Lentiviral vector for gene therapy of neurofibromatosis type 2, and use thereof
Through improved lentiviral vector delivery of NF2 genes, using optimized sequence and promoter design, efficient gene therapy in type 2 neurofibroma is achieved, inhibiting tumor growth and spreading and reducing surgical risks.
Patent Information
- Application Number
- PCT/CN2024/123806
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-29
- Filing Date
- 2024-10-10
- Publication Date
- 2025-09-04
AI Technical Summary
The prior art is difficult to effectively treat type 2 neurofibroma, and surgical resection is high and prone to disability and death, and there is a lack of efficient gene therapy methods.
An improved lentiviral vector was designed using an optimized NF2 coding sequence, Schwann cell-specific promoter CEP0 and enhancer CMV, combined with autoinactivation elements SIN and WPRE, for delivery of NF2 genes to inhibit tumor growth.
Highly efficient expression of NF2/Merlin protein in targeted cells significantly inhibits tumor cell proliferation and spread, reduces tumor volume, reduces the risk of carcinogenicity, and improves expression stability and safety.
Smart Images

Figure CN2024123806_04092025_PF_FP_ABST
Abstract
Description
A lentiviral vector for gene therapy of neurofibromatosis type II and its application Technical Field
[0001] The present invention relates to the field of biomedical technology, and in particular to a lentiviral vector for gene therapy of neurofibromatosis type II and applications thereof. Background Art
[0002] Neurofibromatosis type II is an autosomal dominant inherited disease caused by mutations or partial exon deletions in the NF2 tumor suppressor gene located on autosome 22. The disease is a systemic multiple lesion and a major hereditary tumor susceptibility syndrome. The clinical manifestations of almost all NF2 patients include bilateral vestibular schwannomas. Other common nervous system tumors include intracranial meningiomas, schwannomas of other cranial nerves, and spinal tumors, especially schwannomas of the dorsal nerve roots, meningiomas, and ependymomas. Neuropathy, ocular manifestations, and skin manifestations are also common. Surgical resection of nervous system tumors is risky and can easily lead to deafness, blindness, facial paralysis, and high disability and mortality rates. New treatments are needed.
[0003] The protein product of the NF2 gene is Merlin, which inhibits tumorigenesis. Research data co-authored by the inventors elucidates the mechanisms by which Merlin affects cell proliferation and contact inhibition. These data demonstrate that the tumor suppressor protein Merlin inhibits the E3 ligase CRL4DCAF1 in the cell nucleus, which in turn induces the expression of key genes that initiate the oncogenic process. Therefore, upstream Merlin acts as a "switch protein," crucial for activating downstream oncogenic pathways. Merlin is encoded by the NF2 gene, and therefore plays a key role in NF2's tumor suppression. Knockout of Merlin in normal Schwann cells induces cell proliferation.
[0004] Gene therapy includes two approaches, in vivo and in vitro, and the delivery tools used are mainly divided into non-viral vectors, such as plasmids / naked DNA, viral vectors, bacterial vectors, etc. Compared with non-viral vectors, viral vectors are the most widely used in clinical practice (59%). Viral vectors modify the virus's own fragments and use their highly efficient infection mechanism to carry therapeutic genes into specific tissues or the whole body to achieve the purpose of treating diseases. The two most widely used viral vectors are Lentivirus (LV) and AAV adeno-associated virus. Lentivirus is a type of retrovirus and an RNA virus. Compared with other vectors, the advantages of lentiviral vectors include large packaging capacity, long-term stable expression, no pre-existing immunity, high biocompatibility, and the ability to infect multiple types of cells, dividing or non-dividing. Not only that, the production cost of lentiviral vectors is lower than that of other vectors, but the production efficiency is higher.
