Construction of gene editing system of nuclear transfer donor cells of model pig of neurofibromatosis type 1 with nf1 gene mutation and application thereof
By applying CRISPR/Cas9 technology and ssODN homologous recombination technology in pig cells, the limitations of mouse models in simulating human neurofibromatosis type I were overcome, and a highly efficient neurofibromatosis model pig was constructed. This enabled efficient gene editing and stable preparation of model pigs, supporting research on disease mechanisms and drug development.
Patent Information
- Application Number
- CN202211011546.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-23
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2042-08-23
AI Technical Summary
Existing mouse models differ significantly from human neurofibromatosis type I in simulating the physiological and pathological state, failing to accurately reflect normal human physiological and pathological states. Furthermore, traditional gene editing technologies are inefficient in large animal models.
Using CRISPR/Cas9 technology combined with single-stranded oligonucleotide deoxynucleotide (ssODN) homologous recombination technology, the NF1 gene was precisely edited in porcine cells via electroporation to construct a neurofibromatosis model. Optimized Cas9 protein and gRNA ratios, combined with specific plasmids and mammalian nuclear transfection kits, were used to improve gene editing efficiency.
A single-cell clone with a target site mutation was successfully constructed, and a neurofibromatosis model pig was efficiently obtained. This simplified the pig model production cycle, improved the efficiency and stability of gene editing, and provided an effective experimental tool for research and treatment.
Smart Images

Figure BDA0003811113540000141 
Figure BDA0003811113540000151 
Figure BDA0003811113540000161
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of gene editing, and particularly relates to a gene editing system for constructing a NF1 gene mutation type I neurofibromatosis model pig nuclear transfer donor cell and application thereof. BACKGROUND
[0002] Type I neurofibromatosis (also known as neurofibromatosis type I) is an autosomal dominant genetic disease with non-cancerous tumor growth characteristics, with an incidence rate of 1 / 3000-1 / 2600, about half of the cases are familial, and the de novo mutation is mainly found in the paternal chromosome. Neurofibromas are usually formed on the skin or subcutaneously, as well as in the brain and peripheral nervous system, and can also be found in other parts of the body, and the hallmark features are multiple cafe-au-lait spots and neurofibromas.
[0003] Type I neurofibromatosis is caused by pathogenic variants of the NF1 gene. The protein product of the NF1 gene is neurofibromin, which belongs to the guanosine triphosphate hydrolase (GTPase) activating protein (GAPs) family, and these GAPs can stimulate the intrinsic GTPase activity of the ras p21 family. Ras can activate many signaling pathways, including the stem cell factor SCF / c-kit signaling pathway, the mammalian target of rapamycin (mTOR) pathway and the mitogen-activated protein kinase (MAPK) pathway. When the NF1 gene is mutated, it usually results in a truncated NF1 protein that cannot bind to ras or regulate its activity, leading to overactive ras protein, causing excessive cell division and leading to tumor formation.
[0004] Research on the mechanism of occurrence and development of type I neurofibromatosis and the development of corresponding drugs all need to be based on animal models. The commonly used animal model is the mouse model, and obvious type I neurofibromatosis has been observed in NF1 gene knockout mice. However, mice differ greatly from humans in terms of body size, organ size, physiology, pathology, and other aspects, and cannot truly simulate human normal physiological and pathological states. Pigs, as large animals, are similar to humans in size and physiological functions, are easy to breed in large quantities, and have lower requirements in terms of ethics and animal protection, making them ideal animal models for human diseases.
[0005] Gene editing is a biological technology that has made significant progress in recent years, including gene editing based on homologous recombination to ZFN, TALEN, CRISPR / Cas9 based nuclease editing technology, among which CRISPR / Cas9 technology is the most advanced gene editing technology. Currently, gene editing technology is being increasingly applied to the production of animal models.
[0006] Homologous recombination (HDR) is a process of exchanging DNA sequence information through sequence homology: that is, a repair template containing the desired insert is included in the repair template, and the two ends of the repair template are recombination arms with sequence homology near the insertion site. In the past, double-stranded DNA (dsDNA) has been commonly used as a repair template, but recent studies have revealed the superiority of single-stranded oligonucleotide deoxynucleotide (ssODN) as a HDR donor template. First, ssODN as a donor template is more specific to the insertion site than dsDNA template, and dsDNA template is prone to random insertion. Second, ssODN requires shorter homologous recombination arms than dsDNA template, and a single-sided 30-60 base recombination arm design can achieve efficient and stable HDR, providing higher insertion efficiency than similar dsDNA templates. Third, dsDNA is prone to be incorporated by the NHEJ repair pathway, resulting in replication of the homologous arm or partial integration of the dsDNA template, while ssODN is less likely to occur. In addition, dsDNAs are harmful to cultured cells, linear or plasmid dsDNAs have low transfection efficiency and cause adverse reactions in cells, while ssODN templates have more advantages in these aspects. SUMMARY
[0007] The purpose of the present application is to provide a gene editing system for constructing a model pig for neurofibromatosis type 1 with NFl gene mutation by nuclear transfer and its application.
[0008] The present application provides a method for preparing a recombinant pig cell, comprising the following steps: substituting a DNA molecule represented by SEQ ID NO: 18 for a DNA molecule represented by SEQ ID NO: 19 in the chromosomal DNA of a pig cell to obtain a recombinant pig cell.
[0009] The implementation of substituting a DNA molecule represented by SEQ ID NO: 18 for a DNA molecule represented by SEQ ID NO: 19 in the chromosomal DNA of a pig cell is: co-transfecting NF1-gRNA1, NF1-gRNA4, NF1-mutant-ss216 and NCN protein into a pig cell.
[0010] The ratio of pig cells, NF1-gRNA1, NF1-gRNA4, NF1-mutant-ss216 and NCN protein is 100,000 pig cells: 0.8-1.2 μg NF1-gRNA1: 0.8-1.2 μg NF1-gRNA4: 1.8-2.2 μg NF1-mutant-ss216: 3-5 μg NCN protein.
[0011] The ratio of the pig cells, the NF1-gRNA1, the NF1-gRNA4, the NF1-mutant-ss216 and the NCN protein is 100,000 pig cells: 1 μg NF1-gRNA1: 1 μg NF1-gRNA4: 2 μg NF1-mutant-ss216: 4 μg NCN protein.
[0012] The co-transfection is specifically in the form of electric shock transfection.
[0013] The parameter setting of the electric shock transfection is specifically 1450V, 10ms, 3pulse.
[0014] The co-transfection specifically uses a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a NeonTM transfection system electric transfection instrument.
[0015] The application also protects a kit comprising the NF1-gRNA1, the NF1-gRNA4, the NF1-mutant-ss216 and the NCN protein.
[0016] The application also protects a kit comprising the NF1-gRNA1, the NF1-gRNA4, the NF1-mutant-ss216 and the PRONCN protein.
[0017] The application also protects a kit comprising the NF1-gRNA1, the NF1-gRNA4, the NF1-mutant-ss216 and a specific plasmid.
[0018] The kit also comprises an E. coli BL21 (DE3).
[0019] The kit also comprises a pig cell.
[0020] The application provides application of the NF1-gRNA1, the NF1-gRNA4, the NF1-mutant-ss216 and the NCN protein in preparation of a kit.
[0021] The application also provides application of the NF1-gRNA1, the NF1-gRNA4, the NF1-mutant-ss216 and the PRONCN protein in preparation of a kit.
[0022] The application also provides application of the NF1-gRNA1, the NF1-gRNA4, the NF1-mutant-ss216 and a specific plasmid in preparation of a kit.
[0023] The use of any of the above-mentioned kits is as follows (a) or (b) or (c): (a) preparing a recombinant pig cell; (b) preparing a neurofibromatosis model pig; (c) preparing a neurofibromatosis cell model or a neurofibromatosis tissue model or a neurofibromatosis organ model.
