Composition comprising a GLP1r agonist and engineered extracellular vesicles comprising adiponectin, and uses thereof

WO2025186434A8PCT designated stage Publication Date: 2025-10-02CILOA +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/056259
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-07
Filing Date
2025-03-07
Publication Date
2025-10-02

AI Technical Summary

Technical Problem

Current adiponectin therapies are lacking due to challenges in large-scale production of native functional forms and the short half-life of adiponectin, limiting its availability for clinical applications in treating conditions like diabetes, obesity, and cardiovascular disease.

Method used

A composition comprising GLP1R agonists and engineered extracellular vesicles with adiponectin polypeptides on their surface, which can be produced in high amounts and maintained in native multimerized forms, offering a stable therapeutic option.

Benefits of technology

The combination effectively reduces fat mass, increases muscle mass, regulates glucose and insulin levels, and reverses insulin resistance, providing a valuable treatment for various metabolic and inflammatory conditions.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention relates to a composition comprising (i) at least one GLP1 receptor (GLP1R) agonist and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at its outer surface. It further relates to the use of said composition as a medicament, and in particular, for treating various diseases.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOSITION COMPRISING A GLP1R AGONIST AND ENGINEERED EXTRACELLULAR VESICLES COMPRISING ADIPONECTIN, AND USES THEREOFFIELD OF INVENTION

[0001] The present invention relates to a composition comprising (i) at least one GLP1 receptor (GLP1R) agonist and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at its outer surface. It further relates to the use of said composition as a medicament, and in particular, for treating various diseases.BACKGROUND OF INVENTION

[0002] Adipose tissue is an endocrine organ that secretes a wide variety of bioactive proteins (adipokines) and lipids, among which adiponectin is one of the most abundant adipokines. Adiponectin is a 244 amino acid cytokine, that is mainly found in oligomeric complexes. Adiponectin is known to exert beneficial effects in various human and animal conditions, including insulin resistance, cardiovascular disease, inflammatory conditions and cancer. Thus, adiponectin is a promising candidate for drug development of various diseases.

[0003] Despite this promising aspect, there are currently no adiponectin therapies available for clinical testing. Indeed, large-scale production of adiponectin native functional forms, including post-translational modifications and proper highly multimerized complex assembly, is a daunting task. Combined with the short half-life of adiponectin, no production strategy supplying high levels of bioactive adiponectin at a reasonable price exists. Therefore, alternative approaches providing multimeric native active forms of adiponectin are then awaited.

[0004] The inventors have found that adiponectin can be produced in high amounts and in native highly multimerized forms when anchored in the membrane of extracellular vesicles or when associated at the surface of extracellular vesicles, and that theseadiponectin-rich extracellular vesicles can be purified and stored in characterized and qualified batches.

[0005] In addition, the inventors demonstrated that these adiponectin-rich extracellular vesicles, when combined with GLPl-receptor agonists, and administered to a Diet induced obese DIO / NASH mouse model, were able to reduce fat mass, increase muscle mass, regulate glucose and insulin levels, and reverse insulin resistance.

[0006] Therefore, the combination of adiponectin-rich extracellular vesicles and GLP1R agonist of the present invention would be a valuable tool for the treatment of various human conditions that benefit from adiponectin, such as, for example, diabetes, obesity and associated metabolic disease, insulin resistance, cardiovascular disease, inflammatory conditions, fibrosis, retinopathies and cancer.SUMMARY

[0007] The present invention relates to a composition comprising (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle.

[0008] The composition may further comprise at least one pharmaceutically acceptable excipient.

[0009] The (i) at least one GLP1R agonist may be at least one chimeric GLP1 polypeptide exposed at the outer surface of at least one engineered extracellular vesicle.

[0010] The at least one chimeric GLP1 polypeptide and the at least one adiponectin polypeptide may be exposed at the outer surface of the same engineered extracellular vesicle or at the outer surface of different engineered extracellular vesicles.

[0011] The at least one GLP1R agonist may be selected from albenatide, albiglutide, beinaglutide, cotadutide, danuglipron, dulaglutide, ecnoglutide, efinopegdutide,efpeglenatide, exenatide, froniglutide, gulgafafusp alfa, liraglutide, lixisenatide, lotiglipron, maridebart cafraglutide, mazdutide, orforglipron, pegloxenatide, pegsebrenatide, pegapamodutide, pemvidutide, retatrutide, semaglutide, survodutide, taspoglutide, tirzepatide, utreglutide, vurolenatide, and combinations thereof.

[0012] The at least one GLP1R agonist may be semaglutide.

[0013] The at least one adiponectin polypeptide may be at least one wild-type adiponectin polypeptide, or at least one chimeric adiponectin polypeptide.

[0014] The at least one chimeric adiponectin polypeptide may comprise: i) an amino acid sequence of adiponectin or a variant thereof, preferably of wild-type adiponectin or a variant thereof, ii) an amino acid sequence of a transmembrane domain of a transmembrane protein, and iii) an amino acid sequence of a pilot peptide.

[0015] The at least one chimeric adiponectin polypeptide may comprise: i) an amino acid sequence of wild-type human adiponectin, comprising the amino acid sequence with SEQ ID NO: 1, SEQ ID NO: 3, or a variant thereof, ii) an amino acid sequence of a transmembrane domain of CD8 comprising the amino acid sequence with SEQ ID NO: 6, SEQ ID NO: 7, or a variant thereof, or an amino acid sequence of a transmembrane domain of CD40L comprising the amino acid sequence with SEQ ID NO: 4, SEQ ID NO: 5, or a variant thereof, and iii) an amino acid sequence of a pilot peptide comprising the amino acid sequence with SEQ ID NO: 8, or a variant thereof.

[0016] The at least one chimeric adiponectin polypeptide may comprise the amino acid sequence with SEQ ID NO: 16, SEQ ID NO: 18, or a variant thereof.

[0017] The present invention also relates to a kit-of-parts comprising: (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle.

[0018] The present invention also relates to the composition, or the kit-of-parts, or a combination of (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, for use as a medicament.

[0019] The present invention further relates to the composition, or the kit-of-parts, or a combination of (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, for use in the treatment of a disease, disorder, or condition selected from obesity, insulin resistance, type 1 diabetes, type 2 diabetes, metabolic syndrome, cardiovascular disease, nonalcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), metabolic dysfunction-associated steatotic liver disease (MASLD), metabolic dysfunction- associated steatohepatitis (MASH), polycystic ovary syndrome, Alzheimer’s disease, cancer, hypertension, dyslipidemia, hyperuricemia, atherosclerosis, coronary artery disease, stroke, peripheral artery disease, fibrosis, inflammatory pulmonary diseases, nephrotic disease, sleep apnea, dry eye diseases, inflammatory ocular diseases, retinopathies, gastritis, gastro-esophageal reflux disease, inflammatory bowel disease, pancreatitis, osteoporosis, inflammatory bone diseases, inflammatory joint diseases, Myasthenia gravis, inflammatory skin disease, inherited myopathies, acquired myopathies, and bone repair.

[0020] The disease, disorder, or condition may be selected from obesity, insulin resistance, type 1 diabetes, type 2 diabetes, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), metabolic dysfunction-associated steatotic liver disease (MASLD), and metabolic dysfunction-associated steatohepatitis (MASH).

[0021] The (i) at least one GLP1R agonist, and the (ii) at least one engineered extracellular vesicle may be administered simultaneously, separately or sequentially.DEFINITIONS

[0022] In the present invention, the following terms have the following meanings:

[0023] As used herein, the use of “a” and “an” means “at least one” or “one or more” unless the context clearly dictates otherwise. It should be noted that the term “and” or the term “or” are generally employed in their sense including “and / or” unless the context clearly dictates otherwise.

[0024] “About” preceding a figure encompasses plus or minus 10%, or less, of the value of said figure. It is to be understood that the value to which the term “about” refers is itself also specifically, and preferably, disclosed.

[0025] “Adiponectin” is a protein that is primarily derived from adipocytes. As used herein, the term “adiponectin” includes adiponectin from any species that produces adiponectin. In humans, adiponectin is encoded by the AD1POQ gene. In the NCBI databases, the reference human AD1POQ gene sequence corresponds to NCBI Gene ID: 9370, as updated on February 19, 2024. The human AD1POQ gene consists of 4 exons on chromosome 3q27.3, and encodes a 244 amino acid protein precursor referenced as NP_004788.1, in the NCBI databases. The adiponectin precursor protein corresponds to the amino acid sequence SEQ ID NO: 3, which is processed in vivo into its mature form with SEQ ID NO: 1, after cleavage of its signal peptide (which corresponds to SEQ ID NO: 2). Alternatives names for adiponectin include “Adiponectin, C1Q And Collagen Domain Containing”, “ACDC”, “ADPN”, “APM1”, “APM-1”, “ApMl”, “ApM-1”, “GBP28”, “ACRP30”, “ADIPQTL1”, “30 kDa adipocyte complement-related protein”, “Adipocyte complement-related 30 kDa protein”, “Adipocyte, Clq And Collagen Domain-Containing Protein”, “ADIPQTL1”, as non-limiting examples.

[0026] “CD8” refers to a transmembrane glycoprotein that serves as a co-receptor for the T cell receptor (TCR). In mouse, CD8 transmembrane domain comprises an amino acid sequence with SEQ ID NO: 6.

[0027] “CD40 ligand” (also called “CD40L” or “CD154”) refers to a transmembrane protein, member of the tumor necrosis factor (TNF) superfamily. In humans, CD40L transmembrane domain comprises an amino acid sequence with SEQ ID NO: 4.

[0028] “Chimeric”, when referring to a polypeptide, refers to a polypeptide that combines several domains of at least two different types by their function and / or by their cellular localization, wherein the at least two of these domains come either from distinct proteins of the same or different species, or from the same protein of different species.

[0029] “Diabetes” refers to a metabolic disease characterized by a chronic excess of sugar (glucose) in the blood, also referred to as "diabetes mellitus". One of the criteria used to diagnose diabetes is a fasting glycemia level greater than 1.26 g / L of blood (or about 7 mmol / L of blood). There are several types of diabetes:- “type 1 diabetes”, also called “juvenile diabetes”, is characterized by the disappearance in children or young adults of the P cells of the islets of Langerhans of the pancreas, which produce insulin (autoimmune disease); and- “type 2 diabetes”, also called “noninsulin-dependent diabetes”, is characterized by the gradual onset of insulin resistance (z.e., when the response of insulin-sensitive cells to insulin is diminished). Insulin resistance is symptomized by the decrease of glucose uptake by fat tissues and muscles and the decrease of hepatic glucose production inhibition. At a more advanced stage, type 2 diabetes can lead to insulin deficiency, i.e., a failure to synthesize insulin by endocrine pancreatic cells.

[0030] “Domain”, when referring to a protein or a polypeptide, refers to a region having a structural and / or functional property for said protein or polypeptide. As used herein, a “transmembrane domain” refers to a functional region of a protein or polypeptide that spans the phospholipid bilayer of a biological membrane.

[0031] ‘ ‘Engineered’ ’ , when referring to an extracellular vesicle, refers to an extracellular vesicle which has been produced from producer cells transfected ortransduced either with (i) a vector expressing a specific chimeric polypeptide (i.e., a chimeric adiponectin polypeptide and / or a chimeric GLP1 polypeptide as described herein), or (ii) a vector encoding wild-type adiponectin. Such engineered extracellular vesicles express the normal surface molecules from the producer cells, in addition to either (i) the chimeric polypeptide used to transfect or transduce the producer cells (i.e., a chimeric adiponectin polypeptide or a chimeric GLP1 polypeptide as described herein), or (ii) the wild- type adiponectin used to transfect or transduce the producer cells.

[0032] “ESCRT” or “endosomal sorting complexes required for transport’’ refers originally to a cellular machinery made up of five multi-subunit protein complexes, which act cooperatively at specialized endosomes to facilitate the movement of specific cargoes from the limiting membrane into vesicles that bud into the endosome lumen. This machinery is hijacked by several envelope viruses to bud from cellular membranes, including the plasma membrane.

[0033] “Exosome” refers to a subtype of extracellular vesicle that is produced in the endosomal compartment of eukaryotic cells (Thery el al., 2018. J Extracell Vesicles. 7(l):1535750; Yanez-M6 et al., 2015. J Extracell Vesicles. 4:27066; van Niel et al., 2018. Nat Rev Mol Cell Biol. 19(4) :213-228). Exosomes are surrounded by a lipid bilayer with proteins derived from the origin cell, such as typically, the CD81, CD63 and CD9 markers. Exosomes are secreted by all cell types in both physiological and pathological conditions, and their size typically ranges from 30 to 150 nm in diameter.

[0034] “Extracellular vesicle” refers to any vesicle composed of a lipid bilayer that is naturally released from a cell and comprises a cytosolic fraction of said cell. This expression in particular includes vesicles secreted into the extracellular space, i.e., “exosomes”. Examples of extracellular vesicles include, but are not limited to, small extracellular vesicles (sEV), large extracellular vesicles (1EV), micro vesicles, microvesicle-like particles, prostasomes, exosomes, dexosomes, texosomes, ectosomes, oncosomes, microparticles, apoptotic bodies. Extracellular vesicles are heterogeneous in size with diameters ranging from about 10 nm to about 5000 nm, but also in biogenesis pathway or cellular source.

[0035] “GLP-1” or “glucagon-like peptide 1” or “GLP1” refer to a 30- or 31-amino acid long peptide hormone deriving from the post-translational processing of the proglucagon preproprotein. In the NCBI databases (https: / / www.ncbi.nlm.nih.gov), the reference human GCG or glucagon gene sequence corresponds to NCBI Gene ID: 2641, as updated on February 5, 2024. The human GCG gene consists of 6 exons on chromosome 2q24.2, and encodes a 180 amino acid pro-glucagon preproprotein referenced as NP_002045.1, in the NCBI databases. The pro-glucagon preproprotein is post-translationally processed in a tissue-specific manner in pancreatic A cells and intestinal L cells and cleaved into several distinct mature peptides. Glucagon (which represents amino acids 53 to 81 of the protein referenced as NP_002045.1) is cleaved in pancreatic A cells, while, GLP-1 (1-37) (which represents amino acids 98 to 128 of the protein referenced as NP_002045.1), GLP-2 (which represents amino acids 146 to 178 of the protein referenced as NP_002045.1), glicentin (which represents amino acids 21 to 89 of the protein referenced as NP_002045.1), and oxyntomodulin (which represents amino acids 53 to 89 of the protein referenced as NP_002045.1) are cleaved in the intestinal L cells. GLP-1 (1-37) is further N-terminally truncated by post-translational processing in the intestinal L cells resulting in the two truncated and equipotent biologically active forms, “GLP1 (7-37)” and “GLP1 (7-36) amide”. GLP1 is secreted by the intestinal L-cells and is able to decrease blood sugar levels in a glucose-dependent manner by enhancing the secretion of insulin. The reference human GLP1 (7-37) corresponds to SEQ ID NO: 22, while the reference human GLP1 (7-36) amide corresponds to SEQ ID NO: 23.

[0036] “GLP-1 receptor” or “GLP-1R” refer to a G protein-coupled receptor found on beta cells of the pancreas and on neurons of the brain. GLP-1R is involved in the control of blood sugar level by enhancing insulin secretion. In the NCBI databases, the reference human GLP-1R gene sequence corresponds to NCBI Gene ID: 2740, as updated on February 12, 2024. The human GLP-1R gene consists of 14 exons on chromosome 6p21.2, and encodes a 463 amino acid protein referenced as NP_002053, in the NCBI databases. Alternatives names for GLP-1R include “Glucagon Like Peptide 1 Receptor”, “GLP1R”, “Glucagon-Like Peptide 1 Receptor”, “GLP-1 Receptor”, “GLP1 Receptor”, “GLP-1 -R”, as non-limiting examples.

[0037] “GLP1R agonists” or “GLP1 receptor agonists”, also known as “GLP1 analogs” or “incretin mimetics” refer to agonists of the GLP-1 receptor (GLP1R) and represent a class of drugs that reduce blood sugar levels by activating the GLP-1 receptor. GLP1R agonists mimic the actions of the endogenous incretin hormone GLP1.