[0005] Summary of the Invention
[0006] In order to solve the above technical problems, the present invention provides a lentiviral vector for gene therapy of neurofibromatosis type II, wherein the vector backbone of the lentiviral vector is pPD5, and at least one of the following substitutions is made to the sequence of the pPD5:
[0007] A1) the NF2 coding sequence of pPD5 is replaced with sequence 1;
[0008] A2) the promoter of pPD5 is replaced with sequence 2;
[0009] A3) The control element of pPD5 was replaced with sequence 3.
[0010] In some embodiments, the vector sequence is shown in Sequence 4.
[0011] The present invention also provides a microorganism containing the lentiviral vector for neurofibromatosis type II gene therapy.
[0012] The present invention also provides a plant tissue or organ, wherein the plant tissue or organ contains the lentiviral vector for neurofibromatosis type II gene therapy.
[0013] The present invention also provides an animal tissue or organ, wherein the animal tissue or organ contains the lentiviral vector for gene therapy of neurofibromatosis type II.
[0014] The present invention also provides a lentivirus, wherein the lentivirus contains the lentiviral vector for neurofibromatosis type II gene therapy.
[0015] The present invention also provides a use of any one of the vectors, microorganisms, plant tissues or organs, animal tissues or organs, or lentiviruses in the treatment or adjuvant treatment of tumors associated with NF2 mutations;
[0016] In some embodiments, the NF2 mutation-associated tumor is at least one of neurofibroma type II, meningioma, dorsal nerve root schwannoma, spinal meningioma, ependymoma, or malignant endometrioma.
[0017] Compared with the prior art, the beneficial effects of using the lentiviral vector of the present application for expression are:
[0018] (1) The NF2 gene can be expressed very well in the target Schwann cells by the lentiviral vector of the present invention.
[0019] (2) The CEP0 promoter of the present invention is Schwann cell specific (low expression in 293T cells and high expression in Schwann cells).
[0020] (3) The cell density decreased significantly after NF2 / Merlin expression. Under the strong promoter CECMV vector, the cell density decreased by about 50% after 72 hours of administration.
[0021] (4) NF / Merlin expression can reverse the morphological changes of tumor cells. After administration, the cells will show a spindle-like shape, which is morphologically similar to normal cells.
[0022] (5) NF2 / Merlin can effectively inhibit the proliferation of tumor cells. After 72 hours of transfection with the three vectors pST3, pST4, and pST5, the proliferation of tumor cells was significantly reduced. Among the three vectors, pST4 and pST5 driven by CEP0 showed very good inhibitory effects on tumor cells.
[0023] (6) NF2 / Merlin can effectively inhibit the spread of tumor cells. After 24 hours of expression, pST3, pST4, and pST5 can effectively inhibit the movement of tumor cells, significantly slowing down the spread of tumor cells.
[0024] (7) Lenti-NF2 treated NF2 schwannoma xenografts, and the tumor volume was significantly reduced after treatment.
[0025] The above seven aspects taken together demonstrate that the present invention realizes a highly efficient lentiviral vector for treating neurofibromatosis type II. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] FIG1 is a schematic diagram of a carrier skeleton according to an embodiment of the present invention;
[0027] FIG2 is a schematic diagram of the specific results of two different promoters according to an embodiment of the present invention;
[0028] Figure 3 is a graph showing the expression of Merlin and β-actin under different multiplicity of infection conditions;
[0029] FIG4 is a schematic diagram of the green fluorescence levels of Merlin and β-actin under different multiplicity of infection conditions;
[0030] FIG5 is a schematic diagram of the structure of a lentiviral vector according to an embodiment of the present invention;
[0031] FIG6 is a schematic diagram showing the effect of Merlin expression on cells according to an embodiment of the present invention;
[0032] FIG7 is a schematic diagram showing the inhibition of tumor cells by NF2 / Merlin according to an embodiment of the present invention;
[0033] FIG8 is a comparison of tumor volumes between the Lenti-NF2 treatment group and the control group in an embodiment of the present invention. DETAILED DESCRIPTION
[0034] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.