[0024] The ratio of NF1-gRNA1, NF1-gRNA4, NF1-mutant-ss216 and NCN protein is 0.8-1.2 μg NF1-gRNA1: 0.8-1.2 μg NF1-gRNA4: 1.8-2.2 μg NF1-mutant-ss216: 3-5 μg NCN protein, respectively.
[0025] The ratio of NF1-gRNA1, NF1-gRNA4, NF1-mutant-ss216 and NCN protein is 1 μg NF1-gRNA1: 1 μg NF1-gRNA4: 2 μg NF1-mutant-ss216: 4 μg NCN protein, respectively.
[0026] The ratio of pig cells, NF1-gRNA1, NF1-gRNA4, NF1-mutant-ss216 and NCN protein is 100,000 pig cells: 0.8-1.2 μg NF1-gRNA1: 0.8-1.2 μg NF1-gRNA4: 1.8-2.2 μg NF1-mutant-ss216: 3-5 μg NCN protein, respectively.
[0027] The ratio of pig cells, NF1-gRNA1, NF1-gRNA4, NF1-mutant-ss216 and NCN protein is 100,000 pig cells: 1 μg NF1-gRNA1: 1 μg NF1-gRNA4: 2 μg NF1-mutant-ss216: 4 μg NCN protein, respectively.
[0028] The NF1-gRNA1 of any of the above is an sgRNA, and the target sequence binding region is as shown in SEQ ID NO: 16.
[0029] Specifically, the NF1-gRNA1 is as shown in SEQ ID NO: 16.
[0030] Specifically, the NF1-gRNA1 is as shown in SEQ ID NO: 10.
[0031] The NF1-gRNA4 of any of the above is an sgRNA, and the target sequence binding region is as shown in SEQ ID NO: 17.
[0032] Specifically, the NF1-gRNA4 is as shown in SEQ ID NO: 17.
[0033] Specifically, the NF1-gRNA4 is as shown in SEQ ID NO: 13.
[0034] Specifically, the NF1-mutant-ss216 is a single-stranded DNA molecule as shown in SEQ ID NO: 18.
[0035] The NCN protein is a Cas9 protein or a fusion protein having the Cas9 protein.
[0036] Specifically, the NCN protein is as shown in SEQ ID NO: 3.
[0037] The pig cell is a pig fibroblast.
[0038] The pig cell is a pig primary fibroblast.
[0039] The pig cell is a pig primary fibroblast obtained from a newborn pig.
[0040] The method for preparing the NCN protein comprises the following steps:
[0041] (1) introducing the plasmid pKG-GE4 into E. coli BL21(DE3) to obtain a recombinant bacterium;
[0042] (2) culturing the recombinant bacterium in a liquid medium at 30°C, then adding IPTG and inducing culture at 25°C, and then collecting the bacterial bodies;
[0043] (3) subjecting the collected bacterial bodies to bacterial body disruption to collect a crude protein solution;
[0044] (4) purifying the fusion protein having a His6 tag from the crude protein solution by affinity chromatography;
[0045] (5) subjecting the fusion protein having a His6 tag to enterokinase digestion having a His6 tag, and then removing the protein having a His6 tag by Ni-NTA resin to obtain the purified NCN protein;
[0046] The fusion gene as shown in SEQ ID NO: 1 at positions 5209-9852 in the plasmid pKG-GE4.
[0047] The method for preparing the NCN protein specifically comprises the following steps:
[0048] (1) introducing the plasmid pKG-GE4 into E. coli BL21(DE3) to obtain a recombinant bacterium.
[0049] (2) The recombinant bacteria obtained in step (1) were inoculated into liquid LB medium containing ampicillin and cultured with shaking;
[0050] (3) The bacteria solution obtained in step (2) was inoculated into liquid LB medium and cultured with shaking at 30°C and 230 rpm until the OD 600nm value = 1.0, and then IPTG was added to a concentration of 0.5 mM in the system, and then cultured with shaking at 25°C and 230 rpm for 12 hours, and then the bacteria were collected by centrifugation;
[0051] (4) The bacteria obtained in step (3) were washed with PBS buffer;
[0052] (5) The bacteria obtained in step (4) were suspended in crude extraction buffer, and then the bacteria were disrupted, and then the supernatant was collected by centrifugation, filtered using a filter membrane with a pore size of 0.22 μm, and the filtrate was collected;
[0053] (6) The fusion protein (fusion protein shown in SEQ ID NO: 2) having a His6 tag was purified from the filtrate obtained in step (5) using affinity chromatography;
[0054] (7) The post-column solution collected in step (6) was concentrated using an ultrafiltration tube, and then diluted with 25 mM Tris-HCl (pH 8.0);
[0055] (8) The recombinant bovine enterokinase having a His6 tag was added to the solution obtained in step (7) and subjected to enzymatic cleavage;
[0056] (9) The solution on which step (8) was completed was mixed with Ni-NTA resin, incubated, and then the supernatant was collected by centrifugation;
[0057] (10) The supernatant obtained in step (9) was concentrated using an ultrafiltration tube, and then added to an enzyme storage solution, which is the NCN protein solution.
[0058] The specific method for purifying the fusion protein having a His6 tag from the filtrate obtained in step (5) using affinity chromatography is as follows:
[0059] First, the Ni-NTA agarose column was equilibrated with 5 column volumes of equilibration buffer at a flow rate of 1 ml / min; then 50 ml of the filtrate obtained in step (5) was loaded (at a flow rate of 0.5-1 ml / min); then the column was washed with 5 column volumes of equilibration buffer (at a flow rate of 1 ml / min); then the column was washed with 5 column volumes of buffer (at a flow rate of 1 ml / min) to remove impure proteins; and then the column was eluted with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and the post-column solution (90-100 ml) was collected.
[0060] Any of the above PRONCN proteins includes the following elements from upstream to downstream: a signal peptide, a molecular chaperone protein, a protein tag, a protease cleavage site, a nuclear localization signal, a Cas9 protein, and a nuclear localization signal.
[0061] The function of the signal peptide is to promote protein secretion and expression. The signal peptide can be selected from the Escherichia coli alkaline phosphatase (phoA) signal peptide, the Staphylococcus aureus protein A signal peptide, the Escherichia coli outer membrane protein (ompa) signal peptide, or any other prokaryotic gene signal peptide, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to guide the secretion and expression of the target protein into the bacterial periplasm, thereby separating it from the bacterial intracellular proteins. The target protein secreted into the bacterial periplasm is expressed as a soluble protein and can be cleaved by the signal peptidase in the bacterial periplasm.
[0062] The function of the molecular chaperone protein is to increase the solubility of the protein. The molecular chaperone can be any protein that helps form disulfide bonds, preferably thioredoxin (TrxA protein). Thioredoxin can act as a molecular chaperone to help the co-expressed target protein (e.g., Cas9 protein) form disulfide bonds, improve protein stability, correct folding, and increase the solubility and activity of the target protein.
[0063] The protein tag is used for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), a GST tag, a Flag tag, an HA tag, a c-Myc tag, or any other protein tag, more preferably a His tag. The His tag can bind to a Ni column, allowing the target protein to be purified by one-step Ni column affinity chromatography, greatly simplifying the purification process of the target protein.
[0064] The function of the protease cleavage site is to be used to remove the non-functional segment after purification to release the natural form of Cas9 protein. The protease can be selected from enterokinase, Factor Xa, Thrombin, TEV protease, HRV 3C protease, WELQut protease or any other endoprotease, and enterokinase is further preferred. EK is an enterokinase cleavage site, which is convenient for using enterokinase to remove the fused TrxA-His segment to obtain the natural form of Cas9 protein. After the commercial enterokinase with a His tag is used to cut the fusion protein, the TrxA-His segment and the enterokinase with a His tag can be removed by one affinity chromatography to obtain the natural form of Cas9 protein, thereby avoiding the damage and loss of the target protein caused by multiple purification and dialysis.
