Aptamer targeting connective tissue growth factor protein

Abstract

The present invention relates to the field of biomedicine. Specifically, the present invention relates to an aptamer targeting a connective tissue growth factor (CTGF) protein, an aptamer conjugate targeting the connective tissue growth factor protein, and the use thereof in inhibiting the activity of the connective tissue growth factor protein.

Description

Aptamers targeting connective tissue growth factor protein Technical Field

[0001] The present invention relates to the field of biomedicine. Specifically, the present invention relates to an aptamer targeting connective tissue growth factor (CTGF), an aptamer conjugate targeting CTGF, and uses thereof for inhibiting the activity of CTGF.

[0002] Background of the Invention

[0003] Aptamers are short fragments of DNA or RNA that can recognize and bind to target molecules (usually proteins) through their specific three-dimensional structures. These fragments are selected from randomly synthesized oligodeoxynucleotides or oligonucleotide libraries using SELEX (systematic evolution of ligands by exponential enrichment) (Maier et al., 2016). Compared to small molecule binders, aptamers often have better selectivity and higher affinity. Compared to antibodies, aptamers have a simpler evolution process, are easy to modify, have affinity adjustments, have low immunogenicity, and are versatile in structural design and engineering, making them ideal recognition ligands for their targets. As a result, an increasing number of aptamers have been developed and used as therapeutic agents and probes (Ni et al., 2021).

[0004] Duchenne muscular dystrophy (DMD) is a fatal, progressive genetic disease caused by mutations in the DMD gene, which results in the loss of functional dystrophin expression. DMD not only causes significant physical and mental suffering for patients, but also places a heavy economic burden on their families and society. Currently, steroids are the only approved treatment for DMD, but they can only slow disease progression. While gene therapy and cell therapy targeting dystrophin have potential, these treatments are still underdeveloped, limiting their clinical application. Consequently, treatments targeting the pathological changes in DMD have garnered increasing attention in recent years. Fibrosis, characterized by the excessive accumulation of extracellular matrix (ECM) proteins, is a primary pathological feature of skeletal muscle in DMD patients. In DMD, muscle fibrosis is directly associated with the progressive muscle dysfunction and lethal phenotype. Consequently, therapeutic approaches targeting fibrosis are being extensively developed. CTGF is a central protein regulating fibrosis. In DMD, CTGF levels correlate with the extent of skeletal muscle fibrosis. In mdx mice, an animal model of DMD, reduced CTGF levels can reduce the severity of muscular dystrophy. These findings suggest that CTGF may serve as a potential therapeutic target for treating DMD fibrosis.

[0005] Aptamers are artificially synthesized single-stranded DNA or RNA molecules. Due to their unique tertiary structure, they can tightly bind to target molecules. Aptamers offer several unique advantages, including: 1) wide applicability, targeting a variety of targets, including proteins, peptides, small molecules, inorganic ions, viruses, bacteria, and cells, with high affinity and specificity, capable of distinguishing subtle differences in molecular structure; 3) ease of labeling and modification, allowing them to bind to labeled molecules; 4) excellent stability, allowing for transportation and storage at room temperature; 5) ease of preparation, using methods such as PCR amplification, artificial synthesis, or molecular cloning; and 6) suitability for in vivo applications, lack of immunogenicity, and potential for clinical diagnosis and treatment. Aptamer-based therapies have shown promising results in the treatment of viruses, tumors, the cardiovascular system, the urinary system, the blood system, and the nervous system. Pegaptanib is an FDA-approved therapeutic aptamer for the treatment of age-related macular degeneration. However, there are no aptamer-based therapies targeting the connective tissue growth factor protein.

[0006] Summary of the Invention

[0007] Embodiment 1. An aptamer that specifically binds to a connective tissue growth factor protein, wherein the aptamer that specifically binds to a connective tissue growth factor protein comprises:

[0008] i) a nucleotide sequence that is at least about 90% identical, at least about 91% identical, at least about 92% identical, at least about 93% identical, at least about 94% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, or at least about 99% identical to any one of SEQ ID NOs: 1-10; or

[0009] ii) at least 12, at least 18, at least 24, at least 30, at least 36 or more consecutive nucleotides of any one of SEQ ID NOs: 1-10; or

[0010] iii) the nucleotide sequence of any one of SEQ ID NOs: 1-10, preferably, the nucleotide sequence of SEQ ID NO: 10.

[0011] Embodiment 2. The aptamer of embodiment 1, wherein the aptamer has a Kd (dissociation constant) for connective tissue growth factor of less than 200 nM, less than 175 nM, less than 150 nM, less than 110 nM, preferably less than 100 nM, preferably less than 70 nM, preferably less than 50 nM, preferably less than 30 nM, preferably less than 20 nM or less.

[0012] Embodiment 3. The aptamer nucleotide sequence of embodiment 1 or 2, wherein the aptamer has the biological activity of inhibiting connective tissue growth factor-induced fibrosis in cells.

[0013] Embodiment 4. The aptamer according to any one of embodiments 1 to 3 is truncated to improve the specific binding ability of the aptamer to the connective tissue growth factor protein.

[0014] Embodiment 5. The aptamer of any one of embodiments 1-4, wherein the aptamer is a modified aptamer, for example, the modified aptamer comprises one or more modifications that confer enhanced nuclease resistance to the aptamer and / or modifications that extend the in vivo half-life of the aptamer.

[0015] Embodiment 6. The aptamer of embodiment 5, wherein the modification comprises a 3' inverted deoxythymidine (3'idT) modification.

[0016] Embodiment 7. The aptamer of embodiment 5, wherein the modification comprises replacing one or more naturally occurring nucleotides with modified nucleotides, for example, the modified nucleotides are selected from 2'-fluoro, 2'-methoxyethyl, 2'-methoxy and / or 2'propyleneoxy modified nucleotides, preferably 2'-methoxy modified nucleotides.

[0017] Embodiment 8. The aptamer of embodiment 5, wherein the modification comprises an internucleotide modification, such as an internucleotide phosphorothioate linkage modification.

[0018] Embodiment 9. The aptamer of embodiment 5, wherein the aptamer comprises a 2'-methoxy (2'-OMe) modification and / or a 3' inverted deoxythymidine (3'idT) modification.

[0019] Embodiment 10. The aptamer of embodiment 1, wherein the aptamer nucleotide sequence (5'-3' direction) is

[0020] C(OMe)G(OMe)TAC(OMe)G(OMe)G(OMe)TC(OMe)G(OMe)AC(OMe)G(OMe)C(OMe)TAG(OMe)C(OMe)AC(OMe)ATC(OMe)AAG(OMe)C(OMe)TC(OMe)AATC(OMe)TT-idT, where (OMe) represents the 2'-methoxy (2'-OMe) modification of the corresponding nucleotide and idT represents the 3' inverted deoxythymidine modification.

[0021] Embodiment 11. An aptamer conjugate that specifically binds to a connective tissue growth factor protein, comprising the aptamer according to any one of embodiments 1 to 10 and a fatty acid and / or coumarin derivative conjugated thereto.

[0022] Embodiment 12. The aptamer conjugate of embodiment 11, wherein the fatty acid is selected from palmitic acid (PA), dodecanedioic acid (DA), tetradecanedioic acid, hexadecanedioic acid, stearic acid (SA), octadecanedioic acid, lauric acid, eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), and arachidonic acid (ARA), preferably, the fatty acid is octadecanedioic acid; and / or

[0023] The coumarin derivative is selected from 4-hydroxycoumarin, 3-acetyl-6-carboxycoumarin, warfarin, (2-oxo-2H-chromen-3-yl)acetic acid, [(8-acetyl-4-methyl-2-oxo-2H-chromen-7-yl)oxy]acetic acid, coumarin-3-carboxylic acid, N-(4-methyl-7-coumarin) oxalamide, 7-(carboxymethyl)-4-methylcoumarin, 7-methoxycoumarin-3-carboxylic acid, 6-methoxy-2-oxo-2H-chromen-3-carboxylic acid, preferably, the coumarin derivative is 4-hydroxycoumarin.