[0035] The codon-optimized NF2 cDNA sequence is ATGGCCGGCGCCATCGCCAGCCGCATGAGCTTCAGCAGCCTGAAGCGCAAGCAGCCCAAGACCTTCACCGTGCGCATCGTGACCATGGACGCCGAGATGGAGTTCAACTGCGAGATGAAGTGGAAGGGCAAGGACCTGTTCGACCTGGTGTGCCGCACCCTGGGCCTGCGCGAGACCTGGTTCTTCGGCCTGCAGTACACCATCAAGGACACCGTGGCCTGGCTGAAGATGGACAAGAAGGTGCTGGACCACGACGTGAGCAAGGAGGAGCCCGTGACCTTCCACTTCCTGGCCAAGTTCTACCCCGAGAACGCCGAGGAGGAGCTGGTGCAGGAGATCACCCAGCACCTGTTCTTCCTGCAGGTGAAGAAGCAGATCCTGGACGAGAAGATCTACTGCCCCCCCGAGGCCAGCGTGCTGCTGGCCAGCTACGCCGTGCAGGCCAAGTACGGCGACTACGACCCCAGCGTGCACAAGCGCGGCTTCCTGGCCCAGGAGGAGCTGCTGCCCAAGCGCGTGATCAACCTGTACCAGATGACCCCCGAGATGTGGGAGGAGCGCATCACCGCCTGGTACGCCGAGCACCGCGGCCGCGCCCGCGACGAGGCCGAGATGGAGTACCTGAAGATCGCCCAGGACCTGGAGATGTACGGCGTGAACTACTTCGCCATCCGCAACAAGAAGGGCACCGAGCTGCTGCTGGGCGTGGACGCCCTGGGCCTGCACATCTACGACCCCGAGAACCGCCTGACCCCCAAGATCAGCTTCCCCTGGAACGAGATCCGCAACATCAGCTACAGCGACAAGGAGTTCACCATCAAGCCCCTGGACAAGAAGATCGACGTGTTCAAGTTCAACAGCAGCAAGCTGCGCGTGAACAAGCTGATCCTGCAGCTGTGCATCGGCAACCACGACCTGTTCATGCGCCGCCGCAAGGCCGACAGCCTGGAGGTGCAGCAGATGAAGGCCCAGGCCCGCGAGGAGAAGGCCCGCAAGCAGATGGAGCGCCAGCGCCTGGCCCGCGAGAAGCAGATGCGCGAGGAGGCCGAGCGCACCCGCGACGAGCTGGAGCGCCGCCTGCTGCAGATGAAGGAGGAGGCCACCATGGCCAACGAGGCCCTGATGCGCAGCGAGGAGACCGCCGACCTGCTGGCCGAGAAGGCCCAGATCACCGAGGAGGAGGCCAAGCTGCTGGCCCAGAAGGCCGCCGAGGCCGAGCAGGAGATGCAGCGCATCAAGGCCACCGCCATCCGCACCGAGGAGGAGAAGCGCCTGATGGAGCAGAAGGTGCTGGAGGCCGAGGTGCTGGCCCTGAAGATGGCCGAGGAGAGCGAGCGCCGCGCCAAGGAGGCCGACCAGCTGAAGCAGGACCTGCAGGAGGCCCGCGAGGCCGAGCGCCGCGCCAAGCAGAAGCTGCTGGAGATCGCCACCAAGCCCACCTACCCCCCCATGAACCCCATCCCCGCCCCCCTGCCCCCCGACATCCCCAGCTTCAACCTGATCGGCGACAGCCTGAGCTTCGACTTCAAGGACACCGACATGAAGCGCCTGAGCATGGAGATCGAGAAGGAGAAGGTGGAGTACATGGAGAAGAGCAAGCACCTGCAGGAGCAGCTGAACGAGCTGAAGACCGAGATCGAGGCCCTGAAGCTGAAGGAGCGCGAGACCGCCCTGGACATCCTGCACAACGAGAACAGCGACCGCGGCGGCAGCAGCAAGCACAACACCATCAAGAAGCCCCAGGCCCAGGGCCGCCGCCCCATCTGCATCTAA(Sequence 1).
