System for in-vitro preparation of circular RNA based on group i intron ribozyme, and use thereof

Abstract

A system for in-vitro preparation of a circular RNA based on a group I intron ribozyme, and a use thereof, relating to the technical fields of nucleic acids and biological medicines. The system can significantly improve the RNA cyclization efficiency. The ribozyme in the system can be recycled and can be repeatedly used for multiple times, thereby reducing the production cost. In addition, the linear ribozyme in the system is replaced with the circular ribozyme, thereby further improving the stability and the repeated use efficiency of the ribozyme.

Description

A system for preparing circular RNA in vitro based on group I intron ribozymes and its application

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to the following application documents: invention patent application number 202410221889X, filed on February 28, 2024, entitled “A system for preparing circular RNA in vitro based on type I intron ribozymes and its application”, and invention patent application number 2024107015868, filed on May 31, 2024, entitled “A circular ribozyme system and its application”, the contents of which are incorporated by reference in their entirety. Technical Field

[0003] The present invention belongs to the fields of nucleic acid technology and biomedicine technology. Specifically, the present invention relates to a system for preparing circular RNA in vitro based on group I intron ribozymes and its application. Background Art

[0004] Circular RNA is a single-stranded RNA molecule formed primarily during mRNA splicing within cells through a reverse splicing mechanism. It lacks a 5' cap and a 3' poly(A) tail. Compared to linear RNA, circular structures possess remarkable stability and are less susceptible to nuclease degradation. Recent studies have demonstrated that circular RNA has the ability to adsorb miRNAs and proteins, as well as to promote protein translation and biomarker functions. Due to the widespread use of mRNA vaccines in humans, circular RNA, with its unique advantages, has become a key technology platform in the field of RNA vaccine research and development. In particular, the successful application of circular RNA vaccines in research addressing the novel coronavirus offers potential for their use in vaccine development.

[0005] Currently, several methods are available for in vitro synthesis of circular RNA, including chemical catalysis, enzymatic catalysis, and ribozyme technology. Chemical catalysis suffers from low ligation efficiency and the introduction of impurities during the reaction, posing potential safety risks. Enzymatic catalysis primarily utilizes T4 DNA ligase, T4 RNA ligase 1, and T4 RNA ligase 2 to achieve RNA circularization with or without a splint. However, this method suffers from low efficiency, difficulty in ligating large RNA molecules, and serious intermolecular ligation issues. Ribozyme technology primarily relies on the per muted intron-exon (PIE) method to design and synthesize linear RNA molecules, followed by an autocatalytic mechanism to achieve RNA circularization. Due to its efficient circularization ability, simple reaction conditions, and purification process, ribozyme technology has become the mainstream method for in vitro synthesis of circular RNA.

[0006] In the process of ribozyme preparation of circular RNA, improving circularization efficiency and reducing production costs are crucial for promoting downstream applications. Currently, group I introns are one of the important ribozymes for in vitro synthesis of circular RNA, the most commonly used of which include the T4 bacteriophage td gene intron and the Anabaena tRNA gene intron. Although some optimization methods have been developed, some of these methods may introduce a large amount of exogenous sequences and lead to complementary pairing of the internal sequences of the resulting circular RNA, which may cause the circular RNA to trigger unnecessary immune responses in downstream in vivo applications, posing potential safety risks. Other methods achieve circularization by hiding splice sites within the sequence to avoid the introduction of unnecessary exogenous sequences. However, this usually requires personalized design based on different RNA sequences and lacks versatility. Summary of the Invention

[0007] To overcome the technical problems of the prior art, the present invention has developed a novel, universal RNA cyclization system, named SIE (Seperated Intron-Exon). This system exhibits high cyclization efficiency and can be used to catalyze RNAs of varying lengths. The ribozyme (component 1, the first nucleic acid component) in this SIE system is recyclable and reusable multiple times, helping to reduce production costs. Furthermore, the system does not introduce redundant complementary pairing sequences, minimizing potential immunogenicity.

[0008] The SIE system primarily comprises two linear RNA components. Component 1 (the first nucleic acid component) primarily functions as a ribozyme to catalyze the cyclization of the substrate RNA (the second nucleic acid component). The ribozyme in component 1 of the SIE system can be recovered and reused, but this recovery requires multiple steps, which can easily lead to content loss and reduced subsequent utilization. To address this issue, the present invention replaces the linear ribozyme in the SIE system developed by the present invention, as described above, with a circular ribozyme, improving the stability and reusability of the ribozyme.

[0009] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions:

[0010] The first aspect of the present invention provides a nucleic acid composition for generating a circular sequence to be cyclized, the nucleic acid composition comprising a first nucleic acid component and a second nucleic acid component;

[0011] The first nucleic acid component is an RNA having the following structure or a nucleic acid that produces the RNA: first matching sequence-ribozyme sequence-second matching sequence;

[0012] The second nucleic acid component is an RNA or a nucleic acid that produces the RNA having the following structure: third matching sequence-5' end structure-sequence to be cyclized-3' end structure-fourth matching sequence;

[0013] The first matching sequence and at least 75%, 80%, 85%, 90% or 95% of the fourth matching sequence are reverse complementary sequences;

[0014] The second matching sequence and at least 75%, 80%, 85%, 90% or 95% of the third matching sequence are reverse complementary sequences;

[0015] Optionally, the ribozyme sequence has the sequence shown in SEQ ID NO. 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31 or 34;

[0016] Optionally, the 5' end structure has a sequence shown in SEQ ID NO. 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32 or 35;

[0017] Optionally, the 3' end structure has a sequence shown in SEQ ID NO. 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33 or 36.

[0018] Furthermore, the first matching sequence and the fourth matching sequence are reverse complementary sequences to each other;

[0019] Optionally, the second matching sequence and the third matching sequence are reverse complementary sequences of each other; optionally, the first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence are each independently at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more nt in length;

[0020] Optionally, the first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nt in length;

[0021] Optionally, the length of the first matching sequence, the second matching sequence, the third matching sequence or the fourth matching sequence is at least 5 nt;

[0022] Optionally, the length of the first matching sequence, the second matching sequence, the third matching sequence or the fourth matching sequence is 5-50 nt.

[0023] Further, the molar ratio of the first nucleic acid component to the second nucleic acid component is 0.01-100, 0.1-10 or 0.5-2;

[0024] Optionally, the first nucleic acid component is used in an amount greater than the second nucleic acid component.

[0025] Furthermore, the ribozyme is a linear ribozyme or a circular ribozyme;

[0026] Optionally, the first matching sequence is shown as SEQ ID NO.39 and / or SEQ ID NO.50;

[0027] Optionally, the ribozyme sequence is a ribozyme sequence derived from T4 phage and / or a ribozyme sequence derived from Anabaena;

[0028] Optionally, the ribozyme sequence is shown as SEQ ID NO.1 and / or SEQ ID NO.22;

[0029] Optionally, the second matching sequence is shown as SEQ ID NO.40 and / or SEQ ID NO.51;

[0030] Optionally, the third matching sequence is shown as SEQ ID NO.41 and / or SEQ ID NO.52;

[0031] Optionally, the 5' end structural sequence is shown as SEQ ID NO.2 and / or SEQ ID NO.23;

[0032] Optionally, the 3' end structural sequence is shown as SEQ ID NO.3 and / or SEQ ID NO.24;

[0033] Optionally, the fourth matching sequence is shown as SEQ ID NO.47 or SEQ ID NO.53.

[0034] Furthermore, the first nucleic acid component is composed of a first matching sequence (SEQ ID NO.39), a ribozyme (component 1, a first nucleic acid structure) (SEQ ID NO.1), and a second matching sequence (SEQ ID NO.40) connected in sequence, and the second nucleic acid component is composed of a third matching sequence (SEQ ID NO.41), a component 2-5' end (SEQ ID NO.2), a sequence to be cyclized, a component 2-3' end (SEQ ID NO.3), and a fourth matching sequence (SEQ ID NO.47) connected in sequence.

[0035] Furthermore, the first nucleic acid component is composed of a first matching sequence (SEQ ID NO.50), a ribozyme (component 1, a first nucleic acid structure) (SEQ ID NO.22), and a second matching sequence (SEQ ID NO.51) connected in sequence, and the second nucleic acid component is composed of a third matching sequence (SEQ ID NO.52), a component 2-5' end (SEQ ID NO.23), a sequence to be cyclized, a component 2-3' end (SEQ ID NO.24), and a fourth matching sequence (SEQ ID NO.53) connected in sequence.

[0036] Furthermore, the sequence of the first nucleic acid component is shown as SEQ ID NO.37, and the sequence of the second nucleic acid component is shown as SEQ ID NO.38.

[0037] Furthermore, the sequence of the first nucleic acid component is shown as SEQ ID NO.48, and the sequence of the second nucleic acid component is shown as SEQ ID NO.49.

[0038] In some embodiments, the first nucleic acid component and the second nucleic acid component can be mixed in any proportion; for example, the molar ratio of the first nucleic acid component to the second nucleic acid component is 0.01-100 (including 1-100), 0.1-10 (including 1-10), 0.5-2, more specifically, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2; most preferably, the amount of the first nucleic acid component used is greater than that of the second nucleic acid component.

[0039] In some embodiments, the nucleic acid of the present invention includes DNA and RNA; the nucleic acid can be single-stranded or double-stranded; and the nucleic acid (including the circular RNA prepared by the present invention) can contain modified nucleotide bases.

[0040] In some embodiments, the modifications include phosphate backbone modifications, base modifications, and ribose modifications.

[0041] In some embodiments, the phosphate backbone modification can be a thio modification, which refers to the replacement of the non-bridging oxygen atom in the phosphodiester bond in the nucleotide fragment by a sulfur atom; the modification of the phosphate backbone can also be achieved by forming other types of phosphate bonds, which include but are not limited to methyl phosphate, selenophosphate, methylborylphosphate and dithiophosphate.