[0024] Embodiment 13. The aptamer conjugate of embodiment 11 or 12, wherein the aptamer is conjugated to the fatty acid via a linker arm.

[0025] Embodiment 14. The aptamer conjugate of embodiment 13, wherein the linker is

[0026] i) Connector arm 1 comprising the following structure,

[0027] n is an integer from 1 to 10, and m is an integer from 1 to 10;

[0028] or

[0029] ii) a connecting arm 2 comprising the following structure,

[0030] x is an integer of 1-10, and y is an integer of 1-10.

[0031] Embodiment 15. The aptamer conjugate of embodiment 14, wherein the tether is tether 1, wherein n=2, m=2.

[0032] Embodiment 16. The aptamer conjugate of embodiment 11, comprising the structure shown below:

[0033] Embodiment 17. A method for treating a connective tissue growth factor protein-related disease, comprising administering a therapeutically effective amount of the aptamer of any one of Embodiments 1-10 or the aptamer conjugate of any one of Embodiments 11-16 to a subject in need thereof, preferably, the subject is a human.

[0034] Embodiment 18. The method of embodiment 17, wherein the connective tissue growth factor protein-related disease is selected from Duchenne muscular dystrophy, liver fibrosis, pulmonary fibrosis, cardiac fibrosis, kidney fibrosis, skin fibrosis, and rheumatoid arthritis.

[0035] Embodiment 19. A pharmaceutical composition comprising the aptamer according to any one of embodiments 1-10 or the aptamer-conjugate according to any one of embodiments 11-16, and a pharmaceutically acceptable carrier or excipient.

[0036] Embodiment 20. Use of the aptamer according to any one of embodiments 1-10, the aptamer conjugate according to any one of embodiments 11-16, or the pharmaceutical composition according to embodiment 19 in the preparation of a medicament, wherein the medicament is used to treat connective tissue growth factor protein-related diseases.

[0037] Embodiment 21. The use according to embodiment 20, wherein the connective tissue growth factor protein-related disease is selected from Duchenne muscular dystrophy, liver fibrosis, pulmonary fibrosis, cardiac fibrosis, kidney fibrosis, skin fibrosis, and rheumatoid arthritis.

[0038] BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1. Nucleic acid gel electrophoresis results of 20 rounds of forward SELEX PCR targeting CTGF protein.

[0040] Figure 2. Quality test results of the library prepared by 2100 high-sensitivity DNA bioanalyzer.

[0041] Figure 3. Bioinformatics analysis of high-throughput sequencing data from several rounds of selected library sequencing results.

[0042] FIG4 . The ELONA method was used to detect the binding specificity of CTGF aptamers to CTGF protein.

[0043] Figure 5. IC of CTGF protein candidate aptamer C28 against Fibronectin 50 value.

[0044] Figure 6. IC of CTGF protein-targeting candidate aptamer C27 against Fibronectin 50 value.

[0045] Figure 7. IC of CTGF protein candidate aptamer C72 against Fibronectin 50 value.

[0046] Figure 8. IC of the candidate aptamer C28 targeting CTGF protein on cell migration 50 value.

[0047] Figure 9. IC of the candidate aptamer C27 targeting CTGF protein on cell migration 50 value.

[0048] Figure 10. IC of the candidate aptamer C72 targeting CTGF protein on cell migration 50 value.

[0049] Figure 11. IC of C28-1-40, a truncated variant of C28, against Fibronectin 50 value.

[0050] Figure 12. C28-1-40 inhibits Fibronectin in cells.

[0051] Figure 13. Chemical modification increases the serum stability of C28-1-40.

[0052] Detailed Description of the Invention

[0053] Unless otherwise indicated or defined, all terms used have their ordinary meaning in the art, which will be understood by those skilled in the art. Reference is made, for example, to standard manuals such as Sambrook et al., "Molecular Cloning: A Laboratory Manual"; Lewin, "Genes VIII"; and Roitt et al., "Immunology" (8th edition), as well as to the general prior art cited herein; in addition, unless otherwise indicated, all methods, steps, techniques and operations not specifically described in detail can and have been performed in a manner known per se, which will be understood by those skilled in the art. Reference is also made, for example, to standard manuals, the above-mentioned general prior art and other references cited therein.

[0054] definition

[0055] As used herein, the term "nucleotide" refers to a ribonucleotide or a deoxyribonucleotide, or a modified form thereof and analogs thereof. Nucleotides include species including purines (e.g., adenine, hypoxanthine, guanine, and their derivatives and analogs) and pyrimidines (e.g., cytosine, uracil, thymine, and their derivatives and analogs).

[0056] As used herein, "nucleic acid," "oligonucleotide," and "polynucleotide" are used interchangeably to refer to polymers of nucleotides and include DNA, RNA, DNA / RNA hybrids, and modifications of these types of nucleic acids, oligonucleotides, and polynucleotides, including the addition of various entities or moieties at any position of the nucleotide units. The terms "polynucleotide," "oligonucleotide," and "nucleic acid" include double- and single-stranded molecules. Nucleic acid, oligonucleotide, and polynucleotide are broader terms than the term aptamer, and thus the terms nucleic acid, oligonucleotide, and polynucleotide include aptamers but are not limited to aptamers.

[0057] As used herein, " aptamer " refers to a non-naturally occurring nucleic acid with a desired effect on a target molecule. The desired effect includes, but is not limited to, binding to the target, catalytically changing the target, reacting with the target in a manner that modifies or changes the functional activity of the target or the target, covalently connecting the target and promoting the reaction between the target and other molecules. In some embodiments, the effect is a specific binding affinity for a target molecule (such as a connective tissue growth factor protein), such a target molecule being a three-dimensional chemical structure rather than a polynucleotide, which combines the aptamer by a mechanism that is independent of Watson / Crick base pairing or triple helix formation, wherein the aptamer is not a nucleic acid with a known physiological function that is combined with the target molecule. In this context, " specific binding " of an aptamer to its target (such as a connective tissue growth factor protein) refers to that the aptamer is typically combined to its target with an affinity much higher than that of the aptamer to other non-target components in a mixture or sample. An aptamer can be a single-stranded DNA, a single-stranded DNA, a single-stranded DNA / RNA hybrid, or a double-stranded DNA molecule.

[0058] Sequence "identity" has a meaning recognized in the art, and the percentage of sequence identity between two nucleic acid or polypeptide molecules or regions can be calculated using published techniques. Sequence identity can be measured along the entire length of a polynucleotide or polypeptide or along a region of the molecule. (See, for example: Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). Although there are many methods for measuring the identity between two polynucleotides or polypeptides, the term "identity" is well known to those of skill in the art (Carrillo, H. & Lipman, D., SIAM J Applied Math 48: 1073 (1988)). Many algorithms can be used to determine percent sequence identity. An example of an algorithm suitable for determining percent sequence identity is the algorithm used in the Basic Local Alignment Search Tool (hereinafter "BLAST"), see, for example, Altschul et al., J. Mol. Biol. 215: 403-410, 1990 and Altschul et al., Nucleic Acids Res., 15: 3389-3402, 1997. Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information (hereinafter "NCBI"). Default parameters used in determining sequence identity using software available from NCBI (such as BLASTN for nucleic acid sequences) are described in McGinnis et al. Nucleic Acids Res., 32: W20-W25, 2004.

[0059] Aptamers and aptamer conjugates targeting CTGF

[0060] In one aspect, the present invention provides an aptamer that specifically binds connective tissue growth factor (CTGF).

[0061] The connective tissue growth factor protein described herein is preferably a human connective tissue growth factor protein.