[0038] “Insulin resistance” refers to the inability of a known quantity of exogenous or endogenous insulin to increase glucose uptake and utilization in a subject as much as it does in a normal population.

[0039] “Identity” or “identical”, when used herein in a relationship between the sequences of two or more amino acid sequences, or of two or more nucleic acid sequences, refers to the degree of sequence relatedness between amino acid sequences or nucleic acid sequences, as determined by the number of matches between strings of two or more amino acid residues or nucleic acid residues. “Identity” measures the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (z.e., “algorithms”). Identity of related amino acid sequences or nucleic acid sequences can be readily calculated by known methods. Preferred methods for determining identity are designed to give the largest match between the sequences tested. Methods of determining identity are described in publicly available computer programs. Preferred computer program methods for determining identity between two sequences include the GCG program package, including GAP (Genetics Computer Group, University of Wisconsin, Madison, WI; Devereux et al., 1984. Nucleic Acids Res. 12(1 Pt l):387-95), BLASTP, BLASTN, and FASTA (Altschul et al., 1990. J Mol Biol. 215(3):403-10). The BLASTX program is publicly available from the National Center for Biotechnology Information (NCBI) and other sources (BLAST Manual, Altschul et al. NCB / NLM / NIH Bethesda, Md. 20894). The well-known Smith Waterman algorithm may also be used to determine identity.

[0040] “Isolated” and any declensions thereof, as well as “purified” and any declensions thereof, are used interchangeably, and mean that a molecular entity to which it refers (e.g., a polypeptide, a nucleic acid, an extracellular vesicle, etc.) is substantially free of other components (z.e. , of contaminants) found in the natural environment in whichsaid molecular entity is normally found. Preferably, an isolated or purified molecular entity (e.g., an isolated or purified extracellular vesicle, etc.) is substantially free of other molecular entities with which it is associated in a cell. By “substantially free”, it is meant that said isolated or purified molecular entity represents more than 50% of a heterogeneous composition (z.e., is at least 50% pure), preferably, more than 60%, more than 70%, more than 80%, more than 90%, more than 95%, and more preferably still more than 98% or 99%. Purity can be evaluated by various methods known by the one skilled in the art, including, but not limited to, chromatography, gel electrophoresis, immunoassay, composition analysis, biological assay, and the like.

[0041] “Linker” or “spacer” interchangeably refer to an amino acid sequence, typically a synthetic amino acid sequence, that connects or links two peptide or polypeptide sequences together. Linkers typically connect two peptide or polypeptide sequences via peptide bonds. Linkers are well-known in the art; see., e.g., Chen et al., 2013 (Adv Drug Deliv Rev . 65(10): 1357-1369) or Klein et al., 2014 (Protein Eng Des Sei. 27(10):325-330). Examples of suitable linkers include so-called “GS linkers” or “Gly-Ser linkers”, i.e., amino acid sequences essentially consisting of glycine (G) and serine (S) residues, and usually - but not always - comprising two or more repeats of a peptide motif. GS linkers are well-known and widely used in the art, in particular for their flexibility properties. The GS linker may comprise or consist of an amino acid sequence (GxS)y or (SGx)y, wherein x ranges from 1 to 5 or more, such as 1, 2, 3, 4, 5 or more; and y ranges from 1 to 8 or more, such as 1, 2, 3, 4, 5, 6, 7, 8 or more. The GS linker with amino acid sequence (GxS)yor (SGx)ymay further comprise one or several additional G and / or S residues in N-terminal and / or in C-terminal. Another example of suitable linker includes so-called “glycine linkers”, i.e., amino acid sequences essentially consisting of glycine (G) residues. Glycine linkers are well-known and widely used in the art, in particular for their flexibility properties. The glycine linker may comprise or consist of an amino acid sequence (G)z, wherein z ranges from 1 to 10 or more, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more.

[0042] “Obesity” (or overweight) refers to a chronic disease (as recognized by the World Health Organization since 1997), defined as an abnormal or excessiveaccumulation of body fat which can be harmful to health. Still according to the World Health Organization, the definition of obesity is based on the measurement of the body mass index (BMI =height2)> classifying the disease into 3 levels: "overweight" if 25 kg / m2< BMI < 30 kg / m2; “obesity” if 30 kg / m2< BMI < 40 kg / m2; and “morbid obesity” if 40 kg / m2< BMI.

[0043] “Pilot peptide” refers to a peptide that interact with ESCRT proteins. Said pilot peptide is capable of being addressed to membrane vesicles, in particular to exosome-forming vesicles, or to the cell compartment(s) involved in the formation of membrane vesicles, and in particular of exosome-forming vesicles in eukaryotic cells.

[0044] “Selected from” is used herein according to common patent application drafting terminology, to introduce a list of elements among which one or more item(s) is (are) selected. Any occurrence of “selected from” in the specification may be replaced by “selected from the group comprising or consisting of’ and reciprocally without changing the meaning thereof.

[0045] “Subject” refers to a mammal, preferably a human. A subject may be a “patient”, i.e., a warm-blooded animal, more preferably a human, who / which is awaiting the receipt of, or is receiving medical care or was / is / will be the object of a medical procedure, or is monitored for the development of a disease.

[0046] “Sub-membrane targeting domain” or “membrane targeting domain” or “membrane recruitment domain” are used interchangeably to refer to a domain capable of, in a cell and in particular in a eukaryotic cell (e.g., in an exosome-producing cell), to anchor itself to a cell membrane and / or a vesicular membrane without being inserted into said membrane, said anchoring being achieved by means of one or more anchoring molecule(s) and / or by interactions (e.g., electrostatic interactions) between the submembrane targeting domain and the membrane. The sub-membrane targeting domain may be capable of binding to, or interacting with, the inner surface of the cell membrane (i.e., the cytoplasmic side of the cell membrane) and / or with the inner surface of vesicular membranes i.e., the lumen side of the vesicular membrane).

[0047] “Therapeutically effective amount” refers to the level or amount of a combination, composition, pharmaceutical composition, medicament, components of a kit-of-parts, etc. that is aimed at, without causing significant negative or adverse side effects to the target, (1) delaying or preventing the onset of a disease, disorder, or condition; (2) slowing down or stopping the progression, aggravation, or deterioration of one or more symptoms of the disease, disorder, or condition; (3) bringing about ameliorations of the symptoms of the disease, disorder, or condition; (4) reducing the severity or incidence of the disease, disorder, or condition; or (5) curing the disease, disorder, or condition. A therapeutically effective amount may be administered prior to the onset of the disease, disorder, or condition, for a prophylactic or preventive action. Alternatively, or additionally, the therapeutically effective amount may be administered after initiation of the disease, disorder, or condition, for a therapeutic action.

[0048] “Transfected” or “transduced”, as used herein, refers to a process by which exogenous nucleic acid is transferred or introduced into a host cell. A “transfected” or “transduced” cell is one which has been transfected or transduced, respectively, with exogenous nucleic acid in order to express either (i) a chimeric polypeptide (i.e., a chimeric adiponectin polypeptide or a chimeric GLP1 polypeptide as described herein), or (ii) a wild-type adiponectin as described herein.

[0049] “Transmembrane protein” refers to a protein which comprises at least one transmembrane domain, allowing it to be anchored in the phospholipid bilayer of a biological membrane. A transmembrane domain is generally hydrophobic -helical, and can contain several, in particular 2, 3, 4, 5, 6, 7, 8, 9 or 10, or even 20 or more, hydrophobic a-helices. It can also be arranged in a [3-sheet, e.g., in a [3-barrel structure typically composed of 8 to 22 [3-strands. The transmembrane proteins can also be classified according to the position of the N- and C-terminal on the different sides of the lipid layers: Types I, II, III and IV. Type I transmembrane proteins are anchored to the lipid membrane with a stop-transfer anchor sequence and have their N-terminal domains targeted to the (ER) during synthesis (and the extracellular space, if mature forms are located on cell membranes). Type II and III are anchored with a signal-anchor sequence, with type II being targeted to the ER lumen with its C-terminal domain, while type IIIhave their N-terminal domains targeted to the ER lumen. Type IV is subdivided into IV- A, with their N-terminal domains targeted to the cytosol and IV-B, with an N-terminal domain targeted to the lumen.

[0050] “Treating” or “treatment” or “alleviation” refers to a therapeutic treatment, to a prophylactic (or preventative) treatment, or to both a therapeutic treatment and a prophylactic (or preventative) treatment; wherein the object is to prevent or slow down (lessen) one or more of the symptom(s) or manifestation(s) of the targeted pathologic condition or disorder. Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder is to be prevented. A subject may be successfully “treated” for a disease, disorder, or condition if, after receiving a therapeutic amount of a combination, composition, pharmaceutical composition, medicament, or components of a kit-of-parts, etc. as described herein, the subject shows at least one of the following: relief to some extent of one or more of the symptoms associated with the disease, disorder, or condition to be treated; reduced morbidity and mortality; and improvement in quality-of-life issues. The above parameters for assessing successful treatment and improvement in the disease are readily measurable by routine procedures familiar to a physician.DETAILED DESCRIPTION

[0051] The present invention relates to a composition comprising (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle.

[0052] The composition may comprise, consist essentially of, or consist of (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle.

[0053] As used herein, “consist essentially of’ or “consisting essentially of’, with reference to a composition, means that the at least one GLP1R agonist and the at least oneengineered extracellular vesicle are the only therapeutic agents or agents with a biological activity within said composition.

[0054] The at least one GLP1R agonist may be at least one chimeric GLP1 polypeptide exposed at the outer surface of at least one engineered extracellular vesicle.

[0055] The at least one chimeric GLP1 polypeptide and the at least one adiponectin polypeptide may be exposed at the outer surface of the same engineered extracellular vesicle, or at the outer surface of different engineered extracellular vesicles.

[0056] The at least one chimeric GLP1 polypeptide and the at least one adiponectin polypeptide may be exposed at the outer surface of the same engineered extracellular vesicle.

[0057] The at least one chimeric GLP1 polypeptide and the at least one adiponectin polypeptide may be exposed at the outer surface of different engineered extracellular vesicles.

[0058] The at least one chimeric GLP1 polypeptide may comprise, in any order: i) an amino acid sequence of GLP1, or a variant thereof, ii) an amino acid sequence of a transmembrane domain of a transmembrane protein, and iii) an amino acid sequence of a pilot peptide, i.e., a peptide interacting with the Endosomal Sorting Complexes Required for Transport (ESCRT) cellular machinery.

[0059] Components i), ii) and iii) may be organized in the at least one chimeric GLP1 polypeptide from N- to C-terminal or from C- to N-terminal.

[0060] The at least one chimeric GLP1 polypeptide may comprise an amino acid sequence of GLP1, preferably human GLP1.

[0061] The at least one chimeric GLP1 polypeptide may comprise an amino acid sequence of wild-type human GLP1.

[0062] The amino acid sequence of GLP1 may comprise or consist of the amino acid sequence of wild-type human GLP1, such as wild-type human GLP1 (7-37) or wild-type human GLP1 (7-36) amide. The wild-type human GLP1 may comprise or consist of the amino acid sequence with SEQ ID NO: 22, SEQ ID NO: 23, or a variant thereof.

[0063] The amino acid sequence of GLP1 may comprise or consist of the amino acid sequence with SEQ ID NO: 22, or a variant thereof. The amino acid sequence of GLP1 may comprise or consist of the amino acid sequence with SEQ ID NO: 23, or a variant thereof.

[0064] A variant of the amino acid sequence with SEQ ID NO: 22 or SEQ ID NO: 23 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 22 or SEQ ID NO: 23.

[0065] Alternatively, the at least one chimeric GLP1 polypeptide may comprise or consist of the amino acid sequence of a mutant GLP1, preferably a mutant human GLP1.

[0066] In particular, the mutant human GLP1 may be a wild-type human GLP1 modified with one or several mutation(s), such as one or several amino acid substitution(s). Such mutation(s) allow to stabilize the GLP1 peptide, and in particular confer resistance to dipeptidyl peptidase IV (DPP-IV) degradation.

[0067] Thus, the amino acid sequence of GLP1 with SEQ ID NO: 22 or SEQ ID NO: 23 may comprise at least one amino acid substitution. In particular, the at least one amino acid substitution in the sequence of GLP1 with SEQ ID NO: 22 or SEQ ID NO: 23 may be a substitution of the alanine residue at position 2, preferably a substitution of the alanine residue at position 2 with a glycine residue.

[0068] The amino acid sequence of GLP1 may comprise or consist of the amino acid sequence with SEQ ID NO: 24, or a variant thereof.

[0069] A variant of the amino acid sequence with SEQ ID NO: 24 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %,80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 24.

[0070] The amino acid sequence of GLP1 may comprise of consist of the amino acid sequence with SEQ ID NO: 24.

[0071] The chimeric GLP1 polypeptide may comprise an amino acid sequence of a transmembrane domain of a transmembrane protein.

[0072] The transmembrane domain may be a transmembrane domain of a transmembrane protein of type I. Said transmembrane domain of a transmembrane protein of type I may be used in a chimeric GLP1 polypeptide as described herein, wherein the components i), ii) and iii), are organized in the chimeric GLP1 polypeptide from N- to C- terminal.

[0073] The transmembrane domain may be the transmembrane domain of CD8.

[0074] The transmembrane domain may be a transmembrane domain of a transmembrane protein of type II. Said transmembrane domain of a transmembrane protein of type II may be used in a chimeric GLP1 polypeptide as described herein, wherein the components i), ii) and iii), are organized in the chimeric GLP1 polypeptide from C- to N- terminal.

[0075] The transmembrane domain may be a transmembrane domain of CD40 ligand (CD40L).

[0076] The transmembrane domain may be the transmembrane domain of CD40 ligand (CD40L) or CD8.

[0077] The transmembrane domain of CD40L may comprise or consist of an amino acid sequence with SEQ ID NO: 4, SEQ ID NO: 5, or a variant thereof. The transmembrane domain of CD40L may comprise or consist of an amino acid sequence with SEQ ID NO: 4, or a variant thereof. The transmembrane domain may comprise or consist of an amino acid sequence with SEQ ID NO: 5, or a variant thereof.

[0078] The transmembrane domain of CD8 may comprise or consist of an amino acid sequence with SEQ ID NO: 6, SEQ ID NO: 7, or a variant thereof. The transmembrane domain of CD8 may comprise or consist of an amino acid sequence with SEQ ID NO: 6, or a variant thereof. The transmembrane domain may comprise or consist of an amino acid sequence with SEQ ID NO: 7, or a variant thereof.

[0079] A variant of the amino acid sequence with SEQ ID NO: 4, 5, 6 or 7 comprises an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 4, 5, 6 or 7.

[0080] The chimeric GLP1 polypeptide may comprise an amino acid sequence of a peptide interacting with the Endosomal Sorting Complexes Required for Transport (ESCRT) cellular machinery; otherwise known as “Pilot Peptide”.

[0081] Said pilot peptide may be capable of being addressed to the membrane vesicles, in particular to the exosome-forming vesicles, or to the cell compartment(s) involved in the formation of the membrane vesicles, and in particular the exosome-forming vesicles in eukaryotic cells.

[0082] When integrated into a chimeric polypeptide, such as the chimeric GLP1 polypeptide as described herein, the pilot peptide enables the addressing of said chimeric GLP1 polypeptide to the membrane vesicles and / or to their location(s) of formation, and in particular enables the addressing of said chimeric GLP1 polypeptide to the membrane of membrane vesicles, such that said polypeptide can be secreted by a cell in association with the membrane vesicles (in particular exosomes).

[0083] Pilot peptides which interact with ESCRT proteins have been described in granted patents EP 2 268 816, and US 9,546,371, the relevant content of which is incorporated herein by reference.

[0084] The pilot peptide may comprise or consist of an amino acid sequence with SEQ ID NO: 8, or a variant thereof.

[0085] A variant of the amino acid sequence with SEQ ID NO: 8 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 8.

[0086] The chimeric GLP1 polypeptide may further comprise at least one linker.

[0087] The at least one linker may connect the amino acid sequence of GLP1 and the amino acid sequence of the transmembrane domain.