[0042] In some embodiments, the ribose modification can be a modification of the 2' position of the pentose. The 2' position modification of the pentose includes but is not limited to methoxy, methoxyethoxy, propyleneoxy and fluoro modifications.

[0043] In some embodiments, the base modification mainly refers to the inclusion of rare bases in single-stranded deoxynucleotides, and rare bases refer to some bases other than A, G, C, U, and T, including dihydrouracil (DHU), pseudouracil, and methylated purine (mG, mA).

[0044] In some embodiments, the nucleic acid can be linear or circular. Specifically, the ribozyme and substrate RNA fragments are separated in the nucleic acid composition, which is applicable to all RNA cyclization methods based on intronic ribozymes (including but not limited to type I and II intronic ribozymes).

[0045] The second aspect of the present invention provides a vector or vector composition for preparing circular RNA, wherein the vector or vector composition carries the nucleic acid composition described in the first aspect of the present invention;

[0046] Optionally, the first nucleic acid component and the second nucleic acid component are located on different vectors, or the first nucleic acid component and the second nucleic acid component are located on the same vector;

[0047] Optionally, the first nucleic acid component in the nucleic acid composition of the first aspect of the present invention is connected to a first promoter, and the second nucleic acid component in the nucleic acid composition of the first aspect of the present invention is connected to a second promoter, and the first promoter and the second promoter are the same or different;

[0048] Optionally, the first promoter is selected from T7, Sp6, T3, T7lac, araBAD, trp, lac, Ptac, pL, CMV, EF1a, SV40, PGK1, Ubc, human beta actin, CAG, TRE, UAS, Ac5, Polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, CaMV35S, Ubi, H1 or U6 promoter;

[0049] Optionally, the second promoter is selected from T7, Sp6, T3, T7lac, araBAD, trp, lac, Ptac, pL, CMV, EF1a, SV40, PGK1, Ubc, human beta actin, CAG, TRE, UAS, Ac5, Polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, CaMV35S, Ubi, H1 or U6 promoter;

[0050] Optionally, the first promoter is a T7 promoter;

[0051] Optionally, the second promoter is a T7 promoter.

[0052] In some embodiments, the first promoter and the second promoter, each independently, are promoters routinely used in vitro.

[0053] In some embodiments, the first promoter and the second promoter, each independently, are T7 promoters.

[0054] The third aspect of the present invention provides a cell, wherein the cell contains the nucleic acid composition of the first aspect of the present invention or the vector or vector composition of the second aspect of the present invention.

[0055] In some embodiments, the cells include prokaryotic and eukaryotic cells.

[0056] In some embodiments, the prokaryotic cells include various bacterial cells, including Escherichia coli (E. coli).

[0057] In some embodiments, the eukaryotic cells include, but are not limited to, mammalian cells, insect cells, plant cells, fungal cells, eukaryotic algal cells, nematode cells, protozoan cells, and fish cells.

[0058] In some embodiments, the cells do not include embryonic cells.

[0059] In some embodiments, the cell is an isolated cell or a commercial cell line.

[0060] A fourth aspect of the present invention provides a method for producing circular RNA, the method being selected from any one of the following:

[0061] 1) mixing the first nucleic acid component and the second nucleic acid component in the nucleic acid composition of the first aspect of the present invention, adding a buffer solution, and incubating;

[0062] 2) transcribing the vector or vector composition according to the second aspect of the present invention, or

[0063] 3) culturing the cells according to the third aspect of the present invention;

[0064] Optionally, the incubation condition is 37-60° C. for 5-60 min;

[0065] Alternatively, incubate at 55°C for 15 min;

[0066] Optionally, the buffer solution contains GTP or excess GMP; optionally, the final concentration of GTP is 2 mM;

[0067] Optionally, the buffer solution contains magnesium ions; Optionally, the buffer solution contains 10 mM MgCl2;

[0068] Optionally, the buffer solution consists of 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.5;

[0069] Optionally, the method further comprises the step of purifying the product to improve its purity.

[0070] In some embodiments, the circularized RNA may or may not have actual function.

[0071] Preferably, the method is performed in vitro.

[0072] Preferably, the method is of therapeutic or non-therapeutic purpose.

[0073] The fifth aspect of the present invention provides circular RNA prepared by the method described in the fourth aspect of the present invention.

[0074] A sixth aspect of the present invention provides a composition comprising one or more of the following:

[0075] 1) the nucleic acid composition according to the first aspect of the present invention,

[0076] 2) the carrier or carrier composition described in the second aspect of the present invention,

[0077] 3) The cell according to the third aspect of the present invention,

[0078] 4) The circular RNA described in the fifth aspect of the present invention.

[0079] Furthermore, the composition also includes an agent that promotes gene transfection;

[0080] Optionally, the reagent is selected from lipids and liposomes (DOTMA, DOGS, DOPE, etc.), calcium phosphate, polyethylene glycol (PEG), cationic polymers (such as polyethyleneimine (PEI), DEAE-dextran, nanoparticles, or lipo series commercial transfection reagents.

[0081] In some embodiments, the composition is a pharmaceutical composition, which further contains a pharmaceutically acceptable carrier.

[0082] The pharmaceutically acceptable carrier described herein should be compatible with the aforementioned sequence combination, nucleic acid sequence, vector, and host cell of the present invention, ie, be able to be mixed therewith without significantly reducing the effect of the pharmaceutical composition under normal circumstances.

[0083] In some embodiments, the pharmaceutical composition can be formulated for various modes of parenteral or non-parenteral administration. It can be provided, for example, as a sterile liquid preparation, such as an isotonic aqueous solution, emulsion, suspension, dispersion or viscous composition, which can be buffered to a desired pH.

[0084] A seventh aspect of the present invention provides the use of any one or more of the following in preparing circular RNA or increasing the content or expression of target RNA in cells:

[0085] 1) the nucleic acid composition according to the first aspect of the present invention,

[0086] 2) the carrier or carrier composition described in the second aspect of the present invention,

[0087] 3) The cell according to the third aspect of the present invention.

[0088] Specifically, a circular sequence to be cyclized is prepared.

[0089] An eighth aspect of the present invention provides an RNA composition for preparing circular RNA, the RNA composition comprising a first RNA component and a second RNA component;

[0090] The structure of the first RNA component includes a first matching sequence-enzyme region-third matching sequence-loop region;

[0091] The structure of the second RNA component includes the fourth matching sequence-5' corresponding sequence-sequence to be cyclized or enzyme cleavage site-3' corresponding sequence-second matching sequence;

[0092] Optionally, the first RNA component is a circular RNA;

[0093] Optionally, the enzyme region is an RNA encoded by a DNA having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the sequence shown in SEQ ID NO. 56;

[0094] Optionally, the enzyme region is RNA encoded by the DNA shown in SEQ ID NO.56;

[0095] Optionally, the 5' corresponding sequence is an RNA encoded by a DNA having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the sequence shown in SEQ ID NO. 57;

[0096] Optionally, the 5' corresponding sequence is the RNA encoded by the DNA shown in SEQ ID NO.57;

[0097] Optionally, the 3' corresponding sequence is an RNA encoded by a DNA having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the sequence shown in SEQ ID NO. 58;

[0098] Optionally, the 3' corresponding sequence is the RNA encoded by the DNA shown in SEQ ID NO.58;

[0099] Optionally, the loop region is an RNA encoded by a DNA having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence shown in SEQ ID NO. 59;

[0100] Optionally, the sequence of the enzyme region is RNA encoded by SEQ ID NO. 68, 71, 74, 77, 80, 83, 86, 89, 92, 95, 98 and / or 104;

[0101] Optionally, the 5' corresponding sequence and the 3' corresponding sequence have the sequences shown in SEQ ID NOs. 69-70, 72-73, 75-76, 78-79, 81-82, 84-85, 87-88, 90-91, 93-94, 96-97, 99-100 and / or 57-58, respectively;

[0102] Optionally, the loop region is the RNA encoded by the DNA shown in SEQ ID NO.59;

[0103] Optionally, the first matching sequence and the second matching sequence are complementary sequences to each other;

[0104] Optionally, the third matching sequence and the fourth matching sequence are complementary sequences to each other;

[0105] Optionally, the complementarity includes complete complementarity or incomplete complementarity;

[0106] Optionally, the first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more nt in length;

[0107] Optionally, the length of the first matching sequence, the second matching sequence, the third matching sequence or the fourth matching sequence is at least 5 nt or more;

[0108] Optionally, the first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence are RNAs transcribed from DNAs having sequences shown in SEQ ID NOs. 62-65, respectively;

[0109] Optionally, the enzyme region is a linear ribozyme or a circular ribozyme;

[0110] Optionally, the sequence corresponding to the enzyme region is a ribozyme sequence derived from T4 phage and / or a ribozyme sequence derived from Anabaena.

[0111] In some embodiments, the first RNA component is circular, that is, the first RNA component is a circular RNA.

[0112] The 3' corresponding sequence in the second RNA component corresponds to the 5' end of the enzyme region in the first RNA component, and the 5' corresponding sequence in the second RNA component corresponds to the 3' end of the enzyme region in the first RNA component. The corresponding means that the RNA sequences can interact with each other to form a certain secondary structure.

[0113] In some embodiments, the enzyme region may also be an intron of the T4 bacteriophage td gene, specifically the RNA encoded by the DNA shown in SEQ ID NO. 68, 71, 74, 77, 80, or 83.

[0114] In some embodiments, each of SEQ ID NO. 68, 71, 74, 77, 80, and 83 contains the following sequence: TAGGACTGGTTCTA (SEQ ID NO. 101), and any other sequence of any length can be connected (inserted) between nucleotides 7 and 8 of the fragment shown in SEQ ID NO. 101.