[0062] An exemplary human connective tissue growth factor protein comprises the following amino acid sequence (SEQ ID NO: 22):

[0063] In some embodiments, the aptamer comprises a nucleotide sequence that is at least about 90% identical, at least about 91% identical, at least about 92% identical, at least about 93% identical, at least about 94% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, or at least about 99% identical to any one of SEQ ID NOs: 1-10. In some embodiments, the aptamer specifically binds to a connective tissue growth factor protein.

[0064] In some embodiments, the aptamer comprises at least 32, at least 33, at least 34, at least 35, at least 36, or more contiguous nucleotides of any one of SEQ ID NOs: 1-10. In some embodiments, the aptamer specifically binds to a connective tissue growth factor protein.

[0065] In some embodiments, the aptamer comprises the nucleotide sequence of any one of SEQ ID NOs: 1 to 10. In some preferred embodiments, the aptamer comprises the nucleotide sequence of SEQ ID NO: 10.

[0066] In some embodiments, the aptamers of the present invention have a Kd (dissociation constant) for connective tissue growth factor protein of less than 110 nM, preferably less than 90 nM, preferably less than 70 nM, preferably less than 50 nM, preferably less than 30 nM, preferably less than 20 nM or less. The Kd is determined, for example, by enzyme-linked oligonucleotide assay (ELONA).

[0067] In some embodiments, the aptamer of the present invention may be a modified aptamer, and the modified aptamer may include one or more modifications, such as modifications that confer enhanced nuclease resistance to the aptamer and / or modifications that extend the in vivo half-life of the aptamer.

[0068] The modification includes, for example, 3' and / or 5' modification, such as 3' and 5' capping. In some embodiments, the nucleic acid molecule is capped at the 3' end with inverted deoxythymidine, ie, 3' inverted deoxythymidine (3'idT) modification.

[0069] The modification can also include replacing one or more naturally occurring nucleotides with modified nucleotides. For example, the modified nucleotides include but are not limited to nucleotides modified with 2'-fluoro, 2'-methoxyethyl, 2'-methoxy and / or 2'propyleneoxy (i.e., the hydroxyl group at the 2' position of the ribose is replaced by fluoro, methoxyethyl, methoxy or propyleneoxy). The modified nucleotides can also include C-5 modified pyrimidines. The term "C-5 modified pyrimidine" refers to a pyrimidine with a modification at the C-5 position. C-5 modified pyrimidines can enhance the nuclease resistance of oligonucleotides and are known in the art, for example, as described in International Patent Application WO 2011 / 130195 and the literature cited therein. In some preferred embodiments, the modification is a 2'-methoxy (2'-OMe) modification. In some embodiments, one or more, for example, four nucleotides at the 5' and / or 3' ends of the nucleic acid molecule are modified, for example, with a 2'-methoxy (2'-OMe) modification. In some embodiments, the modification is performed on all C and G residues in the nucleic acid molecule, such as 2'-methoxy (2'-OMe) modification.

[0070] The modifications also include internucleotide modifications, such as internucleotide modifications with uncharged bonds (such as methylphosphonate, phosphotriester, phosphoamine, carbamate, etc.) and internucleotide modifications with charged bonds (such as phosphorothioate, dithiophosphate, etc.), internucleotide modifications with intercalators (such as acridine, psoralen, etc.), internucleotide modifications containing chelators (such as metals, radioactive metals, boron, oxidative metals, etc.), internucleotide modifications containing alkylating agents and internucleotide modifications with modified bonds (such as alpha anomeric nucleic acids, etc.).

[0071] In some embodiments, the aptamer may comprise a combination of the above modifications. For example, the aptamer may comprise a 2'-methoxy (2'-OMe) modification and / or a 3' inverted deoxythymidine (3'idT) modification.

[0072] The aptamer of the present invention can be conjugated with fatty acids and / or coumarin derivatives. The conjugation of the aptamer molecule with fatty acids and / or coumarin derivatives can significantly prolong its half-life in vivo.

[0073] Therefore, in one aspect, the present invention also provides an aptamer-aptamer conjugate that specifically binds to connective tissue growth factor (CTGF), comprising the aptamer of the present invention and a conjugated fatty acid and / or coumarin derivative.

[0074] In some embodiments, the aptamer is conjugated to a fatty acid and / or a coumarin derivative via a linker arm.

[0075] In some embodiments, the tether is tether 1 comprising the following structure:

[0076] Wherein n can be an integer of 1-10, and m can be an integer of 1-10.

[0077] When linker arm No. 1 is selected, the reaction site with the aptamer is the active ester portion, the reaction site with the fatty acid is the primary amino group, n can be 1-10, and m can be 1-10.

[0078] In some embodiments, the tether is tether 2 comprising the following structure:

[0079] Wherein, x can be an integer of 1-10, and y can be an integer of 1-10.

[0080] When linker arm No. 2 is selected, the reaction site with the aptamer is an active ester, the reaction site with the fatty acid is a primary amino group, x can be 1-10, and y can be 1-10.

[0081] In some preferred embodiments, the linker is linker 1, wherein n=2 and m=2.

[0082] In some embodiments, the fatty acid includes but is not limited to palmitic acid (PA), dodecanedioic acid (DA), tetradecanedioic acid, hexadecanedioic acid, stearic acid (SA), octadecanedioic acid, lauric acid, eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), arachidonic acid (ARA), etc. In some preferred embodiments, the fatty acid is octadecanedioic acid.

[0083] In some embodiments, the coumarin derivative includes but is not limited to 4-hydroxycoumarin, 3-acetyl-6-carboxycoumarin, warfarin, (2-oxo-2H-chromen-3-yl)acetic acid, [(8-acetyl-4-methyl-2-oxo-2H-chromen-7-yl)oxy]acetic acid, coumarin-3-carboxylic acid, N-(4-methyl-7-coumarin) oxalamide, 7-(carboxymethyl)-4-methylcoumarin, 7-methoxycoumarin-3-carboxylic acid, 6-methoxy-2-oxo-2H-chromen-3-carboxylic acid. In some preferred embodiments, the coumarin derivative is 4-hydroxycoumarin.

[0084] In some embodiments, the fatty acid, such as octadecanedioic acid, is conjugated to the 5' end of the aptamer. In some embodiments, the coumarin derivative, such as 4-hydroxycoumarin, is conjugated to the 5' end of the aptamer. In some embodiments, the fatty acid, such as octadecanedioic acid, and the coumarin derivative, such as 4-hydroxycoumarin, are conjugated to the 5' end of the aptamer.

[0085] In some embodiments, the fatty acid, such as octadecanedioic acid, is conjugated to the aptamer via a linker. In some embodiments, the coumarin derivative, such as 4-hydroxycoumarin, is conjugated to the aptamer via a linker. In some embodiments, the fatty acid, such as octadecanedioic acid, and the coumarin derivative, such as 4-hydroxycoumarin, are conjugated to the aptamer via a linker.

[0086] In some preferred embodiments, the fatty acid is octadecanedioic acid.

[0087] In some preferred embodiments, the linker is linker 1, wherein n=2 and m=2.

[0088] In some embodiments, the aptamer conjugate comprises a structure represented by the following formula:

[0089] In the structural formula of the present invention, the following structure represents the nucleotide sequence (5'-3' direction) of the aptamer (modified or unmodified):

[0090] In some preferred embodiments of various aspects of the present invention, the nucleotide sequence (5'-3' direction) of the aptamer is C(OMe)G(OMe)TAC(OMe)G(OMe)G(OMe)TC(OMe)G(OMe)AC(OMe)G(OMe)C(OMe)TAG(OMe)C(OMe)AC(OMe)ATC(OMe)AAG(OMe)C(OMe)TC(OMe)AATC(OMe)TT-idT, wherein (OMe) represents the 2'-methoxy (2'-OMe) modification of the corresponding nucleotide, and idT represents the 3' inverted deoxythymidine modification.

