Recombinant strain transformed with recombinant plasmid vector, heme-containing globin recombinant protein produced therefrom, and production method therefor

By optimizing signal peptides and using recombinant plasmids to express HCG proteins in yeast strains, the method enhances production efficiency, overcoming yield limitations and enabling diverse industrial applications.

WO2025183375A1PCT designated stage Publication Date: 2025-09-04FOUND FOR RES & BUSINESS SEOUL NAT UNIV OF SCI & TECH
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/001452
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-01-17
Filing Date
2025-01-24
Publication Date
2025-09-04

AI Technical Summary

Technical Problem

Existing methods for producing leghemoglobin from legume root nodules suffer from low yields and difficulties in mass production, limiting its use in food and pharmaceutical applications, while yeast-based protein production systems face inefficiencies due to suboptimal signal peptides for recombinant protein secretion.

Method used

Optimizing signal peptides in yeast strains by incorporating specific signal peptides such as MFα, HS, and AN, and using recombinant plasmids to express heme-containing globin (HCG) proteins, which are then secreted into the culture medium for enhanced production and purification.

Benefits of technology

The optimized yeast strains significantly increase the production efficiency of HCG proteins, enabling their use as food colorants, health supplements, pharmaceuticals, and cultured meat serum medium replacements, addressing the yield and efficiency issues in existing methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025001452_04092025_PF_FP_ABST
    Figure KR2025001452_04092025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to the expression of a heme-containing globin (hereinafter, HCG) recombinant protein in yeast and provides a recombinant yeast for producing HCG recombinant protein in which after transformation of a recombinant vector into a yeast, the recombinant strain constructed by the method produces the heme-containing globin (HCG), and a method for enhancing the extracellular secretion expression of HCG by modifying a signal peptide in the recombinant yeast. The HCG produced by the method can be used as a material for a food composition, a medical composition, and a health functional food.
Need to check novelty before this filing date? Find Prior Art

Description

Recombinant strain transformed using a recombinant plasmid vector, heme containing globulin recombinant protein produced therefrom, and method for producing the same

[0001] The present invention relates to expressing a heme containing globin (hereinafter, HCG) recombinant protein in a recombinant strain, and to increasing the production amount of HCG protein by further including a signal peptide in the recombinant strain, and to using the protein as a variety of industrial materials, such as a food colorant, a flavoring material, a health functional food material, a pharmaceutical material, and a cultured meat serum medium replacement material.

[0002]

[0003] Exogenous expression of recombinant proteins from strains offers the advantage of protein purification, as the proteins are recovered from the culture medium rather than from the complex protein mixture generated when cells are destroyed. Furthermore, exogenous protein expression reduces the detrimental effects on the host cell caused by intracellular overexpression of heterologous proteins, thereby increasing expression rates.

[0004] However, protein production through yeast strains is limited for commercial use. Consequently, active research is being conducted to enhance recombinant protein expression using signal peptides in yeast strains.

[0005] Here, the signal peptide is a short peptide located at the N-terminus of the protein, which directs the protein to the protein export system of the cytoplasmic membrane. This peptide influences various steps in the protein production process, and the characteristics of the signal peptide used for secretion of the target protein play a crucial role in the final yield of the protein in the culture supernatant of the microbial host organism. This secretion of recombinant proteins into the culture supernatant can facilitate the purification of the target protein, thereby reducing production costs. Therefore, finding the optimal signal peptide for the target protein is a crucial step in efficient protein secretion production. The most commonly used signal peptide in previous studies is the α-mating factor pre-pro leader (MFα) from Saccharomyces cerevisiae. However, some recombinant proteins are secreted inefficiently due to the MFα secretion signal, resulting in low production titers. In other words, the appropriate signal peptide varies depending on the protein, and the ability to induce expression of the target protein varies depending on the signal peptide.

[0006] Thus, signal peptides that function efficiently for the secretion of a specific protein may not be suitable for the secretion of all heterologous proteins. Therefore, there is a growing need to optimize signal peptides in yeast to induce efficient secretion of heterologous proteins.

[0007] Recently, there has been a growing trend toward developing meat substitutes that incorporate leghemoglobin, derived from the root nodules of legumes, to mimic the red meat juice and flavor. Leghemoglobin has a similar protein content to conventional meat, and soy protein, in particular, has a high proportion of essential amino acids. Furthermore, its low fat and saturated fatty acid content has garnered attention as a meat substitute. However, the existing method of extracting leghemoglobin from legume root nodules and adding it to food products suffers from low yields and difficulties in mass production.

[0008] Meat is a crucial nutrient for physical development and maintenance. Compared to other foods, it contains essential amino acids, various fatty acids, and trace vitamins, making it a vital food for human survival. However, according to the Food and Agriculture Organization of the United Nations (FAO), the increasing consumption of meat due to global population growth is causing various environmental problems. These environmental issues include pollution of various resources, such as land and water, and greenhouse gases produced by raising livestock. Interest in sustainable meat alternatives with less environmental impact is growing.

[0009] Meat alternative development can be broadly divided into cultured meat, edible insects, and plant-based meat alternatives. Among these, active research is being conducted on plant-based meat alternatives. Plant-based meat alternatives have similar protein content to conventional meat, and soy protein, in particular, has a high proportion of essential amino acids. Furthermore, their low fat and saturated fatty acid content have garnered attention as a food alternative. However, plant-based meat alternatives lack sensory qualities, such as texture and flavor, compared to conventional meat. To address this issue, research is underway to incorporate various food additives to achieve a taste as close to conventional meat as possible. Among these, various companies are producing meat alternatives using leghemolgobin, derived from the root nodules of legumes, to replicate the red juice and aroma of meat.

[0010] Leghemoglobin, a substance found in the root nodules of legumes, is a 16 kDa monomer with a structure similar to that of animal myoglobin, consisting of a single globin subunit bound to heme. However, the existing method of extracting leghemoglobin from the root nodules of legumes and adding it to food products suffers from low yields and difficulties in mass production.

[0011]

[0012] The technical problem to be achieved by the present invention is to provide an HCG recombinant protein material that can be used as a food colorant, a health functional food material, a pharmaceutical material, a substitute for cultured meat serum medium, etc., by producing several novel HCG recombinant proteins by secreting them into a medium through culturing recombinant strains having a cassette expressing a heme containing globin (hereinafter, HCG) recombinant protein.

[0013] In addition, the present invention proposes a signal peptide that can effectively utilize HCG produced by the recombinant strain.

[0014] As one embodiment of the invention, the purpose of the present invention is to induce efficient expression of HCG in yeast through signal peptide optimization of a yeast strain and to confirm protein expression performance by the signal peptide.

[0015] As one embodiment of the invention, the present invention aims to provide a recombinant strain that further comprises a signal peptide in addition to a recombinant strain that produces an existing HCG protein, and further aims to provide a method for producing the same.

[0016]

[0017] In order to solve the above-mentioned problem, the present invention provides a method for producing a plant-based globin to which heme is bound, thereby providing a recombinant strain that produces a heme-containing globin (hereinafter, HCG) recombinant protein having the same function as leghemoglobin, by inserting a leghemoglobin gene of chickpea (Cicer arietinum), mung bean (Vigna radiate), soybean (Glycine max), black bean (Vigna unguiculata), and red clover (Trifolium pretense).

[0018] The present invention is an invention for mass production of a heme containing globin (hereinafter, HCG) recombinant protein obtained from a recombinant strain.

[0019] In the present invention, the recombinant strain may be a yeast strain.

[0020] The present invention is a composition comprising an HCG recombinant protein obtained from the yeast strain.

[0021] As one embodiment of the invention, the recombinant strain producing the heme containing globin (hereinafter, HCG) recombinant protein further comprises a signal peptide altering plasmid.

[0022] As one embodiment of the invention, the recombinant strain is a recombinant yeast strain.

[0023] In the present invention, the HCG recombinant protein may be a food composition. In addition, the HCG recombinant protein may be used for the purpose of forming a food composition.

[0024] As one embodiment of the invention, the present invention may provide a food composition comprising an HCG recombinant protein produced from a recombinant strain in which the signal peptide has been altered.

[0025] In the present invention, the HCG recombinant protein may be further included in a pharmaceutical composition. In addition, the HCG recombinant protein may be used for the purpose of forming a pharmaceutical preparation.

[0026] In the present invention, the HCG recombinant protein may be a recombinant protein used for an individual in need of treatment. In addition, the HCG recombinant protein may be used for the purpose of forming a pharmaceutical preparation.

[0027] In the present invention, a method for producing an HCG recombinant protein may include the following steps: (a) a step of producing a vector composed of a Leghemoglobin gene, a primer, a vector component gene, and a vector component protein; (b) a step of transforming the produced vector into a strain; (c) a step of growing and proliferating the transformed strain in a culture medium; (d) a step of further including hemin or Bacillus-derived heme in the culture medium; and (e) a step of isolating and purifying the HCG recombinant protein from the amplified strain and the culture medium of the strain.

[0028] In the present invention, the method for producing an HCG recombinant protein may further include a signal peptide in step (a).

[0029]

[0030] HCG recombinant proteins produced using the recombinant strains according to the present invention have the following effects. The present invention produces various industrial materials such as substitute meat additives by expressing HCG recombinant proteins in strains of yeast Pichia pastoris (=Komagataella phaffii) and Saccharomyces cerevisiae, and furthermore, by applying MFα signal peptide, serum albumin signal peptide, and α-amylase signal peptide to the yeast strain, an increase in the expression of HCG was induced, and through this, various levels of protein expression performance by the signal peptide were confirmed, and this can be proposed as a tool for designing a new protein secretion sequence in the future.

[0031] In addition, HCG expressed through signal peptide optimization of yeast strains can be used as a health functional food material, pharmaceutical material, cultured meat serum medium replacement material, etc. in addition to alternative meat additives, and thus can contribute to various industrial fields.

[0032]

[0033] Figure 1 shows a P. pastoris plant HCG expression plasmid produced in the present invention.

[0034] Figure 2 shows the S. cerevisiae plant HCG expression plasmid produced in the present invention.

[0035] Figure 3 shows a plasmid in which the HS signal peptide is substituted in the P. pastoris plant HCG expression plasmid produced in the present invention.

[0036] Figure 4 shows a plasmid in which the AN signal peptide is substituted in the P. pastoris plant HCG expression plasmid produced in the present invention.

[0037] Figure 5 shows a plasmid in which the HS signal peptide is substituted in the S. cerevisiae plant HCG expression plasmid produced in the present invention.

[0038] Figure 6 shows a plasmid in which the AN signal peptide is substituted in the S. cerevisiae plant HCG expression plasmid produced in the present invention.

[0039] Figure 7 is a schematic diagram of the transformation of the HCG recombinant protein expression plasmid produced in the present invention into the Pichia pastoris strain and the Saccharomyces cerevisiae strain.

[0040] Figure 8 shows the expression when hemin was added during HCG recombinant protein expression.

[0041] Figure 9 shows the expression when heme produced by a Bacillus strain was added during expression of HCG recombinant protein.