[0115] In some embodiments, a sequence that can form a neck loop structure, such as CGGCTATTATGCGTTACCGGCGACGGAGATGTTTTCTTGGGTCTACCGTTTAATATTGCGTCATCCGTCGCAGGTAAACCATCATACCCG (SEQ ID NO.103), can be linked between nucleotides 7 and 8 of the sequence shown in SEQ ID NO.101.

[0116] In the circular ribozyme system of the present invention, when the enzyme region is RNA encoded by SEQ ID NO.68, the 5' corresponding sequence and the 3' corresponding sequence in the RNA composition are correspondingly selected from SEQ ID NOs.69-70; when the enzyme region is RNA encoded by altered SEQ ID NOs.71, 74, 77, 80, and 83, the 5' corresponding sequence and the 3' corresponding sequence in the RNA composition are correspondingly selected from SEQ ID NOs.72-73, 75-76, 78-79, 81-82, and 84-85.

[0117] In some embodiments, the enzyme region may also be the RNA encoded by the intron of the Anabaena tRNA gene, specifically the DNA shown in SEQ ID NOs. 86, 89, 92, 95, 98, and 104.

[0118] Preferably, each of SEQ ID NO. 86, 89, 92, 95, 98, and 104 contains the following sequence: GTAAGTTATGACTTAC (SEQ ID NO. 102), and any other sequence of any length may be connected (inserted) between nucleotides 8 and 9 of the fragment shown in SEQ ID NO. 102.

[0119] More preferably, a sequence capable of forming a neck loop structure, such as CGGCTATTATGCGTTACCGGCGACGGAGATGTTTTCTTGGGTCTACCGTTTAATATTGCGTCATCCGTCGCAGGTAAACCATCATACCCG (SEQ ID NO.103), can be linked between nucleotides 8 and 9 of the sequence shown in SEQ ID NO.102.

[0120] In the circular ribozyme system of the present invention, when the enzyme region is selected from the RNA encoded by the changed SEQ ID NO.86, the 5' corresponding sequence and the 3' corresponding sequence in the RNA composition are correspondingly selected from SEQ ID NOs.87-88; when the enzyme region is selected from the RNA encoded by the changed SEQ ID NOs.89, 92, 94, 98, and 104, the 5' corresponding sequence and the 3' corresponding sequence in the RNA composition are correspondingly selected from SEQ ID NOs.90-91, 93-94, 96-97, 99-100, and 57-58.

[0121] In some embodiments, the loop region can have any sequence of any length as long as it loops the first RNA component and does not affect the enzymatic activity of the enzyme region.

[0122] In some embodiments, the loop region is an RNA encoded by the DNA shown in SEQ ID NO.59; or an RNA encoded by a DNA having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence shown in SEQ ID NO.59.

[0123] In some embodiments, the first RNA component and the second RNA component in the RNA composition can be mixed in any ratio.

[0124] In some embodiments, the first RNA component in the nucleic acid composition is 0.5 times or more of the second RNA component, for example, the molar ratio of the first RNA component to the second RNA component is 0.5, 1, 2, 3 or more.

[0125] In the application, the first RNA component is circular, and there are different description methods when describing the structure based on nucleotides at different positions in the circular RNA. The "first matching sequence-enzyme region-third matching sequence-loop region" is based on the first nucleotide of the first matching sequence as the first nucleotide, and the composition of the first component RNA is recorded in sequence from the 5' end to the 3' end. After the loop is formed, the 3' end of the loop region is connected to the 5' end of the first matching sequence to form a loop. As long as the tails of any RNA are connected and the same as the circular RNA formed by the aforementioned "the structure of the first RNA component includes the first matching sequence-enzyme region-third matching sequence-loop region", the linear sequence or the looped structure of the RNA is within the scope of protection of the present invention.

[0126] In a specific embodiment of the present invention, to prepare the first RNA component into a circular form, the DNA shown in SEQ ID NO. 56 is broken between nucleotides 157-158, and DNA is designed and prepared using nucleotide 160 of the DNA shown in SEQ ID NO. 56 as the starting point. More specifically, the sequence shown in SEQ ID NO. 66 is composed from the 5' end to the 3' end of: nucleotides 160-298 of the DNA shown in SEQ ID NO. 56, SEQ ID NO. 64 (third matching sequence), SEQ ID NO. 59 (loop region), SEQ ID NO. 62 (first matching sequence), and nucleotides 1-159 of the DNA shown in SEQ ID NO. 56. The circular RNA obtained by transcribing and circularizing the DNA molecule having the DNA sequence shown in SEQ ID NO. 62 is the first RNA component of the present invention. The DNA sequence shown in SEQ ID NO. 62 and the circular RNA prepared in particular are within the scope of protection of the present invention.

[0127] The ninth aspect of the present invention provides a DNA molecule or a DNA molecule composition, wherein the DNA molecule or the DNA molecule composition comprises a first DNA component and a second DNA component;

[0128] The structure of the first DNA component includes a first matching sequence-enzyme region-third matching sequence-loop region;

[0129] The structure of the second DNA component includes the fourth matching sequence-5' corresponding sequence-sequence to be cyclized or restriction enzyme cutting site-3' corresponding sequence-second matching sequence;

[0130] The 3' corresponding sequence in the second DNA component corresponds to the 5' end of the enzyme region in the first DNA component, and the 5' corresponding sequence in the second DNA component corresponds to the 3' end of the enzyme region in the first DNA component;

[0131] Optionally, the sequence of the enzyme region is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence shown in SEQ ID NO. 56;

[0132] Optionally, the sequence of the enzyme region is shown in SEQ ID NO.56;

[0133] Optionally, the sequences of the 5' corresponding sequence and the 3' corresponding sequence are at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequences shown in SEQ ID NO. 57-58;

[0134] Optionally, the sequences of the 5' corresponding sequence and the 3' corresponding sequence are shown as SEQ ID NO.57-58;

[0135] Alternatively, the sequence of the enzyme region is an altered SEQ ID NO. 68, 71, 74, 77, 80 and / or 83, or the sequence of the enzyme region is an altered SEQ ID NO. 86, 89, 92, 95 and / or 98;

[0136] Optionally, the 5' corresponding sequence and the 3' corresponding sequence have the sequences shown in SEQ ID NO. 69-70, 72-73, 75-76, 78-79, 81-82, 84-85, 87-88, 90-91, 93-94, 96-97 and / or 99-100, respectively.

[0137] The tenth aspect of the present invention provides a vector or a vector composition, wherein the vector or vector composition contains a DNA molecule or a DNA molecule composition encoding the RNA composition of the eighth aspect of the present invention;

[0138] Optionally, the vector is an expression vector.

[0139] The eleventh aspect of the present invention provides a method for stably and efficiently producing circular RNA, the method comprising mixing the first RNA component and the second RNA component in the RNA composition of the eighth aspect of the present invention and incubating the mixture in a circularization buffer;

[0140] Alternatively, the method comprises transcribing the DNA molecule or DNA molecule composition described in the ninth aspect of the present invention into an RNA product, and incubating the RNA product in a circularization buffer;

[0141] Optionally, the RNA product of the first DNA in the RNA product is prepared as a circular RNA;

[0142] Optionally, the molar ratio of the first RNA component to the second RNA component is 0.5, 1, 2, 3 or higher;

[0143] Optionally, the molar ratio of the first RNA component to the second RNA component is 2.

[0144] Furthermore, the incubation is carried out at a temperature of 37-60°C;

[0145] Optionally, the incubation is performed at 55°C;

[0146] Optionally, the incubation period is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 minutes or more;

[0147] Optionally, the incubation time is 15 minutes;

[0148] Optionally, the buffer solution contains GTP or excess GMP;

[0149] Optionally, the concentration of GTP in the buffer solution is 2 mM;

[0150] Optionally, the buffer solution contains magnesium ions;

[0151] Optionally, the buffer solution contains MgCl2;

[0152] Optionally, the buffer solution contains 10 mM MgCl2;

[0153] Optionally, the pH value of the buffer is 7-8, preferably 7.5;

[0154] Optionally, the buffer solution consists of 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.5.

[0155] Optionally, the method is performed in vitro.

[0156] Optionally, the method is therapeutic or non-therapeutic.

[0157] The twelfth aspect of the present invention provides a circular RNA or a composition comprising the circular RNA, wherein the circular RNA is prepared by the method described in the eleventh aspect of the present invention;

[0158] Optionally, the composition further contains a pharmaceutically acceptable carrier and / or an agent that promotes gene conversion;

[0159] Optionally, the pharmaceutically acceptable carrier is selected from any one or a combination of at least two of a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an emulsifier, a solubilizer, a solubilizing agent, an osmotic pressure regulator, a surfactant, a coating material, a colorant, a pH regulator, an antioxidant, an antibacterial agent or a buffer;

[0160] Optionally, the reagent promoting gene conversion is selected from any one or a combination of at least two of lipids and liposomes, calcium phosphate, polyethylene glycol, cationic polymers, DEAE-dextran, nanoparticles, or lipo series commercial transfection reagents.

[0161] In some embodiments, the circular RNA prepared by the method retains (remains) a portion of the 5' corresponding sequence and the 3' corresponding sequence in the second component.

[0162] In some embodiments, the remaining sequence is as shown in SEQ ID NO. 60-61, and the remaining sequence is connected at the ends so that the product is circular, that is, the product is a circular RNA, and the circular RNA contains the sequence of the target RNA.

[0163] The thirteenth aspect of the present invention provides a cell, wherein the cell contains or expresses one or more of the RNA composition of the eighth aspect of the present invention, the DNA molecule or DNA molecule composition of the ninth aspect of the present invention, the vector or vector composition of the tenth aspect of the present invention, the circular RNA of the twelfth aspect of the present invention, or a composition comprising the circular RNA.

