4.0 pL amino acids, qs with water) was added to the now washed construct-ribosome-beads mixture and incubated at 37° C for 30 min. This second translation mix included the amino acid withheld from the first, to reverse ribosomal pause and resume translation.

[0253] The “late click” element was then added to the mixture. 11.52 pL, 10 pM DBCO- Puromycin construct (Fig. 5) was added and the resulting mixture was maintained at ambient temperature for 18 hours, while rotating. Again, at all times this reaction was performed in the dark, using foil to maintain darkness as needed. After 18 hours, the reaction was terminated by adding 100 mM EDTA and incubate at 37° C for 20 min.

[0254] Reverse transcription, for peptide identification, was then performed as follows. A reverse transcription mix (0.625 mM dNTPs, IX buffer, reverse transcriptase) was added to the terminated reaction and incubated 42° C for 1 hour. At 30 minutes, and again at 45 minutes, the entire mixture was pipetted up-and-down to resuspend the beads. Thereafter, the beads were washed twice with HKMio buffer, once with 100 pL IX NEB Buffer r3.1 (New England Biolabs), and the mRNA display constructs were removed from the beads by treatment with the restriction enzyme PvuII (a site for which was built into the DNA adapter sequence for this exact purpose).

[0255] Peptide purification and qPCR analysis confirmed the successful translation of the entire peptide, the successful incorporation of the “late click” element into the peptide, and the creation of an mRNA display product.

[0256] Example 8.

[0257] There is an increasing need to get larger molecules, such as peptide macrocycles, into cells for a variety of applications and sufficient data has begun to foster the belief that this is a tractable problem. Variations on the mRNA display technology that begin to access more cell-permeable chemical space constitute one of the main opportunities for innovation and capitalization. It appears that there is a “sweet spot” for the overall size of the macrocyclic peptide of roughly 5-8 amino acids and that, within this range, modulating the number of hydrogen bond donors / acceptors and the hydrophobicity as inferred by calculated octanol-water partition coefficient (clogP) hold the key to getting this class of compounds potently into cells. The challenge is that, as the macrocycle ring gets smaller, so does the diversity accessible through canonical amino acids. Additionally, the ring juncture, begins to comprise a greater percentage of the molecule. Methods that can sustain high diversity in smaller ring libraries could have a significant impact. mRNA allows rapid de novo ligand discovery against virtually any soluble protein target. At the moment, there are a lot of highly promising targets that are amenable to mRNA display, especially on the intracellular side. On the extracellular side, there are still opportunities in antibody replacements for immunotherapy and radionuclide delivery. Further development of APS in mRNA display will focus both on answering questions about the technology and uncovering valuable, new composition of matter simultaneously, in parallel. The near-term goal is to advance APS-display to an in vitro selection against a target of interest. With the initial qPCR validation in hand, many experiments can be designed and carried out in a sequencing-based format.

[0258] Pausing and recovery efficiency. Impacts of pause and recovery on mRNA display qPCR yields can be assessed. To gain confidence and know-how for implementation of APS in mRNA display, pausing and recovery efficiencies are investigated more intensively with a variety of substrates. Efficiency of pausing at different amino acids.

[0259] Efficiency of pausing at different AAs is investigated by using libraries that are translated under different amino acid drop out conditions. Deep sequencing and subsequent analysis informs on efficiency and context dependence of pausing. Because libraries can be multiplexed and barcoded, multiple iterations of this experiment are carried out rapidly. Efficiency of multiple pauses.

[0260] Similar experiments, but larger libraries are used to test efficiency of multiple pauses. Libraries are designed to contain single pause internal standards.

[0261] Pausing via tRNA Holdout.

[0262] APS can rely on amino acid hold out to control pausing efficiency and recovery. Pausing by tRNA holdout is explored, using both purified pools of natural tRNAs, as well as synthetic tRNAs. Since Flexizyme uses exclusively synthetic tRNAs, APS display will be tested under similar conditions.

[0263] Efficiency of multiple initiations.