[0088] The at least one linker may connect the amino acid sequence of the transmembrane domain and the amino acid sequence of the pilot peptide.

[0089] The at least one linker may not be cleavable. The at least one linker may be cleavable.

[0090] The at least one linker may be a Gly-Ser linker. Examples of Gly / Ser linkers include, but are not limited to, GS linkers, G2S linkers, G3S linkers, G4S linkers, including repeats and combination thereof.

[0091] The at least one linker may comprise or consist of a (GGGS)nsequence (SEQ ID NO: 9), wherein n is a positive integer ranging from 1 to 10, preferably from 1 to 5.

[0092] The at least one linker may comprise or consist of a (GGGSGGGGS)n sequence (SEQ ID NO: 10), wherein n is a positive integer ranging from 1 to 10, preferably from 1 to 5.

[0093] The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 25, or a variant thereof. The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 11, or a variant thereof. The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 12, or a variant thereof. The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 25, or a variant thereof.

[0094] A variant of the amino acid sequence with SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 25 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 25.

[0095] The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 25. The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 11. The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 12. The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 25.

[0096] The at least one linker connecting the amino acid sequence of GLP1 and the amino acid sequence of the transmembrane domain may comprise the sequence GGGSGGGGSGGGSGGGGSGGGSGGGGSGGGSG (SEQ ID NO: 12). Said linker may be used in a chimeric GLP1 polypeptide as described herein, wherein the components i), ii) and iii) are organized in the chimeric GLP1 polypeptide from N- to C- terminal.

[0097] The at least one linker connecting the amino acid sequence of GLP1 and the amino acid sequence of the transmembrane domain may comprise the sequence GGGSGGGGSGGGSGGGGSGGGSGGGGSGGGSG (SEQ ID NO: 12). Said linker may be used in a chimeric GLP1 polypeptide as described herein, wherein the components i), ii) and iii) are organized in the chimeric GLP1 polypeptide from C- to N- terminal.

[0098] The at least one linker connecting the amino acid sequence of the transmembrane domain and the amino acid sequence of the pilot peptide may comprise the sequence GGSRGS (SEQ ID NO: 25). Said linker may be used in a chimeric GLP1 polypeptide as described herein, wherein components i), ii) and iii) are organized in the chimeric GLP1 polypeptide from C- to N-terminal.

[0099] When the chimeric GLP1 polypeptide comprises more than one linker, two or more linkers may be identical or different.

[0100] The chimeric GLP1 polypeptide may further comprise an amino acid sequence of a signal peptide.

[0101] A signal peptide may be added in a chimeric GLP1 polypeptide as described herein, wherein the components i), ii) and iii) are organized in the chimeric GLP1 polypeptide from N- to C-terminal.

[0102] The signal peptide may comprise or consist of an amino acid sequence with SEQ ID NO: 21, or a variant thereof.

[0103] A variant of the amino acid sequence with SEQ ID NO: 21, may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 21.

[0104] The chimeric GLP1 polypeptide may further comprise an amino acid sequence of an initiator.

[0105] An initiator may be added in a chimeric GLP1 polypeptide as described herein, wherein the components i), ii) and iii) are organized in the chimeric GLP1 polypeptide from C- to N-terminal.

[0106] The initiator may comprise or consist of an amino acid sequence with SEQ ID NO: 26, or a variant thereof.

[0107] A variant of the amino acid sequence with SEQ ID NO: 26, may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 26.

[0108] The chimeric GLP1 polypeptide may comprise, or consist of, in any order: i) an amino acid sequence of GLP1, or a variant thereof, as defined herein; ii) an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein; and iii) an amino acid sequence of a pilot peptide, as defined herein.

[0109] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of GLP1, or a variant thereof, preferably of human GLP1, or a variant thereof, more preferably of mutant human GLP1, or a variant thereof, as defined herein; an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein; an amino acid sequence of a pilot peptide, as defined herein.

[0110] Optionally, one or several linker(s) may be added between the components of the chimeric GLP1 polypeptide as described herein.

[0111] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of GLP1, or a variant thereof, preferably of human GLP1, or a variant thereof, more preferably of mutant human GLP1, or a variant thereof, as defined herein; optionally, an amino acid sequence of a linker; an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein; and an amino acid sequence of a pilot peptide, as defined herein.

[0112] Optionally, a signal peptide may be added to the components of the chimeric GLP1 polypeptide as described herein.

[0113] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a signal peptide as described herein; an amino acid sequence of GLP1, or a variant thereof, preferably of human GLP1, or a variant thereof, more preferably of mutant human GLP1, or a variant thereof, as defined herein; optionally, an amino acid sequence of a linker;an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein; and an amino acid sequence of a pilot peptide, as defined herein.

[0114] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of human GLP1, or a variant thereof, preferably of mutant human GLP1, or a variant thereof, as defined herein, an amino acid sequence of a transmembrane domain of CD8, as defined herein, and an amino acid sequence of a pilot peptide, as defined herein.

[0115] Optionally, one or several linker(s) may be added between the components of the chimeric GLP1 polypeptide as described herein.

[0116] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of human GLP1, or a variant thereof, preferably of mutant human GLP1, or a variant thereof, as defined herein, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD8, as defined herein, and an amino acid sequence of a pilot peptide, as defined herein.

[0117] Optionally, a signal peptide may be added to the components of the chimeric GLP1 polypeptide as described herein.

[0118] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a signal peptide as described herein; an amino acid sequence of human GLP1, or a variant thereof, preferably of mutant human GLP1, or a variant thereof, as defined herein, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD8, as defined herein, and an amino acid sequence of a pilot peptide, as defined herein.

[0119] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of mutant human GLP1 with SEQ ID NO: 24, or a variant thereof, an amino acid sequence of a transmembrane domain of CD8 with SEQ ID NO: 7, or a variant thereof, an amino acid sequence of a pilot peptide with SEQ ID NO: 8, or a variant thereof.

[0120] Optionally, one or several linker(s) may be added between the components of the chimeric GLP1 polypeptide as described herein.

[0121] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of mutant human GLP1 with SEQ ID NO: 24, or a variant thereof, optionally, an amino acid sequence of a linker with SEQ ID NO: 12, or a variant thereof, an amino acid sequence of a transmembrane domain of CD8 with SEQ ID NO: 7, or a variant thereof, and an amino acid sequence of a pilot peptide with SEQ ID NO: 8, or a variant thereof.

[0122] Optionally, a signal peptide may be added to the components of the chimeric GLP1 polypeptide as described herein.

[0123] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a signal peptide with SEQ ID NO: 21, or a variant thereof; an amino acid sequence of mutant human GLP1 with SEQ ID NO: 24, or a variant thereof; an amino acid sequence of a linker with SEQ ID NO: 12, or a variant thereof; an amino acid sequence of a transmembrane domain of CD8 with SEQ ID NO: 7 or a variant thereof; andan amino acid sequence of a pilot peptide with SEQ ID NO: 8, or a variant thereof.

[0124] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a signal peptide with SEQ ID NO: 21; an amino acid sequence of mutant human GLP1 with SEQ ID NO: 24; an amino acid sequence of a linker with SEQ ID NO: 12; an amino acid sequence of a transmembrane domain of CD8 with SEQ ID NO: 7, and an amino acid sequence of a pilot peptide with SEQ ID NO: 8.

[0125] A chimeric GLP1 polypeptide comprising from N-terminal to C-terminal the amino acid sequence with SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 12, SEQ ID NO: 7, and SEQ ID NO: 8 may comprise or consist of an amino acid sequence with SEQ ID NO: 27. Thus, the chimeric GLP1 polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 27, or a variant thereof.

[0126] A variant of the amino acid sequence with SEQ ID NO: 27 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 27.

[0127] The chimeric GLP1 polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 27.

[0128] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a pilot peptide, as defined herein, an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein, and an amino acid sequence of GLP1, or a variant thereof, preferably of human GLP1, or a variant thereof, more preferably of mutant human GLP1, or a variant thereof, as defined herein.

[0129] Optionally, one or several linker(s) may be added between the components of the chimeric GLP1 polypeptide as described herein.

[0130] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a pilot peptide, as defined herein, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of GLP1, or a variant thereof, preferably of human GLP1, or a variant thereof, more preferably of mutant human GLP1, or a variant thereof, as defined herein.

[0131] Optionally, an initiator may be added to the components of the chimeric GLP1 polypeptide as described herein.

[0132] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of an initiator, as defined herein, an amino acid sequence of a pilot peptide, as defined herein, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of GLP1, or a variant thereof, preferably of human GLP1, or a variant thereof, more preferably of mutant human GLP1, or a variant thereof, as defined herein.

[0133] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a pilot peptide, as defined herein, an amino acid sequence of a transmembrane domain of CD40L, as defined herein,an amino acid sequence of human GLP1, or a variant thereof, preferably of mutant human GLP1, or a variant thereof, as defined herein.

[0134] Optionally, one or several linker(s) may be added between the components of the chimeric GLP1 polypeptide as described herein.

[0135] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a pilot peptide, as defined herein, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD40L, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of human GLP1, or a variant thereof, preferably of mutant human GLP1, or a variant thereof, as defined herein.

[0136] Optionally, an initiator may be added to the components of the chimeric GLP1 polypeptide as described herein.

[0137] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of an initiator, as defined herein, an amino acid sequence of a pilot peptide, as defined herein, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD40L, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of human GLP1, or a variant thereof, preferably of mutant human GLP1, or a variant thereof, as defined herein.

[0138] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a pilot peptide with SEQ ID NO: 8, or a variant thereof, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5, or a variant thereof, as defined herein,an amino acid sequence of mutant human GLP1 with SEQ ID NO: 24, or a variant thereof, as defined herein.

[0139] Optionally, one or several linker(s) may be added between the components of the chimeric GLP1 polypeptide as described herein.

[0140] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a pilot peptide with SEQ ID NO: 8, or a variant thereof, optionally, an amino acid sequence of a linker with SEQ ID NO: 25, or a variant thereof, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5, or a variant thereof, as defined herein, optionally, an amino acid sequence of a linker with SEQ ID NO: 12, or a variant thereof, and an amino acid sequence of mutant human GLP1 with SEQ ID NO: 24, or a variant thereof, as defined herein.

[0141] Optionally, an initiator may be added to the components of the chimeric GLP1 polypeptide as described herein.

[0142] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of an initiator with SEQ ID NO: 26, or a variant thereof, an amino acid sequence of a pilot peptide with SEQ ID NO: 8, or a variant thereof, optionally, an amino acid sequence of a linker with SEQ ID NO: 25, or a variant thereof, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5, or a variant thereof, as defined herein, optionally, an amino acid sequence of a linker with SEQ ID NO: 12, or a variant thereof, and an amino acid sequence of mutant human GLP1 with SEQ ID NO: 24, or a variant thereof, as defined herein.

[0143] The chimeric GLP1 polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of an initiator with SEQ ID NO: 26, an amino acid sequence of a pilot peptide with SEQ ID NO: 8, an amino acid sequence of a linker with SEQ ID NO: 25, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5, an amino acid sequence of a linker with SEQ ID NO: 12, and an amino acid sequence of mutant human GLP1 with SEQ ID NO: 24.

[0144] A chimeric GLP1 polypeptide comprising from N-terminal to C-terminal the amino acid sequence with SEQ ID NO: 26, SEQ ID NO: 8, SEQ ID NO: 25, SEQ ID NO: 5, SEQ ID NO: 12, and SEQ ID NO: 24 may comprise or consist of an amino acid sequence with SEQ ID NO: 28. Thus, the chimeric GLP1 polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 28, or a variant thereof.

[0145] A variant of the amino acid sequence with SEQ ID NO: 28 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 28.

[0146] The chimeric GLP1 polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 28.

[0147] The at least one GLP1R agonist may be selected from albenatide, albiglutide, beinaglutide, cotadutide, danuglipron, dulaglutide, ecnoglutide, efinopegdutide, efpeglenatide, exenatide, froniglutide, gulgafafusp alfa, liraglutide, lixisenatide, lotiglipron, maridebart cafraglutide, mazdutide, orforglipron, pegloxenatide, pegsebrenatide, pegapamodutide, pemvidutide, retatrutide, semaglutide, survodutide, taspoglutide, tirzepatide, utreglutide, vurolenatide, and combinations thereof.

[0148] Albenatide is a GLP1R agonist, registered under CAS number 1031700-39-6. Albenatide is a synthetic peptide, analog of the naturally occurring compound exendin-4, which is a 39 amino acid peptide secreted by the salivary glands of the desert Gila monster (Heloderma suspectum), conjugated to recombinant human albumin.

[0149] Albiglutide, also known as Tanzeum, is a GLP1R agonist, registered under CAS number 782500-75-8. Albiglutide is a peptide of 645 amino acids with 17 disulfide bonds, comprising two copies of modified human GLP-1 (7-36)NH2 in which the alanine residue at position 2 is replaced by a glycine residue, fused to human albumin.

[0150] Beinaglutide, also known as Benaglutide or HYBR-014, is a GLP1R agonist, registered under CAS number 123475-27-4. Beinaglutide is a recombinant human GLP1 polypeptide that shares almost 100% homology with human GLP-1 (7-36)NH2.

[0151] Cotadutide, also known as MEDI0382, is a dual GLP1R and glucagon receptor agonist, registered under CAS number 1686108-82-6. Cotadutide is a synthetic oxyntomodulin-like peptide.

[0152] Danuglipron, also known as PF-06882961, is a GLP1R agonist, registered under CAS number 2230198-02-2. Danuglipron is a non-peptide small molecule, which chemical name is 2-[[4-[6-[(4-cyano-2-fluorophenyl)methoxy]pyridin-2-yl]piperidin-l- yl]methyl]-3-[[(2S)-oxetan-2-yl]methyl]benzimidazole-5-carboxylic acid.

[0153] Dulaglutide, also known as LY2189265, is a GLP1R agonist, registered under CAS number 923950-08-7. Dulaglutide is a recombinant human GLP1 polypeptide consisting of GLP1 (7-37) covalently linked to a fragment crystallizable region of a human IgG4.

[0154] Ecnoglutide, also known as XW003, is a GLP1R agonist, registered under CAS number 2459531-73-6. Ecnoglutide is an acylated human GLP-1 analogue.

[0155] Efinopegdutide, also known as MK-6024, is a dual GLP1R and glucagon receptor agonist, registered under CAS number 2055640-93-0. Efinopegdutide is a synthetic peptide of oxyntomodulin conjugated to a fragment crystallizable region of human IgG4.

[0156] Efpeglenatide, also known as HM11260C, is a GLP1R agonist, registered under CAS number 1296200-77-5. Efpeglenatide is a single amino acid-modified exendin-4 conjugated to a fragment crystallizable region of human IgG4 via a 3.4-kDa minipolyethylene glycol linker.

[0157] Exenatide, also known as Byetta or Bydureon, is a GLP1R agonist, registered under CAS number 141758-74-9 and CAS number 141732-76-5. Exenatide is a synthetic 39-amino-acid peptide analog of exendin-4.

[0158] Froniglutide, also known as PB-1023, is a GLP1R agonist, registered under CAS number 1234965-40-2. Froniglutide is a fusion protein comprising GLP1 and elastin-like peptide (ELP)-120.

[0159] Gulgafafusp Alfa is a GLP1R agonist, registered under CAS number 2642374-02-3. Gulgafafusp Alfa is a human IgG2K monoclonal antibody targeting the glucagon-like peptide 1 receptor.

[0160] Liraglutide, also known as Victoza, is a GLP1R agonist, registered under CAS number 204656-20-2. Liraglutide is a lipopeptide that is an analogue of human GLP-1 in which the lysine residue at position 27 is replaced by an arginine residue and a hexadecanoyl group is attached to the remaining lysine via a glutamic acid spacer.

[0161] Lixisenatide, also known as Lyxumia or Adlyxin, is a GLP1R agonist, registered under CAS number 320367-13-3. Lixisenatide is a 44 amino acid peptide with an amide group on its C-terminal end, derived from the first 39 amino acid residues of the exendin- 4 sequence, omitting the proline residue at position 38 and adding six lysine residues.