[0164] Optionally, the cells include prokaryotic cells and eukaryotic cells;

[0165] Optionally, the eukaryotic cells include lower eukaryotic cells and higher eukaryotic cells;

[0166] Optionally, the lower eukaryotic cell comprises a yeast cell;

[0167] Optionally, the higher eukaryotic cells include mammalian cells;

[0168] Optionally, the mammal is a human;

[0169] Optionally, the human cells include human immune cells;

[0170] Optionally, the immune cells include T cells, B cells, and NK cells.

[0171] The fourteenth aspect of the present invention provides a method for expressing a target gene or target RNA in a cell, the method comprising the step of introducing the circular RNA or a composition comprising the circular RNA according to the twelfth aspect of the present invention into the cell;

[0172] Optionally, the method of transferring the protein into cells is selected from electroporation, calcium phosphate precipitation, calcium chloride precipitation, microinjection, polyethylene glycol method, DEAE-dextran method, cationic liposome method and lithium acetate-DMSO method.

[0173] The fifteenth aspect of the present invention provides use of any one of the RNA composition described in the eighth aspect of the present invention, the DNA molecule or DNA molecule composition described in the ninth aspect of the present invention, the vector or vector composition described in the tenth aspect of the present invention, the circular RNA or composition comprising the circular RNA described in the twelfth aspect of the present invention, and the cell described in the thirteenth aspect of the present invention in preparing circular RNA or increasing the content or expression of target RNA in cells;

[0174] Optionally, the circular RNA contains a target RNA;

[0175] Optionally, the target RNA is selected from an antigen, an antibody, an antigen-binding fragment, a chimeric antigen receptor, a fluorescent protein, a protein with disease therapeutic activity and / or a protein with gene editing activity.

[0176] In some embodiments, the application is to increase the target RNA content or expression in ex vivo cells, or to prepare an application for increasing the target RNA content or expression in cells, such as in the preparation of protein-containing products (protein vaccines) or RNA-containing products (such as RNA vaccines).

[0177] The sixteenth aspect of the present invention provides use of the circular RNA or a composition comprising the circular RNA according to the twelfth aspect of the present invention, and the cell according to the thirteenth aspect of the present invention in stably and highly expressing a target RNA;

[0178] Optionally, use in the preparation of products that stably and highly express target RNA;

[0179] Optionally, the target RNA is selected from an antigen, an antibody, an antigen-binding fragment, a chimeric antigen receptor, a fluorescent protein, a protein with disease therapeutic activity and / or a protein with gene editing activity;

[0180] Optionally, the product includes a vaccine, specifically an RNA vaccine.

[0181] In addition, the present invention also provides a method for expressing a target gene or target RNA in a cell, wherein the method includes the step of transferring the circular RNA prepared by the present invention into the cell.

[0182] In addition, the present invention also provides a method for preventing or treating a disease, wherein the method comprises administering to a subject an effective amount of the circular RNA prepared by the present invention or a composition comprising the circular RNA.

[0183] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0184] (1) The present invention greatly increases the flexibility of the system by separating the ribozyme and the reaction sequence. In the past, when using type I ribozymes, the ribozyme and the reaction fragment were both present on the same RNA chain, which made it quite challenging to efficiently circularize the RNA fragment with the ribozyme. However, in our system, we can add a large number of ribozymes to promote the reaction, thereby significantly increasing the possibility of RNA circularization;

[0185] In the common exon-intron rearrangement (PIE) system, the two domains of the PIE are spatially distant from each other during the circularization of long RNA fragments, making it difficult to form a complete active center. In contrast, the ribozyme in our system exists as an independent unit, making it easier to form a complete reaction center. Furthermore, our ribozyme can be used in excess, significantly promoting the possibility of long RNA circularization.

[0186] (2) The traditional PIE method requires internal complementary pairing sequences to assist in circularization, which results in a double-stranded RNA structure that increases potential immunogenicity. However, our innovative circularization scheme does not introduce complementary pairing sequences into the circular RNA, thus reducing potential immunogenicity issues.

[0187] (3) The cyclization reactants and products involved in the present invention are relatively clear and single, which facilitates the purification of the circular RNA product in the later stage;

[0188] (4) The ribozyme in this system can be recovered and reused multiple times, which helps to reduce production costs and reuse;

[0189] (5) Based on the universal RNA cyclization system provided by the present invention as described above, the present invention replaces the linear ribozyme in the system with a circular ribozyme, further improving the stability and repeated use efficiency of the ribozyme, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0190] Figure 1 is a schematic diagram of a two-component SIE system;

[0191] Figure 2 is a diagram showing the working principle of the SIE system;

[0192] FIG3 is a diagram showing the results of SIE system cyclization efficiency testing;

[0193] FIG4 is a diagram showing the results of HPLC separation of the cyclized products of the SIE system;

[0194] FIG5 is a diagram showing the results of DNA sequencing to verify circular RNA splicing sites;

[0195] FIG6 is a graph showing the expression results of circular RNA prepared by the SIE system;

[0196] Figure 7 is the result of synthesizing circRNA based on the SIE system designed by Ana-P1+P9.1, where A: RGel electrophoresis analysis of RNA circularization mediated by SIE; BC: HPLC analysis of splicing products (B) obtained using the SIE system and circRNAs collected according to retention time (C), the collection time of circular RNA is shown in the dotted line in Figure B; D: Sequencing analysis to verify the connection site of circRNA and show representative sequencing results, ss: splicing site; EF: Fluorescence analysis (H) and flow cytometry (I) were used to evaluate the expression level of circRNA synthesized by the SIE system; Ana R : Ribozyme based on Ana-P1+P9.1; S EGFP : Substrate containing GOI encoding EGFP.

[0197] Figure 8 shows the results of optimizing the reaction parameters of the SIE system to achieve efficient circRNA synthesis, where A: Evaluation of the changes in the ribozyme to substrate ratio (AB), reaction time (CD), and Mg in the SIE system. 2+ Effects of concentration (EF), reaction temperature (GH) and RS length (IJ) on circRNA synthesis; Effects of SIE system on ribozyme to substrate ratio (A), reaction time (C), Mg 2+ The splicing products generated under different concentrations (E), reaction temperatures (G) and RS lengths (I) were analyzed by gel electrophoresis. RT-qPCR was used to analyze the SIE system under different ribozyme to substrate ratios (B), reaction times (D), Mg 2+ Relative cyclization efficiency under different concentrations (F), reaction temperatures (H), and RS lengths (J).

[0198] Figure 9 is a schematic diagram of a two-component circular ribozyme system;

[0199] FIG10 is an electrophoresis diagram of circular RNA products prepared by the circular ribozyme system;

[0200] FIG11 is a graph showing the HPLC results of the cyclized product of the circular ribozyme system before purification;

[0201] FIG12 is a graph showing the HPLC results of the purified cyclized product;

[0202] FIG13 is a diagram showing the results of DNA sequencing to verify circular RNA splicing sites;

[0203] FIG14 is a diagram showing the expression results of the cyclized product in cells. DETAILED DESCRIPTION

[0204] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs. In order to facilitate understanding of the present invention, the following terms involved in the present invention are explained here:

[0205] As used herein, the terms “include” or “comprising” mean including any one or more of the stated elements or components but not excluding other elements or components.

[0206] As used herein, the term "sequence to be cyclized (GOI)" can be linear or circular, and may contain one or more of IRES, target RNA (target gene) or other elements (such as elements that promote gene expression, spacer, 5'UTR, 3'UTR). The "target RNA" includes any naturally occurring sequence or artificially synthesized sequence, such as any viral antigen, chimeric antigen receptor (CAR) or T cell receptor (TCR), etc. The technical solution to be solved by the present invention is to obtain a circular "sequence to be cyclized" more efficiently, so that the target RNA (target gene) is stably and continuously highly expressed. The term "restriction enzyme cutting site" refers to a specific sequence of bases on DNA, and a restriction endonuclease can recognize this sequence and cut the DNA sequence into two segments here. The restriction enzyme cutting site in the present invention includes a specific sequence recognized by a restriction endonuclease, and also includes a sequence that can be excised after being recognized by two restriction endonucleases.

[0207] In some embodiments, the IRES sequence of the present invention includes an IRES sequence from any source, and the IRES sequence may include but is not limited to an IRES sequence from Taura syndrome virus, blood-sucking assassin bug virus, Theile's encephalomyelitis virus, simian virus type 40, fire ant virus type 1, cereal aphid virus, reticuloendotheliosis virus, Forman poliovirus type 1, soybean looper virus, Kashmir bee virus, human rhinovirus type 2, human immunodeficiency virus type 1, glass leafhopper virus type 1, lice P virus, hepatitis C virus, hepatitis A virus, GB hepatitis virus, foot-and-mouth disease virus, human enterovirus, equine rhinovirus, tea looper-like virus, encephalomyocarditis virus, Drosophila C virus, crucifer tobacco virus, cricket paralysis virus, bovine viral diarrhea virus type 1, Black Queen virus, Cytomegalovirus, aphid lethal paralysis virus, avian encephalomyelitis virus, acute bee paralysis virus, hibiscus yellow ringspot virus, classical swine fever virus, human FGF2, human SFTPA1, human AML1, Drosophila antennae, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAP1, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kip1, human PDGF2, human p53, human Pim-1, mouse Rbm3, Drosophila reaper, canine Scamper, Drosophila Ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP. Or IRES types disclosed in CN112399860A and US11203767B2 patent applications. Wild-type IRES sequences can also be modified or mutated and applied to the present invention.

[0208] In a specific embodiment of the present invention, the present invention is verified using the IRES of Coxsackie B3 virus (CVB3). The coding sequence of the IRES of Coxsackie B3 virus (CVB3) is shown in SEQ ID NO.43.