[0264] By decreasing competition and limiting tRNAs (and thus codon usage) at initiation, it is possible to employ multiple different initiator tRNAs for higher diversity. The PeptiDream, ClAcX, cyclization methodology typically requires that the initiator tRNA and amino acid next to the N-terminal chloride, be held constant. APS enables diversity where there typically is none in the standard mRNA display campaign.

[0265] Compatibility with mRNA display selections.

[0266] A determination as to whether pausing and recovery fidelity is sufficient to support a selection campaign without resulting in bias away from the pause incorporation is made. APS display platform can access massive diversity by repeated genetic code turnover, a series of three sets of selections are carried out in parallel and use the well validated, natural stop codons, (amber, ochre, and opal):

[0267] Standard APS display - this library involves standard pausing up to 2 times at internal positions in an otherwise largely canonical amino acid macrocycle library. A library is used with a single pause point, comprised of the 3 stop codons, located between the variable region and linker region. Nitrile-thiazoline cyclization chemistry is used here (J. Am. Chem. Soc., 145, 1512-17, 2023). Both variable and linker are translated with canonical amino acids and pausing occurs either side of the internal stop codon; the stop codon is translated as one of 3 aryl nitriles, which allows cyclization onto an N-terminal Cys residue. The use of all 3 stop codons is possible via APS-based pausing and restarting.

[0268] Minicycle mRNA display - this library involves pausing after initiation or alternative strategy to allow multiple bridging motifs through GC-switching. A focused set of ring junctures, comprising 3 electrophiles and 3 nucleophiles is feasible in short order via the 3 stop codons. PeptiDream chloroalkane cyclization chemistry is used here. This library displays a canonical variable region flanked on both N- and C-termini by a single codon, randomized between the 3 stop codons; the linker region is canonical. This involves a total of 4 pauses, and uses the 3 stop codons first to encode 3 different initiator electrophiles (N- terminus) and then 3 different thiol nucleophiles (C -terminus).

[0269] Multicycles mRNA display - this library combines the strategies of the prior two libraries and increases the complexity of the libraries, by combining multiple cyclic junctures. The three natural stop codons are employed to allow pausing and switching between sets of electrophiles and nucleophiles. PeptiDream chloroalkane cyclization chemistry is used here as one cyclization chemistry, in conjunction with click or imine chemistry for the second series of junctions. Stop codons are repurposed up to 4 times to encode different moieties. This approach accesses macrocycles of powerful structural complexity.

[0270] Selections are run in parallel. Hit peptides are prepared off-RNA and tested and validated in binding and / or inhibition assays. These selections trade on the in-hand capabilities of APS display. More aggressive selection libraries can also be employed and developed.

Claims

CLAIMS1. A method of synthesizing an artificial peptide, comprising: creating a synthetic mRNA having at least first and second insertion sites in its coding sequence; translating the mRNA; inserting a first nonstandard amino acid into the first insertion site and a second nonstandard amino acid into the second insertion site; and terminating translation.

2. The method of claim 1, further comprising immobilizing the mRNA before translation.

3. The method of claim 2, wherein the immobilizing comprises hybridizing at least a portion of the mRNA to a linker oligonucleotide.

4. The method of claim 3, wherein the hybridizing comprises base-pairing a sequence of the mRNA with a complimentary sequence in the linker oligonucleotide.

5. The method of claim 3 or claim 4, wherein the linker oligonucleotide comprises a moiety selected from a biotin moiety, a puromycin moiety, and both a biotin moiety and a puromycin moiety.

6. The method of any one of claims 2-5, wherein the linker comprises a biotin moiety and the immobilization occurs via binding to a streptavidin-containing substrate.

7. The method of claim 6, wherein the substrate comprises magnetic beads.

8. The method of any one of claims 1-7, wherein inserting a nonstandard amino acid comprises: pausing a ribosome before the at least first and second insertion sites during translation and inserting the first and second nonstandard amino acids after the pause; or pausing a ribosome after the at least first and second insertion sites during translation and inserting the nonstandard amino acids before the pause.