[0162] Lotiglipron, also known as PF-07081532, is a GLP1R agonist, registered under CAS number 2401892-75-7. Lotiglipron is a small molecule, non-peptide, which chemical name is 2-[[4-[(2S)-2-(5-chloropyridin-2-yl)-2-methyl-l,3-benzodioxol-4- yl]piperidin-l-yl]methyl]-3-[[(2S)-oxetan-2-yl]methyl]benzimidazole-5-carboxylic acid.

[0163] Maridebart cafraglutide, also known as AMG- 133, is a GLP1R agonist and GIPR antagonist, registered under CAS number 2760218-55-9. Maridebart cafraglutide is a bispecific molecule engineered by conjugating a fully human monoclonal anti-human GIPR antagonist antibody to two GLP-1 agonist peptides using amino acid linkers.

[0164] Mazdutide, also known as IBI-362, OXM-3 or LY-3305677, is a dual GLP1R and glucagon receptor agonist, registered under CAS number 2259884-03-0. Mazdutide is a synthetic oxyntomodulin analog.

[0165] Orforglipron, also known as LY-3502970, is a GLP1R agonist, registered under CAS number 2212020-52-3. Orforglipron is a non-peptide small molecule, which chemical name is 3-[(lS,2S)-l-[5-[(4S)-2,2-dimethyloxan-4-yl]-2-[(4S)-2-(4-fluoro-3,5- dimethylphenyl)-3-[3-(4-fluoro-l-methylindazol-5-yl)-2-oxoimidazol-l-yl]-4-methyl- 6,7-dihydro-4H-pyrazolo[4,3-c]pyridine-5-carbonyl]indol-l-yl]-2-methylcyclopropyl]- 4H- 1 ,2,4-oxadiazol-5-one.

[0166] Pegloxenatide, also known as Polyethylene glycol loxenatide, PEG-Loxe orPEX-168, is a GLP1R agonist, registered under CAS number 2420483-82-3.Pegloxenatide is a 44.2-kDa molecule obtained by amino acid substitutions and pegylation of exenatide.

[0167] Pegsebrenatide, also known as NLY01, is a GLP1R agonist, registered under CAS number 2243292-26-2. Pegsebrenatide is a pegylated form of exenatide.

[0168] Pegapamodutide, also known as LY2944876 or OPK-88003, is a dual GLP1R and glucagon receptor agonist, registered under CAS number 1492924-65-8. Pegapamodutide is a peptide analogue of oxyntomodulin.

[0169] Pemvidutide, also known as ALT-801, MD-1373, VPD 1070 or SP-1373, is a dual GLPIR / glucagon receptor agonist, registered under CAS number 2538014-94-5. Pemvidutide is a peptide-based agonist coupled with EuPort™, which is a glycolipid moiety.

[0170] Retatrutide, also known as LY3437943, is a triple agonist peptide of the glucagon receptor (GCGR), glucosedependent insulinotropic polypeptide receptor (GIPR), and glucagon-like peptide- 1 receptor (GLP-1R), registered under CAS number 2381089-83-2.

[0171] Semaglutide is a GLP1R agonist, registered under CAS number 910463-68-2. Semaglutide consists of a 31 -amino acid peptide, analog of GLP1 (7-37) with the alanine residue at position 8 substituted with a 2-aminoisobutyric acid, the lysine residue at position 34 substituted with an arginine residue, and the lysine residue at position 26 acylated for attachment with a C18 fatty diacid through a hydrophilic linker “yGlu- 2xOEG”.

[0172] Survodutide, also known as BI 456906, is a dual GLPIR / glucagon receptor agonist, registered under CAS number 2805997-46-8. Survodutide is a 29-amino-acid peptide with C-terminal amidation, a non-coded amino acid 1 -aminocyclobutane- 1- carboxylic acid (Ac4c) at position 2 and a glycine-serine linker at position 24, carrying a Cl 8 di-acid.

[0173] Taspoglutide, also known as ITM077, R1583 or BIM51077, is GLP1R agonist, registered under CAS number 275371-94-3. Taspoglutide consists of a derivative ofhuman GLP1 (7-36)NH2containing a-aminoisobutyric acid substitutions replacing the alanine residue at position 8 and the glycine residue at position 35 of human GLP-1(7- 36)NH2.

[0174] Tirzepatide, also known as LY3298176, is a dual GLP1R / GIPR agonist, registered under CAS number 2023788-19-2. Tirzepatide consists of a 39 amino acid linear peptide analog of GIP conjugated to a C20 fatty acid moiety by a linker connected to the lysine residue at position 20.

[0175] Utreglutide, also known as GL0034, is a GLP1R agonist, registered under CAS number 2460862-12-6. Utreglutide shares substantial structural similarities with semaglutide, including a substitution of the alanine residue at position 2 with a 2- aminoisobutyric acid, as well as an octadecanedioic acid group to promote reversible albumin binding.

[0176] Vurolenatide, also known as NM-002, is a GLP1R agonist, registered under CAS number 2434640-83-0. Vurolenatide consists of a recombinant fusion protein comprising exenatide and XTEN (unstructured biodegradable polypeptides).

[0177] The at least one GLP1R agonist may be semaglutide.

[0178] The at least one adiponectin polypeptide may be at least one wild-type adiponectin polypeptide, or at least one chimeric adiponectin polypeptide.

[0179] The at least one adiponectin polypeptide may be at least one wild- type adiponectin polypeptide. The at least one adiponectin polypeptide may be at least one wild-type human adiponectin polypeptide. Accordingly, the at least one adiponectin polypeptide may be at least one wild-type human adiponectin polypeptide which comprises or consists of the amino acid sequence with SEQ ID NO: 3, or a variant thereof.

[0180] Said wild-type human adiponectin with SEQ ID NO: 3 comprises a peptide signal with amino acid sequence SEQ ID NO: 2, that is typically cleaved in vivo to form the mature form of the wild- type human adiponectin.

[0181] Hence, the at least one wild- type human adiponectin polypeptide may comprise or consist of the amino acid sequence of the mature form of the wild-type human adiponectin with SEQ ID NO: 1, i.e., wherein the peptide signal with SEQ ID NO: 2 has been cleaved from the wild type human adiponectin with SEQ ID NO: 3.

[0182] Thus, the at least one adiponectin polypeptide may be at least one wild- type human adiponectin polypeptide comprising or consisting of the amino acid sequence with SEQ ID NO: 1, SEQ ID NO: 3, or a variant thereof.

[0183] The at least one adiponectin polypeptide may be at least one wild-type human adiponectin polypeptide comprising or consisting of the amino acid sequence with SEQ ID NO: 1, or a variant thereof.

[0184] The at least one adiponectin polypeptide may be at least one wild- type human adiponectin polypeptide comprising or consisting of the amino acid sequence with SEQ ID NO: 3, or a variant thereof.

[0185] The variant of the amino acid sequence with SEQ ID NO: 1 or SEQ ID NO: 3 may comprise an amino acid sequence sharing at least 70 % sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more sequence identity with the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3.

[0186] The at least one adiponectin polypeptide may be at least one chimeric adiponectin polypeptide.

[0187] The at least one chimeric adiponectin polypeptide may comprise, in any order: i) an amino acid sequence of adiponectin, preferably of wild-type adiponectin, ii) an amino acid sequence of a transmembrane domain of a transmembrane protein, and iii) optionally, an amino acid sequence of a pilot peptide, i.e., a peptide interacting with the Endosomal Sorting Complexes Required for Transport (ESCRT) cellular machinery.

[0188] Components i), ii) and iii) may be organized in the at least one chimeric adiponectin polypeptide from N- to C-terminal or from C- to N-terminal.

[0189] The at least one chimeric adiponectin polypeptide may comprise an amino acid sequence of adiponectin.

[0190] The amino acid sequence of adiponectin may comprise or consist of the amino acid sequence of a wild-type adiponectin.

[0191] The amino acid sequence of adiponectin may comprise or consist of the amino acid sequence of a mutant adiponectin.

[0192] The amino acid sequence of adiponectin may comprise or consist of the amino acid sequence of the wild-type human adiponectin. The wild-type human adiponectin may comprise or consist of the amino acid sequence with SEQ ID NO: 3, or a variant thereof.

[0193] Said wild-type human adiponectin comprises a peptide signal with amino acid sequence SEQ ID NO: 2, that is typically cleaved in vivo to form the mature form of the wild- type human adiponectin.

[0194] Hence, the amino acid sequence of adiponectin may comprise or consist of the amino acid sequence of the mature form of the wild-type human adiponectin with SEQ ID NO: 1, i.e. wherein the peptide signal with SEQ ID NO: 2 has been cleaved from the wild-type human adiponectin with SEQ ID NO: 3.

[0195] The amino acid sequence of adiponectin may comprise or consist of the amino acid sequence with SEQ ID NO: 1, SEQ ID NO: 3, or a variant thereof.

[0196] The amino acid sequence of adiponectin may comprise or consist of the amino acid sequence with SEQ ID NO: 3, or a variant thereof.

[0197] The amino acid sequence of adiponectin may comprise or consist of the amino acid sequence with SEQ ID NO: 1, or a variant thereof.

[0198] A variant of the amino acid sequence with SEQ ID NO: 1 or SEQ ID NO: 3 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3.

[0199] The chimeric adiponectin polypeptide may comprise an amino acid sequence of a transmembrane domain of a transmembrane protein.

[0200] The transmembrane domain may be a transmembrane domain of a transmembrane protein of type I. Said transmembrane domain of a transmembrane protein of type I may be used in a chimeric adiponectin polypeptide as described herein, wherein the components i), ii) and iii), when present, are organized in the chimeric adiponectin polypeptide from N- to C- terminal.

[0201] The transmembrane domain may be the transmembrane domain of CD8.

[0202] The transmembrane domain may be a transmembrane domain of a transmembrane protein of type II. Said transmembrane domain of a transmembrane protein of type II may be used in a chimeric adiponectin polypeptide as described herein, wherein the components i), ii) and iii), when present, are organized in the chimeric adiponectin polypeptide from C- to N- terminal.

[0203] The transmembrane domain may be a transmembrane domain of CD40 ligand (CD40L).

[0204] The transmembrane domain may be the transmembrane domain of CD40 ligand (CD40L) or CD8.

[0205] The transmembrane domain of CD40L may comprise or consist of an amino acid sequence with SEQ ID NO: 4, SEQ ID NO: 5, or a variant thereof. The transmembrane domain of CD40L may comprise or consist of an amino acid sequence with SEQ ID NO: 4, or a variant thereof. The transmembrane domain may comprise or consist of an amino acid sequence with SEQ ID NO: 5, or a variant thereof.

[0206] The transmembrane domain of CD8 may comprise or consist of an amino acid sequence with SEQ ID NO: 6, SEQ ID NO: 7, or a variant thereof. The transmembrane domain of CD8 may comprise or consist of an amino acid sequence with SEQ ID NO: 6, or a variant thereof. The transmembrane domain may comprise or consist of an amino acid sequence with SEQ ID NO: 7, or a variant thereof.

[0207] A variant of the amino acid sequence with SEQ ID NO: 4, 5, 6 or 7 comprises an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 4, 5, 6 or 7.

[0208] The chimeric adiponectin polypeptide may further comprise an amino acid sequence of a peptide interacting with the Endosomal Sorting Complexes Required for Transport (ESCRT) cellular machinery; otherwise known as “Pilot Peptide”.

[0209] Said pilot peptide may be capable of being addressed to the membrane vesicles, in particular to the exosome-forming vesicles, or to the cell compartment(s) involved in the formation of the membrane vesicles, and in particular the exosome-forming vesicles in eukaryotic cells.

[0210] When integrated into a chimeric polypeptide, such as the chimeric adiponectin polypeptide as described herein, the pilot peptide enables the addressing of said chimeric adiponectin polypeptide to the membrane vesicles and / or to their location(s) of formation, and in particular enables the addressing of said chimeric adiponectin polypeptide to the membrane of membrane vesicles, such that said polypeptide can be secreted by a cell in association with the membrane vesicles (in particular exosomes).

[0211] The pilot peptide may comprise or consist of an amino acid sequence with SEQ ID NO: 8, or a variant thereof.

[0212] A variant of the amino acid sequence with SEQ ID NO: 8 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 8.

[0213] The chimeric adiponectin polypeptide may further comprise at least one linker.

[0214] The at least one linker may connect the amino acid sequence of adiponectin and the amino acid sequence of the transmembrane domain.

[0215] The at least one linker may not be cleavable. The at least one linker may be cleavable.

[0216] The at least one linker may be a Gly-Ser linker. Examples of Gly / Ser linkers include, but are not limited to, GS linkers, G2S linkers, G3S linkers, G4S linkers, including repeats and combination thereof.

[0217] The at least one linker may comprise or consist of a (GGGS)nsequence (SEQ ID NO: 9), wherein n is a positive integer ranging from 1 to 10, preferably from 1 to 5.

[0218] The at least one linker may comprise or consist of a (GGGSGGGGS)n sequence (SEQ ID NO: 10), wherein n is a positive integer ranging from 1 to 10, preferably from 1 to 5.

[0219] The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 11, SEQ ID NO: 12, or a variant thereof. The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 11, or a variant thereof. The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 12, or a variant thereof.

[0220] A variant of the amino acid sequence with SEQ ID NO: 11 or SEQ ID NO: 12 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 11 or SEQ ID NO: 12.

[0221] The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 11 or SEQ ID NO: 12. The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 11. The at least one linker may comprise or consist of an amino acid sequence with SEQ ID NO: 12.

[0222] The at least one linker connecting the amino acid sequence of adiponectin and the amino acid sequence of the transmembrane domain may comprise the sequence SGGGSGGGGSGGGSGGGGSGGGSGGGGSGGGGS (SEQ ID NO: 11). Said linker may be used in a chimeric adiponectin polypeptide as described herein, wherein thecomponents i), ii) and, when present, iii) are organized in the chimeric adiponectin polypeptide from N- to C- terminal.

[0223] The at least one linker connecting the amino acid sequence of adiponectin and the amino acid sequence of the transmembrane domain may comprise the sequence GGGSGGGGSGGGSGGGGSGGGSGGGGSGGGSG (SEQ ID NO: 12). Said linker may be used in a chimeric adiponectin polypeptide as described herein, wherein the components i), ii) and, when present, iii) are organized in the chimeric adiponectin polypeptide from C- to N- terminal.

[0224] When the chimeric adiponectin polypeptide comprises more than one linker, two or more linkers may be identical or different.

[0225] The chimeric adiponectin polypeptide may further comprise an amino acid sequence of a sub-membrane targeting domain.

[0226] A sub-membrane targeting domain may be added in a chimeric adiponectin polypeptide as described herein, wherein the components i), ii) and, when present, iii) are organized in the chimeric adiponectin polypeptide from C- to N- terminal.

[0227] The sub-membrane targeting domain may be sufficient to allow the chimeric adiponectin polypeptide to be anchored to the lipid bilayer of cellular or vesicular membranes, preferably via one or more anchoring molecules and / or through interactions such as electrostatic interactions.

[0228] Hence, due to its presence in the chimeric adiponectin polypeptide, the sub-membrane targeting domain allows the chimeric adiponectin polypeptide, when expressed in a cell, to be anchored to (or anchored in) a cell or vesicular membrane, without the chimeric adiponectin polypeptide being inserted into said membrane.

[0229] The sub-membrane targeting domain may confer to the chimeric adiponectin polypeptide the property of binding to the inner surface of the cell membrane (z.e., the cytoplasmic side of the cell membrane) and / or to the inner surface of vesicular membranes (z.e., the lumen side of the vesicular membrane).

[0230] The chimeric adiponectin polypeptide may further comprise a sub membrane targeting domain, preferably wherein the sub membrane targeting domain may be linked to an anchoring molecule.

[0231] By “anchoring molecule”, it is meant any molecule capable of being inserted into at least one layer of the lipid bilayer of a cell or vesicular membrane. In particular, the anchoring molecule is a lipid or lipid-containing molecule. The sub-membrane targeting domain is then said to be “lipid- anchored”.

[0232] The anchoring molecule may comprise or consist of one or more lipids or lipid- containing molecules, said lipids comprising a hydrophobic carbon chain which allows them to encapsulate in the lipid bilayer of a cell or vesicular membrane.