[0091] In some embodiments, the aptamer conjugate comprises a structure represented by the following formula:

[0092] In some embodiments, the aptamers or aptamer conjugates of the present invention inhibit the biological activity of a connective tissue growth factor protein. "Inhibit" means that the biological activity of the connective tissue growth factor protein is reduced in the presence of the aptamer or aptamer conjugate compared to the absence of the aptamer or aptamer conjugate, for example, by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or even at least about 90%.

[0093] As used herein, the term "biological activity" refers to an effect on one or more cellular or extracellular processes that can affect physiological or pathophysiological processes. The biological activities of connective tissue growth factor proteins include, but are not limited to, promoting fibrosis.

[0094] In some embodiments, the aptamer or aptamer conjugate of the present invention can inhibit the inhibitory effect of connective tissue growth factor protein on muscle fibrosis. For example, the aptamer or aptamer conjugate of the present invention can inhibit the pro-fibrotic activity of CTGF protein in rat fibroblasts.

[0095] In some embodiments, the aptamers or aptamer conjugates of the present invention inhibit the biological activity of connective tissue growth factor protein with an IC50 value of less than 300 nM, preferably less than 100 nM, preferably less than 60 nM, preferably less than 30 nM, preferably less than 20 nM or less, for example, inhibiting the inhibitory effect of connective tissue growth factor protein on the expression of extracellular matrix proteins (fibronectin; collagen) and the inhibition of fibroblast migration. In some embodiments, the IC50 value is calculated in vitro based on the expression of extracellular matrix proteins and the degree of cell migration after treatment with different concentrations of aptamer conjugates. For details, please refer to the Examples of this application.

[0096] The cells used to detect biological activity herein can be rat fibroblasts, such as RAT 2 cells. The fibroblasts are fibroblasts that highly express connective tissue growth factor.

[0097] Disease treatment

[0098] In another aspect, the present invention provides a method for treating a disease by using the aptamer and / or aptamer conjugate of the present invention, which comprises administering a therapeutically effective amount of the aptamer and / or aptamer conjugate of the present invention to a subject in need thereof.

[0099] Diseases treated by the aptamers and / or aptamer conjugates of the present invention are, for example, connective tissue growth factor protein-related diseases, such as connective tissue growth factor protein-mediated diseases. In some embodiments, the disease is caused by high expression of connective tissue growth factor protein.

[0100] As used herein, "CTGF-related diseases" include muscle fibrosis, a pathological change in Duchenne muscular dystrophy; fibrosis in multiple tissues such as the liver, lungs, heart, and kidneys caused by overexpression of CTGF; tumor growth and spread; and rheumatoid arthritis.

[0101] As used herein, "CTGF protein-related disease" includes CTGF protein-related cancers, examples of which include but are not limited to breast cancer, lung cancer, pancreatic cancer, ovarian cancer, colorectal cancer, glioma, and liver cancer.

[0102] The subject can be any animal (domesticated, livestock or wild), including but not limited to cats, dogs, horses, pigs and cattle, and preferably a human subject. As used herein, the terms patient, individual and subject are used interchangeably.

[0103] The subject can be male or female. Preferably, the subject is male. The Duchenne muscular dystrophy (DMD) gene is located on the X chromosome, and women are typically carriers of the DMD gene. Most female carriers do not exhibit symptoms of DMD. DMD typically affects primarily males, with male patients exhibiting noticeable symptoms.

[0104] As used herein, "treating" a subject having a disease means that the subject's symptoms are partially or completely alleviated, or remain unchanged after treatment. Thus, treatment includes prevention, treatment, and / or cure. Prevention refers to preventing the underlying disease and / or preventing the worsening of symptoms or the development of the disease.

[0105] As used herein, a "therapeutically effective amount" or "therapeutically effective dose" refers to an amount of a substance, compound, material, or composition comprising a compound that is at least sufficient to produce a therapeutic effect after administration to a subject. Thus, it is the amount necessary to prevent, cure, ameliorate, arrest, or partially arrest the symptoms of a disease or condition. As used herein, "therapeutic effect" refers to an effect resulting from treatment of a subject that alters, typically ameliorates, or improves the symptoms of a disease or condition, or cures the disease or condition.

[0106] The dosage regimen for utilizing the aptamer and / or aptamer conjugate is selected based on a variety of factors, including, for example, the type, species, age, weight, sex, and medical condition of the patient; the severity of the condition being treated; the route of administration; the patient's renal and hepatic function; and the specific aptamer and / or aptamer conjugate or salt thereof being used. An ordinarily skilled physician can readily determine and prescribe the effective amount of the composition required to prevent, counteract, or inhibit the progression of the condition.

[0107] Typically, the dosage regimen of the aptamer and / or aptamer conjugate is from about 1 μg / kg body weight to about 100 mg / kg body weight per day.

[0108] Exemplary treatment regimens require administration once a day, once every two days, once a week, twice a week, once every two weeks, once every three weeks, once every four weeks, once a month, once every three months, once every three to six months, or a slightly shorter initial dosing interval (e.g., once a week to once every three weeks) followed by a longer dosing interval (e.g., once a month to once every three to six months). The frequency and interval of administration can be determined by those skilled in the art based on the pharmacokinetic parameters of the aptamer and / or aptamer conjugate.

[0109] Pharmaceutical composition

[0110] In another aspect, the present invention further provides a pharmaceutical composition comprising at least one aptamer and / or aptamer conjugate of the present invention and a pharmaceutically acceptable carrier or excipient, for example, for treating diseases associated with connective tissue growth factor protein.

[0111] The aptamers and / or aptamer conjugates described herein can be used in any pharmaceutically acceptable dosage form, including but not limited to injectable dosage forms, liquid dispersions, gels, sprays, ointments, creams, lyophilized formulations, dry powders, tablets, capsules, controlled release formulations, fast melt formulations, delayed release formulations, extended release formulations, pulsatile release formulations, mixed immediate release and controlled release formulations, etc. Specifically, the aptamers described herein can be formulated to: (a) be administered by any one selected from oral, pulmonary, intravenous, intraarterial, intrathecal, intraarticular, rectal, ophthalmic, colonic, parenteral, intracisternal, intravaginal, intraperitoneal, topical, buccal, nasal, and local administration; (b) be in a dosage form selected from any one selected from liquid dispersions, gels, sprays, ointments, creams, tablets, sachets, and capsules; (c) be in a dosage form selected from any one selected from lyophilized formulations, dry powders, fast melt formulations, controlled release formulations, delayed release formulations, extended release formulations, pulsatile release formulations, and mixed immediate release and controlled release formulations; or (d) any combination thereof.

[0112] Solutions or suspensions for parenteral, intradermal, or subcutaneous administration may contain one or more of the following components: (1) a sterile diluent, such as water for injection, saline, fixed oils, polyethylene glycols, glycerol, propylene glycol, or other synthetic solvents; (2) an antibacterial agent, such as benzyl alcohol or methyl paraben; (3) an antioxidant, such as ascorbic acid or sodium sulfite; (4) a chelating agent, such as ethylenediaminetetraacetic acid; (5) a buffer, such as acetate, citrate, or phosphate; and (6) a substance for adjusting tonicity, such as sodium chloride or glucose. The pH may be adjusted with an acid or base, such as hydrochloric acid or sodium hydroxide. Parenteral preparations may be packaged in ampoules, disposable syringes, or multiple-dose vials made of glass or plastic.

[0113] The pharmaceutical composition that is suitable for injection use can comprise aseptic aqueous solution (wherein being water-soluble) or dispersion and the sterile powder for the temporary preparation of sterile injection solution or dispersion.For intravenous use, suitable carrier comprises physiological saline, antibacterial water or phosphate buffered saline (PBS).In all cases, described composition should be aseptic and its mobility should be easy to inject.Under the condition of manufacture and storage, described pharmaceutical composition should be stable and should be protected to prevent the contamination effect of microorganisms such as antibacterial and fungal.Term " stable " as used herein means to remain on the state or condition that is suitable for using to the patient.