9. The method of claim 8, wherein pausing occurs by reassigning stop codons, wherein at least one of the first and second insertion sites is a stop codon.

10. The method of claim 8, wherein pausing occurs via withholding of one or more amino acids during translation.

11. The method of claim 10, wherein the one or more amino acids correspond to a codon located upstream or downstream of one or more of the first and second insertion sites.

12. The method of claim 10 or claim 11, wherein the one or more amino acids are each independently selected from alanine, histidine, leucine, methionine, and tyrosine.

13. The method of claim 10 or claim 11, wherein the one or more amino acids are each independently selected from arginine, isoleucine, and threonine.

14. The method of claim 8, wherein pausing occurs via withholding of one or more tRNAs during translation.

15. The method of claim 14, wherein the one or more tRNAs each independently comprise anticodons corresponding to one or more of the first and second insertion sites.

16. The method of claim 14 or claim 15, wherein the one or more tRNAs are each independently selected from a tRNA having an anticodon to a codon selected from GCU, GCC, GCA, GCG, CAU, CAC, CUU, CUC, CUA, CUG, AUG, UAU, and UAC.

17. The method of claim 14 or claim 15, wherein the one or more tRNAs are each independently selected from a tRNA having an anticodon to a codon selected from CGU, CGC, CGA, CGG, AUU, AUC, AUA, AUG, ACU, ACC, ACA, and ACG.

18. The method of claim 8, where pausing occurs via withholding of one or more nonstandard amino acids.

19. The method of any one of claims 1-18, wherein the at least first and second insertion sites are nonsequential in the coding sequence.

20. The method of any one of claims 1-18, wherein the at least first and second insertion sites occur sequentially in the coding sequence.

21. The method of any one of claims 1-20, wherein the nonstandard amino acids are the same.

22. The method of any one of claims 1-20, wherein the nonstandard amino acids are different.

23. The method of any one of claims 1-22, wherein each nonstandard amino acid is independently selected from canavanine, cucurbitine, albizziin, laminine, kainic acid, a- diamino acids, P-diamino acids, hydroxyproline, a,a-dialkyl glycines, and azacyclic amino acids.

24. The method of any one of claims 1-22, wherein each nonstandard amino acid is independently selected from p-azido-l-phenylalanine, 4-iodo-l-phenylalanine, 4-methyl-l- phenylalanine, 2-naphthyl-l-alanine, and O-methyl-tyrosine.

25. The method of any one of claims 1-24, wherein the coding sequence further comprises a third insertion site.

26. The method of any one of claims 1-25, further comprising, after the insertion and prior to termination, pausing the ribosome and inserting a puromycin-containing linker into the peptide.

27. The method of claim 26, wherein: the linker comprises puromycin, ethylene glycol, and a click chemistry element; and the mRNA comprises a moiety configured to react with the click chemistry element.

28. The method of claim 27, wherein: the moiety is an azide; the click chemistry element is dibenzocyclooctyne - triethylene glycol (DBCO- TEG); and the DBCO-TEG reacts with the azide, covalently binding the peptide to the mRNA.

29. The method of any one of claims 26-28, further comprising, after termination, reverse-transcribing the mRNA.

30. A method of synthesizing an artificial peptide, comprising: creating a synthetic mRNA having a first insertion site and a second insertion site in its coding sequence with at least one non-insertion codon located between the first and second insertion sites; initiating translation of the mRNA and inserting a first nonstandard amino acid into the first insertion site; thereafter, pausing a translating ribosome at the non-insertion codon; resuming translation and inserting a second nonstandard amino acid into the second insertion site; and terminating translation.

31. The method of claim 30, further comprising immobilizing the mRNA before translation.

32. The method of claim 31, wherein the immobilizing comprises hybridizing at least a portion of the mRNA to a linker oligonucleotide.

33. The method of claim 32, wherein the hybridizing comprises base-pairing a sequence of the mRNA with a complimentary sequence in the linker oligonucleotide.