[0209] As used herein, the term "target RNA" is present in the "sequence to be cyclized (GOI)" and can be any naturally occurring sequence or artificially synthesized sequence. For example, the "target RNA" described in the present invention can be any antigen (such as a viral antigen, a pathogenic viral antigen), antibody (including monoclonal antibodies, polyclonal antibodies, multispecific antibodies, single-chain antibodies, complete antibodies and antibody fragments), antigen-binding fragments, chimeric antigen receptors (CARs), fluorescent proteins, proteins with disease therapeutic activity, proteins with gene editing activity, etc. RNA. Proteins with disease therapeutic activity may include, but are not limited to, enzyme replacement proteins, proteins for supplementation, protein vaccines, antigens (e.g., tumor antigens, viruses, bacteria), hormones, cytokines, antibodies, immunotherapies (e.g., cancer), cell reprogramming / transdifferentiation factors, transcription factors, chimeric antigen receptors, transposases or nucleases, immune effectors (e.g., affecting susceptibility to immune responses / signals), regulated death effector proteins (e.g., inducers of apoptosis or necrosis), non-lytic inhibitors of tumors (e.g., oncoprotein inhibitors), epigenetic modifiers, epigenetic enzymes, transcription factors, DNA or protein modifying enzymes, DNA intercalators, efflux pump inhibitors, nuclear receptor activators or inhibitors, proteasome inhibitors, competitive enzyme inhibitors, protein synthesis effectors or inhibitors, nucleases, protein fragments or domains, ligands or receptors, and CRISPR systems or components thereof, etc.

[0210] In order to further achieve sustained and stable high expression of target RNA (target gene), other elements can be connected before and after the target RNA sequence when preparing circular RNA. That is, the target RNA sequence is included in the sequence to be cyclized (GOI), and other sequences can also be included. Specifically, in a specific embodiment of the present invention, "EGFP (905-1624th position in SEQ ID NO.67)" is the target gene, and its 5' end is connected to IRES (164-904th position in SEQ ID NO.67), and the 5' end of IRES is inserted into spacer, and the 3' end of EGFP is inserted into spacer. The spacer is an intervening sequence, and its main function is to space other key functional sequences with specific functions so that they can play a role relatively independently. As long as this spacing purpose can be achieved, the specific spacer sequence composition can have certain flexibility and is not limited to the spacer of a certain specific sequence. Those skilled in the art can carry out conventional selection of the specific sequence of spacer according to actual needs.

[0211] As used herein, the term "expression" includes any step involved in producing a protein translated from a target RNA, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0212] As used herein, "complementarity" between sequences refers to the phenomenon in which the bases of the nucleotide residues in a nucleic acid molecule are hydrogen-bonded to each other in the corresponding relationships of A to T, A to U, G to T, G to U, and G to C. Complementarity can be "incomplete" or "complete." "Complete" complementarity between nucleic acid molecules means that each nucleic acid base matches another base under the base pairing rules.

[0213] As used herein, the term "element" can be used to regulate the transcription of recombinant nucleic acid molecules, to regulate the translation of circular RNA, to achieve specific expression of circular RNA in different tissues, or to purify circular RNA, etc. Specific examples include: (i) transcriptional regulatory elements, (ii) translational regulatory elements, and (iii) purification elements. Exemplarily, the elements include IRES (Internal ribosome entry site, IRES), 5'UTR sequence, 3'UTR, Kozak sequence, sequence containing m6A modification (N(6)methyladenosine modification), and complementary sequence of ribosomal 18S rRNA.

[0214] As used herein, the terms "circular" or "circularized" have the same meaning in the present invention, and any RNA exhibiting a circular structure can be referred to as a "circular RNA" or "circularized RNA."

[0215] The backbone of the vector or vector composition described in the present invention can be selected from conventional vectors according to actual conditions. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs); bacteriophages such as λ phage or M13 phage, and animal viruses.

[0216] As used herein, the term "cell" encompasses any type of cell system, including eukaryotic cells, such as mammalian cells, insect cells, and yeast cells, and prokaryotic cells, such as Escherichia coli cells. Cells include cultured cells, as well as cells within transgenic animals, transgenic plants, or cultured plant or animal tissues. Preferably, the host cell is a human cell, including a human immune cell; such immune cells include T cells, B cells, and NK cells.

[0217] The term "cell" encompasses progeny cells different from the parent cell after the RNA composition, DNA molecule or DNA molecule composition, vector or vector combination of the present invention is introduced. The cell can be prepared by "transformation, transfection, transduction".

[0218] As used herein, the terms "transformation," "transfection," and "transduction" have meanings generally understood by those skilled in the art, i.e., the process of introducing exogenous DNA into a host. The methods of transformation, transfection, and transduction include any method for introducing nucleic acid into a cell, including, but not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG), DEAE-dextran, cationic liposomes, and lithium acetate-DMSO. In a specific embodiment, the cells do not include embryonic cells. In a specific embodiment, the cells are isolated cells or commercial cell lines.

[0219] As used herein, the term "pharmaceutically acceptable carrier" includes any one or a combination of at least two of diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH regulators, antioxidants, bacteriostats or buffers.

[0220] As used herein, a "pharmaceutically acceptable carrier" should be compatible with the circular RNA, i.e., capable of being co-mingled with the circular RNA without significantly reducing the efficacy of the pharmaceutical composition under normal circumstances. Specific examples of substances that can serve as "pharmaceutically acceptable carriers" or their components include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and methylcellulose; tragacanth powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter; polyols such as propylene glycol, glycerol, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers such as wetting agents such as sodium lauryl sulfate; colorants; flavorings; tableting agents; stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline solution; and phosphate buffered saline. The composition of the present invention can be prepared into various dosage forms as needed, and a physician can determine the dosage that is beneficial to the patient based on factors such as the patient's type, age, weight, general disease condition, and administration method. The administration method can be, for example, injection or other treatment methods.

[0221] As used herein, the term "effective amount" refers to the amount or dosage of the RNA composition, DNA molecule or DNA molecule composition, vector or vector combination, circular RNA prepared by the present invention or composition comprising the circular RNA, or cell, and in particular refers to the amount or dosage of the circular RNA prepared by the present invention or composition comprising the circular RNA; which, after administration to a patient in a single or multiple doses, produces the desired effect in a patient in need of treatment or prevention. The effective amount can be readily determined by the attending physician, who is skilled in the art, by considering a variety of factors, such as the species of mammal; its size, age, and general health; the specific disease involved; the extent or severity of the disease; the response of the individual patient; the specific antibody to be administered; the mode of administration; the bioavailability characteristics of the administered formulation; the selected dosing regimen; and the use of any concomitant therapy.

[0222] As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. A vector can be introduced into a host cell via transformation, transduction, or transfection, enabling expression of the genetic material it carries in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs); bacteriophages, such as lambda phage or M13 phage, and animal viruses.

[0223] As used herein, the term "treatment" generally refers to treatment of humans or animals (e.g., as used by veterinarians) to achieve some desired therapeutic effect, such as inhibiting the progression of a condition (including reducing the rate of progression or halting progression), ameliorating a condition, and curing a condition. Treatment as a preventative measure (e.g., prophylaxis) is also included. Use in patients who have not yet developed a condition but are at risk of developing it is also included in the term "treatment."

[0224] As used herein, the term "pharmaceutical composition" may be in the form of any formulation selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, lyophilized formulations, and suppositories. Furthermore, the pharmaceutical composition may be administered once or multiple times. In this case, the pharmaceutical composition may be administered in the form of a liquid formulation, powder, aerosol, capsule, or suppository.

[0225] The routes of administration of the pharmaceutical composition include, but are not limited to, intravenous, intramuscular, subcutaneous, intradermal, intraperitoneal, oral, topical, intranasal, intrapulmonary, and rectal administration. In specific embodiments, the pharmaceutical composition provided herein can be prepared into various dosage forms according to actual needs, and a clinician can determine the dosage that is beneficial to the patient based on factors such as the type, age, weight, general condition, and administration method of the subject. Administration can be, for example, by injection or any other suitable administration method known to those skilled in the art.

[0226] The present invention will be further described below with reference to specific embodiments. The following specific embodiments are intended only to illustrate the present invention and are not to be construed as limiting the present invention. Those skilled in the art will appreciate that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the claims and their equivalents.

[0227] The experimental consumables, reagents, and raw materials used in the present invention are readily available to those of ordinary skill in the art and, unless otherwise specified, can be obtained commercially. Experimental methods for which specific conditions are not specified in the present invention are generally performed under conventional conditions or as recommended by the manufacturer. In particular, the following examples are intended only to illustrate the present invention and should not limit the scope of the present invention in any way. It should be noted that the experimental conditions and results described in the following examples are intended only to illustrate the present invention and should not, and will not, limit the present invention described in detail in the claims.

[0228] The SIE system provided by the present invention comprises two RNA components. Component 1 is a ribozyme that forms a substantially complete sequence by ring-opening the P1 / P2 and P9 / P.1 / P9.2 ribozymes. Component 2 is constructed by flanking the gene of interest (GOI) (or enzyme cleavage site) with sequences corresponding to the ends of component 1 (component 2-5' end and component 2-3' end). Furthermore, matching sequences are placed at both ends of components 1 and 2 to facilitate their proximity. A schematic diagram is shown in Figure 1.

[0229] In some embodiments, component 1 and its corresponding component 2-5' end and component 2-3' end in various SIE systems provided by the present invention are shown in Table 1.

[0230] Table 1 Sequences in the SIE system

[0231] Specifically, the above SIE systems are named after the intron source and the opening position. For example, the P1+P9.2 system represents an SIE system of a ribozyme sequence that opens at the P1 and P9.2 positions to form component 1, and the corresponding component 2 is set according to component 1; in addition, matching sequences are set at both ends of component 1 and component 2 to form a complete SIE system, which can be subsequently used to prepare circularized RNA.