[0233] The lipids are fatty acids, including, without limitation, myristic acid, palmitic acid, and isoprenoid (such as, e.g., geranyl-geranyl and famesyl).

[0234] The anchoring molecule may be linked to the sub-membrane targeting domain by a covalent bond.

[0235] The anchoring molecule may be linked to the sub-membrane targeting domain through a glycine (e.g., in the case of a myristic acid), cysteine or serine amino acid residue of the sub-membrane targeting domain. This link may be through an amide or thioester bond.

[0236] The sub-membrane targeting domain may be that of an extrinsic membrane protein or may be a variant of the sub-membrane targeting domain of an extrinsic membrane protein.

[0237] The sub-membrane targeting domain may comprise or consist of a consensus sequence allowing the attachment e.g., by acylation or by prenylation) of a fatty acid, and in particular of myristic acid, palmitic acid, or isoprenoid (such as, e.g., geranylgeranyl and famesyl).

[0238] When the chimeric adiponectin polypeptide described herein comprises a submembrane targeting domain linked to an anchoring molecule, it may be preferably located at the N-terminal position of the chimeric adiponectin polypeptide.

[0239] The sub-membrane targeting domain may be derived from a protein of the Src family of proteins. Examples of such proteins include, without limitation, Src, Yes, Lyn, Fyn, Lek, Blk, Fgr, Hck and Yrk proteins (Resh, 1994. Cell. 76(3):411-413), and more particularly the N-terminal portion of one of these proteins, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 N-terminal amino acid residues of one of these proteins.

[0240] The sub-membrane targeting domain may be derived from the c-Src or v-Src protein, and preferably from the c-Src .

[0241] Alternatively, the sub-membrane targeting domain may be derived from other acylated proteins, such as, e.g., viral capsid proteins, including, without limitation, the human immunodeficiency virus (HIV) MA protein, or filo virus proteins.

[0242] The sub-membrane targeting domain may be derived from a Src protein.

[0243] The sub-membrane targeting domain may be derived from a Src protein and may comprise or consist of one of the following amino acid sequences:(M)GSSKSKPKDPSQRRR (SEQ ID NO: 13),(M)GSSKSKPKDPSQRRRKSR (SEQ ID NO: 14)(M)GSSKSKPKDPSQRRRKSRGPGG (SEQ ID NO: 15), or a variant of any of these sequences, said variant retaining the ability of the submembrane targeting domain to be anchored in the lipid bilayer of a cell or vesicular membrane; wherein (M) denotes an initiator methionine which, when located at the N-terminal extremity of the chimeric adiponectin polypeptide, can be removed in vivo by posttranslation processing.

[0244] The sub-membrane targeting domain may be derived from a Src protein and may comprise or consist of an amino acid sequence with SEQ ID NO: 13 or a variant thereof. The sub-membrane targeting domain may be derived from a Src protein and maycomprise or consist of an amino acid sequence with SEQ ID NO: 14 or a variant thereof. The sub-membrane targeting domain may be derived from a Src protein and may comprise or consist of an amino acid sequence with SEQ ID NO: 15 or a variant thereof.

[0245] A variant of the amino acid sequence with SEQ ID NO: 13, 14 or 15 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 13, 14 or 15.

[0246] The sub-membrane targeting domain may be derived from a Src protein and may comprise or consist of an amino acid sequence with SEQ ID NO: 13, 14 or 15 or a variant thereof, preferably with SEQ ID NO: 15; and may further comprise one or more anchoring molecules as defined above; in particular, may comprise a myristic acid (in the form of a myristyl moiety) linked to the glycine residue at position 2.

[0247] When the chimeric adiponectin polypeptide comprises a sub-membrane targeting domain, this sub-membrane targeting domain may be linked to the remaining portions of the chimeric adiponectin polypeptide through at least one linker.

[0248] The chimeric adiponectin polypeptide may further comprise an amino acid sequence of an initiator.

[0249] An initiator may be added in a chimeric adiponectin polypeptide as described herein, wherein the components i), ii) and iii) are organized in the chimeric adiponectin polypeptide from C- to N-terminal.

[0250] The initiator may comprise or consist of an amino acid sequence with SEQ ID NO: 26, or a variant thereof.

[0251] A variant of the amino acid sequence with SEQ ID NO: 26, may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 26.

[0252] The chimeric adiponectin polypeptide may comprise, or consist of, in any order:i) an amino acid sequence of adiponectin, or a variant thereof, as defined herein; ii) an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein; iii) optionally, an amino acid sequence of a pilot peptide, as defined herein.

[0253] The chimeric adiponectin polypeptide may comprise, or consist of: i) an amino acid sequence of adiponectin, or a variant thereof, preferably of wildtype adiponectin, or a variant thereof, as defined herein; ii) an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein; iii) optionally, an amino acid sequence of a pilot peptide, as defined herein.

[0254] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of adiponectin, or a variant thereof, preferably of wild-type adiponectin, or a variant thereof, as defined herein; an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein; an amino acid sequence of a pilot peptide, as defined herein.

[0255] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0256] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of adiponectin, or a variant thereof, preferably of wild-type adiponectin, or a variant thereof, as defined herein; optionally, an amino acid sequence of a linker; an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein; optionally, an amino acid sequence of a linker; and an amino acid sequence of a pilot peptide, as defined herein.

[0257] The chimeric adiponectin polypeptide may comprise or consist of, from N- terminal to C-terminal: an amino acid sequence of human wild-type adiponectin, or a variant thereof, as defined herein, an amino acid sequence of a transmembrane domain of CD8, as defined herein, an amino acid sequence of a pilot peptide, as defined herein.

[0258] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0259] The chimeric adiponectin polypeptide may comprise or consist of, from N- terminal to C-terminal: an amino acid sequence of human wild-type adiponectin, or a variant thereof, as defined herein, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD8, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of a pilot peptide, as defined herein.

[0260] The chimeric adiponectin polypeptide may comprise or consist of, from N- terminal to C-terminal: an amino acid sequence of wild-type human adiponectin with SEQ ID NO: 3, or a variant thereof, an amino acid sequence of a transmembrane domain of CD8 with SEQ ID NO: 7, or a variant thereof, an amino acid sequence of a pilot peptide with SEQ ID NO: 8, or a variant thereof.

[0261] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0262] The chimeric adiponectin polypeptide may comprise or consist of, from N- terminal to C-terminal: an amino acid sequence of wild-type human adiponectin with SEQ ID NO: 3, or a variant thereof,optionally, an amino acid sequence of a linker with SEQ ID NO: 11, or a variant thereof, an amino acid sequence of a transmembrane domain of CD8 with SEQ ID NO: 7, or a variant thereof, optionally an amino acid sequence of a linker, and an amino acid sequence of a pilot peptide with SEQ ID NO: 8, or a variant thereof.

[0263] The chimeric adiponectin polypeptide may comprise or consist of, from N- terminal to C-terminal: an amino acid sequence of wild-type human adiponectin with amino acid sequence SEQ ID NO: 3, an amino acid sequence of a linker with SEQ ID NO: 11, an amino acid sequence of a transmembrane domain of CD8 with SEQ ID NO: 7, and an amino acid sequence of a pilot peptide with SEQ ID NO: 8.

[0264] A chimeric adiponectin polypeptide comprising from N-terminal to C-terminal the amino acid sequence with SEQ ID NO: 3, SEQ ID NO: 11, SEQ ID NO: 7, and SEQ ID NO: 8 may comprise or consist of an amino acid sequence with SEQ ID NO: 16. Thus, the chimeric adiponectin polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 16, or a variant thereof.

[0265] A variant of the amino acid sequence with SEQ ID NO: 16 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 16.

[0266] The chimeric adiponectin polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 16.

[0267] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein,an amino acid sequence of adiponectin or a variant thereof, as defined herein.

[0268] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0269] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of adiponectin or a variant thereof, as defined herein.

[0270] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a transmembrane domain of CD40L, as defined herein, and an amino acid sequence of human wild-type adiponectin or a variant thereof, as defined herein.

[0271] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0272] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a transmembrane domain of CD40L, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of human wild-type adiponectin or a variant thereof, as defined herein.

[0273] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5, or a variant thereof, as defined herein, andan amino acid sequence of human wild-type adiponectin with SEQ ID NO: 1, or a variant thereof, as defined herein.

[0274] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0275] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5, or a variant thereof, as defined herein, and optionally, an amino acid sequence of a linker with SEQ ID NO: 12, or a variant thereof, and an amino acid sequence of human wild-type adiponectin with SEQ ID NO: 1, or a variant thereof, as defined herein.

[0276] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5, or a variant thereof, as defined herein, and an amino acid sequence of a linker with SEQ ID NO: 12, or a variant thereof, and an amino acid sequence of human wild-type adiponectin with SEQ ID NO: 1, or a variant thereof, as defined herein.

[0277] A chimeric adiponectin polypeptide comprising from N-terminal to C-terminal the amino acid sequence with SEQ ID NO: 5, SEQ ID NO: 12, SEQ ID NO: 1 may comprise or consist of an amino acid sequence with SEQ ID NO: 17. Thus, the chimeric adiponectin polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 17, or a variant thereof.

[0278] A variant of the amino acid sequence with SEQ ID NO: 17 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 17.

[0279] The chimeric adiponectin polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 17.

[0280] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a pilot peptide, as defined herein, an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein, an amino acid sequence of adiponectin or a variant thereof, as defined herein.

[0281] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0282] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a pilot peptide, as defined herein, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of adiponectin or a variant thereof, as defined herein.

[0283] Optionally, an initiator may be added to the components of the chimeric adiponectin polypeptide as described herein.

[0284] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of an initiator, as defined herein, an amino acid sequence of a pilot peptide, as defined herein, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of adiponectin or a variant thereof, as defined herein.

[0285] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a pilot peptide, as defined herein, an amino acid sequence of a transmembrane domain of CD40L, as defined herein, an amino acid sequence of human wild-type adiponectin or a variant thereof, as defined herein.

[0286] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0287] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a pilot peptide, as defined herein, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD40L, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of human wild-type adiponectin or a variant thereof, as defined herein.

[0288] Optionally, an initiator may be added to the components of the chimeric adiponectin polypeptide as described herein.

[0289] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of an initiator, as defined herein, an amino acid sequence of a pilot peptide, as defined herein, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD40L, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of human wild-type adiponectin or a variant thereof, as defined herein.

[0290] The chimeric adiponectin polypeptide may comprise or consist of, fromN-terminal to C-terminal:an amino acid sequence of a pilot peptide with SEQ ID NO: 8, or a variant thereof, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5, or a variant thereof, as defined herein, an amino acid sequence of human wild-type adiponectin with SEQ ID NO: 1, or a variant thereof, as defined herein.

[0291] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0292] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a pilot peptide with SEQ ID NO: 8, or a variant thereof, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5, or a variant thereof, as defined herein, optionally, an amino acid sequence of a linker with SEQ ID NO: 12, or a variant thereof, and an amino acid sequence of human wild-type adiponectin with SEQ ID NO: 1, or a variant thereof, as defined herein.

[0293] Optionally, an initiator may be added to the components of the chimeric adiponectin polypeptide as described herein.

[0294] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of initiator with SEQ ID NO: 26, or a variant thereof, an amino acid sequence of a pilot peptide with SEQ ID NO: 8, or a variant thereof, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5, or a variant thereof, as defined herein, optionally, an amino acid sequence of a linker with SEQ ID NO: 12, or a variant thereof, andan amino acid sequence of human wild-type adiponectin with SEQ ID NO: 1, or a variant thereof, as defined herein.

[0295] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of initiator with SEQ ID NO: 26, an amino acid sequence of a pilot peptide with SEQ ID NO: 8, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5, an amino acid sequence of a linker with SEQ ID NO: 12, and an amino acid sequence of human wild-type adiponectin with SEQ ID NO: 1.

[0296] A chimeric adiponectin polypeptide comprising from N-terminal to C-terminal the amino acid sequence with SEQ ID NO: 26, SEQ ID NO: 8, SEQ ID NO: 5, SEQ ID NO: 12, and SEQ ID NO: 1 may comprise or consist of an amino acid sequence with SEQ ID NO: 18. Thus, the chimeric adiponectin polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 18, or a variant thereof.

[0297] A variant of the amino acid sequence with SEQ ID NO: 18 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 18.

[0298] The chimeric adiponectin polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 18.

[0299] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a sub-membrane targeting domain, as defined herein; preferably wherein said sub-membrane targeting domain is linked to an anchoring molecule, an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein, and an amino acid sequence of adiponectin or a variant thereof, as defined herein.

[0300] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0301] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a sub-membrane targeting domain, as defined herein; preferably wherein said sub-membrane targeting domain is linked to an anchoring molecule, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of adiponectin or a variant thereof, as defined herein.

[0302] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a sub-membrane targeting domain, as defined herein; preferably wherein said sub-membrane targeting domain is linked to an anchoring molecule, an amino acid sequence of a transmembrane domain of CD40L, as defined herein, and an amino acid sequence of human wild-type adiponectin, or a variant thereof, as defined herein.

[0303] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0304] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a sub-membrane targeting domain, as defined herein; preferably wherein said sub-membrane targeting domain is linked to an anchoring molecule, optionally, an amino acid sequence of a linker,an amino acid sequence of a transmembrane domain of CD40L, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of human wild-type adiponectin, or a variant thereof, as defined herein.

[0305] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0306] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a sub-membrane targeting domain with SEQ ID NO: 15 preferably wherein said sub-membrane targeting domain is linked to a fatty acid, preferably a myristic acid, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5 or a variant thereof, and an amino acid sequence of human wild-type adiponectin with SEQ ID NO: 1 or a variant thereof.

[0307] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0308] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a sub-membrane targeting domain with SEQ ID NO: 15 preferably wherein said sub-membrane targeting domain is linked to a fatty acid, preferably a myristic acid, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5 or a variant thereof, optionally, an amino acid sequence of a linker with SEQ ID NO: 12, or a variant thereof, and an amino acid sequence of human wild-type adiponectin with SEQ ID NO: 1 or a variant thereof.

[0309] The chimeric adiponectin polypeptide may comprise or consist of, fromN-terminal to C-terminal: an amino acid sequence of a sub-membrane targeting domain with SEQ ID NO: 15 preferably wherein said sub-membrane targeting domain is linked to a fatty acid, preferably a myristic acid, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5 or a variant thereof, an amino acid sequence of a linker with SEQ ID NO: 12, or a variant thereof, and an amino acid sequence of human wild-type adiponectin with SEQ ID NO: 1 or a variant thereof.

[0310] A chimeric adiponectin polypeptide comprising from N-terminal to C-terminal the amino acid sequence with SEQ ID NO: 15, SEQ ID NO: 5, SEQ ID NO: 12, and SEQ ID NO: 1 may comprise or consist of an amino acid sequence with SEQ ID NO: 19. Thus, the chimeric adiponectin polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 19, or a variant thereof.

[0311] A variant of the amino acid sequence with SEQ ID NO: 19 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 19.

[0312] The chimeric adiponectin polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 19.

[0313] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a sub-membrane targeting domain, as defined herein; preferably wherein said sub-membrane targeting domain is linked to an anchoring molecule, an amino acid sequence of a pilot peptide, as defined herein,an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein, and an amino acid sequence of adiponectin or a variant thereof, as defined herein.

[0314] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0315] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a sub-membrane targeting domain, as defined herein; preferably wherein said sub-membrane targeting domain is linked to an anchoring molecule, optionally, an amino acid sequence of a linker, an amino acid sequence of a pilot peptide, as defined herein, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of a transmembrane protein, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of adiponectin or a variant thereof, as defined herein.

[0316] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a sub-membrane targeting domain, as defined herein; preferably wherein said sub-membrane targeting domain is linked to an anchoring molecule, an amino acid sequence of a pilot peptide, as defined herein, an amino acid sequence of a transmembrane domain of CD40L, as defined herein, and an amino acid sequence of human wild-type adiponectin, or a variant thereof, as defined herein.