34. The method of claim 32 or claim 33, wherein the linker oligonucleotide comprises a moiety selected from a biotin moiety, a puromycin moiety, and both a biotin moiety and a puromycin moiety.

35. The method of any one of claims 32-34, wherein the linker comprises a biotin moiety and the immobilization occurs via binding to a streptavidin-containing substrate.

36. The method of claim 35, wherein the substrate is magnetic beads.

37. The method of any one of claims 30-36, wherein inserting a nonstandard amino acid comprises inserting a nonstandard amino acid into the first and / or second insertion sites without pausing the translating ribosome.

38. The method of any one of claims 30-37, wherein the initiation of translation and insertion of a nonstandard amino acid into the first insertion site occurs by contacting the mRNA with a first translation mix.

39. The method of claim 38, wherein the first translation mix comprises the translating ribosome and the first nonstandard amino acid.

40. The method of any one of claims 30-39, wherein pausing occurs via withholding of an amino acid corresponding to the non-insertion codon.

41. The method of any one of claims 30-40, wherein the resumption of translation and insertion of a nonstandard amino acid into the second insertion site occurs by contacting the mRNA with a second translation mix.

42. The method of claim 40 or claim 41, wherein the second translation mix comprises the withheld amino acid and the second nonstandard amino acid.

43. The method of any one of claims 40 - 42, wherein the non-insertion codon codes for an amino acid selected from alanine, histidine, leucine, methionine, and tyrosine.

44. The method of any one of claims 40-42, wherein the non-insertion codon codes for an amino acid selected from arginine, isoleucine, and threonine.

45. The method of any one of claims 38 - 44, wherein the first translation mix is removed from contact with the mRNA before the mRNA is contacted with the second translation mix.

46. The method of any one of claims 30-45, wherein the first and second nonstandard amino acids are the same.

47. The method of any one of claims 30-45, wherein the first and second nonstandard amino acids are different.

48. The method of any one of claims 30-45, wherein the first and second nonstandard amino acids are each independently selected from canavanine, cucurbitine, albizziin, laminine, kainic acid, a-diamino acids, P-diamino acids, hydroxyproline, a,a-dialkyl glycines, and azacyclic amino acids.

49. The method of any one of claims 30-45, wherein the first and second nonstandard amino acids are each independently selected from p-azido-l-phenylalanine, 4-iodo-l- phenylalanine, 4-methyl-l-phenylalanine, 2-naphthyl-l-alanine, and O-methyl-tyrosine.

50. The method of any one of claims 30-49, wherein the coding sequence further comprises a third insertion site located downstream from the second insertion site, and at least one non-insertion codon is located between the second and third insertion sites.

51. The method of any one of claims 30-50, further comprising, after insertion of the second nonstandard amino acid and prior to termination, pausing the ribosome and inserting a puromycin-containing linker into the peptide.

52. The method of claim 51, wherein: the linker comprises puromycin, ethylene glycol, and a click chemistry element; and the mRNA comprises a moiety configured to react with the click chemistry element.

53. The method of claim 52, wherein: the moiety is an azide; the click chemistry element is dibenzocyclooctyne - triethylene glycol (DBCO- TEG); and the DBCO-TEG reacts with the azide, covalently binding the peptide to the mRNA.

54. The method of any one of claims 51-53, further comprising, after termination, reverse-transcribing the mRNA.

55. A method of creating an artificial peptide library, comprising: creating a synthetic mRNA having a first insertion site and a second insertion site in its coding sequence with at least one intervening codon located between the first and second insertion sites; initiating translation of a plurality of copies of the mRNA by contacting the copies with a first translation mix; inserting a first nonstandard amino acid into each first insertion site of each copy; thereafter, pausing a translating ribosome at the intervening codon of each copy; resuming translation of the plurality of copies by contacting the copies with a second translation mix; inserting a second nonstandard amino acid into each second insertion site of each copy; and terminating translation of the plurality of copies.

56. The method of claim 55, further comprising immobilizing each copy of the mRNA before translation.

57. The method of claim 56, wherein the immobilizing comprises independently hybridizing each copy of the mRNA to its own linker oligonucleotide.