[0042] Figure 10 shows the results of purifying the HCG recombinant protein produced by the Pichia pastoris strain.

[0043] Figure 11 shows the results of purifying the HCG recombinant protein produced by the Saccharomyces cerevisiae strain.

[0044] Figure 12 shows the results of confirming the expression level of HCG recombinant protein of Saccharomyces cerevisiae D452-2 strain and Saccharomyces cerevisiae CEN.PK 2.1C strain of the present invention.

[0045] Figure 13 shows the SDS-PAGE results of plant HCG expression when three signal peptides were introduced into P. pastoris.

[0046] Figure 14 shows the SDS-PAGE results of plant HCG expression when three signal peptides were introduced into S. cerevisiae.

[0047] Figure 15 shows the results of confirming the expression of plant HCG when three signal peptides were introduced into P. pastoris using Image-J.

[0048] Figure 16 shows the results of confirming plant HCG expression using Image-J when three signal peptides were introduced into S. cerevisiae.

[0049] Figure 17 shows the results of confirming the protein concentration of plant-based HCG when three signal peptides were introduced into P. pastoris.

[0050] Figure 18 shows the results of confirming the protein concentration of plant-based HCG when three signal peptides were introduced into S. cerevisiae.

[0051]

[0052] The present invention aims to provide a recombinant yeast strain with increased production efficiency of an extracellularly secreted recombinant protein. Specifically, the present invention is an invention for mass-producing a heme-containing globin (hereinafter referred to as HCG) recombinant protein obtained from a recombinant strain.

[0053] The present invention aims to provide a recombinant plasmid comprising a promoter, a plant-derived Heme Containing Globin (HCG) gene, and a signal peptide. Specifically, the present invention relates to a shuttle vector comprising one or more genes selected from the group consisting of a promoter gene, an antibiotic resistance gene, a cellular respiration gene, a marker gene, and a signal gene; and a recombinant vector comprising a primer and a Heme Containing Globin (HCG) gene.

[0054] As a specific example of the present invention, the shuttle vector is a recombinant vector into which a specific gene has been inserted, which is produced for insertion into a specific strain of E. coli, and specifically, may be one or more selected from pPICzαA, pPICzαB, pPICzαC, pESC, pAUR, pPTR, and YEp, and more specifically, pPICzαA, pESC.

[0055] As a specific example of the present invention, the promoter gene is for expression and replication of the vector, and the promoter gene may differ depending on the type of strain and vector to be used. In the present invention, the promoter gene may have an AOX1 promoter in the case of Pichia pastoris, and a GAL promoter in the case of Saccharomyces cerevisiae. However, the present invention is not limited thereto.

[0056] As one embodiment of the invention, the expression regulatory gene may include one or more expression regulatory genes selected from the group consisting of GALp, AOX1p, GAPp, TEF1p, ADH1p, PHO5p, CUP1p, HSP70p, ENO1p, PDC1p, HIS3p, MET25p and CYC1p, and specifically, may include one or more expression regulatory genes selected from the group consisting of GALp, AOX1p, GAPp and TEF1p, and more specifically, may be GALp or AOX1p.

[0057] As one embodiment of the invention, the transcription regulatory gene may include one or more transcription regulatory genes selected from the group consisting of CYC1t, AOX1t, ADH1t, TEF1t, GAPt, HIS3t, PGK1t, ENO1t, MET25t, PDC1t, ACT1t, PHO5t, GAL7t, CUP1t and RPL41t, and specifically, may include one or more transcription regulatory genes selected from the group consisting of CYC1t, AOX1t, ADH1t, TEF1t, and GAPt, and more specifically, is CYC1t or AOX1t.

[0058] As one embodiment of the invention, the antibiotic resistance genes are AmpR (Ampicillin Resistance), KanR (Kanamycin Resistance), TetR (Tetracycline Resistance), EryR (Erythromycin Resistance), Chloramphenicol Acetyltransferase (CAT) gene, Sul1, Sul2, Sul3 (Sulfonamide Resistance), blaCTX-M (Extended-spectrum β-lactamase, ESBL) and Zeo R (Zeocin Resistance), specifically, AmpR, KanR, TetR, and ZeoR may be selected from the group consisting of, more specifically, AmpR, and Zeo R It could be.

[0059] As one embodiment of the invention, the auxotrophic gene may be selected from the group consisting of URA3 (Orotidine-5'-phosphate decarboxylase), HIS3 (Imidazoleglycerol-phosphate dehydratase), LEU2 (β-Isopropylmalate dehydrogenase), and TRP1 (N-(5'-Phosphoribosyl)anthranilate isomerase), and specifically may be selected from the group consisting of URA3, HIS3, LEU2, and TRP1, and more specifically may be URA3, HIS3, LEU2, and TRP1.

[0060] As one embodiment of the invention, the plant-derived Heme Containing Globin (HCG) gene may be a gene derived from one or more plants selected from the group consisting of peas (Lathyrus oleraceus), chickpeas (Cicer arietinum), mung beans (Vigna radiate), soybeans (Glycine max), peanuts (Arachis hypogaea), lentils (Lens culinaris), adzuki beans (Vigna angularis), Phaseolus vulgaris, red clover (Trifolium pretense), elk clover (Trifolium hybridum), black beans (Vigna unguiculata), and rabbit's foot clover (Trifolium arvense), and specifically, peas (Lathyrus oleraceus), chickpeas (Cicer arietinum), mung beans (Vigna radiate), Phaseolus vulgaris, soybeans (Glycine max), It may be a gene derived from one or more plants selected from the group consisting of black bean (Vigna unguiculata) and red clover (Trifolium pretense), and more specifically, it may be a gene derived from one or more plants selected from the group consisting of chickpea (Cicer arietinum), mung bean (Vigna radiate), soybean (Glycine max), black bean (Vigna unguiculata), and red clover (Trifolium pretense).

[0061] As one embodiment of the invention, the recombinant yeast strain may be Pichia pastoris (= komagatella phaffii, K.phaffii), Saccharomyces cerevisiae, Yarrowia lipolytica, Wickerhamomyces anomalus, and Kluyveromyces lactis, Xanthophyllomyces dendrorhous, and specifically, may be Pichia pastoris, Saccharomyces cerevisiae, Yarrowia lipolytica, Wickerhamomyces anomalus, Kluyveromyces lactis, and Xanthophyllomyces dendrorhous, and more specifically, may be Pichia pastoris and Saccharomyces cerevisiae.

[0062] As a specific example of the invention, the signal peptide may have at least one signal peptide selected from the group consisting of Sec Signal Peptide, ComX (Competence Stimulating Peptide), Autoinducer-2 (AI-2), Phr (Phr Peptide), AgrD (Accessory Gene Regulator D), Bacteriocin Signal Peptide, Pheromones in Yeast, OmpA Signal Peptide, HS signal peptide (Human serum albumin signal peptide), AN signal peptide (A. niger α-amylase signal peptide) and α-factor signal peptide, and specifically, may have at least one signal peptide selected from the group consisting of HS signal peptide (Human serum albumin signal peptide), AN signal peptide (A. niger α-amylase signal peptide) and α-factor signal peptide, and more specifically, HS signal peptide (Human serum albumin signal peptide) and AN signal peptide (A. nigerα-amylase signal peptide).

[0063] The above signal gene is used to target and secrete proteins or peptides to the correct location within the strain when transformed into the strain together with the vector.

[0064] In the present invention, the HCG recombinant protein may be expressed from a vector having the sequence of the HCG recombinant protein.

[0065] In the present invention, the vector may be transformed and expressed in the yeast strain.

[0066] In the present invention, the vector may be composed of a shuttle vector, a primer, and a heme containing globin gene, but is not limited thereto.

[0067] As a specific example of the invention, the shuttle vector is a vector derived from E. coli, and specifically, it is an E. coli-strain shuttle vector engineered to be inserted into each strain, and more specifically, it is an E. coli-S. cerevisiae, E. coli-P. pastoris shuttle vector, which is the target strain of the present invention, but is not limited thereto.

[0068] As a specific example of the invention, the vector comprises Aox1p, CYC1, Zeo R , α-factor signal peptide, Galp, ADH1t, URA3, and AmpR are further included, but are not limited thereto. The above substances are substances necessary for replication and proliferation of the vector, and may be applied differently for each strain.

[0069] As a specific example of the invention, the material included in the vector and inserted into the P. pastoris strain is Aox1p, CYC1, Zeo R and α-factor signal peptide, but are not limited thereto.

[0070] As a specific example of the invention, the material included in the vector and inserted into the S. cerevisiae strain may be, but is not limited to, Galp, ADH1t, URA3, AmpR, and α-factor signal peptide.

[0071] In the present invention, when culturing the P. pastoris and S. cerevisiae strains, hemin and heme may be further included. The hemin and heme serve as starting proteins or nutrients that enable each strain to produce proteins in the HCG recombination assay.

[0072] The above hemin is an iron-containing porphyrin that can be formed from heme groups such as heme B found in hemoglobin.

[0073] The above heme is a heme produced by a Bacillus strain (Publication Patent No. 10-2023-0064552) applied for by the inventor of the present invention, but is not limited thereto.

[0074] In the present invention, the HCG recombinant protein can be obtained by separating and purifying it from a strain that produces the HCG recombinant protein.

[0075] In one specific embodiment of the present invention, the HCG recombinant protein may be obtained by isolation and purification, or may be contained in a culture medium and a supernatant, and the process for isolation and purification of the protein may be obtained through a protein isolation and purification method known in the art, but is not limited thereto.

[0076] In the present invention, the expression amount of the HCG recombinant protein may vary depending on the strain.

[0077] As one specific example of the invention, the expression of the HCG recombinant protein may be higher in S. cerevisiae D452-2 than in S. cerevisiae CEN.PK 2-1C.

[0078] As one embodiment of the invention, the present invention aims to provide a recombinant yeast strain for producing Heme Containing Globin (HCG) transformed with the above recombinant plasmid. As one embodiment of the invention, the present invention may provide a method for producing a recombinant yeast strain with increased production efficiency of an extracellularly secreted recombinant protein, comprising the following steps.

[0079] (1) A step of constructing a recombinant plasmid containing a promoter, a plant-derived Heme Containing Globin (HCG) gene, and a signal peptide;

[0080] (2) a step of transforming the recombinant plasmid produced in step (1) into a yeast strain; and

[0081] (3) A step of culturing, growing and propagating the recombinant yeast strain of step (2) to produce HCG protein.

[0082] As a specific example of the invention, the recombinant yeast strain of step (2) may be Pichia pastoris, Saccharomyces cerevisiae, Yarrowia lipolytica, Wickerhamomyces anomalus, Kluyveromyces lactis and Xanthophyllomyces dendrorhous, specifically, may be Pichia pastoris, Saccharomyces cerevisiae, Yarrowia lipolytica, Wickerhamomyces anomalus, Kluyveromyces lactis and Xanthophyllomyces dendrorhous, and more specifically, may be Pichia pastoris and Saccharomyces cerevisiae.

[0083] As one embodiment of the invention, the recombinant plasmid of step (1) may be composed of a plant-derived HCG as a template; and a primer for producing a plant-derived HCG expression plasmid.