[0036]
[0037] The control element (CMV enhancer + CMV promoter-5'LTR) sequence is
[0038]
[0039]
[0040] Example 1
[0041] 1. Carrier skeleton
[0042] As shown in FIG1 , based on the clinically validated backbone pPD5, the present invention comprises a specific promoter and an optimized NF2 sequence.
[0043] 2.NF2 Optimization
[0044] (1) The NF2 gene has three major mRNA isoforms, of which isoforms 1 and 2 are the most abundantly expressed in humans;
[0045] (2) In cell models, Merlin protein synthesized by isoform 1 is more effective in inhibiting tumor growth.
[0046] The present invention selects the cDNA sequence of isoform 1 and optimizes the NF2 codons in order to enhance protein expression and achieve tumor suppression effects.
[0047] 3. Promoter design: CEP0 (CMV enhancer + P0)
[0048] Type II neurofibromatosis is a homozygous benign tumor whose pathological cell type is Schwann cells. The vector of the present invention selects the Schwann cell-specific promoter P0 (Schwann-specific promoter myelin protein zero P0). Ahmed et al, J Neurosci Methods. 2019 reported the results: (1) In vivo experiments, P0 activity was lower than the universal CBA promoter, but there was no difference in activity in in vivo experiments; (2) In Schwann cell experiments, there was no significant difference in the activity of 2kb, 1kb and 0.3kb promoters. The present invention uses this human-derived P0 cell. In order to retain more regulatory elements and assemble them into a lentiviral backbone, the present invention selects a 1kb P0 promoter. The P0 promoter has high specificity, but the expression regulation strength may be insufficient. The present invention seamlessly connects the CMV enhancer and the P0 promoter to obtain the CEP0 promoter, ultimately achieving a lentiviral vector with both specificity and high expression effect.
[0049] 4. Control element design
[0050] The present invention is a lentiviral vector designed for clinical application. The design and installation of control elements are an important part of the present invention, the purpose of which is to further improve safety, reduce integration risk, reduce gene silencing and improve long-term stable gene expression. The core skeleton of the present invention uses the following elements:
[0051] (1)CMV enhancer+CMV promoter-CMV(CECMV)-R-5'LTR
[0052] The chimera 5' end long repeat sequence LTR, the present invention uses the enhancer and promoter of human macrophage virus CMV to replace the original U3 region promoter sequence of lentivirus. The purpose of this design is to construct a plasmid that is tat-independent transcription but still maintains high-level expression, ultimately achieving improved safety and reduced carcinogenic risk.
[0053] (2) The present invention also utilizes three essential HIV-1 elements for clinical lentiviral vectors: the signaling protein motif (Ψ), which is required for packaging and replication, the Rev response element (RRE), and the central polypurine tract (cPPT) of the HIV-1 integrase gene. Rev is crucial for protein expression. The cPPT increases viral titer.
[0054] (3) U3-3'LTR (Self-Inactivating, SIN). The present invention uses the self-inactivating element SIN, which is the most important element for ensuring the safety of clinical lentiviral vectors, to ensure that the lentiviral particles are self-inactivated after transduction and integration into the genomic DNA of the target cells.
[0055] (4) WPRE. The present invention also installs a Woodchuck hepatitis virus post-transcriptional regulation element in the vector backbone to increase the expression level of the protein.
[0056] (5) Kozak sequence. To improve the efficiency of NF2 mRNA translation into Merlin protein, we added the Kozak sequence GCCACC to the bases of the flanking sequence after the restriction site and before the first ATG of the NF2 gene.
[0057] (6) Barrier insulator (AnK-R)
[0058] Romero et al. (2015) (Molecular Therapy-Methods & Clinical Development) proposed that the use of a human-derived AnK-R gene insulator could effectively protect the promoter, preventing silencing of foreign genes after integration into the human genome. In one application example (pST5) of the present invention, AnK-R was installed after the HIV1-cPPT and before the CEP0 promoter, providing a protective effect.