[0065] The nuclear localization signal can be any nuclear localization signal, preferably an SV40 nuclear localization signal and / or a nucleoplasmin nuclear localization signal. The NLS is a nuclear localization signal, and one NLS site is designed at the N-terminus and C-terminus of Cas9, respectively, so that Cas9 can more effectively enter the nucleus for gene editing.
[0066] The Cas9 protein can be a saCas9 or a spCas9, preferably a spCas9 protein.
[0067] The PRONCN protein is specifically shown in SEQ ID NO: 2.
[0068] The specific plasmid of any of the above includes the following elements from upstream to downstream: a promoter, an operator, a ribosome binding site, a coding gene of a PRONCN protein, and a terminator.
[0069] The promoter can be specifically a T7 promoter. The T7 promoter is a strong promoter for prokaryotic expression, which can efficiently drive the expression of an exogenous gene.
[0070] The operator can be specifically a Lac operator. The Lac operator is a regulatory element for lactose-induced expression, which can be used to induce the expression of the target protein at low temperature after the bacteria grow to a certain number, thereby avoiding the influence of the early expression of the target protein on the growth of the host bacteria, and significantly improving the solubility of the expressed target protein.
[0071] The ribosome binding site is the ribosome binding site during protein translation, which is necessary for protein translation.
[0072] The terminator can be specifically a T7 terminator. The T7 terminator can effectively terminate the transcription of the target gene at the end of the target gene, thereby avoiding the transcription and translation of other downstream sequences other than the target gene.
[0073] For the codons of the spCas9 protein, the codons are optimized in the present application to completely adapt to the codon bias of the selected E. coli high-efficiency expression strain E. coli BL21(DE3), thereby improving the expression level of the Cas9 protein.
[0074] The T7 promoter is shown in SEQ ID NO: 1 at nucleotides 5121-5139.
[0075] The Lac operator is shown in SEQ ID NO: 1 at nucleotides 5140-5164.
[0076] The ribosome binding site is shown in SEQ ID NO: 1 at nucleotides 5178-5201.
[0077] The coding sequence of the alkaline phosphatase signal peptide is shown as nucleotides 5209-5271 in SEQ ID NO: 1.
[0078] The coding sequence of the TrxA protein is shown as nucleotides 5272-5598 in SEQ ID NO: 1.
[0079] The coding sequence of the His-Tag is shown as nucleotides 5620-5637 in SEQ ID NO: 1.
[0080] The coding sequence of the enterokinase cleavage site is shown as nucleotides 5638-5652 in SEQ ID NO: 1.
[0081] The coding sequence of the nuclear localization signal is shown as nucleotides 5656-5670 in SEQ ID NO: 1.
[0082] The coding sequence of the spCas9 protein is shown as nucleotides 5701-9801 in SEQ ID NO: 1.
[0083] The coding sequence of the nuclear localization signal is shown as nucleotides 9802-9849 in SEQ ID NO: 1.
[0084] The T7 terminator is shown as nucleotides 9902-9949 in SEQ ID NO: 1.
[0085] Specifically, the specific plasmid is plasmid pKG-GE4.
[0086] The plasmid pKG-GE4 has a DNA molecule shown as nucleotides 5121-9949 in SEQ ID NO: 1.
[0087] Specifically, the above-mentioned plasmid pKG-GE4 is shown as SEQ ID NO: 1.
[0088] The present application also protects the recombinant pig cell prepared by the above-mentioned method.
[0089] The recombinant pig cell is a double-allele same mutant recombinant cell with a target site mutation.
[0090] The double-allele same mutant with a target site mutation means that both homologous chromosomes have completed replacement of single-stranded Donor DNA.
[0091] The replacement of single-stranded Donor DNA means that the DNA molecule shown as SEQ ID NO: 19 in the chromosomal DNA is replaced by the DNA molecule shown as SEQ ID NO: 18.
[0092] The DNA molecule shown in SEQ ID NO: 19 is located in the NF1 gene in the chromosomal DNA of the pig cell.
[0093] Pig NF1 gene information: encoding neurofibromin 1; located in chromosome 12; Gene ID is 100526136, Sus scrofa.
[0094] The protein encoded by the pig NF1 gene is shown in XP_020923119.1 (MAM 13-MAY-2017) in NCBI.
[0095] The protein encoded by the pig NF1 gene has a protein segment shown in SEQ ID NO: 8.
[0096] The pig NF1 gene has a DNA segment shown in SEQ ID NO: 9.
[0097] The application also protects the use of the recombinant pig cell in the preparation of a neurofibromatosis model pig.
[0098] The somatic cell clone of the recombinant pig cell as a nuclear transfer donor cell can obtain a cloned pig, which is a neurofibromatosis model pig.
[0099] The application also protects the pig tissue of the model pig prepared by the recombinant pig cell, i.e. a neurofibromatosis tissue model.
[0100] The application also protects the pig organ of the model pig prepared by the recombinant pig cell, i.e. a neurofibromatosis organ model.
[0101] The application also protects the pig cell (such as a neural cell, an endothelial cell or an immune cell obtained from the model pig) of the model pig prepared by the recombinant pig cell, i.e. a neurofibromatosis cell model.
[0102] The application also protects the use of the recombinant pig cell, the neurofibromatosis tissue model, the neurofibromatosis organ model, the neurofibromatosis cell model or the neurofibromatosis model pig, which is as follows (d1) or (d2) or (d3) or (d4):
[0103] (d1) screening drugs for treating neurofibromatosis;
[0104] (d2) performing pharmacodynamic evaluation of neurofibromatosis drugs;
[0105] (d3) performing efficacy evaluation of gene therapy and / or cell therapy for neurofibromatosis;
[0106] (d4) studying the pathogenesis of neurofibromatosis.
[0107] Any of the above pigs can be a Jiangxiang pig.
[0108] Any of the above pigs can be a newborn Jiangxiang pig.
[0109] Any of the above pigs can be a Bama pig.
[0110] Any of the above pigs can be a newborn Bama pig.
[0111] Any of the above neurofibromatosis can be neurofibromatosis type I.
[0112] Compared with the prior art, the present application has at least the following beneficial effects:
[0113] (1) The research object (pig) of the present application has better applicability than other animals (mice, primates).
[0114] Rodents such as mice are very different from humans in terms of body size, organ size, physiology, pathology, etc., and cannot truly simulate the normal physiological and pathological states of humans. Studies have shown that more than 95% of drugs that are effective in mice are ineffective in human clinical trials. As for large animals, primates are the closest relatives of humans, but they are small in size, mature late (6-7 years old for mating), and are single-birth animals, with a very slow population expansion rate and high feeding costs. In addition, primate cloning is low in efficiency, difficult, and high in cost.
[0115] Pigs, as model animals, do not have the above-mentioned shortcomings. Pigs are the closest relatives of humans after primates, and their body size, weight, organ size, etc. are similar to those of humans, and they are very similar to humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, etc. At the same time, pigs mature early (4-6 months old), have high reproductive capacity, and can produce multiple offspring per litter, and a large population can be formed within 2-3 years. In addition, the cloning technology of pigs is very mature, and the cloning and feeding costs are much lower than those of primates. Therefore, pigs are very suitable as animal models for human diseases.