[0084] As a specific example of the invention, the recombinant plasmid of step (1) is for transforming a Pichia pastoris strain, and the recombinant Pichia pastoris strain may include a recombinant plasmid comprising a backbone composed of primers of SEQ ID NO: 1 (LP-01) and SEQ ID NO: 2 (LP-02); at least one template template selected from a plant-derived HCG protein template composed of SEQ ID NO: 33 (Glycinin maxleghemoglobin C2) to SEQ ID NO: 37 (Vigna unguiculataleghemoglobin); and at least one primer selected from the group consisting of HCG protein primers composed of SEQ ID NO: 3 (LP-03) to SEQ ID NO: 12 (LP-12).

[0085] More specifically, the recombinant plasmid of step (1) above is a recombinant plasmid comprising a backbone composed of SEQ ID NO: 1 (LP-01) and SEQ ID NO: 2 (LP-02), an HCG protein primer composed of SEQ ID NO: 3 (LP-03) and SEQ ID NO: 4 (LP-04), and a template of a plant-derived HCG protein of SEQ ID NO: 33 (Glycinin maxleghemoglobin C2); a recombinant plasmid comprising a backbone composed of SEQ ID NO: 1 (LP-01) and SEQ ID NO: 2 (LP-02), an HCG protein primer composed of SEQ ID NO: 5 (LP-05) and SEQ ID NO: 6 (LP-06), and a template of a plant-derived HCG protein of SEQ ID NO: 34 (Cicer arietinumleghemoglobin-1-like); A recombinant plasmid comprising a backbone composed of SEQ ID NO: 1 (LP-01) and SEQ ID NO: 2 (LP-02), HCG protein primers composed of SEQ ID NO: 7 (LP-07) and SEQ ID NO: 8 (LP-08), and a template of plant-derived HCG protein of SEQ ID NO: 35 (Vigna radiata var. radiataleghemoglobin-2); A recombinant plasmid comprising a backbone composed of SEQ ID NO: 1 (LP-01) and SEQ ID NO: 2 (LP-02), HCG protein primers composed of SEQ ID NO: 9 (LP-09) and SEQ ID NO: 10 (LP-10), and a template of plant-derived HCG protein of SEQ ID NO: 36 (Trifolium pratenseleghemoglobin); It may comprise at least one recombinant plasmid selected from the group consisting of a backbone consisting of sequence number 1 (LP-01) and sequence number 2 (LP-02), a recombinant plasmid consisting of an HCG protein primer consisting of sequence number 11 (LP-11) and sequence number 12 (LP-12), and a template of a plant-derived HCG protein of sequence number 37 (Vigna unguiculataleghemoglobin);

[0086] As a specific example of the invention, the recombinant plasmid of step (1) is for transforming a Saccharomyces cerevisiae strain, and the recombinant plasmid for transforming the recombinant Saccharomyces cerevisiae strain is a recombinant plasmid produced using a recombinant plasmid included in the recombinant Pichia pastoris strain as a template and at least one primer selected from the group consisting of primers of SEQ ID NO: 25 (LP-25) to SEQ ID NO: 30 (LP-30). Specifically, a backbone composed of primers of SEQ ID NO: 1 (LP-01) and SEQ ID NO: 2 (LP-02); at least one template template selected from the group consisting of templates of plant-derived HCG proteins of SEQ ID NO: 33 (Glycinin maxleghemoglobin C2) to SEQ ID NO: 37 (Vigna unguiculataleghemoglobin); It may include a recombinant plasmid produced using one or more primers selected from the group consisting of HCG protein primers consisting of SEQ ID NO: 3 (LP-03) to SEQ ID NO: 12 (LP-12) as a template, and one or more primers selected from the group consisting of SEQ ID NO: 25 (LP-25) to SEQ ID NO: 30 (LP-30).

[0087] As a specific example of the invention, the recombinant plasmid of step (1) is a recombinant plasmid produced using the primers of SEQ ID NO: 25 (LP-25) and SEQ ID NO: 26 (LP-26) using the recombinant plasmid included in the recombinant Pichia pastoris strain as a template; a recombinant plasmid produced using the primers of SEQ ID NO: 25 (LP-25) and SEQ ID NO: 27 (LP-27) using the recombinant plasmid included in the Pichia pastoris strain as a template; a recombinant plasmid produced using the primers of SEQ ID NO: 25 (LP-25) and SEQ ID NO: 28 (LP-28) using the recombinant plasmid included in the Pichia pastoris strain as a template; a recombinant plasmid produced using the primers of SEQ ID NO: 25 (LP-25) and SEQ ID NO: 29 (LP-29) using the recombinant plasmid included in the Pichia pastoris strain as a template; a recombinant plasmid produced using the primers of SEQ ID NO: 25 (LP-25) and SEQ ID NO: 29 (LP-29) using the recombinant plasmid included in the Pichia pastoris strain as a template; A recombinant yeast strain comprising at least one recombinant plasmid selected from the group consisting of a recombinant plasmid produced with primers of sequence number 25 (LP-25) and sequence number 30 (LP-30).

[0088]

[0089] As a specific example of the invention, the signal peptide of step (1) may be an MFα signal peptide (α-factor signal peptide, MFα signal peptide), a HS signal peptide (Human serum albumin signal peptide, HS signal peptide), or an AN signal peptide (A. nigerα-amylase signal peptide, AN signal peptide), and specifically, the α-factor signal peptide contained in the existing strain may be replaced with an HS signal peptide (Human serum albumin signal peptide) or an AN signal peptide (A. nigerα-amylase signal peptide).

[0090] As a specific example of the invention, in the step (1), the recombinant strain in which the signal peptide is replaced with the HS signal peptide may be a recombinant Pichia pastoris strain and a recombinant Saccharomyces cerevisiae strain.

[0091] As a specific example of the invention, the recombinant Pichia pastoris strain in which the signal peptide of step (1) is replaced with an HS signal peptide comprises: a backbone composed of primers of SEQ ID NO: 1 (LP-01) and SEQ ID NO: 13 (LP-13); at least one template template selected from the template of plant-derived HCG proteins composed of SEQ ID NO: 33 (Glycinin maxleghemoglobin C2) to SEQ ID NO: 37 (Vigna unguiculataleghemoglobin); at least one signal peptide primer selected from the group consisting of signal peptide primers of SEQ ID NO: 14 (LP-14) to SEQ ID NO: 18 (LP-18); and one or more primers selected from the group consisting of HCG protein primers consisting of SEQ ID NO: 4 (LP-04), SEQ ID NO: 6 (LP-06), SEQ ID NO: 8 (LP-08), SEQ ID NO: 10 (LP-10), and SEQ ID NO: 12 (LP-12).

[0092] Specifically, the recombinant Pichia pastoris strain in which the signal peptide of the step (1) is replaced with an HS signal peptide is a recombinant plasmid comprising a backbone composed of primers of SEQ ID NO: 1 (LP-01) and SEQ ID NO: 13 (LP-13), an HS signal peptide primer of SEQ ID NO: 14 (LP-14), an HCG protein primer of SEQ ID NO: 4 (LP-04), and a template of a plant-derived HCG protein of SEQ ID NO: 33 (Glycinin maxleghemoglobin C2); a recombinant plasmid comprising a backbone composed of primers of SEQ ID NO: 1 (LP-01) and SEQ ID NO: 13 (LP-13), an HS signal peptide primer of SEQ ID NO: 15 (LP-15), an HCG protein primer of SEQ ID NO: 6 (LP-06), and a template of a plant-derived HCG protein of SEQ ID NO: 34 (Cicer arietinumleghemoglobin-1-like); A backbone consisting of primers of SEQ ID NO: 1 (LP-01) and SEQ ID NO: 13 (LP-13), a HS signal peptide primer of SEQ ID NO: 16 (LP-16), an HCG protein primer of SEQ ID NO: 8 (LP-08), and a primer of SEQ ID NO: 35 (Vigna radiata var.A recombinant plasmid comprising a plant-derived HCG protein template of Trifolium pratenseleghemoglobin-2; a backbone comprising primers of SEQ ID NO: 1 (LP-01) and SEQ ID NO: 13 (LP-13), an HS signal peptide primer of SEQ ID NO: 17 (LP-17), an HCG protein primer of SEQ ID NO: 10 (LP-10), and a plant-derived HCG protein template of SEQ ID NO: 36 (Trifolium pratenseleghemoglobin); It may include at least one recombinant plasmid selected from the group consisting of a backbone composed of primers of SEQ ID NO: 1 (LP-01) and SEQ ID NO: 13 (LP-13), a HS signal peptide primer of SEQ ID NO: 18 (LP-18), an HCG protein primer of SEQ ID NO: 12 (LP-12), and a recombinant plasmid composed of a template of a plant-derived HCG protein of SEQ ID NO: 37 (Vigna unguiculataleghemoglobin).

[0093]

[0094] As a specific example of the invention, the recombinant Saccharomyces cerevisiae strain in which the signal peptide of step (1) is replaced with an HS signal peptide may include a recombinant plasmid produced using a recombinant plasmid included in a recombinant Pichia pastoris strain as a template, and one or more HCG protein primers selected from the group consisting of the HS signal peptide of SEQ ID NO: 31 (LP-31); and the HCG protein primers of SEQ ID NO: 26 (LP-26) to SEQ ID NO: 30 (LP-30).

[0095] Specifically, the recombinant Saccharomyces cerevisiae strain in which the signal peptide of the step (1) is replaced with the HS signal peptide is a recombinant plasmid produced using a recombinant plasmid included in a recombinant Pichia pastoris strain as a template, the HS signal peptide of SEQ ID NO: 31 (LP-31), and the HCG protein primer of SEQ ID NO: 26 (LP-26); a recombinant plasmid produced using a recombinant plasmid included in a recombinant Pichia pastoris strain as a template, the HS signal peptide of SEQ ID NO: 31 (LP-31), and the HCG protein primer of SEQ ID NO: 27 (LP-27); a recombinant plasmid produced using a recombinant plasmid included in a recombinant Pichia pastoris strain as a template, the HS signal peptide of SEQ ID NO: 31 (LP-31), and the HCG protein primer of SEQ ID NO: 28 (LP-28); It comprises at least one recombinant plasmid selected from the group consisting of a recombinant plasmid produced using a HS signal peptide of SEQ ID NO: 31 (LP-31) and an HCG protein primer of SEQ ID NO: 29 (LP-29) using a recombinant plasmid included in a recombinant Pichia pastoris strain as a template; a recombinant plasmid produced using a HS signal peptide of SEQ ID NO: 31 (LP-31) and an HCG protein primer of SEQ ID NO: 30 (LP-30) using a recombinant plasmid included in a recombinant Pichia pastoris strain as a template.

[0096]

[0097] As a specific example of the invention, in the step (1), the recombinant strain in which the signal peptide is replaced with an AN signal peptide may be a recombinant Pichia pastoris strain and a recombinant Saccharomyces cerevisiae strain.