[0317] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0318] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a sub-membrane targeting domain, as defined herein; preferably wherein said sub-membrane targeting domain is linked to an anchoring molecule, optionally, an amino acid sequence of a linker, an amino acid sequence of a pilot peptide, as defined herein, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD40L, as defined herein, optionally, an amino acid sequence of a linker, and an amino acid sequence of human wild-type adiponectin, or a variant thereof, as defined herein.

[0319] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0320] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a sub-membrane targeting domain with SEQ ID NO: 15 preferably wherein said sub-membrane targeting domain is linked to a fatty acid, preferably a myristic acid, an amino acid sequence of a pilot peptide with SEQ ID NO: 8 or a variant thereof, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5 or a variant thereof, an amino acid sequence of human wild-type adiponectin with SEQ ID NO: 1 or a variant thereof.

[0321] Optionally, one or several linker(s) may be added between the components of the chimeric adiponectin polypeptide as described herein.

[0322] The chimeric adiponectin polypeptide may comprise or consist of, fromN-terminal to C-terminal:an amino acid sequence of a sub-membrane targeting domain with SEQ ID NO: 15 preferably wherein said sub-membrane targeting domain is linked to a fatty acid, preferably a myristic acid, optionally, an amino acid sequence of a linker, an amino acid sequence of a pilot peptide with SEQ ID NO: 8 or a variant thereof, optionally, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5 or a variant thereof, optionally, an amino acid sequence of a linker with SEQ ID NO: 12, or a variant thereof, and an amino acid sequence of human wild-type adiponectin with SEQ ID NO: 1 or a variant thereof.

[0323] The chimeric adiponectin polypeptide may comprise or consist of, from N-terminal to C-terminal: an amino acid sequence of a sub-membrane targeting domain with SEQ ID NO: 15 preferably wherein said sub-membrane targeting domain is linked to a fatty acid, preferably a myristic acid, an amino acid sequence of a linker, an amino acid sequence of a pilot peptide with SEQ ID NO: 8 or a variant thereof, an amino acid sequence of a linker, an amino acid sequence of a transmembrane domain of CD40L with SEQ ID NO: 5 or a variant thereof, an amino acid sequence of a linker with SEQ ID NO: 12, or a variant thereof, and an amino acid sequence of human wild-type adiponectin with SEQ ID NO: 1 or a variant thereof.

[0324] A chimeric adiponectin polypeptide comprising from N-terminal to C-terminal the amino acid sequence with SEQ ID NO: 15, SEQ ID NO: 8, SEQ ID NO: 5, SEQ ID NO: 12, and SEQ ID NO: 1 may comprise or consist of an amino acid sequence with SEQ ID NO: 20. Thus, the chimeric adiponectin polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 20, or a variant thereof.

[0325] A variant of the amino acid sequence with SEQ ID NO: 20 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 20.

[0326] The chimeric adiponectin polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 20.

[0327] The chimeric adiponectin polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or a variant thereof.

[0328] A variant of the amino acid sequence with SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 20 may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 20.

[0329] The chimeric adiponectin polypeptide may comprise or consist of an amino acid sequence with SEQ ID NO: 16, SEQ ID NO: 18, or a variant thereof.

[0330] A variant of the amino acid sequence with SEQ ID NO: 16, or SEQ ID NO: 18, may comprise an amino acid sequence sharing at least 70 % of sequence identity, preferably at least 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % or more of sequence identity with the amino acid sequence of SEQ ID NO: 16, or SEQ ID NO: 18.

[0331] The at least one engineered extracellular vesicle may harbor at its outer surface the at least one adiponectin polypeptide. The at least one engineered extracellular vesicle may harbor at its outer surface the at least one GLP1 polypeptide. The at least one engineered extracellular vesicle may harbor at its outer surface the at least one adiponectin polypeptide and / or the at least one chimeric GLP1 polypeptide.

[0332] As used herein, the expression “harbor at its outer surface” or “exposed at the outer surface of the at least one engineered extracellular vesicle” means that either (i)the at least one wild-type adiponectin polypeptide is bound through any suitable type of labile interaction with external components of the engineered extracellular vesicle (such as, without limitation, electrostatic interactions, protein-protein interactions, protein-lipid interactions, etc.), or (ii) the adiponectin comprised in the at least one chimeric adiponectin polypeptide is exposed, partially or completely, outside the extracellular vesicle, and / or (iii) the GLP1 comprised in the at least one chimeric GLP1 polypeptide is exposed, partially or completely, outside the extracellular vesicle. These configurations enable the oligomerization of either the wild-type adiponectin or the adiponectin comprised in the chimeric adiponectin polypeptide, with other adiponectin of neighboring chimeric polypeptides in the same extracellular vesicle, or with soluble adiponectin. These configurations also enable the interaction of the GLP1 comprised in the chimeric GLP1 polypeptide with the GLP1 receptor.

[0333] The at least one engineered extracellular vesicle may harbor at its outer surface the at least one wild-type adiponectin polypeptide, as described herein, or the at least one chimeric adiponectin polypeptide, as described herein.

[0334] The at least one engineered extracellular vesicle may harbor at its outer surface the at least one wild-type adiponectin polypeptide, preferably the at least one wild-type human adiponectin polypeptide, as described herein.

[0335] The at least one engineered extracellular vesicle may harbor at its outer surface the at least one chimeric adiponectin polypeptide, as described herein.

[0336] The transmembrane domain of the at least one chimeric adiponectin polypeptide may be anchored in the extracellular vesicle lipid bilayer.

[0337] The at least one engineered extracellular vesicle may harbor at its outer surface the at least one wild-type adiponectin polypeptide and / or the at least one chimeric GLP1 polypeptide, as described herein. The at least one engineered extracellular vesicle may harbor at its outer surface the at least one chimeric adiponectin polypeptide and / or the at least one chimeric GLP1 polypeptide.

[0338] The transmembrane domain of the at least one chimeric GLP1 polypeptide may be anchored in the extracellular vesicle lipid bilayer.

[0339] The engineered extracellular vesicle as described herein may have a diameter ranging from about 10 nm to about 5000 nm, preferably from about 10 nm to about 3000 nm, preferably from about 10 nm to about 2000 nm, preferably from about 20 nm to about 1000 nm, preferably from about 30 nm to about 500 nm, preferably from about 40 nm to about 300 nm, preferably from about 50 nm to about 200 nm, more preferably from about 60 nm to about 180 nm.

[0340] The engineered extracellular vesicle as described herein may have a diameter of about 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 nm.

[0341] The extracellular vesicle may be a small extracellular vesicle.

[0342] The extracellular vesicle may be an exosome.

[0343] Exosomes may have a diameter ranging from about 30 nm to about 150 nm, preferably from about 30 nm to about 120 nm, more preferably from about 40 nm to about 80 nm. Exosomes may have a diameter ranging from about 30 nm to about 120 nm.

[0344] General means and methods for obtaining extracellular vesicles are well known in the art. See, e.g., Whitford & Guterstam, 2019. Future Med Chem. 11(10): 1225-1236; Taylor & Shah, 2015. Methods. 87:3-10; Desplantes et al., 2017. Sci Rep. 7(1): 1032.

[0345] The method for obtaining at least one engineered extracellular vesicle as described herein may comprise a step of producing the at least one engineered extracellular vesicle, as defined herein.

[0346] This step of producing the at least one engineered extracellular vesicle may comprise transfecting or transducing cells with a nucleic acid encoding the chimeric adiponectin polypeptide or the chimeric GLP1 polypeptide, as defined herein.

[0347] The cells may be HEK293T cells or cells from a derivative cell line. The cells may be adipocytes. The cells may be immune cells, including, but not limited to, mastocytes, lymphocytes (such as, e.g., T-cells or B-cells), and dendritic cells. The cells may be stem cells, including, but not limited to, embryonic stem cells, adult stem cells (such as, e.g., hematopoietic stem cells, adipose tissue derived stem cells, mammary stem cells, intestinal stem cells, mesenchymal stem cells, endothelial stem cells, neural stem cells, olfactory adult stem cells, or neural crest stem cells), cancer stem cells, induced pluripotent stem cells (iPSC) and induced stem cells (iSC).

[0348] The method for obtaining at least one engineered extracellular vesicle may further comprise a step of culturing the transfected or transduced cells for a time sufficient to allow engineered extracellular vesicle production, preferably in a medium devoid of extracellular vesicles (z.e., a serum- free medium, a medium supplemented with extracellular vesicle-depleted serum, or a medium supplemented with extracellular vesicle-depleted platelet lysate).

[0349] The method for obtaining at least one engineered extracellular vesicle may further comprise a step of purifying said at least one engineered extracellular vesicle.

[0350] The step of purifying said at least one engineered extracellular vesicle may comprise clarification (such as, e.g., by centrifugation or by depth-filtration), filtration, ultra-filtration, diafiltration, size-exclusion purification and / or ion exchange chromatography of the transfected cell culture supernatant. Other methods to purify extracellular vesicles include, without limitation, ultra-centrifugation, tangential flow filtration (TFF) and BE-SEC chromatography.

[0351] The at least one engineered extracellular vesicle as described herein may be purified.

[0352] Methods for purification are well-known by the skilled artisan in the art and includes, without limitation, the methods of purification as described herein.

[0353] The at least one engineered extracellular vesicle as described herein may be purified by ultra-centrifugation to obtain at least one semi-purified engineeredextracellular vesicle. Thus, the at least one semi-purified engineered extracellular vesicle mya be semi-purified.

[0354] As used herein, a semi-purified engineered extracellular vesicle may comprise the engineered extracellular vesicle, the proteins anchored in the membrane of the engineered extracellular vesicle or tightly associated with the engineered extracellular vesicle, as well as a crown of proteins associated with the engineered extracellular vesicle.

[0355] The at least one engineered extracellular vesicle as described herein may be purified by tangential flow filtration and chromatography, in particular SEC and BE-SEC chromatography, to obtain at least one ultra-purified engineered extracellular vesicle. Thus, the at least one engineered extracellular vesicle may be ultra-purified.

[0356] As used herein, an ultra-purified engineered extracellular vesicle may comprise the engineered extracellular vesicle, and the proteins anchored in the membrane of the engineered extracellular vesicle or tightly associated with the engineered extracellular vesicle.

[0357] The composition as described herein may further comprise at least one pharmaceutically acceptable excipient.

[0358] Consequently, another object of the present invention is a pharmaceutical composition comprising, consisting essentially of, or consisting of (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein.

[0359] The term “pharmaceutically acceptable excipient” includes any and all solvents, diluents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. Said excipient does not produce an adverse, allergic or other untoward reaction when administered to an animal, preferably a human. For human administration, preparations should meet sterility, pyrogenicity, and general safety and purity standards as required by regulatory offices, such as, for example, FDA Office or EMA.

[0360] Pharmaceutically acceptable excipients that may be used in these pharmaceutical compositions include, but are not limited to, hyaluronic acid, cross-linked hyaluronate, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of vegetable oil saturated fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances (e.g., sodium carboxymethylcellulose), polyethylene glycol, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat.

[0361] The present invention further relates to a medicament comprising, consisting essentially of or consisting of (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein.

[0362] The present invention further relates to a kit-of-parts comprising: (i) in a first part, at least one GLP1 receptor (GLP1R) agonist, as described herein, and (ii) in a second part, (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein.

[0363] The two parts of the kit-of-parts may be intended for simultaneous use, for separate use, or for sequential use in any order.

[0364] The present invention also relates to a combination of (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein.

[0365] The combination may be a pharmaceutical combination. Thus, the present invention relates to a pharmaceutical combination of (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at leastone adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein.

[0366] The combination or pharmaceutical combination may comprise or consist of (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein.

[0367] “Combination or “pharmaceutical combination” as used herein refer to either a fixed combination in a single unit dosage form (e.g., a composition, pharmaceutical composition, capsule, tablet, sachet, and the like), or a non-fixed combination for combined administration wherein (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle as described herein, may be administered simultaneously, sequentially, independently at the same time or separately within time intervals that allow the combination partners to show a cooperative, e.g., a synergistic effect, or an additive effect.

[0368] The term “fixed combination” means that the active ingredients, i.e., (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle as described herein, are administered to a subject simultaneously in the form of a single unit dosage form (e.g., a composition, pharmaceutical composition, capsule, tablet, sachet, and the like).

[0369] The term “non-fixed combination” means that the active ingredients, i.e., (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle as described herein, are administered to a subject as separate entities simultaneously, sequentially, independently at the same time or separately within time intervals that allow the combination partners to show a cooperative, e.g., a synergistic effect, or an additive effect.

[0370] The present invention further relates to the combination, the composition, the pharmaceutical composition, the medicament, the kit-of-parts, or the components of the kit-of-parts as defined herein, for use as a drug or as a medicament.

[0371] The present invention further relates to the combination, the composition, the pharmaceutical composition, the medicament, the kit-of-parts, or the components of the kit-of-parts as defined herein, for use in the treatment of a disease, disorder or condition.

[0372] The combination as described herein, may be used in the treatment of a disease, disorder or condition, wherein the (i) at least one GLP1R agonist, and the (ii) at least one engineered extracellular vesicle, as described herein, are to be administered simultaneously, separately or sequentially.

[0373] The present invention also relates to at least one GLP1 receptor (GLP1R) agonist, as described herein, for use in the treatment of a disease, disorder or condition, wherein the GLP1R agonist is used simultaneously, separately or sequentially with at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein.

[0374] The present invention also relates to at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein, for use in the treatment of a disease, disorder or condition, wherein the at least one engineered extracellular vesicle is used simultaneously, separately or sequentially with at least one GLP1 receptor (GLP1R) agonist.

[0375] The present invention further relates to a method of treating a disease, disorder or condition in a subject in need thereof, comprising or consisting of administering a therapeutically effective amount of the combination, the composition, the pharmaceutical composition, the medicament, the kit-of-parts, or the components of the kit-of-parts as defined herein, to the subject.

[0376] Another object of the present invention is a method of treating a disease, disorder or condition in a subject in need thereof, comprising or consisting of the simultaneous,separate or sequential administration to said subject of a therapeutically effective amount of: (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein.

[0377] The present invention further relates to the use of the combination, the composition, the pharmaceutical composition, the medicament, the kit-of-parts, or the components of the kit-of-parts as defined herein, in the manufacture of a medicament for the treatment of a disease, disorder or condition in a subject in need thereof.

[0378] The present invention also relates to the use of the combination, the composition, the pharmaceutical composition, the medicament, the kit-of-parts, or the components of the kit-of-parts as defined herein, in the manufacture of a medicament for the treatment of a disease, disorder or condition in a subject in need thereof, wherein the (i) at least one GLP1R agonist, and the (ii) at least one engineered extracellular vesicle are used simultaneously, separately or sequentially.

[0379] The present invention also relates to the use of the combination, the composition, the pharmaceutical composition, the medicament, the kit-of-parts, or the components of the kit-of-parts as defined herein, for treating or for the treatment of a disease, disorder or condition.

[0380] The present invention also relates to the use of the combination or the kit-of-parts as defined herein, for treating or for the treatment of a disease, disorder or condition, wherein the (i) at least one GLP1R agonist, and the (ii) at least one engineered extracellular vesicle are to be administered simultaneously, separately or sequentially.

[0381] The present invention further relates to a pharmaceutical composition for use in the treatment of a disease, disorder or condition, wherein the pharmaceutical composition comprises the combination, the composition, the pharmaceutical composition, the medicament, the kit-of-parts, or the components of the kit-of-parts as defined herein.

[0382] The disease, disorder or condition may be selected from obesity, insulin resistance, type 1 diabetes, type 2 diabetes, metabolic syndrome, cardiovascular disease,non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), metabolic dysfunction-associated steatotic liver disease (MASLD), metabolic dysfunction-associated steatohepatitis (MASH), polycystic ovary syndrome, Alzheimer’s disease, cancer, hypertension, dyslipidemia, hyperuricemia, atherosclerosis, coronary artery disease, stroke, peripheral artery disease, fibrosis, inflammatory pulmonary diseases, nephrotic disease, sleep apnea, dry eye diseases, inflammatory ocular diseases, retinopathies, gastritis, gastro-esophageal reflux disease, inflammatory bowel disease, pancreatitis, osteoporosis, inflammatory bone diseases, inflammatory joint diseases, Myasthenia gravis, inflammatory skin disease, inherited myopathies, acquired myopathies, and bone repair.