[0114] In some embodiments, the carrier can be a solvent or dispersion medium, including water, ethanol, polyol (such as, glycerol, propylene glycol, liquid polyethylene glycol etc.) and a suitable mixture thereof. For example, by using a coating such as lecithin, by maintaining required particle size and by using a surfactant, suitable fluidity can be maintained. By various antibacterial and antifungal reagents, for example, p-hydroxybenzoate, chlorobutanol, phenol, ascorbic acid, thimerosal etc. can be realized to prevent the effect of microorganisms. In many cases, it is preferred to include isotonic agents in the composition, such as sugar, polyol (such as mannitol or sorbitol) and inorganic salts (such as sodium chloride). By including in the composition the material that delays absorption such as aluminum monostearate and gelatin, the absorption of the prolongation of the injectable composition can be brought.

[0115] Sterile injectable solutions can be prepared by incorporating the active agent (e.g., aptamer and / or aptamer conjugate) in the desired amount with one or a combination of the ingredients listed above (as needed) in an appropriate solvent followed by filtration sterilization. Typically, dispersions are prepared by incorporating at least one aptamer conjugate into a sterile vehicle containing a basic dispersion medium and any other desired ingredients. In the case of sterile powders for preparing sterile injectable solutions, exemplary methods of preparation include vacuum drying and freeze drying, both of which yield a powder of the aptamer and / or aptamer conjugate and any additional desired ingredients from a previously sterile filtered solution thereof.

[0116] Oral compositions typically include an inert diluent or edible carrier. For example, they can be encapsulated in gelatin capsules or compressed into tablets. For oral therapeutic administration, the aptamers for connective tissue growth factor proteins can be incorporated into excipients and used in the form of tablets, lozenges, or capsules. Pharmaceutically compatible binding agents and / or adjuvant materials can be included as part of the composition.

[0117] For administration by inhalation, the compound is delivered in the form of an aerosol spray from a pressurized container or dispenser containing a suitable propellant (e.g., a gas (e.g., carbon dioxide), an atomized liquid, or a dry powder from a suitable device). For transmucosal or transdermal administration, a penetrant that is appropriate to the barrier to be penetrated is used in the formulation. Such penetrants are generally known in the art and include, for example, detergents, bile salts, and fusidic acid derivatives for transmucosal administration. Transmucosal administration can be achieved by using nasal sprays or suppositories. For transdermal administration, the active agent is formulated into an ointment, salves, gel, or cream as is known in the art. The agent can also be prepared in the form of a suppository (e.g., with a conventional suppository base, such as cocoa butter and other glycerides) or a retention enema for rectal delivery.

[0118] In one embodiment, the aptamer and / or aptamer conjugate is formulated for topical administration. As used herein, "topical administration" refers to delivering the aptamer and / or aptamer conjugate to the animal by contacting (directly or otherwise) a formulation comprising the aptamer and / or aptamer conjugate with all or part of the skin (epidermis) of the animal. The term encompasses several routes of administration, including but not limited to topical administration and transdermal administration. A common requirement for these modes of administration is effective delivery to the target tissue or layer. On the one hand, topical administration is used as a means of penetrating the epidermis and dermis and ultimately achieving systemic delivery of the aptamer and / or aptamer conjugate. On the other hand, topical administration is used as a means of selectively delivering the aptamer and / or aptamer conjugate to the epidermis or dermis or a specific layer thereof of the animal.

[0119] For topical administration, the aptamers and / or aptamer conjugates can be formulated into pharmaceutically acceptable ointments, creams, lotions, eye ointments, eye drops, ear drops, impregnated dressings, and aerosols, medicated powders, medicated adhesives, foams, and can contain appropriate conventional additives or excipients, including, for example, preservatives or solvents to aid drug penetration and emollients in ointments, gels, and creams. Such topical formulations can also contain compatible conventional carriers, such as ethanol or oleyl alcohol for emulsions. Such carriers may constitute from about 1% to about 98% by weight of the formulation, more typically, such carriers will constitute up to about 80% by weight of the formulation. Specific formulations for topical delivery of aptamers are described in the prior art.

[0120] In one embodiment, the aptamers and / or aptamer conjugates are prepared with a carrier that prevents rapid removal from the body. For example, controlled release formulations, including implantable and microencapsulated delivery systems, can be used. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art.

[0121] Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art.

[0122] In addition, the suspension of the aptamer and / or aptamer conjugate can be prepared as a suitable oily injection suspension. Suitable lipophilic solvents or carriers include fatty oils (such as sesame oil) or synthetic fatty acid esters (such as ethyl oleate, triglycerides) or liposomes. Non-fat polycationic amino acid polymers can also be used for delivery. Optionally, the suspension can also include a suitable stabilizer or reagent to increase the solubility of the compound and allow for the preparation of highly concentrated solutions.

[0123] In some cases, it may be particularly advantageous to formulate oral or parenteral compositions in dosage units for ease of administration and uniformity of dosage. As used herein, dosage unit form refers to physically discrete units suitable as single dosages for the subject to be treated; each unit contains a predetermined quantity of aptamer and / or aptamer conjugate calculated to produce the desired therapeutic effect and the required pharmaceutical carrier. The specification of dosage unit forms for the aptamers and / or aptamer conjugates described herein is dictated by and directly dependent upon the unique characteristics of the particular aptamer and / or aptamer conjugate and the specific therapeutic effect to be achieved, as well as the inherent limitations of the art of formulating such active agents for use in treating individuals.

[0124] Pharmaceutical compositions comprising at least one aptamer and / or aptamer conjugate may include one or more pharmaceutical excipients. Examples of such excipients include, but are not limited to, binders, fillers, lubricants, suspending agents, sweeteners, flavorings, preservatives, buffers, wetting agents, disintegrants, effervescent agents, and other excipients. Such excipients are known in the art. Exemplary excipients include: (1) binders, including various celluloses and cross-linked polyvinyl pyrrolidone, microcrystalline cellulose (such as Avicel PH101 and Avicel PH102), silicified microcrystalline cellulose (ProSolv SMCC TM), tragacanth and gelatin; (2) fillers, such as various starches, lactose, lactose monohydrate, anhydrous lactose; (3) disintegrants, such as alginic acid, Primogel, corn starch, lightly cross-linked polyvinyl pyrrolidine, potato starch, corn starch and modified starches, cross-linked sodium carboxymethylcellulose, crospovidone, sodium starch glycolate and mixtures thereof; (4) lubricants, including agents that affect the flowability of the powder to be compressed, including magnesium stearate, colloidal silicon dioxide (such as Aerosil 200, talc), stearic acid, calcium stearate and silica gel; (5) glidants, such as colloidal silicon dioxide; (6) preservatives, such as potassium sorbate, methylparaben, propylparaben, benzoic acid and its salts, other esters of parahydroxybenzoic acid (such as butylparaben), alcohols (such as ethanol or benzyl alcohol), phenolic compounds (such as phenol) or quaternary ammonium compounds (such as benzalkonium chloride); (7) diluents, such as pharmaceutically acceptable inert fillers, such as microcrystalline cellulose, lactose, calcium hydrogen phosphate, sugars and / or any mixture thereof; Examples of diluents include microcrystalline cellulose, such as Avicel- PH101 and Avicel-PH102; lactose such as lactose monohydrate, anhydrous lactose and Pharmatose-DCL21; calcium hydrogen phosphate such as Emcompress mannitol, starch, sorbitol, sucrose and glucose; (8) sweeteners, including any natural or artificial sweeteners such as sucrose, saccharin sucrose, xylitol, saccharin sodium, sodium cyclamate, aspartame and acesulfame potassium; (9) flavorings such as mint, methyl salicylate, orange flavoring, Magnasweet TM (Trademark MAFCO), bubble gum flavor, fruit flavor, etc.; and (10) effervescent agents, including effervescent agent pairs, such as organic acids and carbonates or bicarbonates. Example

[0125] The present invention will be further described below by way of examples, but the present invention is not limited to the scope of the described examples.