[0116] (2) The application uses a strong promoter T7-lac to express the target protein, and uses the signal peptide of bacterial periplasmic alkaline phosphatase (phoA) to guide the secretion of the target protein to the bacterial periplasmic cavity, so as to separate the target protein from the intracellular protein of the bacterium, and the target protein secreted into the bacterial periplasmic cavity is soluble expression. Meanwhile, the Cas9 protein is expressed in fusion with the thioredoxin TrxA, which can help the co-expressed target protein to form a disulfide bond, improve the stability and folding correctness of the protein, and increase the solubility and activity of the target protein. In order to facilitate the purification of the target protein, a His tag is designed, and the target protein can be purified by one-step Ni column affinity chromatography, which greatly simplifies the purification process of the target protein. Meanwhile, an enterokinase cleavage site is designed after the His tag, which facilitates the removal of the fused TrxA-His polypeptide fragment, and the natural form of the Cas9 protein is obtained. After the fusion protein is cleaved by the enterokinase with the His tag, the TrxA-His polypeptide fragment and the enterokinase with the His tag can be removed by one-step affinity chromatography, and the natural form of the Cas9 protein is obtained, which avoids the damage and loss of the target protein caused by multiple purification and dialysis. Meanwhile, an NLS site is designed at the N and C terminals of the Cas9, so that the Cas9 can more effectively enter the nucleus for gene editing. In addition, the application selects E. coli BL21 (DE3) as the target protein expression strain, which can efficiently express the foreign genes cloned in the expression vector (such as pET-32a) containing the bacteriophage T7 promoter. Meanwhile, the codon of the Cas9 protein is optimized to adapt to the codon bias of the expression strain, so as to improve the expression level of the target protein. In addition, the application induces the expression of the target protein at low temperature after the bacteria grow to a certain number, which can avoid the influence of the early expression of the target protein on the growth of the host bacteria, and the induction of the expression at low temperature can significantly improve the solubility of the expressed target protein. After the above optimization design and experimental implementation, the activity of the obtained Cas9 protein is significantly higher than that of the commercial Cas9 protein.
[0117] (3) The Cas9 high-efficiency protein complex constructed and expressed by the application is combined with in vitro transcribed gRNA for gene editing, and the optimal dosage ratio of Cas9 and gRNA is optimized, and the synthesized ssODN is used as Donor DNA, so that the single cell clone with target site mutation can be obtained at a rate of up to 20%, which is much higher than the conventional point mutation efficiency (<5%).
[0118] (4) The single cell clone with target site mutation obtained by the application can be used for somatic cell nuclear transfer animal cloning to directly obtain a cloned pig containing the target site mutation, and the mutation can be stably inherited.
[0119] The method of fertilized egg microinjection of gene editing material and then embryo transfer in the mouse model making has a very low probability (less than 1%) of directly obtaining a point mutation offspring, and needs to be hybridized and selected for breeding, which is not suitable for long gestation period of large animals (such as pigs) model making. Therefore, the method of primary cell in vitro editing and ssODN homologous recombination and screening of positive editing single cell clone with high technical difficulty and high challenge is adopted, and then the corresponding disease model pig is directly obtained through somatic cell nuclear transfer animal cloning technology, which can greatly shorten the model pig making cycle and save manpower, material resources and financial resources.
[0120] The CRISPR / Cas9 technology is combined with the ssODN homologous recombination technology to edit the NF1 gene, the natural pathogenesis genetic characteristics of neurofibromatosis are simulated, and the single cell clone with precise point mutation of the NF1 gene is obtained, which lays a foundation for cultivating the neurofibromatosis model pig through somatic cell nuclear transfer animal cloning technology in the later period. The model pig will provide a powerful experimental tool for studying the pathogenesis of neurofibromatosis and drug research and development.
[0121] The present application lays a solid foundation for obtaining the neurofibromatosis model pig with NF1 gene mutation through gene editing means, which will help to study and reveal the pathogenesis of neurofibromatosis caused by NF1 gene mutation, and can be used for drug screening, drug efficacy detection, gene therapy and cell therapy research, and can provide effective experimental data for further clinical application, and further provide a powerful experimental means for successfully treating human neurofibromatosis. The present application has great application value for developing neurofibromatosis drugs and revealing the pathogenesis of the disease. BRIEF DESCRIPTION OF DRAWINGS
[0122] Figure 1 It is a structural schematic diagram of plasmid pET-32a.
[0123] Figure 2 It is a structural schematic diagram of plasmid pKG-GE4.
[0124] Figure 3 It is an electrophoresis diagram of gRNA and NCN protein dosage ratio optimization in Example 2.
[0125] Figure 4 It is an electrophoresis diagram of gene editing efficiency comparison of NCN protein and commercial Cas9 protein in Example 2.
[0126] Figure 5 It is an electrophoresis diagram of using the ear tissue of a pig named BX4 to extract genome as a template and using different primer pairs for PCR amplification in Example 3.
[0127] Figure 6Electrophoresis map of PCR amplification with primer pair of NF1-E40-JDF99 and NF1-E40-JDR403 using genomic DNA of 10 pigs as template in Example 3.
[0128] Figure 7 Alignment result of forward sequencing of single cell clone No. 46 with NF1-mutant-ss216 sequence.
[0129] Figure 8 Alignment result of forward sequencing of single cell clone No. 12 with NF1-mutant-ss216 sequence. DETAILED DESCRIPTION
[0130] The application will be further described in conjunction with the specific embodiments. The examples given are only for the purpose of illustrating the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.
[0131] The experimental methods in the following examples are all routine methods, unless otherwise specified, which are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially. The recombinant plasmids constructed in the examples have been sequenced and verified. The commercial Cas9-A protein is a commercially available Cas9 protein with good effect. The commercial Cas9-B protein is a commercially available Cas9 protein with good effect. Complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, 5% CO2, 5% O2 constant temperature incubator.
[0132] The porcine primary fibroblasts used in Example 2 were prepared from the ear tissue of a newborn Jiangxiang pig. The porcine primary fibroblasts used in Example 3 and Example 4 were both prepared from the ear tissue of a newborn Bama pig. The method for preparing porcine primary fibroblasts from porcine ear tissue is as follows: 1) Take 0.5 g of porcine ear tissue, remove the hair and bone tissue, then immerse in 75% alcohol for 30-40 s, then wash with PBS buffer containing 5% (v / v) Penicillin-Streptomycin (Gibco) for 5 times, then wash with PBS buffer once; 2) Cut the tissue into small pieces with scissors, then digest with 5 mL of 0.1% collagenase solution (Sigma) at 37°C for 1 h, then centrifuge at 500g for 5 min, discard the supernatant; 3) Resuspend the precipitate with 1 mL of complete culture medium, then plate into a 10 cm diameter cell culture dish containing 10 mL of complete culture medium and sealed with 0.2% gelatin (VWR), culture until the cells grow to about 60% of the bottom of the dish; 4) After completing step 3, digest and collect the cells with trypsin, then resuspend in complete culture medium. The cells are used for subsequent electroporation experiments.
[0133] The plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 in the patent application 202010084343.6. In SEQ ID NO: 2 in the patent application 202010084343.6, the nucleotides 395-680 constitute a CMV enhancer, the nucleotides 682-890 constitute an EFla promoter, the nucleotides 986-1006 encode a nuclear localization signal (NLS), the nucleotides 1016-1036 encode a nuclear localization signal (NLS), the nucleotides 1037-5161 encode a Cas9 protein, the nucleotides 5162-5209 encode a nuclear localization signal (NLS), the nucleotides 5219-5266 encode a nuclear localization signal (NLS), the nucleotides 5276-5332 encode a polypeptide P2A (the amino acid sequence of the polypeptide P2A is “ATNFSLLKQAGDVEENPGP”, and the cleavage site is between the first and the second amino acid residues from the C terminus), the nucleotides 5333-6046 encode an EGFP protein, the nucleotides 6056-6109 encode a polypeptide T2A (the amino acid sequence of the polypeptide T2A is “EGRGSLLTCGDVEENPGP”, and the cleavage site is between the first and the second amino acid residues from the C terminus), the nucleotides 6110-6703 encode a Puromycin protein (referred to as Puro protein), the nucleotides 6722-7310 constitute a WPRE sequence element, the nucleotides 7382-7615 constitute a 3’LTR sequence element, and the nucleotides 7647-7871 constitute a bGH poly(A) signal sequence element. In SEQ ID NO: 2 in the patent application 202010084343.6, the nucleotides 911-6706 form a fusion gene, which expresses a fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms three proteins: a protein with the Cas9 protein, a protein with the EGFP protein, and a protein with the Puro protein.