[0383] The disease, disorder, or condition may be selected from obesity, insulin resistance, type 1 diabetes, type 2 diabetes, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), metabolic dysfunction-associated steatotic liver disease (MASLD), and metabolic dysfunction-associated steatohepatitis (MASH).

[0384] The disease, disorder, or condition may be obesity. The disease, disorder, or condition may be insulin resistance. The disease, disorder, or condition may be type 1 diabetes. The disease, disorder, or condition may be type 2 diabetes. The disease, disorder, or condition may be non-alcoholic fatty liver disease (NAFLD). The disease, disorder, or condition may be non-alcoholic steatohepatitis (NASH). The disease, disorder, or condition may be metabolic dysfunction-associated steatotic liver disease (MASLD). The disease, disorder, or condition may be metabolic dysfunction-associated steatohepatitis (MASH).

[0385] Examples of inflammatory pulmonary diseases include, but are not limited to, asthma, allergic asthma, emphysema, chronic obstructive pulmonary disease (COPD), acute respiratory distress syndrome, bronchitis, pneumonia, cystic fibrosis, pulmonary fibrosis, and pulmonary sarcoidosis.

[0386] Examples of dry eye diseases include, but are not limited to, hypolacrimation, tear deficiency, xerophthalmia, Sjogren’s syndrome dry eye, non-Sjogren’s syndrome dry eye, keratoconjuctivitis sicca, aqueous tear-deficiency dry eye, evaporative dry eye,Stevens-Johnson syndrome, ocular pemphigoid blepharitis marginal, allergic conjunctivitis-associated dry eye, post-viral conjunctivitis-associated dry eye, post-cataract surgery-associated dry eye, visual display terminals operation-associated dry eye, and contact lens wearing-associated dry eye.

[0387] Examples of inflammatory ocular diseases include, but are not limited to, uveitis, scleritis, post-eye surgery inflammation, corneal transplantation, corneal wound healing, conjunctivitis, retinal disease, glaucoma, and ocular hypertension.

[0388] Examples of retinopathies include, but are not limited to, age-related retinopathy, diabetes-associated retinopathy, oxygen-induced neo-natal retinopathy.

[0389] Examples of inflammatory bone diseases and inflammatory joint diseases include, but are not limited to, osteitis fibrosa cystica, osteomyelitis, sesamoiditis, Brodie abscess, periostitis, costochondritis, and polychondritis.

[0390] Examples of inherited myopathies include, but are not limited to, Duchenne Muscular Dystrophy, Collagen Vl-related myopathies, Myotonic dystrophy type 1.

[0391] Bone repair may be following injury or following a disease.

[0392] Metabolic dysfunction-associated steatotic liver disease (MASLD) also encompasses aggressive forms of MASLD.

[0393] Metabolic dysfunction-associated steatohepatitis (MASH) may lead to fibrosis, cirrhosis, hepatocellular carcinoma, and liver failure.

[0394] The at least one GLP1 receptor (GLP1R) agonist, and the at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein, may be administered simultaneously, separately or sequentially.

[0395] Thus, the at least one GLP1 receptor (GLP1R) agonist, and the at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposedat the outer surface of the at least one engineered extracellular vesicle, as described herein, may be formulated separately.

[0396] In particular, the at least one GLP1R agonist, and the at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein, may be administered through different routes of administration.

[0397] In particular, the at least one GLP1R agonist, and the at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein, may be administered at different time.

[0398] The combination, the composition, the pharmaceutical composition, the medicament, the kit-of-parts, the components of the kit-of-parts, or the at least one GLP1 receptor (GLP1R) agonist, and the at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle as defined herein, may be formulated for administration to a subject in need thereof.

[0399] Administration to a subject may be performed parenterally, by inhalation spray, rectally, nasally, orally, intravitreally, topically or via an implanted reservoir. The term “administration” includes, inter alia, subcutaneous, intravenous, intraperitoneal, intramuscular, intra- articular, intra- synovial, intrastemal, intrathecal, intrahepatic, intralesional, intravitreal, and intracranial injection or infusion techniques, or application to body surfaces such as the skin or mucous membranes.

[0400] For example, the at least one GLP1R agonist, as described herein, may be administered subcutaneously, intraperitoneally or orally, while the at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein, may be administered intravenously, intraperitoneally, subcutaneously, orally, by inhalation, intrathecally, or via an implanted reservoir.

[0401] Alternatively, the at least one GLP1R agonist, when in the form of at least one engineered extracellular vesicle harboring at least one chimeric GLP1 polypeptide at its outer surface, and the at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein, may be administered simultaneously, separately or sequentially intravitreally, topically, intraperitoneally or orally.

[0402] The combination, the composition, the pharmaceutical composition, the medicament, the kit-of-parts, the components of the kit-of-parts, or the at least one GLP1 receptor (GLP1R) agonist, and the at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle as defined herein, may be administered to a subject in need thereof in a therapeutically effective amount.

[0403] It will be however understood that the total daily usage of the combination, the composition, the pharmaceutical composition, the medicament, the kit-of-parts, the components of the kit-of-parts, or the at least one GLP1 receptor (GLP1R) agonist, and the at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle as defined herein, will be decided by the attending physician within the scope of sound medical judgment.

[0404] In particular, the specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disease being treated and the severity of the disease; activity of the combination, the composition, the pharmaceutical composition, the medicament, the kit-of-parts, the components of the kit-of-parts, or the at least one GLP1 receptor (GLP1R) agonist, and the at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle as defined herein, employed; the age, body weight, general health, gender and diet of the subject; the time of administration, route of administration, and rate of excretion of the combination, the composition, the pharmaceutical composition, the medicament, the kit-of-parts, the components of the kit- of-parts, or the at least one GLP1 receptor (GLP1R) agonist, and the at least oneengineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle as defined herein, employed; the duration of the treatment; drugs used in combination or coincidental with the combination, the composition, the pharmaceutical composition, the medicament, the kit-of-parts, the components of the kit-of-parts, or the at least one GLP1 receptor (GLP1R) agonist, and the at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle as defined herein, employed; and like factors well known in the medical arts. The total dose required for each treatment may be administered by multiple doses or in a single dose.

[0405] The combination of (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, as described herein, has the following (non-exhaustive) advantages: it induces a decrease in body weight, it induces a decrease of total fat mass percentage, it induces an increase of total lean mass percentage, and it induces a reduction of insulin resistance.

[0406] Thus, the combination as described herein may be able induce a decrease in body weight, and / or a decrease of total fat mass percentage, and / or an increase of total lean mass percentage, and / or a reduction of insulin resistance. The combination as described herein may be able induce a decrease in body weight. The combination as described herein may be able induce a decrease of total fat mass percentage. The combination as described herein may be able induce an increase of total lean mass percentage. The combination as described herein may be able induce a reduction of insulin resistance.BRIEF DESCRIPTION OF THE DRAWINGS

[0407] Figure 1 is a graph showing the body weight of mice treated daily with either (1) vehicle, (2) extracellular vesicles coated with adiponectin (APN-EV), (3) GLP1R agonist(GLPIRa), or (4) a combination of extracellular vesicles coated with adiponectin and GLPR1 agonist (APN-EV + GLPIRa), as indicated. Mice were weighted weekly during the whole duration of the experimental protocol. Body weight gain or loss was presented by comparison to the weight of each animal at the starting date. Graph represents mean ± S.E.M.

[0408] Figures 2A-C are a combination of graphs showing the total fat mass percentage at day 78 (Figure 2A), the relative left eWAT weight at day 84 (Figure 2B) and the relative right eWAT weight at day 84 (Figure 2C) in mice treated daily with either (1) vehicle, (2) extracellular vesicles coated with adiponectin (APN-EV), (3) GLP1R agonist (GLPIRa), or (4) a combination of extracellular vesicles coated with adiponectin and GLPR1 agonist (APN-EV + GLPIRa), as indicated. Body composition in fat was determined using a Minispec NMR-based equipment. After animal sacrifice, right and left epididymal white adipose tissue (eWAT) were weighted. Graphs represent mean ± S.E.M.

[0409] Figures 3A-C are a combination of graphs showing the total lean mass percentage at day 78 (Figure 3A), the relative left gastrocnemius weight at day 84 (Figure 3B), and the right gastrocnemius weight at day 84 (Figure 3C) in mice treated daily with either (1) vehicle, (2) extracellular vesicles coated with adiponectin (APN- EV), (3) GLP1R agonist (GLPIRa), or (4) a combination of extracellular vesicles coated with adiponectin and GLPR1 agonist (APN-EV + GLPIRa), as indicated. Body composition in lean mass was determined using a Minispec NMR-based equipment. After animal sacrifice, right and left gastrocnemius were weighted. Graphs represent mean ± S.E.M.

[0410] Figures 4A-B are a combination of graphs showing the blood glucose level (Figure 4A) and the plasma insulin level (Figure 4B) measured in mice treated daily with either (1) vehicle, (2) extracellular vesicles coated with adiponectin (APN-EV), (3) GLP1R agonist (GLPIRa), or (4) a combination of extracellular vesicles coated with adiponectin and GLPR1 agonist (APN-EV + GLPIRa), as indicated. Graphs represent mean ± S.E.M.

[0411] Figure 5A-B are a combination of graphs showing the blood glucose level (relative expression as compared to TO) before and after insulin injection (Figure 5A) and the area under the curve (AUC) of the blood glucose level at 120min after insulin injection (Figure 5B) in mice treated daily with either (1) vehicle, (2) extracellular vesicles coated with adiponectin (APN-EV), (3) GLP1R agonist (GLPIRa), or (4) a combination of extracellular vesicles coated with adiponectin and GLPR1 agonist (APN- EV + GLPIRa), as indicated. Graphs represent mean ± S.E.M.

[0412] Figure 6 is a graph showing the Alanine Transaminase (ALT) level at day 84 measured in mice treated daily with either (1) vehicle, (2) extracellular vesicles coated with adiponectin (APN-EV), (3) GLP1R agonist (GLPIRa), or (4) a combination of extracellular vesicles coated with adiponectin and GLPR1 agonist (APN-EV + GLPIRa), as indicated. Graphs represent mean ± S.E.M.

[0413] Figure 7 is a graph showing the mRNA gene expression in eWAT of mice treated daily with either (1) vehicle, (2) extracellular vesicles coated with adiponectin (APN- EV), (3) GLP1R agonist (GLPIRa), or (4) a combination of extracellular vesicles coated with adiponectin and GLPR1 agonist (APN-EV + GLPIRa), as indicated. Key metabolic genes (PPARy, ACC1, SCD1, SREBPlc, FAS and PEPCK) known to be transcriptionally regulated in adipose tissue were analyzed by RT-qPCR. *p<0.05 and **p<0.01 vs control (DIO-NASH injected i.p with vehicle every days) using a Kruskal- Wallis + Dunns posttest. (n>5 for each condition).

[0414] Figure 8 is a combination of immunoblots showing the expression of N-GLP1, C-GLP1, the combination of N-GLP1 and adiponectin or the combination of C-GLP1 and adiponectin by transfected cells (Lanes 1, 2, 5 and 6) and the sorting of the proteins to extracellular vesicles (Lanes 3, 4, 7, 8, 9, and 10). Full circle: N-GLP1; Open circle: C- GLP1; Triangle: Adiponectin monomer, hnmunoblots 1-8 are conducted under reducing conditions; Immunoblots 9 and 10 are conducted under non-reducing conditions allowing to visualize the adiponectin multimerization.Lane 1: cells transfected with a chimeric GLP1 polypeptide anchored in EVs by its N- terminus (N-GLP1 - SEQ ID NO: 28), reduced condition.Lane 2: cells transfected with a chimeric GLP1 polypeptide anchored in EVs by its C- terminus (C-GLP1 - SEQ ID NO: 27), reduced condition.Lane 3: extracellular vesicles produced by cells transfected with a chimeric GLP1 polypeptide anchored in EVs by its N-terminus (N-GLP1 - SEQ ID NO: 28), reduced condition.Lane 4: extracellular vesicles produced by cells transfected with a chimeric GLP1 polypeptide anchored in EVs by its C-terminus (C-GLP1 - SEQ ID NO: 27), reduced condition.Lane 5: cells transfected with a chimeric GLP1 polypeptide anchored in EVs by its N- terminus (N-GLP1 - SEQ ID NO: 28) and a chimeric adiponectin polypeptide (SEQ ID NO: 18), reduced condition.Lane 6: cells transfected with a chimeric GLP1 polypeptide anchored in EVs by its C- terminus (C-GLP1 - SEQ ID NO: 27) and a chimeric adiponectin polypeptide (SEQ ID NO: 18), reduced condition.Lane 7: extracellular vesicles produced by cells transfected with a chimeric GLP1 polypeptide anchored in EVs by its N-terminus (N-GLP1 - SEQ ID NO: 28) and a chimeric adiponectin polypeptide (SEQ ID NO: 18), reduced condition.Lane 8: extracellular vesicles produced by cells transfected with a chimeric GLP1 polypeptide anchored in EVs by its C-terminus (C-GLP1 - SEQ ID NO: 27) and a chimeric adiponectin polypeptide (SEQ ID NO: 18), reduced condition.Lane 9: extracellular vesicles produced by cells transfected with a chimeric GLP1 polypeptide anchored in EVs by its N-terminus (N-GLP1 - SEQ ID NO: 28) and a chimeric adiponectin polypeptide (SEQ ID NO: 18), non-reduced condition.Lane 10: extracellular vesicles produced by cells transfected with a chimeric GLP1 polypeptide anchored in EVs by its C-terminus (C-GLP1 - SEQ ID NO: 27) and a chimeric adiponectin polypeptide (SEQ ID NO: 18), non-reduced condition.TABLE OF SEQUENCESEXAMPLES

[0415] The present invention is further illustrated by the following examples.Example 1Materials and methodsProduction of adiponectin and of extracellular vesicles harboring adiponectin in mammalian cells

[0416] Extracellular vesicles were produced in HEK293T cells (obtained from M C Dokhelar, Institut Cochin, France). Cells were cultured in a complete medium made of DMEM supplemented with 5 % of heat-inactivated fetal bovine serum (iFBS), 2 mM of GlutaMAX and 5 pg / mL of gentamicin at 37 °C in a 5 % CO2 humidified incubator. HEK293T cells were routinely tested and found negative by MycoStrip™ kit (Invivogen).

[0417] A nucleic acid sequence coding for a chimeric adiponectin polypeptide comprising a pilot peptide, a CD40L transmembrane domain and human wild-type adiponectin (SEQ ID NO: 18) was inserted in an eucaryotic expression vector under the control of a CMV / HTLV chimeric promoter. These nucleic acid sequences were transfected into HEK293T cells using PEI.

[0418] In order to generate large-scale exosome production, HEK293T transfected cells were plated into cell chambers of 10 trays in 1 L of complete medium. 24 hours later, cultures were fed with an extracellular vesicle-free synthetic medium and incubated for a further 48 hours.Adiponectin-extracellular vesicles and extracellular vesicle purification

[0419] Cell culture medium was harvested from transfected HEK293T cells and adiponectin-extracellular vesicle isolation was performed as previously described (Taylor & Shah, 2015. Methods. 87:3-10; Desplantes et al., 2017. Sci Rep. 7(l):1032; Corso G. et al. 2017. Scientific Reports. 7: 11561. DGI:10.1038 / s41598-017-10646-x). Briefly, cell culture supernatant was clarified by two consecutive centrifugations:10 minutes at 1 300 rpm and 15 minutes at 4000 rpm, both at 4°C, followed by filtration through 0.22 pm membrane filters. The supernatant was then concentrated by ultra-filtration and diafiltration using Tangential Flow Filtration and load onto either size exclusion chromatography (SEC) or BE-SEC columns (CL2-B or Sephacryl S1000 or Captocore, GE Healthcare). Fractions containing extracellular vesicle biomarkers (CD81 and CD63) were identified by ELISA. Extracellular vesicle fractions containing adiponectin identified by Western-Blot were pooled, concentrated when necessary and used for analysis and injections to mice.Mouse model

[0420] 40 C57BL / 6NTac male mice aged 22 weeks were used for this study (obtained from Taconic Biosciences, Denmark). Mice were housed in enriched and ventilated housing cages - mouse cage GM500 (501 CM2) throughout the experimental phase. Animals’ cages litters were changed at least once a week. Animals were housed in groups of 4 animals on a normal 12-hours light cycle (at 07:30 pm lights off), 22 ± 2 °C and 50 ± 10 % relative humidity.