58. The method of claim 57, wherein the hybridizing comprises base-pairing a sequence of each copy of the mRNA with a complimentary sequence in its linker oligonucleotide.

59. The method of claim 57 or claim 58, wherein each linker oligonucleotide independently comprises a moiety selected from a biotin moiety, a puromycin moiety, and both a biotin moiety and a puromycin moiety.

60. The method of any one of claims 57-59, wherein each linker independently comprises a biotin moiety and the immobilization occurs via binding to a streptavidin- containing substrate.

61. The method of claim 60, wherein the substrate is magnetic beads.

62. The method of any one of claims 55-61, wherein: the first translation mix comprises a mixture of nonstandard amino acids; and inserting the first nonstandard amino acid comprises randomly inserting one of the nonstandard amino acids from the mixture into each of the first insertion sites without pausing the translating ribosome.

63. The method of claim 62, wherein the mixture of nonstandard amino acids comprises canavanine, cucurbitine, albizziin, laminine, kainic acid, a-diamino acids, P-diamino acids, hydroxyproline, a,a-dialkyl glycines, and azacyclic amino acids.

64. The method of claim 62, wherein the mixture of nonstandard amino acids comprises p-azido-l-phenylalanine, 4-iodo-l-phenylalanine, 4-methyl-l-phenylalanine, 2-naphthyl-l- alanine, and O-methyl-tyrosine.

65. The method of any one of claims 55-64, wherein pausing occurs via withholding of an amino acid corresponding to each intervening codon and the first translation mixture is free of that amino acid.

66. The method of claim 65, wherein each intervening codon corresponds to an amino acid selected from alanine, histidine, leucine, methionine, and tyrosine.

67. The method of claim 65, wherein each intervening codon corresponds to an amino acid selected from arginine, isoleucine, and threonine.

68. The method of any one of claims 55-67, wherein:the first translation mix is removed from contact with the copies of the mRNA before the copies are placed into contact with the second translation mix; and the second translation mix comprises the withheld amino acid.

69. The method of any one of claims 55-67, wherein: the first translation mix is not removed when the copies of the mRNA are placed into contact with the second translation mix; and the second translation mix comprises the withheld amino acid.

70. The method of any one of claims 55-69, wherein: the second translation mix comprises a mixture of nonstandard amino acids; and inserting the second nonstandard amino acid comprises randomly inserting one of the nonstandard amino acids from the second mixture into each of the first insertion sites without pausing the translating ribosome.

71. The method of claim 70, wherein the mixture of nonstandard amino acids comprises canavanine, cucurbitine, albizziin, laminine, kainic acid, a-diamino acids, P-diamino acids, hydroxyproline, a,a-dialkyl glycines, and azacyclic amino acids.

72. The method of claim 70, wherein the mixture of nonstandard amino acids comprises p-azido-l-phenylalanine, 4-iodo-l-phenylalanine, 4-methyl-l-phenylalanine, 2-naphthyl-l- alanine, and O-methyl-tyrosine.

73. The method of any one of claims 55-64, wherein each intervening codon is a stop codon and pausing occurs by repurposing stop codons.

74. The method of claim 73, wherein: each intervening codon is an amber stop codon and the first translation mix is free of release factor 1 (RF1); each intervening codon is an ochre stop codon and the first translation mix is free of RF1; or each intervening codon is an opal stop codon and the first translation mix is free of release factor 2.

75. The method of claim 73 or claim 74, wherein the first translation mix is removed from contact with the copies of the mRNA before the copies are placed into contact with the second translation mix; the second translation mix comprises a synthetic tRNA comprising an anticodon to the stop codon; andthe synthetic tRNA is configured to insert a natural or a nonstandard amino acid into the intervening codon.

76. The method of claim 73 or claim 74, wherein: the first translation mix is not removed when the copies of the mRNA are placed into contact with the second translation mix; the second translation mix comprises a synthetic tRNA comprising an anticodon to the stop codon; and the synthetic tRNA is configured to insert a natural or a nonstandard amino acid into the intervening codon.