[0134] The pKG-U6gRNA vector, i.e., the plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in the patent application 202010084343.6. In SEQ ID NO: 3 in the patent application 202010084343.6, the nucleotides 2280-2539 constitute a hU6 promoter, and the nucleotides 2558-2637 are used for transcription to form a gRNA backbone. When used, a DNA molecule with a length of about 20 bp (a target sequence binding region used for transcription to form a gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain a gRNA.
[0135] Example 1, Preparation and purification of NCN protein
[0136] I. Construction of prokaryotic Cas9 high-efficiency expression vector
[0137] The schematic diagram of the structure of plasmid pET-32a is shown in Figure 1 .
[0138] Plasmid pKG-GE4 is obtained by modifying plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (referred to as plasmid pKG-GE4) is shown in SEQ ID NO: 1, which is a circular plasmid, and the schematic diagram of the structure is shown in Figure 2 .
[0139] In SEQ ID NO: 1, nucleotides 5121-5139 constitute a T7 promoter, nucleotides 5140-5164 encode a lac operator, nucleotides 5178-5201 constitute a ribosome binding site (RBS), nucleotides 5209-5271 encode a phoA signal peptide, nucleotides 5272-5598 encode a TrxA protein, nucleotides 5620-5637 encode a His-Tag (also known as His6 tag), nucleotides 5638-5652 encode an enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode a nuclear localization signal, nucleotides 5701-9801 encode a spCas9 protein, nucleotides 9802-9849 encode a nuclear localization signal, and nucleotides 9902-9949 constitute a T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for E. coli BL21 (DE3) strain.
[0140] The main modification of the plasmid pKG-GE4 is as follows: ① The coding region of the TrxA protein is retained, which can help the expressed target protein form disulfide bonds, increase the solubility and activity of the target protein; the coding sequence of the alkaline phosphatase signal peptide is added before the coding region of the TrxA protein, which can guide the expressed target protein to be secreted into the periplasmic cavity of the bacteria and can be cleaved by the prokaryotic periplasmic signal peptide enzyme; ② The coding sequence of His-Tag is added downstream of the coding sequence of TrxA protein, which can be used for enrichment of the expressed target protein; ③ The coding sequence of enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) is added downstream of the coding sequence of His-Tag, and the purified protein will remove His-Tag and the upstream fused TrxA protein under the action of enterokinase; ④ The codon-optimized Cas9 gene suitable for expression in E. coli BL21 (DE3) strain is inserted, and the coding sequence of nuclear localization signal is added upstream and downstream of the gene to increase the nuclear localization ability of the purified Cas9 protein in the later stage.
[0141] The fusion gene in the plasmid pKG-GE4 is shown as nucleotides 5209-9852 in SEQ ID NO: 1, which encodes the fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, referred to as PRONCN protein for short). Due to the presence of alkaline phosphatase signal peptide and enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3. The protein shown in SEQ ID NO: 3 is named NCN protein.
[0142] II. Inducing expression
[0143] 1. Introduce the plasmid pKG-GE4 into E. coli BL21 (DE3) to obtain a recombinant strain.
[0144] 2. Inoculate the recombinant strain obtained in step 1 into liquid LB medium containing 100 μg / ml ampicillin, and culture at 37°C with 200 rpm shaking overnight.
[0145] 3. Inoculate the bacterial solution obtained in step 2 into liquid LB medium, and culture at 30°C with 230 rpm shaking until the OD value is 1.0, then add isopropyl thiogalactoside (IPTG) to make its concentration in the system 0.5 mM, then culture at 25°C with 230 rpm shaking for 12 hours, then centrifuge at 4°C at 10000 g for 15 minutes, and collect the bacterial cells. 600nm
[0146] 4. Take the bacterial cells obtained in step 3, and wash with PBS buffer.
[0147] III. Purification of fusion protein TrxA-His-EK-NLS-spCas9-NLS
[0148] 1. Take the bacteria obtained in step 2, add crude extraction buffer and suspend the bacteria, then use a homogenizer to break the bacteria (1000 par cycles three times), then centrifuge at 4°C, 15000g for 30min, collect the supernatant, and filter the supernatant with a 0.22μm pore size filter membrane, collect the filtrate. In this step, 10ml of crude extraction buffer is added per g of wet weight of bacteria.
[0149] Crude extraction buffer: contains 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, and the rest is ddH2O.
[0150] 2. Purify the fusion protein by affinity chromatography.
[0151] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate 1ml / min); then load 50ml of filtrate obtained in step 1 (flow rate 0.5-1ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate 1ml / min); then wash the column with 5 column volumes of buffer (flow rate 1ml / min) to remove impurities; then elute with 10 column volumes of eluent at a flow rate of 0.5-1ml / min, collect the post-column solution (90-100ml).
[0152] Ni-NTA agarose column: Kingsway, L00250 / L00250-C, filler 10ml.
[0153] Equilibration buffer: contains 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, and the rest is ddH2O.
[0154] Buffer: contains 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 50mM Imidazole, and the rest is ddH2O.
[0155] Eluent: contains 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 500mM Imidazole, and the rest is ddH2O.
[0156] IV. Enzymatic digestion of fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein
[0157] 1. Take 15 ml of the solution collected after passing through the column in step three, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, with a capacity of 15 ml), then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). A total of 6 ml is obtained using 6 ultrafiltration tubes.
[0158] 2. Add commercially sourced recombinant bovine enterokinase with His6 tag (Shenguo Biotech, C620031, recombinant bovine enterokinase light chain with His6 tag, Recombinant Bovine Enterokinase Light Chain, His) to the solution obtained in step 1 (about 6 ml), and incubate at 25°C for 16 hours. Add 2 units of enterokinase for every 50 μg of protein.
[0159] 3. Take the solution after completing step 2 (about 6 ml), mix it with 480 μl of Ni-NTA resin (Genscript, L00250 / L00250-C), rotate it at room temperature for 15 min, then centrifuge at 7000 g for 3 min to collect the supernatant (4-5.5 ml).
[0160] 4. Take the supernatant obtained in step 3, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, with a capacity of 15 ml), then add enzyme storage solution to adjust the protein concentration to 5 mg / ml, which is the NCN protein solution.
[0161] Sequencing shows that the protein in the NCN protein solution has an N-terminal 15 amino acid residue as shown in SEQ ID NO: 3, i.e., NCN protein.
[0162] The NCN protein used in subsequent examples is provided by the NCN protein solution.
[0163] Enzyme storage solution (pH 7.4): contains 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (by volume) glycerol, and the rest is ddH2O.
[0164] Example 2, Performance of NCN protein
[0165] The two gRNA target sites targeting the TTN gene are as follows:
[0166] TTN-gRNA1 target site: AGAGCACAGTCAGCCTGGCG;
[0167] TTN-gRNA2 target site: CTTCCAGAATTGGATCTCCG.
[0168] Primers for identifying target fragments containing gRNAs in TTN gene are as follows:
[0169] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;
[0170] TTN-R560: CAAAGTTAACTCTCTGTGTCT.
[0171] I. Preparation of gRNA
[0172] 1. Preparation of TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template
[0173] TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.
[0174] TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.
[0175] 2. In vitro transcription to obtain gRNA
[0176] Take TTN-T7-gRNA1 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) for recovery and purification to obtain TTN-gRNA1. TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.
[0177] Take TTN-T7-gRNA2 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) for recovery and purification to obtain TTN-gRNA2. TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.