[0126] Example 1. Screening of aptamers specifically targeting connective tissue growth factor protein

[0127] Experimental design:

[0128] The applicant used the exponential enrichment aptamer system evolution experiment (SELEX) method to screen aptamers for the connective growth factor (CTGF) protein. In order to select aptamers that can specifically recognize and bind to CTGF, recombinant human CTGF was immobilized on Magnabind™ carboxyl-derivatized beads as a positive selection target. Blank Magnabind™ carboxyl-derivatized beads and other proteins will serve as negative selection targets. After 20 rounds of selection, the single-stranded DNA pool from each round, including the initial random library, will be used for next-generation sequencing to detect enrichment relative to CTGF.

[0129] Experimental methods:

[0130] Magnabind TM The carboxyl derivative magnetic bead SELEX method will be used to select aptamers for CTGF. CTGF is first incubated with magnetic beads to form protein-bound magnetic beads. This complex is then incubated with a double-stranded DNA random library at room temperature to form a double-stranded DNA-protein-bound magnetic bead complex. After washing, the double-stranded DNA-protein-bound magnetic bead complex will be used as a template for PCR using a forward primer and a biotinylated reverse primer. The double-stranded DNA is then regenerated using magnetic beads covered with streptavidin. The double-stranded DNA pool will be used for the next round of SELEX. Starting from the fourth round, the evolved ssDNA pool will be incubated with beads or non-target proteins for negative selection. The double-stranded DNA that falls off from the negative selection will be collected and then applied to the CTGF-bound Magnabind TM Carboxyl derivative magnetic beads. The double-stranded DNA pool from each round, including the initial random library, will be sent for next-generation sequencing.

[0131] Results and Discussion

[0132] After each round of selection, the collected single-stranded DNA pool was amplified by PCR and checked by agarose gel electrophoresis before single-stranded DNA regeneration (Figure 1). A total of 20 rounds of SELEX screening were performed.

[0133] Example 2: Determination of CTGF-enriched aptamers by SELEX by next-generation sequencing

[0134] Experimental design:

[0135] In order to determine the sequence of the aptamers in the enrichment pool, the second generation sequencing (NGS) of the aptamer clones was performed. After 20 rounds of SELEX procedures, the DNA sequence of the entire enrichment pool was analyzed by second generation sequencing. Next-generation sequencing (NGS) libraries are prepared on the platform, using products from six rounds of selection as input fragments. Different adapters are ligated to the selected products through PCR reactions. The adapter-ligated products are cleaned up using VAHTS DNA Clean Beads. After amplification of the obtained library samples, the quality and concentration of the library samples are tested using the 2100 expert-High Sensitivity DNA Assay and Qubit fluorescence quantitative quantification. Sequencing results of the amplified library samples are compared using a multiple sequence alignment tool. Sequences are ultimately ranked by copy number from highest to lowest.

[0136] Experimental methods:

[0137] The platform was used for next-generation sequencing (NGS) library preparation, with products from six rounds of SELEX screening serving as sequencing samples. Different adapters were ligated to the SELEX screening products via adapter-mediated PCR. The adapter-ligated products were purified using VAHTS DNA Clean Beads. The resulting library samples were amplified and assayed for quality and concentration using the 2100 Expert-High Sensitivity DNA Assay and Qubit fluorescence quantitative quantification, respectively.

[0138] Results and Discussion

[0139] The aptamer screening products from rounds 2, 6, 9, 12, 16, and 20 were selected as input library templates. After 12 rounds of PCR amplification, the obtained products were amplified by Fast Purification was performed using the Gel DNA Extraction Mini Kit. To facilitate multiplexing, each sample was prepared using a different barcoded adapter. 100 ng of the purified product was used for library preparation: (i) end preparation, (ii) adapter ligation, (iii) library amplification, and (iv) library quality control. Based on the results of the 2100 Expert-High Sensitivity DNA Assay (Figure 2), the peak was primarily enriched at 195-198 bp and had a high concentration. These results indicate that the obtained library sample is of high quality and suitable for next-generation sequencing.

[0140] Example 3: Next-generation sequencing for determining enriched aptamer sequences

[0141] Experimental design:

[0142] The sample of Example 2 library is subjected to second generation sequencing to generate raw sequencing data. Base calling is performed using a corresponding software package (such as Bustard) to convert the raw sequencing data into analyzable sequence information. The primers and tags associated with each selection round are then compared with the sequencing data to assign the sequence information to a specific selection round. In order to minimize analytical artifacts, only sequences with no mismatches during comparison and with random fragments of a specific length range are retained. Finally, the filtered sequences are subjected to further data analysis, including enrichment effect evaluation, enrichment species distribution, etc.

[0143] Experimental methods:

[0144] After the sequencing process, base calling was performed using the Bustard software package, resulting in nearly 13 million reads. Subsequently, the primers and tags associated with each round of selection were aligned to the individual reads using Razer S. To minimize artifacts, only reads that aligned without mismatches and contained random fragments between 38 and 42 base pairs in length were retained. Approximately 5.5 million clones (43%) met these criteria and were assigned to specific rounds based on their tags. Finally, the top 100 enriched aptamer sequences targeting the CTGF protein were obtained.

[0145] Results and Discussion

[0146] Based on the results of next-generation sequencing, cluster analysis was performed on the aptamer library targeting CTGF. After the fifth round of selection, the enrichment effect increased significantly. It was also observed that after the fifth round, the molecular diversity tended to converge significantly, indicating that some specific aptamer sequences were successfully enriched during the selection process (Figure 3). In addition, the total reads and valid reads were defined. The 100 most frequent unique sequences and their percentage in all available reads were determined. The molecular enrichment of each round was calculated by the following formula: total reads of the first 100 unique sequences in round X / number of rounds without selection.

[0147] Example 4: Screening candidate aptamers for full-length aptamers that specifically bind to CTGF

[0148] Experimental design:

[0149] To determine the specificity of aptamer candidates for CTGF, 20 representative aptamer candidates and a random sequence (RS) (negative control) were synthesized, all with N-terminal biotin modification. Each aptamer / RS was used at a concentration of 1 μM to determine its specificity for CTGF using enzyme-linked oligonucleotide analysis (ELONA). When the aptamer binds to CTGF, the absorbance at 450 nm of the specific aptamer will be significantly higher than that of the blank control. Aptamer candidates with high specificity for CTGF were selected for binding affinity determination.

[0150] Experimental methods:

[0151] The enzyme-linked oligonucleotide assay (ELONA) was used to test the specific binding ability of candidate aptamer sequences to the CTGF protein. 160 ng of CTGF protein and a negative control protein were added to each well of a 96-well microplate and incubated overnight at 4°C via hydrophobic interaction. Non-binding sites in the wells were blocked with BSA for 1 hour at room temperature, followed by four washes with DNA binding buffer for 5 minutes. An appropriate concentration of biotinylated aptamer was added to each well, mixed, and incubated for 45 minutes at room temperature with continuous gentle agitation. After binding, the plate was washed four times with wash buffer for 5 minutes to remove nonspecific and weak binding. 100 μl of streptavidin-horseradish peroxidase (HRP) (1:10,000 dilution in PBST + 0.1% BSA) was added to each well and incubated for 30 minutes, followed by four washes with binding buffer. 50 μl of HRP substrate 3,3',5,5'-tetramethylbenzidine (TMB) was added to each well and incubated for 20 minutes. The reaction was stopped by adding 50 μl of 2M H2SO4. The absorbance at 450 nm was measured using a microplate reader (Molecular Device i3x).

[0152] The results showed that the aptamer candidates C28, C27, C72, C3, C57, C62, C49, C31, and C38 exhibited good specificity for the FL-CTGF protein. Therefore, these aptamer candidates were selected for further affinity testing.