[0098] As a specific example of the invention, the recombinant Pichia pastoris strain in which the signal peptide of step (1) is replaced with an AN signal peptide comprises: a backbone composed of primers of SEQ ID NO: 1 (LP-01) to SEQ ID NO: 19 (LP-19); at least one template template selected from the template of plant-derived HCG proteins composed of SEQ ID NO: 33 (Glycinin maxleghemoglobin C2) to SEQ ID NO: 37 (Vigna unguiculataleghemoglobin); at least one signal peptide primer selected from the group consisting of signal peptide primers of SEQ ID NO: 20 (LP-20) to SEQ ID NO: 24 (LP-24); and one or more primers selected from the group consisting of HCG protein primers consisting of SEQ ID NO: 4 (LP-04), SEQ ID NO: 6 (LP-06), SEQ ID NO: 8 (LP-08), SEQ ID NO: 10 (LP-10), and SEQ ID NO: 12 (LP-12).

[0099] Specifically, the recombinant Pichia pastoris strain in which the signal peptide of the step (1) is replaced with an AN signal peptide is a recombinant plasmid comprising a backbone composed of primers of SEQ ID NO: 1 (LP-01) to SEQ ID NO: 19 (LP-19), an AN signal peptide primer of SEQ ID NO: 20 (LP-20), an HCG protein primer of SEQ ID NO: 4 (LP-04), and a template of a plant-derived HCG protein of SEQ ID NO: 33 (Glycinin maxleghemoglobin C2); a recombinant plasmid comprising a backbone composed of primers of SEQ ID NO: 1 (LP-01) to SEQ ID NO: 19 (LP-19), an AN signal peptide primer of SEQ ID NO: 21 (LP-21), an HCG protein primer of SEQ ID NO: 6 (LP-06), and a template of a plant-derived HCG protein of SEQ ID NO: 34 (Cicer arietinumleghemoglobin-1-like); A backbone consisting of primers of SEQ ID NO: 1 (LP-01) to SEQ ID NO: 19 (LP-19), an AN signal peptide primer of SEQ ID NO: 22 (LP-22), an HCG protein primer of SEQ ID NO: 8 (LP-08), and a primer of SEQ ID NO: 35 (Vigna radiata var.A recombinant plasmid comprising a plant-derived HCG protein template of Trifolium pratenseleghemoglobin-2; a backbone comprising primers of SEQ ID NO: 1 (LP-01) to SEQ ID NO: 19 (LP-19), an AN signal peptide primer of SEQ ID NO: 23 (LP-23), an HCG protein primer of SEQ ID NO: 10 (LP-10), and a plant-derived HCG protein template of SEQ ID NO: 36 (Trifolium pratenseleghemoglobin); It may include at least one recombinant plasmid selected from the group consisting of a backbone composed of primers of SEQ ID NO: 1 (LP-01) to SEQ ID NO: 19 (LP-19), an AN signal peptide primer of SEQ ID NO: 24 (LP-24), an HCG protein primer of SEQ ID NO: 12 (LP-12), and a recombinant plasmid composed of a template of a plant-derived HCG protein of SEQ ID NO: 37 (Vigna unguiculataleghemoglobin).

[0100] As a specific example of the invention, the recombinant Saccharomyces cerevisiae strain in which the signal peptide of step (1) is replaced with an AN signal peptide may include a recombinant plasmid produced using a recombinant plasmid included in a recombinant Pichia pastoris strain as a template, the AN signal peptide of SEQ ID NO: 32 (LP-32); and one or more HCG protein primers selected from the group consisting of HCG protein primers of SEQ ID NO: 26 (LP-26) to SEQ ID NO: 30 (LP-30).

[0101] Specifically, the recombinant Saccharomyces cerevisiae strain in which the signal peptide of the step (1) is replaced with the HS signal peptide is a recombinant plasmid produced using a recombinant plasmid included in a recombinant Pichia pastoris strain as a template, the AN signal peptide of SEQ ID NO: 32 (LP-32), and the HCG protein primer of SEQ ID NO: 26 (LP-26); a recombinant plasmid produced using a recombinant plasmid included in a recombinant Pichia pastoris strain as a template, the AN signal peptide of SEQ ID NO: 32 (LP-32), and the HCG protein primer of SEQ ID NO: 27 (LP-27); a recombinant plasmid produced using a recombinant plasmid included in a recombinant Pichia pastoris strain as a template, the AN signal peptide of SEQ ID NO: 32 (LP-32), and the HCG protein primer of SEQ ID NO: 28 (LP-28); It comprises at least one recombinant plasmid selected from the group consisting of a recombinant plasmid produced using a recombinant plasmid included in a recombinant Pichia pastoris strain as a template, an AN signal peptide of SEQ ID NO: 32 (LP-32), and an HCG protein primer of SEQ ID NO: 29 (LP-29); a recombinant plasmid produced using a recombinant plasmid included in a recombinant Pichia pastoris strain as a template, an AN signal peptide of SEQ ID NO: 32 (LP-32), and an HCG protein primer of SEQ ID NO: 30 (LP-30);

[0102] As a specific example of the invention, the culture of the recombinant yeast strain of step (3) may be selected from the group consisting of LB medium (Luria-Bertani broth), selective medium (Selective media), M9 medium, YPD medium (Yeast extract-Peptone-Dextrose), SC medium (Synthetic Complete media), SD medium (Synthetic Dropout media), Tryptic Soy Broth (TSB), R2A medium, S agar medium (Sabouraud Dextrose agar), Nutrient Agar, BMGY medium (Buffered Glycerol complex medium) and BMMY medium (Buffered Methanol complex medium), and specifically, may be selected from the group consisting of LB medium (Luria-Bertani broth), SC medium (Synthetic Complete media), BMGY medium (Buffered Glycerol complex medium) and BMMY medium (Buffered Methanol complex medium), and more specifically, SC medium (Synthetic Complete media), BMGY medium (Buffered The medium is selected from the group consisting of, but not limited to, Glycerol complex medium and BMMY medium (Buffered Methanol complex medium), and other media other than the media described above can be used for the type of strain or purification of the desired protein.

[0103] As one specific example of the invention, the present invention may be to obtain a Heme Containing Globin (HCG) protein through a recombinant yeast strain produced through the above method.

[0104] As a specific example of the invention, an HCG protein obtained from a recombinant strain in which a signal peptide is substituted may have an excellent expression level of HCG when the signal peptide of the recombinant Pichia pastoris strain is MFα, and may have a difference in the signal peptide that shows a high expression rate in the case of the recombinant Saccharomyces cerevisiae strain.

[0105]

[0106] The present invention may provide a food composition comprising a recombinant strain produced through the above method and a recombinant HCG protein produced by the same.

[0107] In one embodiment of the invention, the food composition may include, in addition to the active ingredient, a food additive acceptable from a food science perspective. The food additive refers to a component that can be added to the food as a supplement, and any food additive known in the art that is added in the production of each type of food may be used without limitation. In the present invention, any food additive that aids in the anemia-improving effect of the food composition without significantly altering the properties of the food composition may be used without limitation.

[0108] As an embodiment of the invention, the food composition may be, for example, various foods, beverages, gum, tea, vitamin complexes, health functional foods, etc. In addition, in the present invention, the food includes, but is not limited to, special nutritional foods (e.g., formulated milk, infant food, baby food, etc.), processed meat products, fish products, tofu, starch jelly, noodles (e.g., ramen, noodles, etc.), health supplements, seasoned foods (e.g., soy sauce, soybean paste, red pepper paste, mixed sauce, etc.), sauces, confectionery (e.g., snacks), processed dairy products (e.g., fermented milk, cheese, etc.), other processed foods, kimchi, pickled foods (various kimchi, pickled vegetables, etc.), beverages (e.g., fruit and vegetable beverages, soy milk, fermented beverages, etc.), natural seasonings (e.g., ramen soup, etc.).

[0109] Examples of food additives include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and fillers, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, and carbonating agents used in carbonated beverages.

[0110] The above food composition can be used as a functionalized health food. The above health functional food refers to a food manufactured and processed using raw materials or ingredients with beneficial functional properties for the human body, in the form of tablets, capsules, powders, granules, liquids, or pills. "Functionality" here refers to achieving beneficial health effects, such as regulating nutrients or physiological effects on the structure and function of the human body.

[0111] In addition, the food composition can be used as an additive to various foods. Foods to which the food composition can be added include, without limitation, meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes.

[0112]

[0113] The present invention may provide a cultured meat containing a recombinant strain produced by the above method and a recombinant HCG protein produced by the same, and may provide a method for producing the same.

[0114] The present invention relates to a recombinant HCG protein produced using the above method, which may be used as a food additive. As an example, the recombinant HCG protein may be used as a food additive or cell culture food raw material for enhancing the flavor and aroma of plant-based meat substitutes, enhancing the taste and aroma of meat, realizing the meat color, and changing the color before and after cooking.

[0115] As one embodiment of the invention, the present invention may provide a meat substitute comprising a recombinant HCG protein produced using the above method, and a method for producing the same. As one specific example of the invention, the meat substitute comprising the recombinant HCG protein may contain various flavoring agents or natural carbohydrates as additional ingredients, similar to a food composition.

[0116] Examples of the above-mentioned natural carbohydrates are monosaccharides, such as glucose, fructose, etc.; disaccharides, such as maltose, sucrose, etc.; and polysaccharides, such as dextrin, cyclodextrin, etc., common sugars, and sugar alcohols, such as xylitol, rebitol, erythritol, etc. The above-mentioned flavoring agent may include one or more carbohydrates selected from the group consisting of natural flavoring agents (thaumatin), stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.).

[0117] The above substitute meat may contain conventional food additives, and its suitability as a food additive shall be determined by the specifications and standards for the relevant item in accordance with the general provisions and general test methods of the Food Additives Code approved by the Ministry of Food and Drug Safety, unless otherwise provided.

[0118] The above food additives may be chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, high-molecular-weight pigment, and guar gum; and mixed preparations such as sodium L-glutamate preparations, noodle additive alkaline agents, preservative preparations, and tar color preparations. The mixture mixed with excipients, binders, disintegrants, and other additives may be granulated using a conventional method, and then a lubricant, etc. may be added and compression molded, or the mixture may be directly compression molded. In addition, the health functional food in tablet form may contain a flavoring agent, etc., as needed.

[0119]

[0120] The present invention may provide a medical composition comprising a recombinant strain produced by the above method and a recombinant HCG protein produced by the same, and a method for producing the same.

[0121] The present invention may provide a cell culture serum for producing cultured meat containing a recombinant HCG protein produced using the above method, and an additive included in a substitute medium material using the same.

[0122]

[0123] Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are provided for illustrative purposes only and the scope of the present invention is not limited to these examples.

[0124]

[0125]

[0126] Example 1. Construction of a plant-based HCG expression plasmid

[0127] To construct a strain expressing plant-based HCG, an expression plasmid was constructed. All cloning and plasmid replication were performed using the E. coli TOP10 strain. PrimeSTAR HS DNA polymerase from Takara was used to construct all DNA fragments used in the experiments (Fig. 1A).

[0128]

[0129] 1-1. Method for producing plant-based HCG-expressing P. pastoris plasmid.