[0059] 5. Restriction site design
[0060] In order to effectively perform vector inspection and further optimize the vector, the present invention added two restriction enzyme sites, NheI (pST5, 4250) and BmtI (pST5, 4254), to the bases of the flanking sequence before the first ATG of the NF2 gene.
[0061] CEPO-NF2 expression specificity and intensity
[0062] The present invention provides a lentiviral vector for precise expression in Schwann cells. In 293T cells, the present invention compared the specificity of two promoters. The CMV enhancer plus the control element bound to the CMV promoter can achieve strong expression of eGFP green fluorescent protein in 293T cells. In transfections of four different plasmid concentrations, 0.1 μg, 0.5 μg, 1 μg, and 1.5 μg, we observed that green fluorescent protein expression from the CEP0 promoter was significantly lower than that from eGFP under the CMV promoter, demonstrating the cell specificity of the P0 promoter.
[0063] The results are shown in Figures 2, 3, and 4. In Schwann cells, the expression of CECMV and CEP0 is essentially the same. Comparing the green fluorescence levels, the expression levels of CEP0 and CECMV are essentially the same. This result was also verified in a protein expression (Western Blot) experiment. Comparing the results of PST3 (CECMV-NF2) and PST4 & 5 (CEPO-NF), it was found that the expression levels of the P0 promoter and the CMV promoter in Schwann cells are essentially the same. Combined with the experimental results of 293T, the present invention can conclude that the CEP0 promoter is cell-specific for Schwann cells.
[0064] Example 2
[0065] In this example, five different lentiviral vectors were constructed.
[0066] 1.pST1:HIV1.CECMV.eGFP (macrophage promoter)
[0067] 2.pST2:HIV1.CEP0.eGFP (Schwann cell-specific promoter)
[0068] 3.pST3:HIV1.CECMV.NF2 (macrophage promoter + NF2 gene)
[0069] 4.pST4:HIV1.CEP0.NF2 (Schwann cell-specific promoter + NF2 gene)
[0070] 5.pST5:HIV1.AnK-R.CEP0.NF2 (insulator + Schwann cell-specific promoter + NF2 gene).
[0071] The method includes four steps: (1) plasmid synthesis; (2) virus packaging and titer measurement; (3) transfection; and (4) effectiveness verification. The results are shown in Figures 6 and 7.
[0072] Merlin, short for moesin-ezrin-radixin-like protein, also known as Schwannomin, is the protein encoded by the NF2 gene. Merlin is one of the top 15 human tumor suppressor proteins. Merlin inhibits tumors by inhibiting multiple signaling pathways within the cell membrane and nucleus, including the DCAF1 / Hippo pathway, Ras / Raf / MEK / ERK, PI3K / AKT / mTOR, Wnt / beta-catenin, and P53.
[0073] Figure 8 shows Lenti-NF2 treatment of NF2 schwannoma xenografts (PDXs). The left side shows a PDX image 18 days after treatment; the right side shows a volume comparison histogram 18 days after treatment, showing a significant reduction in tumor volume in the treatment group. *pST5: HIV1.AnK-R.CMV+P0.NF2.
[0074] Patients with neurofibromatosis type II inherit a mutation in one copy of NF2 from their parents. When the second copy of NF2 in Schwann cells mutates, tumors begin to form. Therefore, almost all Schwann cells in neurofibromatosis type II patients have the NF2- / - genotype, which also means that the Schwann cells of patients with neurofibromatosis type II lack the expression of the functional Merlin protein. This invention uses a lentiviral vector to precisely deliver the normal NF2 gene into Schwann cells, where it expresses the full-length, functional Merlin protein. This approach utilizes Merlin's inherent tumor suppressor mechanism to treat neurofibromatosis type II and other human diseases caused by NF2 mutations.