[0232] More specifically, the matching sequence at the 5' end of component 1 is called the first matching sequence, the matching sequence at the 3' end of component 1 is called the second matching sequence, the matching sequence at the 5' end of component 2 is called the third matching sequence (connected to the 5' end structure), and the matching sequence at the 3' end of component 2 is called the fourth matching sequence (connected to the 3' end structure).

[0233] The first matching sequence can be paired with at least 75%, 80%, 85%, 90%, or 95% of the fourth matching sequence, and the second matching sequence can be paired with at least 75%, 80%, 85%, 90%, or 95% of the third matching sequence. Preferably, the first matching sequence is completely paired with the fourth matching sequence, and the second matching sequence is completely paired with the third matching sequence.

[0234] By adding in vitro promoters (such as the T7 promoter from Escherichia coli) to the two components of the designed SIE system, the two RNA components in the SIE system can be synthesized using an in vitro transcription kit to prepare circular RNA.

[0235] In the T4-P1+P9.2 system, IRES-EGFP (CVB3-IRES and EGFP coding sequences are linked by Kozak) is used as the GOI to prepare circular RNA. The specific steps are as follows:

[0236] Example 1 Preparation of circular RNA (based on the T4-P1+P9.2 system)

[0237] The sequences shown in SEQ ID NO. 37-38 were constructed into a vector to prepare circularized IRES-EGFP.

[0238] SEQ ID NO.37 is composed of a first matching sequence (SEQ ID NO.39), a ribozyme (component 1, first nucleic acid structure) (SEQ ID NO.1), and a second matching sequence (SEQ ID NO.40). SEQ ID NO.38 carries the coding sequences for IRES and EGFP. SEQ ID NO.38 is composed of a third matching sequence (SEQ ID NO.41), component 2-5' end (SEQ ID NO.2), Spacer 1 (SEQ ID NO.42), IRES (SEQ ID NO.43), kozak (SEQ ID NO.44, GCCACC), EGFP (SEQ ID NO.45), Spacer 2 (SEQ ID NO.46), component 2-3' end (SEQ ID NO.3), and a fourth matching sequence (SEQ ID NO.47). The vector structure and working principle are shown in Figure 2. FIG2 shows a schematic diagram of the SIE design for circular RNA synthesis provided by the present invention. The schematic diagram describes the process of using SIE to synthesize circular RNA. The ribozyme and substrate are obtained by in vitro transcription (IVT) using a T7 promoter. After the ribozyme and substrate are mixed, the ribozyme can interact with the substrate through the recognition sequence (RS). 2+ With the help of ribozymes, ribozymes can cyclize substrates through two transesterification reactions. After completing the catalytic reaction, the ribozyme can participate in the cyclization of the next substrate again. GOI: gene of interest.

[0239] Specific steps:

[0240] 1. For plasmid extraction, refer to the instructions of the Tiangen Plasmid Extraction Kit.

[0241] 2. Plasmid linearization can be performed using a single enzyme cutting site reserved in the plasmid DNA. Please refer to the instructions of Takara restriction endonuclease for instructions.

[0242] 3. Linearized plasmid purification:

[0243] 1) Add water to 500 μL of the digested product, add an equal volume of organic solvent (phenol / chloroform / isoamyl alcohol 25:24:1), mix well, and centrifuge at 12,000 rpm for 15 min at 4°C.

[0244] 2) After centrifugation, transfer the DNA from the upper aqueous phase to a fresh EP tube, aspirating approximately 400 μL. Add an equal volume of chloroform, bringing the total volume to 800 μL, and vortex to mix. Centrifuge at 12,000 rpm at 4°C for 15 minutes.

[0245] 3) Transfer 300 μL of the supernatant to a new centrifuge tube and add 30 μL of 3M sodium acetate. Then, add twice the volume (660 μL) of pre-chilled anhydrous ethanol. Mix thoroughly and allow to settle at -20°C for at least 30 min.

[0246] 4) Centrifuge at 14,000 rpm for 15 min at 4°C to collect the DNA precipitate.

[0247] 5) After removing the supernatant, slowly add 750 μL of ice-cold 70% ethanol to the EP tube. Gently shake the tube and centrifuge at 14,000 rpm for 5 minutes at 4°C to collect the DNA precipitate.

[0248] 6) Repeat step 5);

[0249] 7) Discard the supernatant, invert the tube, and air dry. Add 20 μL of RNase-free water to dissolve the solution.

[0250] 4. In vitro transcription:

[0251] 1) Prepare the following system in an EP tube using NEB's in vitro transcription kit:

[0252] 2) Gently flick to mix, then centrifuge to the bottom of the tube. Incubate the reaction mixture at 37°C in a PCR instrument for 2 hours.

[0253] 3) Add DNase I (Takara) to degrade the DNA template. Prepare the reaction system according to the table below, mix well, and place in a 37°C metal bath for 20-30 minutes.

[0254] 4) After incubation, add 2.5 μL of 0.5 M EDTA to the reaction mixture, mix thoroughly, centrifuge, and incubate in an 80°C water bath for 2 minutes to inactivate DNase I. RNA is then purified using an RNA column.

[0255] 5. Cyclization reaction:

[0256] Prepare 100 μL of the circularization system: Mix the two RNA components in equal molar proportions (total amount: 50-100 μg) and add circularization buffer (final concentration: 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.5) and GTP (final concentration: 2 mM). Make up the remaining volume with RNase-free water.

[0257] The reaction product containing circular RNA was obtained by incubating at 55°C for 15 minutes and then performing RNA column purification.

[0258] The electrophoresis analysis results showed that circular RNA was successfully obtained ( FIG. 3 ), and grayscale analysis indicated that the circularization efficiency could reach over 95%.

[0259] Example 2 Purity Analysis of Circular RNA

[0260] The cyclized product was separated and purified by high performance liquid chromatography (HPLC). Isogradient elution with 150 mM phosphate was used for separation and purification, and the separation pattern showed that the cyclized product could be effectively separated (Figure 4A).

[0261] The samples corresponding to the main peak in FIG5A were collected and analyzed for purity using HPLC. The results showed that the impurities in the cyclization reaction had been basically removed ( FIG4B ).

[0262] Example 3 Splice Site Verification

[0263] The collected circular RNA was used for reverse transcription using the All-Gold Reverse Transcription Kit. The PCR-amplified product was inserted into the pUC57-kan vector between EcoR1 and HidIII via homologous recombination. DNA sequencing confirmed that the circular RNA spliced ​​at the expected position (Figure 5).

[0264] Example 4 Circular RNA Expression Analysis

[0265] After desalting and precipitation, the resulting circular RNA was transformed into 293T cells and cultured for 12 hours before observing fluorescent protein expression. The results showed that circular RNA could efficiently express green fluorescent protein (GFP) (Figure 6).

[0266] The following examples are based on the above-mentioned Ana-P1+P9.1 system, using IRES-EGFP (CVB3-IRES and EGFP coding sequences connected by Kozak) as the GOI to prepare circular RNA. Specifically,

[0267] Example 5 Preparation of circular RNA (based on the Ana-P1+P9.1 system)

[0268] The sequences shown in SEQ ID NO. 48-49 were constructed into a vector to prepare circularized IRES-EGFP.

[0269] SEQ ID NO.48 is composed of the first matching sequence (SEQ ID NO.50), ribozyme (component 1, first nucleic acid structure) (SEQ ID NO.22), and the second matching sequence (SEQ ID NO.51). SEQ ID NO.49 carries the coding sequences of IRES and EGFP, and SEQ ID NO.49 is composed of the third matching sequence (SEQ ID NO.52), component 2-5' end (SEQ ID NO.23), Spacer 1 (SEQ ID NO.54), IRES (SEQ ID NO.43), kozak (SEQ ID NO.44, GCCACC), EGFP (SEQ ID NO.45), Spacer 2 (SEQ ID NO.55), component 2-3' end (SEQ ID NO.24), and the fourth matching sequence (SEQ ID NO.53).

[0270] The sequences shown in SEQ ID NO. 48-49 were constructed into a vector to prepare circularized IRES-EGFP.

[0271] The synthesized circular RNA was characterized and verified using the methods described above.

[0272] The results show that Figure 7A is the electrophoresis result after cyclization, Ana R Representative component 1, S EGFP Represents component 2. Figures 7B-F are the corresponding results of the characterization of the synthesized circular RNA. The above results show that the SIE system designed based on the Ana-P1+P9.1 system can successfully synthesize circular RNA. Among them, L9.1 and L1 are the same as P9.1 and P1 shown in Figure 1, both referring to the opening of the loop region. The preparation steps and working principles are the same as those described in Example 1. Enhanced L1 represents the extended matching sequence at the L1 position.

[0273] Example 6 Optimization of reaction parameters that may affect ribozymes

[0274] In this example, the reaction parameters that may affect the ribozyme were optimized, including five aspects: ratio, time, Mg 2+ , temperature, RS length (i.e. the length of the paired sequence).

[0275] The experimental results are shown in Figure 8. The above results indicate that the optimal RNA cyclization conditions for the SIE system designed based on Ana-P1+P9.1 are: a molar ratio of component 1 to component 2 of 2, a reaction time of 5 min, and Mg 2+ The concentration is 8-10 mM, the reaction temperature is 42-55°C, and the RS length is 60 bp.

[0276] Based on the above examples, to address the issues of linear ribozymes being easily degraded and having a low reuse rate, the present invention further replaces the linear ribozyme in the aforementioned SIE system with a circular ribozyme (as shown in FIG9 ) to improve the stability of the ribozyme and the efficiency of repeated use. Specifically, the following are the steps:

[0277] Example 7 Preparation of circular RNA

[0278] Step 1: Preparation of Component 1 - Circular Ribozyme

[0279] The sequence shown in SEQ ID NO.66 was constructed on a plasmid, and the DNA sequence shown in SEQ ID NO.66 was transcribed into RNA and made into a circular RNA according to the method in the article "Engineering circular RNA for potent and stable translation in eukaryotic cells".