[0130] 1-1-1.P. Pastoris-Glycinin maxleghemoglobin C2 plasmid production method

[0131] The backbone of pPICzαA-gmaLegHb was constructed using primers LP-01 and LP-02. The pPICzαA-gmaLegHb insert was constructed using a codon-optimized synthesized gblock. Using the synthesized Glycinin maxleghemoglobin C2 gblock as a template, the pPICzαA-gmaLegHb insert was constructed using primers LP-03 and LP-04. Subsequently, pPICzαA-gmaLegHb was constructed using the Gibson Assembly Kit from NEB (Fig. 1B).

[0132]

[0133] 1-1-2.P. How to produce pastoris-Cicer arietinumleghemoglobin-1-like plasmid

[0134] The backbone of pPICzαA-carLegHb was constructed using primers LP-01 and LP-02. The pPICzαA-carLegHb insert was constructed using a codon-optimized synthesized gblock. Using the synthesized Cicer arietinum leghemoglobin-1-like gblock as a template, the pPICzαA-carLegHb insert was constructed using primers LP-05 and LP-06. Subsequently, pPICzαA-carLegHb was constructed using the Gibson Assembly Kit from NEB (Fig. 1C).

[0135]

[0136] 1-1-3.P. pastoris- Vigna radiata var. How to produce radiataleghemoglobin-2 plasmid

[0137] The backbone of pPICzαA-vraLegHb was constructed using primers LP-01 and LP-02. The pPICzαA-vraLegHb insert was constructed using a codon-optimized synthesized gblock. Using the synthesized Vigna radiata var. radiataleghemoglobin-2 gblock as a template, the pPICzαA-vraLegHb insert was constructed using primers LP-07 and LP-08. Subsequently, pPICzαA-vraLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 1D).

[0138]

[0139] 1-1-4.P. pastoris-Trifolium pratenseleghemoglobin plasmid construction method

[0140] The backbone of pPICzαA-tprLegHb was constructed using primers LP-01 and LP-02. The pPICzαA-tprLegHb insert was constructed using a codon-optimized synthesized gblock. Using the synthesized Trifolium pratenseleghemoglobin gblock as a template, the pPICzαA-tprLegHb insert was constructed using primers LP-09 and LP-10. Subsequently, pPICzαA-tprLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 1E).

[0141]

[0142] 1-1-5.P. How to produce pastoris-Vigna unguiculataleghemoglobin plasmid

[0143] The backbone of pPICzαA-vunLegHb was constructed using primers LP-01 and LP-02. The pPICzαA-vunLegHb insert was constructed using a codon-optimized synthesized gblock. Using the synthesized Vigna unguiculataleghemoglobin gblock as a template, the pPICzαA-vunLegHb insert was constructed using primers LP-11 and LP-12. Subsequently, pPICzαA-vunLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 1F).

[0144]

[0145] 1-2. Method for producing plant-based HCG-expressing S. cerevisiae plasmid.

[0146] To construct a strain expressing plant-based HCG, an expression plasmid was constructed. All cloning and plasmid replication were performed using the E. coli TOP10 strain. PrimeSTAR HS DNA polymerase from Takara was used to construct all DNA fragments used in the experiments (Fig. 2A).

[0147]

[0148] 1-2-1.S. cerevisiae-Glycinin maxleghemoglobin C2 plasmid production method

[0149] The pESC-gmaLegHb backbone was constructed using the BamHI restriction enzyme. The pESC-gmaLegHb insert was constructed using pPICzαA-gmaLegHb as a template and the LP-25 and LP-26 primers. Subsequently, pESC-gmaLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 2B).

[0150]

[0151] 1-2-2.S. cerevisiae- Cicer arietinumleghemoglobin-1-like plasmid production method

[0152] The pESC-carLegHb backbone was constructed using the BamHI restriction enzyme. The pESC-carLegHb insert was constructed using pPICzαA-carLegHb as a template using the LP-25 and LP-27 primers. Subsequently, pESC-carLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 2C).

[0153]

[0154] 1-2-3.S. cerevisiae - Vigna radiata var. How to produce radiataleghemoglobin-2 plasmid

[0155] The pESC-vraLegHb backbone was constructed using the BamHI restriction enzyme. The pESC-vraLegHb insert was constructed using pPICzαA-vraLegHb as a template using the LP-25 and LP-28 primers. Subsequently, pESC-vraLegHb was constructed using the NEB Gibson Assembly Kit. Detailed experimental methods followed the Gibson Assembly Kit Protocol. The pESC-tprLegHb backbone was constructed using the BamHI restriction enzyme (Fig. 2D).

[0156]

[0157] 1-2-4. S. cerevisiae - Trifolium pratenseleghemoglobin plasmid construction method

[0158] pESC-tprLegHb insert was constructed using pPICzαA-tprLegHb as a template using LP-25 and LP-29 primers. Subsequently, pESC-tprLegHb was constructed using NEB's Gibson Assembly Kit. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 2E).

[0159]

[0160] 1-2-5.S. cerevisiae - Vigna unguiculataleghemoglobin plasmid production method

[0161] The pESC-vunLegHb backbone was constructed using the BamHI restriction enzyme. The pESC-vunLegHb insert was constructed using pPICzαA-vunLegHb as a template using the LP-25 and LP-30 primers. Subsequently, pESC-vubLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 2F).

[0162]

[0163] 1-3.P. Method for producing a plasmid with a signal peptide change (MFα → HS) of pastoris plasmid

[0164] Afterwards, an additional plasmid was constructed to change the existing signal peptide. The existing MFα signal peptide was changed to the HS signal peptide (Fig. 3A).

[0165]

[0166] 1-3-1.P. pastoris-Glycinin maxleghemoglobin C2 signal peptide alteration plasmid construction method

[0167] The backbone of pPICzαA-HS-gmaLegHb was constructed using primers LP-01 and LP-13. The pPICzαA-HS-gmaLegHb insert was constructed using a codon-optimized synthesized gblock. The synthesized Glycinin maxleghemoglobin C2 gblock was used as a template to construct the pPICzαA-HS-gmaLegHb insert using primers LP-14 and LP-04. Subsequently, pPICzαA-HS-gmaLegHb was constructed using the Gibson Assembly Kit from NEB (Fig. 3B).

[0168]

[0169] 1-3-2. Method for constructing a plasmid that changes the signal peptide of P. pastoris-Cicer arietinumleghemoglobin-1-like

[0170] The backbone of pPICzαA-HS-carLegHb was constructed using primers LP-01 and LP-13. The pPICzαA-HS-carLegHb insert was constructed using a codon-optimized synthesized gblock. The synthesized Cicer arietinum leghemoglobin-1-like gblock was used as a template to construct the pPICzαA-HS-carLegHb insert using primers LP-15 and LP-06. Subsequently, pPICzαA-HS-carLegHb was constructed using the Gibson Assembly Kit from NEB (Fig. 3C).

[0171]

[0172] 1-3-3. Method for constructing a plasmid that alters the signal peptide of P. pastoris-Vigna radiata var. radiataleghemoglobin-2

[0173] The backbone of pPICzαA-HS-vraLegHb was constructed using primers LP-01 and LP-13. The pPICzαA-HS-vraLegHb insert was constructed using a codon-optimized synthesized gblock. Using the synthesized Vigna radiata var. radiataleghemoglobin-2 gblock as a template, the pPICzαA-HS-vraLegHb insert was constructed using primers LP-16 and LP-08. Subsequently, pPICzαA-HS-vraLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 3D).

[0174]

[0175] 1-3-4.P. pastoris-Trifolium pratenseleghemoglobin signal peptide alteration plasmid construction method

[0176] The backbone of pPICzαA-HS-tprLegHb was constructed using primers LP-01 and LP-13. The pPICzαA-HS-tprLegHb insert was constructed using a codon-optimized synthesized gblock. Using the synthesized Trifolium pratenseleghemoglobin gblock as a template, the pPICzαA-HS-tprLegHb insert was constructed using primers LP-17 and LP-10. Subsequently, pPICzαA-HS-tprLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 3E).

[0177]

[0178] 1-3-5. P. pastoris - Method for constructing a plasmid that changes the signal peptide of Vigna unguiculataleghemoglobin

[0179] The backbone of pPICzαA-HS-vunLegHb was constructed using primers LP-01 and LP-13. The pPICzαA-HS-vunLegHb insert was constructed using a codon-optimized synthesized gblock. Using the synthesized Vigna unguiculataleghemoglobin gblock as a template, the pPICzαA-HS-vunLegHb insert was constructed using primers LP-18 and LP-12. Subsequently, pPICzαA-HS-vunLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 3F).

[0180]

[0181] 1-4.P. Method for producing a plasmid with a signal peptide change (MFα → AN) of pastoris plasmid

[0182] An additional plasmid was constructed by changing the existing MFα signal peptide to the AN signal peptide (Fig. 4A).

[0183]

[0184] 1-4-1.P. pastoris-Glycinin maxleghemoglobin C2 signal peptide alteration plasmid construction method

[0185] The backbone of pPICzαA-AN-gmaLegHb was constructed using primers LP-01 and LP-19. The pPICzαA-AN-gmaLegHb insert was constructed using a codon-optimized synthesized gblock. The synthesized Glycinin maxleghemoglobin C2 gblock was used as a template to construct the pPICzαA-AN-gmaLegHb insert using primers LP-20 and LP-04. Subsequently, pPICzαA-AN-gmaLegHb was constructed using the Gibson Assembly Kit from NEB (Fig. 4B).

[0186]

[0187] 1-4-2.P. pastoris-Cicer arietinumleghemoglobin-1-like signal peptide alteration plasmid construction method

[0188] The backbone of pPICzαA-AN-carLegHb was constructed using primers LP-01 and LP-19. The pPICzαA-AN-carLegHb insert was constructed using a codon-optimized synthesized gblock. Using the synthesized Cicer arietinum leghemoglobin-1-like gblock as a template, the pPICzαA-AN-carLegHb insert was constructed using primers LP-21 and LP-06. Subsequently, pPICzαA-AN-carLegHb was constructed using the Gibson Assembly Kit from NEB (Fig. 4C).

[0189]

[0190] 1-4-3. Method for constructing a plasmid that alters the signal peptide of P. pastoris-Vigna radiata var. radiataleghemoglobin-2

[0191] The backbone of pPICzαA-AN-vraLegHb was constructed using primers LP-01 and LP-19. The pPICzαA-AN-vraLegHb insert was constructed using a codon-optimized synthesized gblock. Using the synthesized Vigna radiata var. radiataleghemoglobin-2 gblock as a template, the pPICzαA-AN-vraLegHb insert was constructed using primers LP-22 and LP-08. Subsequently, pPICzαA-AN-vraLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 4D).

[0192]

[0193] 1-4-4.P. pastoris- Method for constructing a plasmid that alters the signal peptide of Trifolium pratenseleghemoglobin

[0194] The backbone of pPICzαA-AN-tprLegHb was constructed using primers LP-01 and LP-19. The pPICzαA-AN-tprLegHb insert was constructed using a codon-optimized synthesized gblock. Using the synthesized Trifolium pratenseleghemoglobin gblock as a template, the pPICzαA-AN-tprLegHb insert was constructed using primers LP-23 and LP-10. Subsequently, pPICzαA-AN-tprLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 4E).