[0178] II. Optimization of gRNA and NCN protein dosage ratio
[0179] 1. Co-transfection of porcine primary fibroblasts
[0180] Group 1: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1: 0.5 μg TTN-gRNA2: 4 μg NCN protein.
[0181] Group 2: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 0.75 μg TTN-gRNA1: 0.75 μg TTN-gRNA2: 4 μg NCN protein.
[0182] Group 3: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.
[0183] Group 4: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1: 1.25 μg TTN-gRNA2: 4 μg NCN protein.
[0184] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.
[0185] Co-transfection was performed by electroporation. Mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon TM transfection system electroporation instrument (parameter setting: 1450V, 10ms, 3pulse) were used.
[0186] 2. After completing step 1, use complete culture medium to culture for 12-18 hours, then replace with new complete culture medium for culture. The total culture time after electroporation is 48 hours.
[0187] 3. After completing step 2, trypsinize and collect the cells, extract genomic DNA, perform PCR amplification using primer pair TTN-F55 and TTN-R560, and then perform 1% agarose gel electrophoresis.
[0188] The electrophoretogram is shown in Figure 3The 505 bp band is the wild type band (WT), and the band of about 254 bp (the wild type band of 505 bp theoretically lacks 251 bp) is the deletion mutant band (MT).
[0189] The gene deletion mutation efficiency = (MT gray level / MT band bp number) / (WT gray level / WT band bp number + MT gray level / MT band bp number) x 100%. The first group of gene deletion mutation efficiency is 19.9%, the second group of gene deletion mutation efficiency is 39.9%, the third group of gene deletion mutation efficiency is 79.9%, and the fourth group of gene deletion mutation efficiency is 44.3%. The fifth group does not occur mutation.
[0190] The results show that when the mass ratio of two gRNAs to NCN protein is 1:1:4, and the actual amount used is 1 μg:1 μg:4 μg, the gene editing efficiency is the highest. Therefore, the optimal amount of two gRNAs and NCN protein is determined to be 1 μg:1 μg:4 μg.
[0191] III. Comparison of gene editing efficiency of NCN protein and commercial Cas9 protein
[0192] 1. Co-transfection of porcine primary fibroblasts
[0193] Cas9-A group: co-transfect TTN-gRNA1, TTN-gRNA2 and commercial Cas9-A protein into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-A protein.
[0194] pKG-GE4 group: co-transfect TTN-gRNA1, TTN-gRNA2 and NCN protein into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.
[0195] Cas9-B group: co-transfect TTN-gRNA1, TTN-gRNA2 and commercial Cas9-B protein into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-B protein.
[0196] Control group: co-transfect TTN-gRNA1, TTN-gRNA2 into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.
[0197] Co-transfection was performed by electroporation, using a mammalian nucleofection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameter settings: 1450V, 10ms, 3pulse).
[0198] 2. After step 1, the cells were cultured with complete culture medium for 12-18 hours, and then new complete culture medium was used for culture. The total culture time after electroporation was 48 hours.
[0199] 3. After step 2, the cells were trypsinized and collected, genomic DNA was extracted, and PCR amplification was performed using a primer pair consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.
[0200] The electrophoretogram is shown in Figure 4 The gene deletion mutation efficiency of the commercial Cas9-A protein was 28.5%, the gene deletion mutation efficiency of the NCN protein was 85.6%, and the gene deletion mutation efficiency of the commercial Cas9-B protein was 16.6%.
[0201] The results show that, compared with the commercial Cas9 protein, the NCN protein prepared by the application can significantly improve the gene editing efficiency.
[0202] Example 3, Screening of High-efficiency gRNA Target Sites of NF1 Gene
[0203] Pig NF1 gene information: encoding neurofibromin protein 1; located on chromosome 12; Gene ID is 100526136, Sus scrofa. The protein encoded by the pig NF1 gene is shown in XP_020923119.1 (MAM 13-MAY-2017) in NCBI. The partial segment amino acid sequence of the protein encoded by the pig NF1 gene is shown in SEQ ID NO: 8. In the pig genomic DNA, the NF1 gene has a total of 58 exons, and the 40th coding exon and its upstream and downstream 200bp are shown in SEQ ID NO: 9.
[0204] I. Analysis of NF1 gene pre-set point mutation site and adjacent genomic sequence conservation
[0205] 10 newborn Bama miniature pigs, including 6 females (named BC1, BC2, BC3, BC4, BC5, BC6, respectively) and 4 males (named BX1, BX2, BX3, BX4, respectively).
[0206] NF1-E40-JDF99: TGGTCTTGACCTTTTACTTCCCT;
[0207] NF1-E40-JDR403: ACTCAATACCTGCCCAAGGC.
[0208] NF1-E40-JDR403: ACTCAATACCTGCCCAAGGC.
[0209] NF1-E40-JDR403: ACTCAATACCTGCCCAAGGC.
[0210] The ear tissue of a pig named BX4 was extracted to obtain a genome as a template, PCR amplification was performed using different primer pairs, and then 1% agarose gel electrophoresis was performed. The electrophoresis map is shown in Figure 5 . Figure 5 Group 1: the primer pair composed of NF1-E40-JDF99 and NF1-E40-JDR403 was used; Group 2: the primer pair composed of NF1-E40-JDF99 and NF1-E40-JDR547 was used; Group 3: the primer pair composed of NF1-E40-JDF110 and NF1-E40-JDR403 was used; and Group 4: the primer pair composed of NF1-E40-JDF110 and NF1-E40-JDR547 was used. The results showed that the primer pair composed of NF1-E40-JDF99 and NF1-E40-JDR403 was preferably used for amplifying the target fragment.
[0211] The genomic DNA of 10 pigs was used as a template, and the primer pair composed of NF1-E40-JDF99 and NF1-E40-JDR403 was used for PCR amplification, and then 1% agarose gel electrophoresis was performed. The electrophoresis map is shown in Figure 6 . The PCR amplification product was recovered and sequenced, and the sequencing results were compared and analyzed with the NF1 gene sequence in the public database. The conserved region common to 10 pigs was selected for gRNA target site design.
[0212] II. Screening of target sites
[0213] A number of target sites were preliminarily screened by screening NGG (avoiding possible mutation sites), and 4 target sites were further screened from them through a pre-experiment.
[0214] The 4 target sites are as follows:
[0215] NF1-E40-gRNA1 target site: GTTTGGAATACATGACTCCA;
[0216] NF1-E40-gRNA2 target site: CGTACTAGATTTGACAGCCA;
[0217] NF1-E40-gRNA3 target: CGCAGTAACTCTTTGTCGTT;
[0218] NF1-E40-gRNA4 target: TCATTGTTATCAGCTTATCA.
[0219] III. Preparation of recombinant plasmid
[0220] The plasmid pKG-U6gRNA was digested with restriction enzyme Bbsl, and the vector skeleton (a linear large fragment of about 3 kb) was recovered.
[0221] NF1-E40-gRNA1-S and NF1-E40-gRNA1-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector skeleton were ligated to obtain the plasmid pKG-U6gRNA(NF1-E40-gRNA1). The plasmid pKG-U6gRNA(NF1-E40-gRNA1) expresses the sgRNA shown in SEQ ID NO: 10 NF1-E40-gRNA1 .
[0222] sgRNA NF1-E40-gRNA1 (SEQ ID NO: 10):
[0223] GUUUGGAAUACAUGACUCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0224] NF1-E40-gRNA2-S and NF1-E40-gRNA2-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector skeleton were ligated to obtain the plasmid pKG-U6gRNA(NF1-E40-gRNA2). The plasmid pKG-U6gRNA(NF1-E40-gRNA2) expresses the sgRNA shown in SEQ ID NO: 11 NF1-E40-gRNA2 .