[0075] Summary of the validity of cell / animal experiments:
[0076] (1) The NF2 gene can be expressed very well in the target Schwann cells by the lentiviral vector of the present invention.
[0077] (2) The CEP0 promoter of the present invention is Schwann cell specific (low expression in 293T cells and high expression in Schwann cells).
[0078] (3) The cell density decreased significantly after NF2 / Merlin expression. Under the strong promoter CECMV vector, the cell density decreased by about 50% after 72 hours of administration.
[0079] (4) NF / Merlin expression can reverse the morphological changes of tumor cells. After administration, the cells will show a spindle-like shape, which is morphologically similar to normal cells.
[0080] (5) NF2 / Merlin can effectively inhibit the proliferation of tumor cells. After 72 hours of transfection with the three vectors pST3, pST4, and pST5, the proliferation of tumor cells was significantly reduced. Among the three vectors, pST4 and pST5 driven by CEP0 showed very good inhibitory effects on tumor cells.
[0081] (6) NF2 / Merlin can effectively inhibit the spread of tumor cells. After 24 hours of expression, pST3, pST4, and pST5 can effectively inhibit the movement of tumor cells, significantly slowing down the spread of tumor cells.
[0082] (7) Lenti-NF2 treated NF2 schwannoma xenografts, and the tumor volume was significantly reduced after treatment.
[0083] The above seven aspects taken together demonstrate that the present invention realizes a highly efficient lentiviral vector for treating neurofibromatosis type II.
[0084] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and substitutions can be made without departing from the technical principles of the present invention. These improvements and substitutions should also be regarded as the scope of protection of the present invention.
Claims
1. A lentiviral vector for gene therapy of neurofibromatosis type II, characterized in that: The vector backbone of the lentiviral vector is pPD5, and at least one of the following substitutions is made to the sequence of the pPD5: A1) the NF2 coding sequence of pPD5 is replaced with sequence 1; A2) the promoter of pPD5 is replaced with sequence 2; A3) The control element of pPD5 was replaced with sequence 3.
2. The lentiviral vector for gene therapy of neurofibromatosis type II according to claim 1, wherein The vector sequence is shown in Sequence 4.
3. A microorganism, characterized in that The microorganism contains the lentiviral vector for gene therapy of neurofibromatosis type II according to claim 1 or 2.
4. A plant tissue or organ, characterized in that: The plant tissue or organ contains the lentiviral vector for gene therapy of neurofibromatosis type II according to claim 1 or 2.
5. An animal tissue or organ, characterized in that: The animal tissue or organ contains the lentiviral vector for gene therapy of neurofibromatosis type II according to claim 1 or 2.
6. A lentivirus, characterized in that The lentivirus contains the lentiviral vector for gene therapy of neurofibromatosis type II according to claim 1 or 2.
7. Use of the vector of claim 1 or 2, the microorganism of claim 3, the plant tissue or organ of claim 4, the animal tissue or organ of claim 5, or the lentivirus of claim 6 in the treatment or adjuvant treatment of tumors associated with NF2 mutation.
8. The use according to claim 7, characterized in that The tumor associated with NF2 mutation is at least one of neurofibroma type II, meningioma, schwannoma of the dorsal nerve root, meningioma, ependymoma or malignant endometrioma.
Citation Information
Patent Citations
PD-1 gene recombinant virus plasmid, construction thereof, recombinant retrovirus Lenti-PD-1-Puro and packaging and application of recombinant retrovirus Lenti-PD-1-Puro
CN105671083A
AAV vectors with myelin protein zero promoter and uses thereof for treating schwann cell-associated diseases like charcot-marie-tooth disease
CN114026242A
Lentiviral vector, recombinant stem cell and application thereof
CN115927478A
Lentiviral vector for type 2 neurofibroma gene therapy and application of lentiviral vector
CN118291543A
Compositions and methods for treating neurofibromatic disorders
WO2022261209A1