[0195]

[0196] 1-4-5.P. pastoris-Vigna unguiculataleghemoglobin signal peptide alteration plasmid construction method

[0197] The backbone of pPICzαA-AN-vunLegHb was constructed using primers LP-01 and LP-19. The pPICzαA-AN-vunLegHb insert was constructed using a codon-optimized synthesized gblock. Using the synthesized Vigna unguiculataleghemoglobin gblock as a template, the pPICzαA-AN-vunLegHb insert was constructed using primers LP-24 and LP-12. Subsequently, pPICzαA-AN-vunLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 4F).

[0198]

[0199] 1-5. Method for constructing a plasmid with a signal peptide change (MFα → HS) in S. cerevisiae plasmid

[0200] Afterwards, an additional plasmid was created to change the existing signal peptide. The existing MFα signal peptide was changed to the HS signal peptide.

[0201]

[0202] 1-5-1. S. cerevisiae- Glycinin maxleghemoglobin C2 signal peptide alteration plasmid construction method

[0203] The backbone of pESC-HS-gmaLegHb was constructed using the BamHI restriction enzyme. The pESC-HS-gmaLegHb insert was constructed using pPICzαA-gmaLegHb as a template and the LP-31 and LP-26 primers. Subsequently, pESC-HS-gmaLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 5A).

[0204]

[0205] 1-5-2. S. cerevisiae-Cicer arietinumleghemoglobin-1-like signal peptide alteration plasmid construction method

[0206] The pESC-HS-carLegHb backbone was constructed using the BamHI restriction enzyme. The pESC-HS-carLegHb insert was constructed using pPICzαA-carLegHb as a template and the LP-31 and LP-27 primers. Subsequently, pESC-HS-carLegHb was constructed using the NEB Gibson Assembly Kit. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 5B).

[0207]

[0208] 1-5-3. Method for constructing a plasmid that alters the signal peptide of S. cerevisiae-Vigna radiata var. radiataleghemoglobin-2

[0209] The pESC-HS-vraLegHb backbone was constructed using the BamHI restriction enzyme. The pESC-HS-vraLegHb insert was constructed using pPICzαA-vraLegHb as a template and the LP-31 and LP-28 primers. Subsequently, pESC-HS-vraLegHb was constructed using the NEB Gibson Assembly Kit. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 5C).

[0210]

[0211] 1-5-4. S. cerevisiae- Method for constructing a plasmid that alters the signal peptide of Trifolium pratenseleghemoglobin

[0212] The pESC-HS-tprLegHb backbone was constructed using the BamHI restriction enzyme. The pESC-HS-tprLegHb insert was constructed using pPICzαA-tprLegHb as a template and the LP-31 and LP-29 primers. Subsequently, pESC-HS-tprLegHb was constructed using the NEB Gibson Assembly Kit. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 5D).

[0213]

[0214] 1-5-5. S. cerevisiae- Method for constructing a plasmid that alters the signal peptide of Vigna unguiculataleghemoglobin

[0215] The pESC-HS-vunLegHb backbone was constructed using the BamHI restriction enzyme. The pESC-HS-vunLegHb insert was constructed using pPICzαA-vunLegHb as a template and the LP-31 and LP-30 primers. Subsequently, pESC-HS-vunLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 5E).

[0216]

[0217] 1-6. Method for constructing a plasmid with a signal peptide change (MFα → AN) in S. cerevisiae plasmid

[0218] An additional plasmid was constructed by changing the existing MFα signal peptide to the AN signal peptide. The backbone of pESC-AN-gmaLegHb was constructed using the BamHI restriction enzyme.

[0219]

[0220] 1-6-1. S. cerevisiae- Glycinin maxleghemoglobin C2 signal peptide alteration plasmid construction method

[0221] The pESC-AN-gmaLegHb insert was constructed using pPICzαA-gmaLegHb as a template and the LP-32 and LP-26 primers. Subsequently, pESC-AN-gmaLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 6A).

[0222]

[0223] 1-6-2. S. cerevisiae-Cicer arietinumleghemoglobin-1-like signal peptide alteration plasmid construction method

[0224] The pESC-AN-carLegHb backbone was constructed using the BamHI restriction enzyme. The pESC-AN-carLegHb insert was constructed using pPICzαA-carLegHb as a template and the LP-32 and LP-27 primers. Subsequently, pESC-AN-carLegHb was constructed using the NEB Gibson Assembly Kit. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 6B).

[0225]

[0226] 1-6-3. Method for constructing a plasmid that alters the signal peptide of S. cerevisiae-Vigna radiata var. radiataleghemoglobin-2

[0227] The pESC-AN-vraLegHb backbone was constructed using the BamHI restriction enzyme. The pESC-AN-vraLegHb insert was constructed using pPICzαA-vraLegHb as a template and the LP-32 and LP-28 primers. Subsequently, pESC-AN-vraLegHb was constructed using the Gibson Assembly Kit from NEB. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 6C).

[0228]

[0229] 1-6-4. S. cerevisiae- Method for constructing a plasmid that alters the signal peptide of Trifolium pratenseleghemoglobin

[0230] The pESC-AN-tprLegHb backbone was constructed using the BamHI restriction enzyme. The pESC-AN-tprLegHb insert was constructed using pPICzαA-tprLegHb as a template and the LP-32 and LP-29 primers. Subsequently, pESC-AN-tprLegHb was constructed using the NEB Gibson Assembly Kit. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 6D).

[0231]

[0232] 1-6-5. S. cerevisiae- Method for constructing a plasmid that alters the signal peptide of Vigna unguiculataleghemoglobin

[0233] The pESC-AN-vunLegHb backbone was constructed using the BamHI restriction enzyme. The pESC-AN-vunLegHb insert was constructed using pPICzαA-vunLegHb as a template and the LP-32 and LP-30 primers. Subsequently, pESC-AN-vunLegHb was constructed using the NEB Gibson Assembly Kit. Detailed experimental methods followed the Gibson Assembly Kit Protocol (Fig. 6E).

[0234] 식물 유래의 HCG 발현 plasmid 제작을 위한 PCR 프라이머No.PrimersSequences 5’→3’Seq NO.LP-01pPICzαA backbone FGTTTGTAGCCTTAGACATGAC1LP-02pPICzαA backbone RAGCTTCAGCCTCTCTTTTCT2LP-03pPICzαA-gma insert FgaaaagagaggctgaagctGGTGCCTTCACAGAAAAAC3LP-04pPICzαA-gma insert RtcatgtctaaggctacaaacTTAATGATGATGATGATGATGGAAGGCTTTCTTGATTGC4LP-05pPICzαA-car insert FagaaaagagaggctgaagctGGATTTTCCGAGAAACAG5LP-06pPICzαA-car insert RtcatgtctaaggctacaaacTTAATGATGATGATGATGATGGTTCATGGCTTTTTTGATC6LP-07pPICzαA-vra insert FagaaaagagaggctgaagctGTTGCCTTCAGTGACAAG7LP-08pPICzαA-vra insert RtcatgtctaaggctacaaacCTAATGATGATGATGATGATGGTAAGCCTTCTTAATTGC8LP-09pPICzαA-tpr insert FagaaaagagaggctgaagctGTTTTTACGGAGAAACAGG9LP-10pPICzαA-tpr insert RtcatgtctaaggctacaaacTCAATGATGATGATGATGATGGTTCATTGCCTTTTTGATC10LP-11pPICzαA-vun insert FagaaaagagaggctgaagctGTGGCGTTTTCCGATAAA11LP-12pPICzαA-vun insert RtcatgtctaaggctacaaacCTAATGATGATGATGATGATGGTAGGCTTTCTTAATCGC12LP-13pPICzαA HS backbone RAGAGTAAGCAGAAGAGAAAA13LP-14pPICzαA-HS-gma insertFttttctcttctgcttactctGGTGCCTTCACAGAAAAA14LP-15pPICzαA-HS-car insert FttttctcttctgcttactctGGATTTTCCGAGAAACAG15LP-16pPICzαA-HS-vra insert FttttctcttctgcttactctGTTGCCTTCAGTGACAA16LP-17pPICzαA-HS-tpr insert FttttctcttctgcttactctGTTTTTACGGAGAAACAGG17LP-18pPICzαA-HS-vun insert FttttctcttctgcttactctGTGGCGTTTTCCGATAAA18LP-19pPICzαA AN backbone RAGCCAAAGCAGGTGCAG19LP-20pPICzαA-AN-gma insert FtcgctgcacctgctttggctGGTGCCTTCACAGAAAAA20LP-21pPICzαA-AN-car insert FtcgctgcacctgctttggctGGATTTTCCGAGAAACAG21LP-22pPICzαA-AN-vra insert FtcgctgcacctgctttggctGTTGCCTTCAGTGACAA22LP-23pPICzαA-AN-tpr insert FtcgctgcacctgctttggctGTTTTTACGGAGAAACAGG23LP-24pPICzαA-AN-vun insert FtcgctgcacctgctttggctGTGGCGTTTTCCGATAAA24LP-25pESC-insert FgtcaaggagaaaaaaccccgATGAGATTTCCTTCAATT25LP-26pESC-gma insert RctatagtgagtcgtattacgCTAATGATGATGATGATGATGGAAGGCTTTCTTGATTGC26LP-27pESC-car insert RctatagtgagtcgtattacgCTAATGATGATGATGATGATGGTTCATGGCTTTTTTGA27LP-28pESC-vra insertRctatagtgagtcgtattacgCTAATGATGATGATGATGATGGTAAGCCTTCTTAATTGCCG28LP-29pESC-tpr insert RctatagtgagtcgtattacgCTAATGATGATGATGATGATGGTTCATTGCCTTTTTG29LP-30pESC-vun insert RctatagtgagtcgtattacgCTAATGATGATGATGATGATGGTAGGCTTTCTTAATCGC30LP-31pESC-HS-insert FgtcaaggagaaaaaaccccgATGAAGTGGGTTACCTTT31LP-32pESC-AN-insert FgtcaaggagaaaaaaccccgATGGTCGCTTGGTGGT32