[0280] Step 2: Preparation of component 2

[0281] 1. Construct the sequence shown in SEQ ID NO.67 on a plasmid and extract it according to the instructions of the Tiangen Plasmid Extraction Kit.

[0282] 2. Plasmid linearization can be performed using a single enzyme cutting site reserved in the plasmid DNA. Please refer to the instructions of Takara restriction endonuclease for instructions.

[0283] 3. Linearized plasmid purification:

[0284] 1) Add water to 500 μL of the digested product, add an equal volume of organic solvent (phenol / chloroform / isoamyl alcohol 25:24:1), mix well, and centrifuge at 12,000 rpm for 15 min at 4°C.

[0285] 2) After centrifugation, transfer the DNA from the upper aqueous phase to a fresh EP tube, aspirating approximately 400 μL. Add an equal volume of chloroform, bringing the total volume to 800 μL, and vortex to mix. Centrifuge at 12,000 rpm at 4°C for 15 minutes.

[0286] 3) Transfer 300 μL of the supernatant to a new centrifuge tube and add 30 μL of 3M sodium acetate. Then, add twice the volume (660 μL) of pre-chilled anhydrous ethanol. Mix thoroughly and allow to settle at -20°C for at least 30 min.

[0287] 4) Centrifuge at 14,000 rpm for 15 min at 4°C to collect the DNA precipitate.

[0288] 5) After removing the supernatant, slowly add 750 μL of ice-cold 70% ethanol to the EP tube. Gently shake the tube and centrifuge at 14,000 rpm for 5 minutes at 4°C to collect the DNA precipitate.

[0289] 6) Repeat step 5);

[0290] 7) Discard the supernatant, invert the tube, and air dry. Add 20 μL of RNase-free water to dissolve the solution.

[0291] 4. In vitro transcription:

[0292] 1) Prepare the following system in an EP tube using NEB's in vitro transcription kit:

[0293] 2) Gently flick to mix, then centrifuge to the bottom of the tube. Incubate the reaction mixture at 37°C in a PCR instrument for 2 hours.

[0294] 3) Add DNase I (Takara) to degrade the DNA template. Prepare the reaction system according to the table below, mix well, and place in a 37°C metal bath for 20-30 minutes.

[0295] 4) After incubation, add 2.5 μL of 0.5 M EDTA to the reaction mixture, mix thoroughly, centrifuge, and incubate in an 80°C water bath for 2 minutes to inactivate DNase I. RNA is then purified using an RNA column.

[0296] Step 3: Cyclization

[0297] The circular ribozyme prepared in step 1 was mixed with the RNA component obtained by in vitro transcription in step 2 at a molar ratio of 2:1. Circularization buffer (50mM Tris-HCl, 10mM MgCl2, 1mM DTT, pH 7.5) and GTP were added to a final concentration of 2mM / L. The mixture was incubated at 55°C for 15 minutes, and then purified using an RNA column to obtain a reaction product containing circular RNA. Electrophoresis analysis showed that circular RNA was successfully obtained (Figure 10).

[0298] Example 8 Purity Analysis of Circular RNA

[0299] The cyclized product was separated and purified by high performance liquid chromatography (HPLC). Isogradient elution with 150 mM phosphate was used for separation and purification, and the separation pattern showed that the cyclized product could be effectively separated (Figure 11).

[0300] The main peak sample (peak 1) corresponding to FIG11 was collected and analyzed for purity using HPLC. The results showed that the impurities in the cyclization reaction had been basically removed ( FIG12 ).

[0301] Example 9 Splice Site Verification

[0302] The collected circular RNA was used for reverse transcription using the All-Gold Reverse Transcription Kit. The PCR-amplified product was inserted into the pUC57-kan vector between EcoR1 and HidIII via homologous recombination. DNA sequencing confirmed that the circular RNA spliced ​​at the expected position (Figure 13).

[0303] According to the detection results, partial sequences of the 5' corresponding sequence and the 3' corresponding sequence in the second component are present in the circular RNA product, and the sequences are shown in FIG13 or SEQ ID NO. 60-61.

[0304] Example 10 Circular RNA Expression Analysis

[0305] The circular RNA prepared in step 3 of Example 8 was desalted, precipitated, and then transformed into 293T cells. After culturing for 12 hours, the expression of fluorescent protein was observed. The results showed that the circular RNA could efficiently express green fluorescent protein (Figure 14).

Claims

1. A nucleic acid composition for generating a circular sequence to be cyclized, the nucleic acid composition comprising a first nucleic acid component and a second nucleic acid component; The first nucleic acid component is an RNA having the following structure or a nucleic acid that produces the RNA: first matching sequence-ribozyme sequence-second matching sequence; The second nucleic acid component is an RNA or a nucleic acid that produces the RNA having the following structure: third matching sequence-5' end structure-sequence to be cyclized-3' end structure-fourth matching sequence; The first matching sequence and at least 75%, 80%, 85%, 90% or 95% of the fourth matching sequence are reverse complementary sequences; The second matching sequence and at least 75%, 80%, 85%, 90% or 95% of the third matching sequence are reverse complementary sequences; Optionally, the ribozyme sequence has the sequence shown in SEQ ID NO. 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31 or 34; Optionally, the 5' end structure has a sequence shown in SEQ ID NO. 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32 or 35; Optionally, the 3' end structure has a sequence shown in SEQ ID NO. 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33 or 36.

2. The nucleic acid composition according to claim 1, wherein the first matching sequence and the fourth matching sequence are reverse complementary sequences to each other; Optionally, the second matching sequence and the third matching sequence are reverse complementary sequences of each other; optionally, the first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence are each independently at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more nt in length; Optionally, the first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nt in length; Optionally, the length of the first matching sequence, the second matching sequence, the third matching sequence or the fourth matching sequence is at least 5 nt; Optionally, the length of the first matching sequence, the second matching sequence, the third matching sequence or the fourth matching sequence is 5-50 nt.

3. The nucleic acid composition of claim 1, wherein the molar ratio of the first nucleic acid component to the second nucleic acid component is 0.01-100, 0.1-10, or 0.5-2; Optionally, the first nucleic acid component is used in an amount greater than the second nucleic acid component.

4. The nucleic acid composition according to claim 1, wherein the ribozyme is a linear ribozyme or a circular ribozyme; Optionally, the first matching sequence is shown as SEQ ID NO.39 and / or SEQ ID NO.50 Optionally, the ribozyme sequence is a ribozyme sequence derived from T4 phage and / or a ribozyme sequence derived from Anabaena; Optionally, the ribozyme sequence is shown as SEQ ID NO.1 and / or SEQ ID NO.22; Optionally, the second matching sequence is shown as SEQ ID NO.40 and / or SEQ ID NO.51; Optionally, the third matching sequence is shown as SEQ ID NO.41 and / or SEQ ID NO.52; Optionally, the 5' end structural sequence is shown as SEQ ID NO.2 and / or SEQ ID NO.23; Optionally, the 3' end structural sequence is shown as SEQ ID NO.3 and / or SEQ ID NO.24; Optionally, the fourth matching sequence is shown as SEQ ID NO.47 or SEQ ID NO.

53.

5. The nucleic acid composition of claim 1, wherein the first nucleic acid component is composed of the first matching sequence of SEQ ID NO. 39, the ribozyme of SEQ ID NO. 1, and the second matching sequence of SEQ ID NO. 40, connected in sequence; and the second nucleic acid component is composed of the third matching sequence of SEQ ID NO. 41, the 5' end structure of SEQ ID NO. 2, the sequence to be cyclized, the 3' end structure of SEQ ID NO. 3, and the fourth matching sequence of SEQ ID NO. 47, connected in sequence; Optionally, the first nucleic acid component is composed of the first matching sequence shown in SEQ ID NO.50, the ribozyme shown in SEQ ID NO.22, and the second matching sequence shown in SEQ ID NO.51, connected in sequence; the second nucleic acid component is composed of the third matching sequence shown in SEQ ID NO.52, the 5' end structure shown in component SEQ ID NO.23, the sequence to be cyclized, the 3' end structure shown in SEQ ID NO.24, and the fourth matching sequence shown in SEQ ID NO.53, connected in sequence; Optionally, the sequence of the first nucleic acid component is shown as SEQ ID NO.37, and the sequence of the second nucleic acid component is shown as SEQ ID NO.38; Optionally, the sequence of the first nucleic acid component is shown as SEQ ID NO.48, and the sequence of the second nucleic acid component is shown as SEQ ID NO.

49.

6. A vector or vector composition for preparing circular RNA, wherein the vector or vector composition carries the nucleic acid composition according to any one of claims 1 to 5; Optionally, the first nucleic acid component and the second nucleic acid component are located on different vectors, or the first nucleic acid component and the second nucleic acid component are located on the same vector; Optionally, the first nucleic acid component in the nucleic acid composition of any one of claims 1 to 5 is connected to a first promoter, and the second nucleic acid component in the nucleic acid composition of any one of claims 1 to 5 is connected to a second promoter, and the first promoter and the second promoter are the same or different; Optionally, the first promoter is selected from T7, Sp6, T3, T7lac, araBAD, trp, lac, Ptac, pL, CMV, EF1a, SV40, PGK1, Ubc, human beta actin, CAG, TRE, UAS, Ac5, Polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, CaMV35S, Ubi, H1 or U6 promoter; Optionally, the second promoter is selected from T7, Sp6, T3, T7lac, araBAD, trp, lac, Ptac, pL, CMV, EF1a, SV40, PGK1, Ubc, human beta actin, CAG, TRE, UAS, Ac5, Polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, CaMV35S, Ubi, H1 or U6 promoter; Optionally, the first promoter is a T7 promoter; Optionally, the second promoter is a T7 promoter.