77. The method of claim 75 or claim 76, wherein the synthetic tRNA is configured to insert a natural amino acid selected from alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

78. The method of claim 75 or claim 76, wherein the synthetic tRNA is configured to insert a nonstandard amino acid selected from canavanine, cucurbitine, albizziin, laminine, kainic acid, a-diamino acids, P-diamino acids, hydroxyproline, a,a-dialkyl glycines, and azacyclic amino acids.

79. The method of claim 75 or claim 76, wherein the synthetic tRNA is configured to insert a nonstandard amino acid selected from p-azido-l-phenylalanine, 4-iodo-l- phenylalanine, 4-methyl-l-phenylalanine, 2-naphthyl-l-alanine, and O-methyl-tyrosine80. The method of any one of claims 55-79, further comprising, after insertion of the second nonstandard amino acid and prior to termination, pausing the ribosomes and contacting each mRNA with a puromycin-containing linker configured for covalent attachment to each synthetic peptide.

81. The method of claim 80, wherein: the linker comprises puromycin, ethylene glycol, and a click chemistry element; and each mRNA comprises a moiety configured to react with the click chemistry element.

82. The method of claim 81, wherein: the moiety is an azide; the click chemistry element is dibenzocyclooctyne - triethylene glycol (DBCO- TEG); andthe DBCO-TEG reacts with the azide, covalently binding each peptide to the mRNA from which it was translated.

83. The method of any one of claims 80-82, further comprising, after termination, reverse-transcribing each mRNA.

84. A method of synthesizing an artificial peptide, comprising: creating a synthetic mRNA having a first insertion site and a second insertion site in its coding sequence with at least one non-insertion codon located before the first and second insertion sites; initiating translation of the mRNA; thereafter, pausing a translating ribosome at the non-insertion codon; resuming translation and inserting a first nonstandard amino acid into the first insertion site and a second nonstandard amino acid into the second insertion site; and terminating translation; wherein the first and second insertion sites occur sequentially in the coding sequence.

85. The method of claim 84, further comprising immobilizing the mRNA before translation.

86. The method of claim 85, wherein the immobilizing comprises hybridizing at least a portion of the mRNA to a linker oligonucleotide.

87. The method of claim 86, wherein the hybridizing comprises base-pairing a sequence of the mRNA with a complimentary sequence in the linker oligonucleotide.

88. The method of claim 86 or claim 87, wherein the linker oligonucleotide comprises a moiety selected from a biotin moiety, a puromycin moiety, and both a biotin moiety and a puromycin moiety.

89. The method of any one of claims 86-88, wherein the linker comprises a biotin moiety and the immobilization occurs via binding to a streptavidin-containing substrate.

90. The method of claim 89, wherein the substrate is magnetic beads.

91. The method of any one of claims 84-90, wherein inserting a nonstandard amino acid comprises inserting a nonstandard amino acid into the first and / or second insertion sites after pausing the translating ribosome at the non-insertion codon.

92. The method of any one of claims 84-91, wherein the initiation of translation and the pausing occurs by contacting the mRNA with a first translation mix.

93. The method of claim 92, wherein the first translation mix comprises one or more ribosomes and is free of an element required for translation of non-insertion codon.

94. The method of any one of claims 84-93, wherein pausing occurs via withholding of an amino acid corresponding to the non-insertion codon.

95. The method of any one of claims 84-94, wherein the resumption of translation, insertion of a nonstandard amino acid into the second insertion site, and insertion of a nonstandard amino acid into the second insertion site occurs by contacting the mRNA with a second translation mix.

96. The method of claim 94 or claim 95, wherein the second translation mix comprises the withheld amino acid. The first nonstandard amino acid, and the second nonstandard amino acid.

97. The method of any one of claims 94-96, wherein the non-insertion codon codes for an amino acid selected from alanine, histidine, leucine, methionine, and tyrosine.

98. The method of any one of claims 94-96, wherein the non-insertion codon codes for an amino acid selected from arginine, isoleucine, and threonine.