[0235] 코돈 최적화된 식물 유래의 HCG 서열Gene nameSequence 5’→3’Seq NO.Glycinin maxleghemoglobin C2 (gmaLegHb)GGTGCCTTCACAGAAAAACAAGAGGCTCTGGTTAGTTCCAGCTTTGAAGCCTTCAAAGCGAACATACCCCAGTACTCAGTAGTATTCTATACATCAATCCTTGAGAAGGCACCAGCAGCTAAAGACTTATTTTCATTCCTATCTAATGGGGTTGATCCATCTAACCCCAAACTGACCGGACACGCCGAGAAGTTATTCGGGCTTGTTAGGGATTCCGCAGGACAGTTGAAAGCTAACGGGACGGTAGTCGCTGATGCAGCTCTTGGTTCAATACACGCACAAAAAGCAATCACCGATCCTCAATTCGTTGTGGTGAAGGAGGCGTTATTAAAAACTATAAAGGAAGCTGTCGGGGATAAGTGGTCTGACGAGCTGTCCTCTGCTTGGGAAGTCGCATATGATGAGTTGGCCGCAGCAATCAAGAAAGCCTTC33Cicer arietinumleghemoglobin-1-like(carLegHb)GGATTTTCCGAGAAACAGGAAGCACTAGTGAATAGCAGTTGGGAATCATTCAAGCAAAACATACCGCAATATAGCGTTTTGTTTTATACCTTCATCTTGGAAA AGGCCCCGGCGGTCAAAGATCTTTTCAGCTTCCTAAAGGATACGGCTGGAATCCAAGACAGTCCTAAGTTGCAAGCGCACGCCGAAAAGGTGTTCGGCCTAGTGAGAGATAGCG CCATCCAATTGAGAGCCAAAGGTGAAGTGGTATTGGGAGATACCCTTATCAGTTATCCACGTACAGAAAGGAGTGATCGATCCGCATTTTGTAGTAGTAAGAAGCTCTTT TGAAAACCATCAAAGAGGCTACTGGCGACAAGTGGTCAGAGGAACTAAACACTGCTTGGGAGGTCGCCTATGAACTAGCTACAGCGATCAAAAAAGCCATGAAC34Vigna radiata var. radiatalehemoglobin-2 (vraLegHb)GTTGCCTTCAGTGACAAGCAAGAGGCGTTAGTTAACGGTGCATACGAAGCCTTTAAGGCGGATATACCAAAGTATTCCGTGTGTTCTACACTTCAATATTAG AGAAGGCACCGGCGGCGAAGAATTTGTTCTCATTTTTAGCGAATGGAGTAGATCCCAGTAACCCCAAGCTGACTGCTCACGCAGAAAAGTTATTCGGACTGGTGCGTGACAGT GCAGCGCAATTAAAGGCAAGTGGTGCTGTTGTCGCTGATGCGGCCCTTGGAGCTGTTCATAGTCAGAAAGCAGTGAATGCACAGTTTTTGGTAGTGAAGAGGCGCTTGT AAAAACATTAAAAGAGGCCGTGGGTGCGAAATGGTCCGATGAGCTGTCAGGTGCCGTAGAGGTAGCTTACGATGAACTGGCGGCGGCAATTAAGAAGGCTTAC35Trifolium pratenseleghemoglobin(tprLegHb)GTTTTTACGGAGAAACAGGAGGCGCTTGTAAATGGGTCCTGGGAGAGTTTTAAGCAAAACTTACCTCAGTACAGCGTCCTGTTTTACACGTTTGTCCTGGAGAAAGCACCTGCCGCCAAAGATCTTTTCTCTTTTTTGAAGGACACCCCGAGCGTCCAATATAGCCCGAAGTTACATGCCCACGCAGAGAAAGTCTTTGGTCTGGTGAGGGATAGCGCAGTTCAACTTAGGGCCAAAGGGGAGGTTGTATTGGGGGACGCGACGCTTGGAGCCGTTCACGTGCAGAAGGGGGTGGCCGGACCGCACTTCGTCGTAGTTAAAGAAGCGTTATTAAAAACGATTAAGGAGGTAGCCGGTGATAAATGGTCTGAAGAGCTGTCAACAGCCTGGGAGGTAGCGTATGACGAGCTAGCAACCGCGATCAAAAAGGCAATGAAC36Vigna unguiculataleghemoglobin (vunLegHb)GTGGCGTTTTCCGATAAACAGGAAGGATTGGTGAACGGTGCATACGAAGCCTTTAAAGCTGACATCCCTAAGTACAGCGTCGTGTTTTATACGACGATACTAGAGAAAGCGCCTGCCGCAAAGAATCTTTTTTCCTTCCTTGCAAATGGAGTAGATGCCACTAATCCAAAGCTAACCGGACACGCGGAGAAATTATTCGGTCTAGTCAGGGATTCAGCCGCGCAACTTAGAGCATCTGGGGGTGTGGTCGCTGACGCAGCTCTAGGTGCGGTGCATAGTCAAAAAGCGGTCAACGACGCCCAGTTTGTTGTGGTTAAAGAGGCGCTGGTAAAGACTTTAAAGGAAGCGGTCGGGGACAAGTGGAGTGATGAGCTAGGGACCGCAGTCGAACTAGCCTACGATGAATTGGCGGCAGCGATTAAGAAAGCCTAC37

[0236] 상기 유전자는 시작 및 종결 코돈이 제외된 것이다.

[0237]

[0238] Signal peptide sequenceGene nameSequence 5'→3'Seq NO.,Alpha factor (MFα)ATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGA AGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCT38serum albumin (HS)ATGAAGTGGGTTACCTTTATCTCTTTGTTGTTTCTTTTCTCTTCTGCTTACTCT39α-amylase (AN)ATGGTCGCTTGGTGGTCTTTGTTTCTGTACGGTCTTCAGGTCGCTGCACCTGCTTTGGCT40

[0239]

[0240] Plant-derived HCG expression plasmid Name Description pESC-uraGALp, CYC1t, URA3, Amp R pESC-αF-gmaLegHbE. coli-S. cerevisiaeshuttle vector, GALp, CYC1t, URA3, Amp R , α-factor signal peptide, Glycinin maxleghemoglobin C2pESC-αF-carLegHbE. coli-S. cerevisiaeshuttle vector, GALp, CYC1t, URA3, Amp R, α-factor signal peptide,Cicer arietinumLeghemoglobin-1-like genepESC-αF-vraLegHbE. coli-S. cerevisiae shuttle vector, GALp, CYC1t, URA3, Amp R , α-factor signal peptide,Vigna radiata var. radiataleghemoglobin-2 genepESC-αF-tprLegHbE. coli-S. cerevisiae shuttle vector, GALp, CYC1t, URA3, Amp R , α-factor signal peptide,Trifolium pratenseleghemoglobin genepESC-αF-skinLegHbE. coli-S. cerevisiae shuttle vector, GALp, CYC1t, URA3, Amp R , α-factor signal peptide,Glycinein maxleghemoglobin C2pESC-HS-gmaLegHbE. coli-S. cerevisiae shuttle vector, GALp, CYC1t, URA3, Amp R , Human serum albumin signal peptide,Glycinin maxleghemoglobin C2pESC-HS-carLegHbE. coli-S. cerevisiae shuttle vector, GALp, CYC1t, URA3, Amp R , Human serum albumin signal peptide,Cicer arietinumLeghemoglobin-1-like genepESC-HS-vraLegHbE. coli-S. cerevisiae shuttle vector, GALp, CYC1t, URA3, Amp R, Human serum albumin signal peptide,Vigna radiata var. radiataleghemoglobin-2 genepESC-HS-tprLegHbE. coli-S. cerevisiae shuttle vector, GALp, CYC1t, URA3, Amp R , Human serum albumin signal peptide,Trifolium pratenseleghemoglobin genepESC-HS-skinLegHbE. coli-S. cerevisiae shuttle vector, GALp, CYC1t, URA3, Amp R , Human serum albumin signal peptide,Glycinin maxleghemoglobin C2pESC-AN-gmaLegHbE. coli-S. cerevisiae shuttle vector, GALp, CYC1t, URA3, Amp R ,A. nigerα-amylase signal peptide,Glycinin maxleghemoglobin C2pESC-AN-carLegHbE. coli-S. cerevisiae shuttle vector, GALp, CYC1t, URA3, Amp R ,A. nigerα-amylase signal peptide,Cicer arietinumLeghemoglobin-1-like genepESC-AN-vraLegHbE. coli-S. cerevisiae shuttle vector, GALp, CYC1t, URA3, Amp R ,A. nigerα-amylase signal peptide,Vigna radiata var. radiataleghemoglobin-2 genepESC-AN-tprLegHbE. coli-S. cerevisiae shuttle vector, GALp, CYC1t, URA3, Amp R,TO. nigerα-amylase signal peptide,Trifolium pratenseleghemoglobin genepESC-AN-vunLegHbE. coli-S. coli cerevisiaeshuttle vector, GALp, CYC1t, URA3, Amp R ,TO. nigerα-amylase signal peptide,Glycinin maxleghemoglobin C2pPICzαAE. coli-Pichiashuttle vector, AOX1p, AOX1t, Zeo R pPICzαA-αF-gmaLegHbE. coli-P. pastorisshuttle vector, AOX1p, AOX1t, Zeo R , α-factor signal peptide, Glycinin maxleghemoglobin C2pPICzαA-αF-carLegHbE. coli-P. pastorisshuttle vector, AOX1p, AOX1t, Zeo R , α-factor signal peptide, Cicer arietinumLeghemoglobin-1-like genepPICzαA-αF-vraLegHbE. coli-P. pastorisshuttle vector, AOX1p, AOX1t, Zeo R , α-factor signal peptide, Vigna radiata var. radiata, hemoglobin-2 gene, pPICzαA-αF-tpr, LegHbE. coli-P. pastoris shuttle vector, AOX1p, AOX1t, Zeo R , α-factor signal peptide,Trifolium pratenseleghemoglobin genepPICzαA-αF-vunLegHbE. coli-P. pastorisshuttle vector, AOX1p, AOX1t, Zeo R , α-factor signal peptide, Vigna unguiculataleghemoglobin gene pPICzαA-HS-gmaLegHbE. coli-P. pastoris shuttle vector, AOX1p, AOX1t, Zeo R , Human serum albumin signal peptide,Glycinin maxleghemoglobin C2pPICzαA-HS-carLegHbE. coli-P. pastorisshuttle vector, AOX1p, AOX1t, Zeo R , Human serum albumin signal peptide,Cicer arietinumLeghemoglobin-1-like genepPICzαA-HS-vraLegHbE. coli-P. pastorisshuttle vector, AOX1p, AOX1t, Zeo R , Human serum albumin signal peptide, Vigna radiata var. radiataleghemoglobin-2 genepPICzαA-HS-tprLegHbE. coli-P. pastorisshuttle vector, AOX1p, AOX1t, Zeo R , Human serum albumin signal peptide,Trifolium pratenseleghemoglobin genepPICzαA-HS-vunLegHbE. coli-P. pastorisshuttle vector, AOX1p, AOX1t, Zeo R , Human serum albumin signal peptide, Vigna unguiculata leghemoglobin gene pPICzαA-AN-gmaLegHbE. coli-P. pastoris shuttle vector, AOX1p, AOX1t, Zeo R,TO. nigerα-amylase signal peptide,Glycinin maxleghemoglobin C2pPICzαA-AN-carLegHbE. coli-P. pastorisshuttle vector, AOX1p, AOX1t, Zeo R ,TO. nigerα-amylase signal peptide,Cicer arietinumLeghemoglobin-1-like genepPICzαA-AN-vraLegHbE. coli-P. pastorisshuttle vector, AOX1p, AOX1t, Zeo R ,TO. nigerα-amylase signal peptide,Vigna radiata var. radiataleghemoglobin-2 genepPICzαA-AN-tprLegHbE. coli-P. pastorisshuttle vector, AOX1p, AOX1t, Zeo R ,TO. nigerα-amylase signal peptide,Trifolium prateneseleghemoglobin genepPICzαA-AN-vunLegHbE. coli-P. pastorisshuttle vector, AOX1p, AOX1t, Zeo R ,TO. nigerα-amylase signal peptide,Vigna unguiculataleghemoglobin gene

[0241]

[0242]

[0243] 실시예 2. HCG injection. shepherd(=K. phaffii)와S. cerevisiae균주 제작

[0244] The plant-based HCG expression plasmid constructed in Example 1 was transformed into P. pastoris X-33 and S. cerevisiae D452-2 strains. The P. pastoris X-33 transformation method followed the Pichia expression kit from Invitrogen, and the S. cerevisiae D452-2 strain transformation method followed the High-efficiency yeast transformation using the LiAc / SS carrier DNA / PEG method (R Daniel Gietz & Robert H Schiestl, 2007, NATURE PROTOCOLS) (Fig. 7).