[0225] sgRNA NF1-E40-gRNA2 (SEQ ID NO: 11):
[0226] CGUACUAGAUUUGACAGCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0227] NF1-E40-gRNA3-S and NF1-E40-gRNA3-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(NF1-E40-gRNA3). The plasmid pKG-U6gRNA(NF1-E40-gRNA3) expresses sgRNA represented by SEQ ID NO: 12 NF1-E40-gRNA3 .
[0228] sgRNA NF1-E40-gRNA3 (SEQ ID NO: 12):
[0229] CGCAGUAACUCUUUGUCGUUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0230] NF1-E40-gRNA4-S and NF1-E40-gRNA4-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(NF1-E40-gRNA4). The plasmid pKG-U6gRNA(NF1-E40-gRNA4) expresses sgRNA represented by SEQ ID NO: 13 NF1-E40-gRNA4 .
[0231] sgRNA NF1-E40-gRNA4 (SEQ ID NO: 13):
[0232] UCAUUGUUAUCAGCUUAUCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0233] NF1-E40-gRNA1-S: caccGTTTGGAATACATGACTCCA;
[0234] NF1-E40-gRNA1-A: aaacTGGAGTCATGTATTCCAAAC;
[0235] NF1-E40-gRNA2-S: caccgCGTACTAGATTTGACAGCCA;
[0236] NF1-E40-gRNA2-S: caccgTGGCTGTCAAATCTAGTACG
[0237] NF1-E40-gRNA3-S: caccgCGCAGTAACTCTTTGTCGTT
[0238] NF1-E40-gRNA3-A: aaacAACGACAAAGAGTTACTGCGc
[0239] NF1-E40-gRNA4-S: caccgTCATTGTTATCAGCTTATCA
[0240] NF1-E40-gRNA4-A: aaacTGATAAGCTGATAACAATGAc
[0241] NF1-E40-gRNA1-S, NF1-E40-gRNA1-A, NF1-E40-gRNA2-S, NF1-E40-gRNA2-A, NF1-E40-gRNA3-S, NF1-E40-gRNA3-A, NF1-E40-gRNA4-S, NF1-E40-gRNA4-A are all single-stranded DNA molecules.
[0242] IV. Comparison of editing efficiency of different target sites
[0243] 1. Co-transfection
[0244] First group: co-transfect plasmid pKG-U6gRNA (NF1-E40-gRNA1), plasmid pKG-GE3 into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (NF1-E40-gRNA1): 1.08 μg plasmid pKG-GE3.
[0245] Second group: co-transfect plasmid pKG-U6gRNA (NF1-E40-gRNA2), plasmid pKG-GE3 into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (NF1-E40-gRNA2): 1.08 μg plasmid pKG-GE3.
[0246] Third group: co-transfect plasmid pKG-U6gRNA (NF1-E40-gRNA3), plasmid pKG-GE3 into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (NF1-E40-gRNA3): 1.08 μg plasmid pKG-GE3.
[0247] Group 4: Plasmid pKG-U6gRNA(NF1-E40-gRNA4) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. The ratio was about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(NF1-E40-gRNA4): 1.08 μg of plasmid pKG-GE3.
[0248] Group 5: porcine primary fibroblasts, the same electroporation parameters without plasmid were used for electroporation.
[0249] Co-transfection was performed by electroporation, using the mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon TM transfection system electroporator (parameter settings: 1450V, 10ms, 3pulse).
[0250] 2. After completing step 1, use complete culture medium to culture for 12-18 hours, then replace the new complete culture medium for culture. The total culture time after electroporation is 48 hours.
[0251] 3. After completing step 2, use trypsin to digest and collect cells, lyse cells, extract genomic DNA, use primer pairs composed of NF1-E40-JDF99 and NF1-E40-JDR403 for PCR amplification, then perform 1% agarose gel electrophoresis. The target product is cut and recovered and then sent to a sequencing company for sequencing. Then the sequencing results are analyzed using the web-based Synthego ICE tool to obtain the gene editing efficiency of different targets. The gene editing efficiencies of the first to fourth groups are 84%, 75%, 7%, and 78%, respectively, and the fifth group does not occur gene editing. The results show that the editing efficiencies of NF1-E40-gRNA1 and NF1-E40-gRNA4 are higher.
[0252] Example 4, preparation of recombinant pig cells with NF1 gene site-directed mutation
[0253] Two high-efficiency gRNA target points (NF1-E40-gRNA1 and NF1-E40-gRNA4) screened in Example 3 were selected.
[0254] I. Preparation of gRNA
[0255] 1. Preparation of NF1-T7-gRNA1 transcription template and NF1-T7-gRNA4 transcription template
[0256] The NF1-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 14.
[0257] The NF1-T7-gRNA4 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 15.
[0258] 2. In vitro transcription of gRNA
[0259] The NF1-T7-gRNA1 transcription template was taken, and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) to obtain NF1-gRNA1. NF1-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 16.
[0260] The NF1-T7-gRNA4 transcription template was taken, and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) to obtain NF1-gRNA4. NF1-gRNA4 is a single-stranded RNA, as shown in SEQ ID NO: 17.
[0261] NF1-gRNA1 (SEQ ID NO: 16):
[0262] GGGUUUGGAAUACAUGACUCCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU
[0263] NF1-gRNA4 (SEQ ID NO: 17):
[0264] GGUCAUUGUUAUCAGCUUAUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU
[0265] II. Synthesis of single-stranded donor DNA containing NF1 gene mutations
[0266] The NF1 gene mutation associated with type I neurofibromatosis (the codon CGA encoding the 1970th amino acid residue R in the NF1 gene is mutated into a termination codon TGA), corresponding to the 40th exon of the porcine NF1 gene.
[0267] Synthesize single-stranded Donor DNA, which contains a synonymous mutation of the 3' end sequence of the PAM or adjacent PAM of NF1-E40-gRNA1 and NF1-E40-gRNA4 in addition to the above mutation. The single-stranded Donor DNA is named NF1-mutant-ss216.
[0268] NF1-mutant-ss216 is shown in SEQ ID NO: 18. The introduced mutation site is marked with capital letters.
[0269] NF1-mutant-ss216 (SEQ ID NO: 18):
[0270]
[0271] The DNA segment corresponding to the single-stranded Donor DNA in the wild-type porcine primary fibroblast chromosome DNA is shown in SEQ ID NO: 19.
[0272] SEQ ID NO: 19:
[0273]
[0274] III. Transfection of porcine primary fibroblasts
[0275] 1. Co-transfect the porcine primary fibroblasts with NF1-gRNA1, NF1-gRNA4, NF1-mutant-ss216 and NCN protein. The ratio is about 100,000 porcine primary fibroblasts: 1 μg NF1-gRNA1: 1 μg NF1-gRNA4: 2 μg NF1-mutant-ss216: 4 μg NCN protein. Co-transfection is performed by electroporation, using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameter settings: 1450V, 10ms, 3 pulses).
[0276] 2. After completing step 1, culture with complete culture medium for 16-18 hours, then replace with new complete culture medium for culture. The total culture time after electroporation is 48 hours.
[0277] 3、After step 2 is completed, the cells are digested with trypsin and collected, then washed with complete culture medium, then resuspended with complete culture medium, then each single clone is picked and transferred into a 96-well plate (1 cell per well, each well contains 100 μl of complete culture medium), and cultured for 2 weeks (new complete culture medium is replaced every 2-3 days).
[0278] 4、After step 3 is completed, the cells are digested with trypsin and collected (the cells obtained from each well, about 2 / 3 are inoculated into a 6-well plate containing complete culture medium, and the remaining 1 / 3 is collected in a 1.5 mL centrifuge tube).
[0279] 5、Take the 6-well plate of step 4, and culture until the cells reach 80% confluence, then digest and collect the cells with trypsin, and freeze the cells using cell freezing solution (90% complete culture medium + 10% DMSO, by volume).