7. A cell comprising the nucleic acid composition according to any one of claims 1 to 5 or the vector or vector composition according to claim 6.

8. A method for producing circular RNA, the method being selected from any one of the following: 1) mixing the first nucleic acid component and the second nucleic acid component in the nucleic acid composition according to any one of claims 1 to 5, adding a buffer solution, and incubating; 2) transcribing the vector or vector composition according to claim 6, or 3) culturing the cell according to claim 7; Optionally, the incubation condition is 37-60° C. for 5-60 min; Alternatively, incubate at 55°C for 15 min; Optionally, the buffer solution contains GTP or excess GMP; optionally, the final concentration of GTP is 2 mM; Optionally, the buffer solution contains magnesium ions; Optionally, the buffer solution contains 10 mM MgCl2; Optionally, the buffer solution consists of 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.5; Optionally, the method further comprises the step of purifying the product to improve its purity.

9. The circular RNA prepared by the method of claim 8.

10. A composition comprising one or more of the following: 1) The nucleic acid composition according to any one of claims 1 to 5, 2) The carrier or carrier composition according to claim 6, 3) The cell according to claim 7, 4) The circular RNA according to claim 9.

11. The composition of claim 10, further comprising an agent that promotes gene transfection; Optionally, the agent is selected from lipids and liposomes, calcium phosphate, polyethylene glycol, cationic polymers, DEAE-dextran or nanoparticles.

12. Use of any one or more of the following in preparing circular RNA or increasing the content or expression of target RNA in cells; 1) The nucleic acid composition according to any one of claims 1 to 5, 2) The carrier or carrier composition according to claim 6, 3) The cell according to claim 7.

13. An RNA composition for preparing circular RNA, the RNA composition comprising a first RNA component and a second RNA component; The structure of the first RNA component includes a first matching sequence-enzyme region-third matching sequence-loop region; The structure of the second RNA component includes the fourth matching sequence-5' corresponding sequence-sequence to be cyclized or enzyme cleavage site-3' corresponding sequence-second matching sequence; Optionally, the first RNA component is a circular RNA; Optionally, the enzyme region is an RNA encoded by a DNA having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the sequence shown in SEQ ID NO. 56; Optionally, the enzyme region is RNA encoded by the DNA shown in SEQ ID NO.56; Optionally, the 5' corresponding sequence is an RNA encoded by a DNA having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the sequence shown in SEQ ID NO. 57; Optionally, the 5' corresponding sequence is the RNA encoded by the DNA shown in SEQ ID NO.57; Optionally, the 3' corresponding sequence is an RNA encoded by a DNA having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the sequence shown in SEQ ID NO. 58; Optionally, the 3' corresponding sequence is the RNA encoded by the DNA shown in SEQ ID NO.58; Optionally, the loop region is an RNA encoded by a DNA having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence shown in SEQ ID NO. 59; Optionally, the sequence of the enzyme region is RNA encoded by SEQ ID NO. 68, 71, 74, 77, 80, 83, 86, 89, 92, 95, 98 and / or 104; Optionally, the 5' corresponding sequence and the 3' corresponding sequence have the sequences shown in SEQ ID NOs. 69-70, 72-73, 75-76, 78-79, 81-82, 84-85, 87-88, 90-91, 93-94, 96-97, 99-100 and / or 57-58, respectively; Optionally, the loop region is the RNA encoded by the DNA shown in SEQ ID NO.59; Optionally, the first matching sequence and the second matching sequence are complementary sequences to each other; Optionally, the third matching sequence and the fourth matching sequence are complementary sequences to each other; Optionally, the complementarity includes complete complementarity or incomplete complementarity; Optionally, the first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more nt in length; Optionally, the length of the first matching sequence, the second matching sequence, the third matching sequence or the fourth matching sequence is at least 5 nt or more; Optionally, the first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence are RNAs transcribed from DNAs having sequences shown in SEQ ID NOs. 62-65, respectively; Optionally, the enzyme region is a linear ribozyme or a circular ribozyme; Optionally, the sequence corresponding to the enzyme region is a ribozyme sequence derived from T4 phage and / or a ribozyme sequence derived from Anabaena.

14. A DNA molecule or a DNA molecule composition comprising a first DNA component and a second DNA component; The structure of the first DNA component includes a first matching sequence-enzyme region-third matching sequence-loop region; The structure of the second DNA component includes the fourth matching sequence-5' corresponding sequence-sequence to be cyclized or restriction enzyme cutting site-3' corresponding sequence-second matching sequence; The 3' corresponding sequence in the second DNA component corresponds to the 5' end of the enzyme region in the first DNA component, and the 5' corresponding sequence in the second DNA component corresponds to the 3' end of the enzyme region in the first DNA component; Optionally, the sequence of the enzyme region is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence shown in SEQ ID NO. 56; Optionally, the sequence of the enzyme region is shown as SEQ ID NO.56; Optionally, the sequences of the 5' corresponding sequence and the 3' corresponding sequence are at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequences shown in SEQ ID NO. 57-58; Optionally, the sequences of the 5' corresponding sequence and the 3' corresponding sequence are shown as SEQ ID NO.57-58; Alternatively, the sequence of the enzyme region is an altered SEQ ID NO. 68, 71, 74, 77, 80 and / or 83, or the sequence of the enzyme region is an altered SEQ ID NO. 86, 89, 92, 95 and / or 98; Optionally, the 5' corresponding sequence and the 3' corresponding sequence have the sequences shown in SEQ ID NO. 69-70, 72-73, 75-76, 78-79, 81-82, 84-85, 87-88, 90-91, 93-94, 96-97 and / or 99-100, respectively.

15. A vector or a combination of vectors, comprising a DNA molecule or a combination of DNA molecules encoding the RNA composition of claim 13; Optionally, the vector is an expression vector.

16. A method for stably and efficiently producing circular RNA, the method comprising mixing the first RNA component and the second RNA component in the RNA composition of claim 13 and incubating the mixture in a circularization buffer; Alternatively, the method comprises transcribing the DNA molecule or DNA molecule composition of claim 14 into an RNA product, and incubating the RNA product in a circularization buffer; Optionally, the RNA product of the first DNA in the RNA product is prepared as a circular RNA; Optionally, the molar ratio of the first RNA component to the second RNA component is 0.5, 1, 2, 3 or higher; Optionally, the molar ratio of the first RNA component to the second RNA component is 2.

17. The method of claim 16, wherein the incubation is performed at a temperature of 37-60°C; Optionally, the incubation is performed at 55°C; Optionally, the incubation period is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 minutes or more; Optionally, the incubation time is 15 minutes; Optionally, the buffer solution contains GTP or excess GMP; Optionally, the concentration of GTP in the buffer solution is 2 mM; Optionally, the buffer solution contains magnesium ions; Optionally, the buffer solution contains MgCl2; Optionally, the buffer solution contains 10 mM MgCl2; Optionally, the pH value of the buffer is 7-8, preferably 7.5; Optionally, the buffer solution consists of 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.

5.

18. A circular RNA or a composition comprising the circular RNA, wherein the circular RNA is prepared by the method of claim 16 or 17; Optionally, the composition further contains a pharmaceutically acceptable carrier and / or an agent that promotes gene conversion; Optionally, the pharmaceutically acceptable carrier is selected from any one or a combination of at least two of a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an emulsifier, a solubilizer, a solubilizing agent, an osmotic pressure regulator, a surfactant, a coating material, a colorant, a pH regulator, an antioxidant, an antibacterial agent or a buffer; Optionally, the reagent promoting gene conversion is selected from any one or a combination of at least two of lipids and liposomes, calcium phosphate, polyethylene glycol, cationic polymers, DEAE-dextran, nanoparticles, or lipo series commercial transfection reagents.

19. A cell containing or expressing one or more of the RNA composition of claim 13, the DNA molecule or DNA molecule composition of claim 14, the vector or vector combination of claim 15, the circular RNA of claim 18, or the composition comprising the circular RNA; Optionally, the cells include prokaryotic cells and eukaryotic cells; Optionally, the eukaryotic cells include lower eukaryotic cells and higher eukaryotic cells; Optionally, the lower eukaryotic cell comprises a yeast cell; Optionally, the higher eukaryotic cells include mammalian cells; Optionally, the mammal is a human; Optionally, the human cells include human immune cells; Optionally, the immune cells include T cells, B cells, and NK cells.

20. A method for expressing a target gene or target RNA in a cell, the method comprising the step of introducing the circular RNA of claim 18 or a composition comprising the circular RNA into the cell; Optionally, the method of transferring the protein into cells is selected from electroporation, calcium phosphate precipitation, calcium chloride precipitation, microinjection, polyethylene glycol method, DEAE-dextran method, cationic liposome method and lithium acetate-DMSO method.

21. Use of any one of the RNA composition of claim 13, the DNA molecule or DNA molecule composition of claim 14, the vector or vector composition of claim 15, the circular RNA or composition comprising the circular RNA of claim 18, and the cell of claim 19 in preparing circular RNA or increasing the content or expression of target RNA in cells; Optionally, the circular RNA contains a target RNA; Optionally, the target RNA is selected from an antigen, an antibody, an antigen-binding fragment, a chimeric antigen receptor, a fluorescent protein, a protein with disease therapeutic activity and / or a protein with gene editing activity.

22. Use of the circular RNA according to claim 18 or a composition comprising the circular RNA, or the cell according to claim 19 in stably and highly expressing a target RNA; Optionally, use in the preparation of products that stably and highly express target RNA; Optionally, the target RNA is selected from an antigen, an antibody, an antigen-binding fragment, a chimeric antigen receptor, a fluorescent protein, a protein with disease therapeutic activity and / or a protein with gene editing activity; Optionally, the product includes a vaccine, specifically an RNA vaccine.

Images