[0245]

[0246] Example 3. Confirmation of expression of produced HCG protein

[0247] 3-1. Culture method for expression of HCG in P. pastoris (=K. phaffii) strain

[0248] Culture was performed to express HCG in the P. pastoris strain. The strain transformed with HCG in the P. pastoris strain was pre-cultured in 5 ml of BMGY medium (Buffered Glycerol complex medium, 1% yeast extract, 2% peptone, 100 mM potassium phosphate pH 6.0, 1.34% yeast nitrogen base, 0.00004% biotin, 1% glycerol) with zeocin. The pre-cultured strain was inoculated at 1% concentration in 100 ml of BMGY medium and cultured for 24 hours. Afterwards, the cells cultured on BMGY medium were inoculated into BMMY medium (Buffered Methanol complex medium, 1% yeast extract, 2% peptone, 100 mM potassium phosphate pH 6.0, 1.34% yeast nitrogen base, 0.00004% biotin, 0.5% methanol) at the same OD and cultured at 30°C and 200 rpm for 72 hours. The detailed method followed the Pichia expression kit from Invitrogen.

[0249]

[0250] 3-2. Culture method for HCG expression in S. cerevisiae strains

[0251] Culture was performed for the expression of HCG in S. cerevisiae strain. The strain transformed with HCG was pre-cultured in 5 ml of minimal (SC) medium (6.7 g / L yeast nitrogen base without amino acids and 0.6 g / L complete supplement mixture without histidine, leucine, tryptophan, and uracil) with histidine, leucine, and tryptophan. The pre-cultured strain was inoculated at 1% in 50 ml of minimal (SC) medium containing histidine, leucine, and tryptophan and cultured for 24 hours. Afterwards, the cells cultured in minimal (SC) medium were inoculated in YP medium (10 g / L yeast extract, 20 g / L peptone) with 20 g / L galactose and adjusted to the same OD to 30 o C, cultured at 200 rpm for 72 hours.

[0252]

[0253] Example 4: Confirmation of expression of HCG recombinant protein when hemin was added to the culture medium.

[0254] 4-1. Experimental method

[0255] During the expression of the HCG recombinant protein gene in the P. pastorisX-33 strain, 10 μM of hemin was added to the BMMY medium for 30 o C, cultured for 72 hours at 200 rpm. During the expression of the HCG recombinant protein gene in the S. cerevisiae CEN.PK 2-1C strain, 10 μM hemin was added to the YP glactose medium and 30 oC, cultured for 72 hours at 200 rpm. In Example 2, hemin was added during the expression of the HCG recombinant protein-expressing P. pastoris X-33 and S. cerevisiae CEN.PK 2-1C strains to confirm the difference in secretion expression rate (Fig. 8).

[0256]

[0257] 4-2. Experimental Results

[0258] Through the above experimental method, it was confirmed that when hemin was added together, the expression level of HCG recombinant protein increased in P. pastorisX-33 and S. cerevisiaeCEN.PK 2-1C strains.

[0259] Specifically, in the P. pastoris X-33 strain, it was confirmed that the expression levels of the HCG recombinant protein significantly increased when hemin was added to the Vigna radiata var. radiataleghemoglobin-2 (vra) and Glycinin maxleghemoglobin C2 (C2) proteins in the above experiment. In the S. cerevisiae CEN.PK 2-1C strain, it was confirmed that the expression levels of the HCG recombinant protein significantly increased when hemin was added to the Vigna radiata var. radiataleghemoglobin-2 (vra) protein in the above experiment.

[0260]

[0261] Example 5: Confirmation of expression of Leghemoglobin protein when heme produced by Bacillus was added to the culture medium.

[0262]

[0263] 5-1. Experimental method

[0264] During the expression of the HCG recombinant protein gene in the P. pastorisX-33 strain, heme produced by a heme-producing Bacillus strain was added to the BMMY medium for 30 oC, cultured for 72 hours at 200 rpm. During the expression of the HCG recombinant protein gene in the S. cerevisiae CEN.PK 2-1C strain, heme produced by the Bacillus strain was added to the YP glactose medium and 30 o C, cultured for 72 hours at 200 rpm. In Example 2, the HCG recombinant protein expression P. pastoris X-33 and S. cerevisiae CEN.PK 2-1C strains were expressed, and the difference in expression rate was confirmed by adding heme produced by Bacillus (Fig. 9).

[0265]

[0266] 5-2. Experimental Results

[0267] As a result of conducting experiments using the above method, it was confirmed that when Bacillus-derived heme was added together, the expression level of HCG recombinant protein in P. pastoris X-33 and S. cerevisiae CEN.PK 2-1C increased in some cases, but there were also cases where there was no significant difference. In addition, it was confirmed that the increase in expression rate was lower compared to when hemin was added to the medium used in Example 4.

[0268]

[0269]

[0270] Example 6. Purification of HCG recombinant protein

[0271] Based on the experiments of the above examples, the HCG recombinant proteins expressed by each vector were purified and obtained. Upon confirming the results, it was confirmed that each EP tube became opaque due to the HCG recombinant proteins obtained from each strain (Figs. 10 and 11).

[0272]

[0273] Example 7. Enhancement of expression of HCG recombinant protein in S. cerevisiae D452-2 strain

[0274] In the experiments of the above examples, the expression of the HCG recombinant protein was confirmed in S. cerevisiae CEN.PK 2-1C. Subsequently, the yeast strain was changed to S. cerevisiae D452-2 to express the same HCG recombinant protein, and the change in the expression level was confirmed. When the expression rates of the HCG recombinant protein of S. cerevisiae CEN.PK 2-1C and S. cerevisiae D452-2 strains were compared, some HCG proteins (vra, tpr, C2) showed higher expression levels in the D452-2 strain. Therefore, the HCG expression level may be controlled by changing the yeast strain (Fig. 12).

[0275]

[0276] Example 8. Results of HCG expression according to signal peptide substitution in P. pastoris (=K. phaffii) and S. cerevisiae strains

[0277] The supernatant cultured in Example 3 was purified for His-Tag through a Ni-NTA column. The protein purified using the Ni-NTA column was added with 2x Laemmli sample buffer and 98 o C for 10 minutes. The protein sample was loaded onto a 15% SDS-page gel and the bands were confirmed. The exogenous expression of HCG produced in P. pastoris by introducing three different signal peptides was confirmed through SDS-PAGE (Fig. 13). The exogenous expression of HCG produced in S. cerevisiae by introducing three different signal peptides was confirmed through SDS-PAGE (Fig. 14).

[0278]

[0279] Example 9. Comparison of expression rates according to signal peptides of HCG using Image-J.

[0280] Using Image-J, the protein thickness of the SDS-PAGE gel was measured to confirm the difference in expression rate when three signal peptides were introduced. The difference in expression rate according to the three signal peptides of HCG produced in P. pastoris was confirmed by measuring the band thickness (Fig. 15). The difference in expression rate according to the three signal peptides of HCG produced in S. cerevisiae was confirmed by measuring the band thickness (Fig. 16). In the case of S. cerevisiae strains, there were differences in the signal peptides showing high expression rates for each HCG. On the other hand, in the case of P. pastoris strains, the signal peptide of MFα showed a high expression rate in all HCGs.

[0281]

[0282]

[0283] Example 10. Quantification of produced HCG

[0284] HCG purified using His-Tag was quantified using the Bradford protein assay. The overall protein production concentration differences according to the three signal peptides of HCG produced in the P. pastoris strain were confirmed (Fig. 17). The overall protein production concentration differences according to the three signal peptides of HCG produced in the S. cerevisiae strain were confirmed (Fig. 18). These results were similar to those confirmed in Example 9.

[0285]

[0286] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0287]

[0288] The present invention relates to expressing a heme containing globin (hereinafter, HCG) recombinant protein in yeast, and provides a method for producing and overexpressing HCG. In addition, the present invention provides that HCG produced through the above method can be used as a material for food compositions, medical compositions, and health functional foods.

[0289]

[0290] Attach an electronic file of the sequence list

Claims

1. A shuttle vector comprising one or more genes selected from the group consisting of a promoter gene, an antibiotic resistance gene, a cellular respiration gene, and a marker gene; and A recombinant plasmid comprising a primer and a plant-derived Heme Containing Globin (HCG) gene.

2. In claim 1, A recombinant plasmid, wherein the recombinant plasmid further comprises a base sequence encoding a signal peptide.

3. A recombinant plasmid according to claim 2, wherein the signal peptide is an MFα signal peptide (α-factor signal peptide, MFα signal peptide), an HS signal peptide (human serum albumin signal peptide, HS signal peptide), or an AN signal peptide (A. nigerα-amylase signal peptide, AN signal peptide).

4. In claim 1, The above recombinant plasmid is a recombinant plasmid for transformation of a strain.

5. A recombinant strain for producing Heme Containing Globin (HCG), transformed with the recombinant plasmid of paragraph 1.

6. A method for producing HCG recombinant protein comprising the following steps: (a) a step of producing a recombinant plasmid of claim 1; (b) a step of transforming the recombinant plasmid produced in step (a) into a strain; (c) a step of growing and proliferating the transformed strain in a culture medium; (d) a step of confirming the expression of the HCG recombinant protein produced from the above-mentioned propagated strain; and (e) A step of isolating and purifying the HCG recombinant protein from the amplified strain and the culture medium of the strain.

7. In claim 6, A method wherein the recombinant plasmid of step (a) further comprises a signal peptide.

8. A food composition comprising HCG produced from the recombinant strain of claim 5.

9. An experimental composition comprising HCG produced from the recombinant strain of claim 5.

Citation Information

Patent Citations

  • Method for increasing exogenous gene expression quantity and Chlamydomonas reinhardtii hydrogen production quantity by codon optimization

    CN102146344A

  • Access control device to prevent accidents caused by flooding of tunnels and underpasses

    KR1020220034999A

  • Multilayer electronic component

    KR1020230050233A

  • surgical instrument and assembling methods for surgical instrument

    KR1020230108795A

  • Electronic apparatus for playing a plurality of videos at the same time and control method thereof

    KR1020240058512A