[0280] 6、Take the centrifuge tube of step 4, take the cells, perform cell lysis and extract genomic DNA, then perform PCR amplification using the primer pair consisting of NF1-E40-JDF99 and NF1-E40-JDR403, and then perform electrophoresis. Pig primary fibroblasts are used as wild type control (WT).
[0281] 7、After step 6 is completed, the PCR amplification product is recovered and sequenced.
[0282] The sequencing result of pig primary fibroblasts is only one, and its genotype is wild type (also referred to as homozygous wild type). If the sequencing result of a single cell clone has two, one is consistent with the sequencing result of pig primary fibroblasts, and the other is mutated compared with the sequencing result of pig primary fibroblasts (mutation includes deletion, insertion or substitution of one or more nucleotides), the genotype of the single cell clone is heterozygous; if the sequencing result of a single cell clone is two, both are mutated compared with the sequencing result of pig primary fibroblasts (mutation includes deletion, insertion or substitution of one or more nucleotides), the genotype of the single cell clone is double allele different mutant; if the sequencing result of a single cell clone is one, and it is mutated compared with the sequencing result of pig primary fibroblasts (mutation includes deletion, insertion or substitution of one or more nucleotides), the genotype of the single cell clone is double allele same mutant; if the sequencing result of a single cell clone is one, and it is consistent with the sequencing result of pig primary fibroblasts, the genotype of the single cell clone is wild type (also referred to as homozygous wild type).
[0283] The results are shown in Table 1. The genotypes of single cell clones No. 53 and 55 are wild type. The genotypes of single cell clones No. 6, 8, 17, 20, 39, 46, and 50 are heterozygous. The genotypes of single cell clones No. 1, 4, 5, 7, 10, 13, 18, 23, 24, 25, 26, 30, 32, 33, 36, 37, 38, 40, 44, 48, and 49 are double-allele different mutant. The genotypes of single cell clones No. 2, 3, 9, 11, 12, 14, 15, 16, 19, 21, 22, 27, 28, 29, 31, 34, 35, 41, 42, 43, 45, 47, 51, 52, and 54 are double-allele same mutant. The ratio of obtaining NF1 gene editing single cell clones is 96.4%.
[0284] The single cell clone No. 46 is heterozygous mutant at the target site (i.e., one of the two homologous chromosomes is replaced by single-stranded Donor DNA, and the other is wild type). The single cell clones No. 5, 7, 24, 26, 33, 40, 44, and 48 are double-allele different mutant at the target site (i.e., one of the two homologous chromosomes is replaced by single-stranded Donor DNA, and the other is mutated). The single cell clones No. 12 and 34 are double-allele same mutant at the target site (i.e., both of the two homologous chromosomes are replaced by single-stranded Donor DNA). The ratio of obtaining single cell clones mutant at the target site (i.e., single cell clones No. 5, 7, 12, 24, 26, 33, 34, 40, 44, 46, and 48) is 20%.
[0285] An exemplary sequencing alignment result is shown in Figure 7 and Figure 8 . Figure 7 is the alignment result of forward sequencing of single cell clone No. 46 with NF1-mutant-ss216 sequence, which is heterozygous mutant at the target site. Figure 8 is the alignment result of forward sequencing of single cell clone No. 12 with NF1-mutant-ss216 sequence, which is double-allele same mutant at the target site.
[0286] Table 1 Genotype determination results of NF1 gene editing single cell clones
[0287]
[0288]
[0289]
[0290] Note: Target site mutation refers to the replacement of single-stranded Donor DNA; that is, the DNA molecule shown in SEQ ID NO: 18 replaces the DNA molecule shown in SEQ ID NO: 19 in the chromosome.
[0291] The single cell clone of the biallelic identical mutant of the target site mutation (i.e., the single cell clones numbered 12, 34 in Table 1) is the target single cell clone. The target single cell clone is used as a nuclear transfer donor cell for somatic cloning, and a cloned pig, which is a type I neurofibromatosis model pig, can be obtained.
[0292] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In short, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in this application. Some basic features can be applied within the scope of the following attached claims.
Claims
1. A method for preparing a recombinant pig cell, comprising the following steps: substituting a DNA molecule shown in SEQ ID NO: 19 in a chromosome DNA of a pig cell with a DNA molecule shown in SEQ ID NO: 18 to obtain a recombinant pig cell; The implementation of substituting the DNA molecule shown in SEQ ID NO: 19 in the chromosome DNA of the pig cell with the DNA molecule shown in SEQ ID NO: 18 is as follows: co-transfecting NF1-gRNA1, NF1-gRNA4, NF1-mutant-ss216 and NCN protein into the pig cell; the NF1-gRNA1 is sgRNA, and a target sequence binding region thereof is shown in nucleotides 3-22 of SEQ ID NO: 16; the NF1-gRNA4 is sgRNA, and a target sequence binding region thereof is shown in nucleotides 3-22 of SEQ ID NO: 17; the NF1-mutant-ss216 is a single-stranded DNA molecule shown in SEQ ID NO: 18; The NCN protein is shown in SEQ ID NO: 3; The preparation method of the NCN protein comprises the following steps: (1) introducing a plasmid pKG-GE4 into E. coli BL21 (DE3) to obtain a recombinant bacterium; (2) culturing the recombinant bacterium at 30℃ using a liquid medium, then adding IPTG and inducing culture at 25℃, and then collecting bacterial bodies; (3) crushing the collected bacterial bodies to collect a crude protein solution; (4) purifying a fusion protein with a His6 tag from the crude protein solution by affinity chromatography; (5) using enterokinase with a His6 tag to cut the fusion protein with a His6 tag, then removing the protein with a His6 tag by using Ni-NTA resin to obtain the purified NCN protein; The plasmid pKG-GE4 is shown in SEQ ID NO:
1.
2. The method of claim 1, wherein: The ratio of the pig cell, NF1-gRNA1, NF1-gRNA4, NF1-mutant-ss216 and NCN protein is 100,000 pig cells: 0.8-1.2 μg NF1-gRNA1: 0.8-1.2 μg NF1-gRNA4: 1.8-2.2 μg NF1-mutant-ss216: 3-5 μg NCN protein. 3.A kit comprising NF1-gRNA1, NF1-gRNA4, NF1-mutant-ss216 and NCN protein; The NF1-gRNA1 is the NF1-gRNA1 as claimed in claim 1; The NF1-gRNA4 is the NF1-gRNA4 as claimed in claim 1; the NF1-mutant-ss216 is the NF1-mutant-ss216 as claimed in claim 1; and the NCN protein is the NCN protein as claimed in claim 1. The use of the kit is as follows (a) or (b) or (c): (a) preparing a recombinant pig cell; (b) preparing a neurofibromatosis model pig; (c) preparing a neurofibromatosis cell model or a neurofibromatosis tissue model or a neurofibromatosis organ model.
4. The use of NF1-gRNA1, NF1-gRNA4, NF1-mutant-ss216 and NCN protein in the preparation of a kit; The NF1-gRNA1 is the NF1-gRNA1 as claimed in claim 1; The NF1-gRNA4 is the NF1-gRNA4 as claimed in claim 1; The NF1-mutant-ss216 is the NF1-mutant-ss216 as claimed in claim 1; The NCN protein is the NCN protein as claimed in claim 1; The use of the kit is as follows (a) or (b) or (c): (a) preparing a recombinant pig cell; (b) preparing a neurofibromatosis model pig; (c) preparing a neurofibromatosis cell model or a neurofibromatosis tissue model or a neurofibromatosis organ model.
Citation Information
Patent Citations
CRISPR / Cas9 system and application thereof in construction of swine-derived recombinant cells with insulin receptor substrate gene defects
CN112522255A
Heterozygous modifications of tumor suppressor genes and swine model of neurofibromatosis type 1
CN107105634A
Application of gRNA target combinations in construction of hemophilia model pig cell line
CN112442515A