99. The method of any one of claims 92-98, wherein the first translation mix is removed from contact with the mRNA before the mRNA is contacted with the second translation mix.

100. The method of any one of claims 84-99, wherein the first and second nonstandard amino acids are the same.

101. The method of any one of claims 84-99, wherein the first and second nonstandard amino acids are different.

102. The method of any one of claims 84-101, wherein the first and second nonstandard amino acids are each independently selected from canavanine, cucurbitine, albizziin, laminine, kainic acid, a-diamino acids, P-diamino acids, hydroxyproline, a,a-dialkyl glycines, and azacyclic amino acids.

103. The method of any one of claims 84-101, wherein the first and second nonstandard amino acids are each independently selected from p-azido-l-phenylalanine, 4-iodo-l- phenylalanine, 4-methyl-l-phenylalanine, 2-naphthyl-l-alanine, and O-methyl-tyrosine.

104. The method of any one of claims 84-103, wherein the coding sequence further comprises a third insertion site located downstream from the second insertion site.

105. The method of claim 104, wherein the first, second, and third insertion sites occur sequentially in the coding sequence.

106. The method of any one of claims 84-105, further comprising, after insertion of the second nonstandard amino acid and prior to termination, pausing the ribosome and inserting a puromycin-containing linker into the peptide.

107. The method of claim 106, wherein: the linker comprises puromycin, ethylene glycol, and a click chemistry element; and the mRNA comprises a moiety configured to react with the click chemistry element.

108. The method of claim 107, wherein: the moiety is an azide; the click chemistry element is dibenzocyclooctyne - triethylene glycol (DBCO- TEG); and the DBCO-TEG reacts with the azide, covalently binding the peptide to the mRNA.

109. The method of any one of claims 106-108, further comprising, after termination, reverse-transcribing the mRNA.

110. A method for reassignment of stop codons comprising: immobilizing an mRNA, wherein the mRNA includes two or more stop codons; reacting the mRNA with a first reaction mixture to form a complex, wherein the first reaction mixture comprises a first nonstandard amino acid to be inserted at a position of a first stop codon in the mRNA; collecting the complex, wherein the complex comprises the immobilized mRNA, a peptide with the first nonstandard amino acid, and the paused ribosome; and reacting the complex with a second reaction mixture, wherein the second reaction mixture comprises a second nonstandard amino acid to be inserted at a position of a second stop codon in the mRNA.

111. A method of creating an mRNA displayed peptide, comprising: immobilizing an mRNA to a support; translating the mRNA to create the peptide; and after translation, contacting the mRNA with a puromycin moiety for incorporation into the peptide; wherein: the puromycin moiety comprises means for attachment to the mRNA; and the contacting occurs after the peptide is created.

112. The method of claim 111, wherein the immobilizing comprises hybridizing the mRNA to a linker oligonucleotide.

113. The method of claim 111, wherein the hybridizing comprises base-pairing a sequence of the mRNA with a complimentary sequence in the linker oligonucleotide.

114. The method of claim 112 or claim 113, wherein the linker oligonucleotide comprises a biotin moiety.

115. The method of any one of claims 111-114, wherein immobilization occurs via binding to a streptavidin-containing substrate.

116. The method of claim 115, wherein the substrate comprises magnetic beads.

117. The method of any one of claims 111-116, wherein the puromycin moiety is part of a puromycin-containing linker molecule.

118. The method of claim 117, wherein the linker comprises puromycin, ethylene glycol, and a click chemistry element.

119. The method of claim 118, wherein the mRNA comprises a binding moiety configured to react with the click chemistry element.

120. The method of claim 119, wherein: the binding moiety is an azide; the click chemistry element is dibenzocyclooctyne - triethylene glycol (DBCO- TEG); and the DBCO-TEG reacts with the azide, covalently binding the peptide to the mRNA.

121. The method of any one of claims 111-120, further comprising, after translation and after contact with the puromycin moiety, reverse-transcribing the mRNA.

Images