[0153] Example 5: Using the ELONA method to detect the affinity of candidate aptamer sequences to CTGF

[0154] Experimental plan:

[0155] To evaluate the affinity of candidate aptamers for CTGF, nine specific aptamer candidates and one random sequence will be used at concentrations of 0, 1 nM, 5 nM, 10 nM, 50 nM, 100 nM, and 500 nM, respectively. Their binding affinities to CTGF will be measured by ELONA. Binding curves will be plotted for each aptamer, and Kd values ​​will be calculated.

[0156] Experimental methods:

[0157] Enzyme-linked oligonucleotide detection (ELONA) was used to test the specific binding ability of candidate aptamer sequences to CTGF protein. 160 ng of CTGF protein and a negative control protein were added to each well of a 96-well microplate and incubated overnight at 4°C via hydrophobic interaction. Non-binding sites in the wells were blocked with BSA at room temperature for 1 hour, followed by four washes with DNA binding buffer for 5 minutes. Different concentrations of biotinylated candidate aptamer sequences (0, 1 nM, 5 nM, 10 nM, 50 nM, 100 nM, and 500 nM) were added to each well, mixed, and incubated at room temperature for 45 minutes with continuous gentle shaking. After binding, the plate was washed four times with wash buffer for 5 minutes to remove nonspecific and weak binding. 100 μl of streptavidin-horseradish peroxidase (HRP) (1:10,000 dilution in PBST + 0.1% BSA) was added to each well and incubated for 30 minutes, followed by four washes with binding buffer. 50 μl of the HRP substrate 3,3',5,5'-tetramethylbenzidine (TMB) was added to each well and incubated for 20 minutes. The reaction was stopped by adding 50 μl of 2M H2SO4. The absorbance at 450 nm was measured using a microplate reader (Molecular Device i3x). Data were analyzed using Origin software. Binding curves were drawn using the nonlinear curve fitting model Hyperbl and KD values ​​were calculated.

[0158] Results and Discussion

[0159] Aptamer candidates C28, C27, C72, C3, C57, C62, C49, C31 and C38 showed good affinity for binding to CTGF protein, and their Kd values ​​are shown in Table 1. These sequences were used to detect the inhibition of the profibrotic activity of CTGF protein.

[0160] Table 1. Kd values ​​of aptamer candidates binding to CTGF protein

[0161] Example 6: Determination of the fibrosis-inhibiting activity of candidate aptamers with high affinity for CTGF protein in rat fibroblasts

[0162] Western blot analysis was performed to analyze the expression levels of fibronectin and collagen III in rat fibroblasts treated with candidate aptamers. Briefly, chondrocytes were cultured at a density of 2 × 10^5 cells / well in DMEM supplemented with 10% FBS. After seeding, cells were starved for 12 hours in DMEM supplemented with 2% FBS. Following starvation, the medium was replaced with DMEM supplemented with human full-length CTGF protein (100 mg / ml) and candidate aptamers (100 nM). Subsequently, both the culture medium and cell lysates were collected for analysis. Cells were lysed on ice using RIPA lysis buffer (P0013B, Beyotime, Shanghai, China) containing 2% PMSF (P7626, Sigma) as a protease inhibitor for protein preparation. Protein concentrations were determined using BCA assay (P0010, Beyotime, Shanghai, China). Protein samples were separated by 10% SDS-PAGE and transferred to PVDF membranes. The membrane was blocked with 5% skim milk for 1 hour and then incubated with antibodies against GAPDH (Santa cruz, sc-32233), Fibronectin (Santa cruz, sc-8422), Collagen III (Thermo Fisher, PA1-28870) and at 4°C overnight. After washing with TBST, the membrane was incubated with the corresponding anti-mouse or anti-rabbit secondary antibodies at room temperature for 2 hours (1:5000 dilution). Western (P90719, Millipore) visualization.

[0163] The results are shown in Figure 4. Candidate aptamers C28, C27, C72, C57, C62, C31, C49, and C38 reduced Fibronectin protein levels. Meanwhile, C3, C27, C28, and C72 also reduced Collagen III protein levels. Overall, C27, C28, and C72 significantly reduced both Fibronectin and Collagen III protein levels.

[0164] IC 50(Half maximal inhibitory concentration) is a measure used in pharmacology and biochemistry to express the concentration required for a substance (such as a drug or inhibitor) to inhibit a biological process or response, that is, the concentration at which the substance can exert half of its maximum inhibitory effect. The effects of the three aptamer candidates, C27, C28 and C72, in inhibiting the profibrotic activity of CTGF were further evaluated. Rat RAT 2 cells were treated with the same concentration of CTGF protein and gradient concentrations of the three aptamer candidates, at concentrations of 200, 100, 50, 25, 12.5 and 6.25 nmol / L, respectively. After 48 hours of incubation, cell lysates and culture medium from each group were collected for Western Blot analysis as described above. Protein expression levels were analyzed by Image J software (NIH, Bethesda, MD) and normalized to GAPDH. The IC values ​​of the candidate aptamers were then calculated based on the Western Blot results. 50 The results are shown in Figures 5-7. C28, C27 and C72 inhibit the IC value of Fibronectin. 50 The values ​​were 52.47 nM, 18.97 nM and 261.8 nM, respectively.

[0165] In addition, the inhibition of cell migration by C27, C28 and C72 was also evaluated. The experimental method is as follows: After Rat 2 cells were cultured in a 6-well plate until the bottom of the well was completely covered, a fine scratch was made in the center of the cell layer using a 200μL sterile pipette tip. After washing with PBS to remove cell debris, the adherent cells were cultured in basal culture medium for 48 hours. Cell migration and proliferation were captured by phase contrast microscopy at 0, 24 and 48 hours after the scratch. The migration rate was calculated by Image J software using the method of migrating cell area / scratch area. The results are shown in Figures 8-10. The IC values ​​of C28, C27 and C72 for inhibiting cell migration are as follows: 50 The values ​​were 25.72nM, 12.32nM and 138.7nM respectively. The above data show that C28 has a better inhibitory effect on fibroblast migration than C27 and C72, which also indicates that C28 has a better inhibitory effect on fibrosis.

[0166] Example 7: C28 aptamer candidate sequence was truncated to improve its specific binding ability

[0167] 7.1. Truncation of C28 to obtain C28-1-40 with improved affinity

[0168] The inventors also truncated C28 to enhance its specific binding ability. Briefly, each 6-nucleotide sequence was considered a truncated unit of C28, resulting in a total of 11 truncated sequences. The truncated aptamer sequences were synthesized by INTEGRATED DNA TECHNOLOGIES and diluted in ddH2O. Subsequently, ELONA technology was used to test the specific binding of these truncated sequences to the CTGF protein. For specific experimental methods, refer to Example 5.

[0169] The specificity of these sequences for CTGF protein was determined by ELONA experiments, and the aptamer C28-1-40 (CGTACGGTCGACGCTAGCACATCAAGCTCAATCTT, SEQ ID NO: 10) sequence was finally determined to be a truncated aptamer sequence with better affinity, with a Kd value of 20.4 nM.

[0170] 7.3. Fibrosis Inhibitory Activity of C28-1-40

[0171] Referring to the method of Example 6, the IC of C28-1-40 for inhibiting Fibronectin was determined. 50 The value was 16.83 nM (see Figure 11).

[0172] C28-1-40 was also tested for its inhibitory activity against fibronectin in cells. The experimental method was as follows: Fibronectin expression levels in rat fibroblasts treated with candidate aptamers were analyzed by Western blot. Briefly, chondrocytes were cultured at a density of 2 × 10^5 cells / well in DMEM medium supplemented with 10% FBS. After seeding, cells were starved for 12 hours in DMEM medium supplemented with 2% FBS. Following starvation, the medium was replaced with DMEM supplemented with human full-length CTGF protein (100 mg / ml) and candidate aptamers (100 nM). Subsequently, both the culture medium and cell lysates were collected for analysis. Cells were lysed on ice using RIPA lysis buffer (P0013B, Beyotime, Shanghai, China) containing 2% PMSF (P7626, Sigma) as a protease inhibitor. Protein concentrations were determined by BCA assay (P0010, Beyotime, Shanghai, China). Protein samples were separated by 10% SDS-PAGE and transferred to PVDF membranes. The membranes were blocked with 5% skim milk for 1 hour and then incubated with antibodies against GAPDH (Santa cruz, sc-32233) and Fibronectin (Santa cruz, sc-8422) at 4°C overnight. After washing with TBST, they were incubated with corresponding anti-mouse or anti-rabbit secondary antibodies for 2 hours at room temperature (1:5000 dilution). Western blotting (P90719, Millipore) was performed for visualization. As shown in FIG12 , C28-1-40 significantly inhibited Fibronectin in cells in a dose-dependent manner.

[0173] 7.4. Chemical modification of C28-1-40 to increase its stability

[0174] Methoxy modification is commonly used in the chemical modification of nucleic acid aptamers to increase their stability and biocompatibility. Methoxy modification involves modifying the C and G residues in the aptamer sequence. Similar to truncation, the modification proceeds from both ends of the sequence toward the center. Every five nucleotides are treated as a unit, and the C and G residues in every five nucleotides are modified. Once the modified aptamer sequence is obtained, the stability of the modified aptamer sequence is tested in 10% and 100% fetal bovine serum, respectively.

[0175] The experimental method is as follows: To evaluate the stability of the obtained product, the aptamer was incubated with 10 μl fetal bovine serum (FBS) at 37 ° C. As a control, the same amount of aptamer was also added to 10 μl PBS. After incubation for 0 hours, 2 hours, 4 hours, 8 hours, 12 hours, 24 hours, 36 hours, 48 ​​hours and 72 hours, the samples were collected and incubated at 95 ° C for 10 minutes to inhibit nuclease activity. Finally, the samples were electrophoresed in 3% agarose gel (Sigma-Aldrich) using 1× TAE buffer and visualized using GelRed (Sigma-Aldrich). The lanes were quantified and analyzed by Image Lab software.

[0176] The results are shown in Figure 13. C28-1-40 (C(OMe)G(OMe)TAC(OMe)G(OMe)G(OMe)TC(OMe)G(OMe)AC(OMe)G(OMe)C(OMe)TAG(OMe)C(OMe)AC(OMe)ATC(OMe)AAG(OMe)C(OMe)TC(OMe)AATC(OMe)TT) in which all C and G were methoxy-modified had the best serum stability.

[0177] The nucleotide sequences of some candidate aptamers of the present invention, their Kd values ​​for binding to CTGF protein, and their biological activities are shown in the table below:

[0178] References:

[0179] Maier,KE&Levy,M.From selection hits to clinical leads:progress in aptamer discovery(2016).Mol Ther Methods Clin Dev 5,16014;

[0180] Ni, S., Zhuo, Z., Pan, Y., Yu, Y., Li, F., Liu, J., Wang, L., Wu, X., Li, D., Wan, Y. et al.

Claims

1. An aptamer that specifically binds to a connective tissue growth factor protein, wherein the aptamer that specifically binds to a connective tissue growth factor protein comprises: i) a nucleotide sequence that is at least about 90% identical, at least about 91% identical, at least about 92% identical, at least about 93% identical, at least about 94% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, or at least about 99% identical to any one of SEQ ID NOs: 1-10; or ii) at least 12, at least 18, at least 24, at least 30, at least 36 or more consecutive nucleotides of any one of SEQ ID NOs: 1-10; or iii) the nucleotide sequence of any one of SEQ ID NOs: 1-10, preferably, the nucleotide sequence of SEQ ID NO:

10.

2. The aptamer of claim 1, wherein the aptamer has a Kd (dissociation constant) for connective tissue growth factor of less than 200 nM, less than 175 nM, less than 150 nM, less than 110 nM, preferably less than 100 nM, preferably less than 70 nM, preferably less than 50 nM, preferably less than 30 nM, preferably less than 20 nM or less.

3. The aptamer of claim 1 or 2, wherein the aptamer is a modified aptamer, for example, the modified aptamer comprises one or more modifications that confer enhanced nuclease resistance to the aptamer and / or modifications that extend the in vivo half-life of the aptamer. The aptamer of claim 3 , wherein the modification comprises a 3′ inverted deoxythymidine (3′idT) modification.

5. The aptamer of claim 3, wherein the modification comprises replacing one or more naturally occurring nucleotides with modified nucleotides, for example, the modified nucleotides are selected from 2'-fluoro, 2'-methoxyethyl, 2'-methoxy and / or 2'propyleneoxy modified nucleotides, preferably 2'-methoxy modified nucleotides. The aptamer of claim 3 , wherein the modification comprises an internucleotide modification, such as an internucleotide phosphorothioate linkage modification. The aptamer of claim 3 , wherein the aptamer comprises a 2′-methoxy (2′-OMe) modification and / or a 3′ inverted deoxythymidine (3′idT) modification.

8. The aptamer of claim 1, wherein the aptamer nucleotide sequence (5'-3' direction) is C(OMe)G(OMe)TAC(OMe)G(OMe)G(OMe)TC(OMe)G(OMe)AC(OMe)G(OMe)C(OMe)TAG(OMe)C(OMe)AC(OMe)ATC(OMe)AAG(OMe)C(OMe)TC(OMe)AATC(OMe)TT-idT, where (OMe) represents the 2'-methoxy (2'-OMe) modification of the corresponding nucleotide and idT represents the 3' inverted deoxythymidine modification.

9. An aptamer conjugate that specifically binds to a connective tissue growth factor protein, comprising the aptamer according to any one of claims 1 to 8 and a fatty acid conjugated thereto.

10. The aptamer conjugate of claim 9, wherein the fatty acid is selected from palmitic acid (PA), dodecanedioic acid (DA), tetradecanedioic acid, hexadecanedioic acid, stearic acid (SA), octadecanedioic acid, lauric acid, eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), and arachidonic acid (ARA), preferably, the fatty acid is octadecanedioic acid. The aptamer conjugate of claim 9 , wherein the aptamer is conjugated to the fatty acid via a linker arm.

12. The aptamer conjugate of claim 11, wherein the linker is i) Connector arm 1 comprising the following structure, n is an integer from 1 to 10, and m is an integer from 1 to 10; or ii) a connecting arm 2 comprising the following structure, x is an integer of 1-10, and y is an integer of 1-10. The aptamer conjugate of claim 12 , wherein the tether is tether 1, wherein n=2, m=2.

14. The aptamer conjugate of claim 9, comprising the structure shown below:

15. A method for treating a connective tissue growth factor protein-related disease, comprising administering a therapeutically effective amount of the aptamer according to any one of claims 1 to 8 or the aptamer conjugate according to any one of claims 9 to 14 to a subject in need thereof, preferably, the subject is a human.

16. The method of claim 15, wherein the connective tissue growth factor protein-related disease is selected from the group consisting of Duchenne muscular dystrophy, liver fibrosis, lung fibrosis, cardiac fibrosis, kidney fibrosis, skin fibrosis, and rheumatoid arthritis. 17 . A pharmaceutical composition comprising the aptamer according to claim 1 or the aptamer conjugate according to claim 9 , and a pharmaceutically acceptable carrier or excipient.

18. Use of the aptamer according to any one of claims 1 to 8, the aptamer conjugate according to any one of claims 9 to 14, or the pharmaceutical composition according to claim 17 in the preparation of a medicament, wherein the medicament is used to treat connective tissue growth factor protein-related diseases.

19. The method according to claim 18, wherein the connective tissue growth factor protein-related disease is selected from Duchenne muscular dystrophy, liver fibrosis, pulmonary fibrosis, cardiac fibrosis, kidney fibrosis, skin fibrosis, and rheumatoid arthritis.

Images