[0421] Non-alcoholic steatohepatitis (NASH) was induced through specific diet provided during 16 weeks. During the whole experimental phase, specific diet (Research Diets, D09100310, 40 kcal% fat, 20 kcal% fructose and 2% cholesterol) and tap water were provided ad libitum. Diet-induced NASH mouse model is a relevant animal model to study NASH as they develop fatty liver and in later stages, liver inflammation and fibrosis.Treatment

[0422] Mice were treated once a day for 12 weeks with either (1) vehicle, (2) extracellular vesicles coated with adiponectin, (3) a GLP1R agonist, or (4) a combination of extracellular vesicles coated with adiponectin and GLP1R agonist. 8 mice were randomly attributed to each group.

[0423] Vehicle was PBS IX with 10 pg / mL BSA. Vehicle was injected intraperitoneally .

[0424] Extracellular vesicles coated with adiponectin were injected intraperitoneally at a dose of 10 pg in a volume of 100 pL (concentration of 100 pg / mL) per mouse per injection. Extracellular vesicles were in suspension in PBS IX with 10 pg / mL BSA.

[0425] The GLP1R agonist was semaglutide (Ozempic®). Semaglutide was injected subcutaneously at a dose of 0.06 mg / kg, in a dose volume of 5mL / kg (concentration of 12 mg / mL). Semaglutide was solubilized in PBS IX.

[0426] After a two weeks acclimation period, the 40 mice were weighted and 6-hour fasted at ~8:00am bled at ~2:00pm to collect blood (25pL / EDTA from the tail tip and 150pL / heparin from the retro-orbital sinus under isoflurane anesthesia) and measure fasting blood glucose, plasma insulin levels to calculate Homeostasis Model Assessment of Insulin Resistance (HOMA-IR) index, and plasma alanine aminotransferase (ALT) levels.

[0427] Mice were then randomized into 4 homogenous groups (n=8 / group). 8 mice showing extreme values for the above parameters were excluded from the study. Among them, 5 mice were selected to collect and weight liver in 6-hour fasting conditions (fasting starts at ~8:00am) and one liver sample was dissected from the left lateral lobe and was then formalin-fixed for optional histology analysis, as described below. The remaining liver was flash-frozen and stored at -80°C for eventual additional analysis.

[0428] Mice included in the treatment groups (n=8 / group) was then treated for 12 weeks with (1) vehicle, (2) extracellular vesicles coated with adiponectin, (3) a GLP1R agonist, or (4) a combination of extracellular vesicles coated with adiponectin and GLP1R agonist, as described above. Mice body weight was monitored weekly during the whole experimental phase.

[0429] At -day 28 and -day 56 of treatment, mice were weighted, and 6-hour fasted at ~8:00am bled at ~2:00pm to collect blood (25pL / EDTA from the tail tip and 150pL / heparin from the retro-orbital sinus under isoflurane anesthesia) from the tail tipto measure fasting blood glucose, plasma insulin levels to calculate HOMA-IR index, and plasma ALT levels.

[0430] On -day 80 of treatment, mice were weighted 3-hour fasted at -11:00am, before a subcutaneous injection of insulin (lU / kg; 0,2U / mL; 5mL / kg injection volume) at ~2:00pm. Blood glucose was measured from the tail tip at -30, 0, 15, 30, 60, 90 and 120 minutes after insulin injection. Blood glucose area under the curve was calculated.

[0431] On -day 84 of treatment, mice were weighted, and 6-hour fasted at -8 :00am bled at ~2:00pm to collect blood (25pL / EDTA from the tail tip and 150pL / heparin from the retro-orbital sinus under isoflurane anesthesia) and measure fasting blood glucose, plasma insulin levels to calculate HOMA-IR index of insulin resistance, and plasma ALT levels. After blood collection, mice were sacrificed by cervical dislocation and exsanguinated with saline.

[0432] One epididymal fat pad and one gastrocnemius muscle were collected, weighted and a ~50mg sample of each tissue was flash-frozen in liquid nitrogen before storage at -80°C. Liver was collected and weighted.

[0433] Two liver samples were dissected from the left lateral lobe, flash-frozen and stored at -80°C: (1) a left lateral lobe was dissected, and formalin fixed for histology staining (H&E and Sirius Red staining) for NAFLD scoring and % of Sirius Red labelling quantification, and (2) one ~30mg liver sample (weight not recorded) was flash-frozen and stored at -80°C for optional genes expression studies (15 genes: ACLY, ACCS2, ACC1, ACC2, FASN, SCD1, SERBP-lc for lipid synthesis; MCP-1, IL-6, NF-KB, TLR4, IL- lb, TNF-a for inflammation, Collalphal and TGF-beta for fibrosis) and for eventual additional analysis.RT- PCR analysis

[0434] Total RNA was extracted from frozen epididymal WAT, liver, and skeletal muscle (-15 to 30 mg) using the Direct-zol™ RNA Miniprep Plus (Zymo). Isolated RNA (-500 ng) was used for complementary DNA (cDNA) synthesis using the reverse transcriptase SuperScript™ III (ThermoFisher) in a final reaction volume of 20 pl.Subsequently, RT-qPCR was carried out in a LightCycler 480 (Roche). Reactions for qPCR were set up in a total volume of 1,5 pL containing 1 pl of Master Mix PowerUp™ SYBR™ Green (Applied Biosystem), water, forward (F) and reverse (R) primers each (500 nM), and 0,5pL cDNA for 40 cycles. Primers are as follows: PPARy (Peroxisome proliferator- activated receptor gamma) F: TCACAATGCCATCAGGTTTG (SEQ ID NO: 29) / R: GCGGGAAGGACTTTATGTATG (SEQ ID NO: 30); PEPCK (Phosphoenolpyruvate carboxykinase) F: TGCGGATCATGACTCGGATG (SEQ ID NO: 31) / R: AGGCCCAGTTGTTGACCAAA (SEQ ID NO: 32); ACC1 (Acetyl-CoA carboxylasel) F: CTTCCGTGAGTCTATCCTGCG (SEQ ID NO: 33) / R: CGATGAGGGCAATCTGGATGG (SEQ ID NO: 34); SCD1 (stearoyl-CoA desaturase 1) F: TCCAGAGGAGGTACTACAAG (SEQ ID NO: 35) / R:TGAGCACCAGAGTGTATCG (SEQ ID NO: 36); SREBPlc (Sterol Regulatory Element Binding Protein 1) F: GATCAAAGAGGAGCCAGTGC (SEQ ID NO: 37) / R: TAGATGGTGGCTGCTGAGTG (SEQ ID NO: 38); FAS (Fatty Acid Synthase) F: CTTCCGTGAGTCTATCCTGCG (SEQ ID NO: 39) / R:CCATCCAGATTGCCCTCATCG (SEQ ID NO: 40); RPLP0 (acidic ribosomal phosphoprotein P0) F: AGATTCGGGATATGCTGTTGGC (SEQ ID NO: 41) / R: TCGGGTCCTAGACCAGTGTTC (SEQ ID NO: 42); RER1 (Retention In Endoplasmic Reticulum Sorting Receptor 1) F: GAAGAGGCAAATCAAGCACAT (SEQ ID NO: 43) / R: GTCCTCCTTCCCTTTGTATCT (SEQ ID NO: 44). Gene expression was normalized to RPLP0 and RER1 as internal reference, for adipose tissue / liver and muscle respectively. Fold change over the control was calculated using the AACt method. qPCR reactions were performed in triplicate from a minimum of five individual mice.Data analysis

[0435] Mean ± standard deviation (S.E.M, S.D.) are presented in graphics. Adiponectin-EVs (APN-EV), or semaglutide (GLPIRa) or semaglutide+Adiponectin- EVs-treated (GLPlRa+ APN-EV) mice were compared to placebo (vehicle)-treated mice. Statistical analyses were performed using GraphPad Prism as follows: a) Two-way ANOVA + Bonferroni's post-test was used for body weight follow-up, b) For the other parameters, in case of normality, parametric test, i.e., student t-test (two groups) or One-Way ANOVA test followed by Dunnett’s post-test (more than 2 groups) was performed. If groups do not assume equal sd, the test was performed with Welch’s correction. In absence of normality, nonparametric test, i.e., Mann- Whitney test (two groups) or Kruskal- Wallis followed by Dunns post-test (more than 2 groups) was performed. For all tests, the significant level was set at p < 0.05.Results

[0436] As shown on Figure 1, representing the evolution of mice body weight along the course of treatment, mice treated with the vehicle exhibited progressive body weight gain from day 0 to day 80, while mice treated with extracellular vesicles coated with adiponectin (APN-EV) exhibited progressive body weight gain from day 0 to day 50, followed by a slow body weight decrease from day 50 until day 80. On the opposite, mice treated with GLP1R agonist (GLPIRa) exhibited an important body weight loss at the beginning of treatment, followed by a return to initial body weight by day 80 of treatment (Figure 1). This reveals a transient effect of the GLP1R agonist. Finally, mice treated with the combination of extracellular vesicles coated with adiponectin and GLP1R agonist (GLPIRa + APN-EV) exhibited a similar body weight loss than mice treated with GLP1R agonist alone at the beginning of the treatment (Figure 1). However, after day 7, the body weight reduction was more pronounced in mice treated with the combination of extracellular vesicles coated with adiponectin and GLP1R agonist. Furthermore, contrary to GLP1R agonist alone, mice treated with the combination of extracellular vesicles coated with adiponectin and GLP1R agonist exhibited a more stable body weight decrease along the course of treatment (Figure 1). This demonstrates that the combination of extracellular vesicles coated with adiponectin and GLP1R agonist induces a superior decrease in body weight as compared to either compound administered alone (i.e., extracellular vesicles coated with adiponectin or GLP1R agonist administered alone).

[0437] Epididymal white adipose tissue (eWAT) is an anatomically distinct and metabolically active abdominal fat depot widely used to study adipose tissue biology, and in particular adipose tissue weight, in rodents. As shown on Figures 2A-2C, mice treated with the combination of extracellular vesicles coated with adiponectin and GLP1R agonist (GLPIRa + APN-EV) exhibited a more important decrease of total fat masspercentage at day 78 (Figure 2A), as well as a more important decrease of both relative left (Figure 2B) and right (Figure 2C) eWAT weight at day 84, as compared to mice treated with the vehicle, and to both mice treated with extracellular vesicles alone (APN- EV), or mice treated with the GLP1R agonist alone (GLPIRa). Thus, these data demonstrate that the treatment with the combination of extracellular vesicles coated with adiponectin and GLP1R agonist is more efficient in reducing total fat mass percentage and relative eWAT weight, than either treatment administered alone (i.e., extracellular vesicles coated with adiponectin or GLP1R agonist administered alone).

[0438] The gastrocnemius muscle corresponds to one of the calf muscles, typically used to study muscle biology, and in particular muscle weight, in rodents. As shown on Figures 3A-3C, mice treated with the combination of extracellular vesicles coated with adiponectin and GLP1R agonist (GLPIRa + APN-EV) exhibited a more important increase of total lean mass percentage at day 78 (Figure 3A), as well as a greater increase of both relative left (Figure 3B) and right (Figure 3C) gastrocnemius weight at day 84, as compared to mice treated with the vehicle, and to both mice treated with extracellular vesicles alone (APN-EV), or mice treated with the GLP1R agonist alone (GLPIRa). These data demonstrate that the combination of extracellular vesicles coated with adiponectin and GLP1R agonist is more efficient in increasing total lean mass percentage and relative gastrocnemius weight, than either treatment administered alone (i.e., extracellular vesicles coated with adiponectin or GLP1R agonist administered alone).

[0439] The glucose and insulin levels in the blood are standard tests that indicate the existence of diabetes. As shown on Figure 4A, blood glucose level was significantly lower in all treatment conditions (i.e., mice treated with either extracellular vesicles coated with adiponectin alone (APN-EV), GLP1R agonist alone (GLPIRa), or the combination of extracellular vesicles coated with adiponectin and GLP1R agonist (GLPIRa + APN-EV)) as compared to mice receiving the vehicle. In addition, as shown on Figure 4B, plasma insulin level was lower in all treatment conditions (i.e., mice treated with either extracellular vesicles coated with adiponectin alone (APN-EV), GLP1R agonist alone (GLPIRa), or the combination of extracellular vesicles coated withadiponectin and GLP1R agonist (GLPIRa + APN-EV)) as compared to mice receiving the vehicle.

[0440] The Insulin Tolerance Test (ITT) is a standard test to determine the insulin resistance status in humans and animal models. It allows to determine the insulin receptor sensitivity of the whole-body. The blood glucose levels are measured in each group of treated mice, before and after insulin administration. As shown on Figure 5A, blood glucose level was lower in all treatment conditions (i.e., mice treated with either extracellular vesicles coated with adiponectin alone (APN-EV), GLP1R agonist alone (GLPIRa), or the combination of extracellular vesicles coated with adiponectin and GLP1R agonist (GLPIRa + APN-EV)) as compared to mice receiving the vehicle. A better visualization of the ITT is given by plotting the Area Under the Curve (AUC) obtained with the different treatments at specific timepoints. Thus, as shown on Figure 5B, the AUC 120min after insulin administration was lower in mice treated with the combination of extracellular vesicles coated with adiponectin and GLP1R agonist (GLPIRa + APN-EV), as compared to mice receiving the vehicle, as well as mice receiving either extracellular vesicles coated with adiponectin alone (APN-EV), or GLP1R agonist alone (GLPIRa). This demonstrates that the combination of extracellular vesicles coated with adiponectin and GLP1R agonist induces a greater reduction of insulin resistance as compared to mice treated with the vehicle, and in a more efficient manner than each compound administered alone (i.e., extracellular vesicles coated with adiponectin alone, or GLP1R agonist alone).

[0441] Figure 6 shows the level of Alanine Transaminase (ALT) in each of the treatment group. ALT is a blood biomarker of liver health. As shown on Figure 6, ALT levels were high in mice receiving the vehicle. On the contrary, ALT levels were significantly reduced in all treatment conditions (i.e., mice treated with either extracellular vesicles coated with adiponectin alone (APN-EV), GLP1R agonist alone (GLPIRa), or the combination of extracellular vesicles coated with adiponectin and GLP1R agonist (GLPIRa + APN- EV)). Therefore, no hepatic toxicity was observed for any of the treatment, indicating that each product alone is safe (i.e., extracellular vesicles coated with adiponectin alone orGLP1R agonist alone), as well as the combination of extracellular vesicles coated with adiponectin and GLP1R agonist administered together.

[0442] Figure 7 shows the relative mRNA expression level of lipid metabolism-related genes (PPARy, ACC1, SCD1, SREBPlc and FAS) and of a glucose metabolism-related gene (PEPCK) in Epididymal White Adipose Tissue (EWAT) from mice treated with either placebo (vehicle), extracellular vesicles coated with adiponectin alone (APN-EV), GLP1R agonist alone (GLPIRa), or the combination of extracellular vesicles coated with adiponectin and GLP1R agonist (GLPIRa + APN-EV). RNA from Epididymal White Adipose Tissue (EWAT) were extracted, reverse transcribed, amplified by quantitative PCR using specific primers, and relative mRNA expression levels were quantified. The results revealed the absence of regulation of all these genes by the GLP-1R agonist (Semaglutide), in contrast with the clear impact of the adiponectin coated-EV ; an impact that is enhanced when the the adiponectin coated-EV are combined with the GLP-1R agonist (Semaglutide). Thus, the Adiponectin has a net impact on lipogenesis and gluconeogenesis; an impact enhanced when combined with GLP-1R agonist.Conclusion

[0443] These data demonstrate that the combination of extracellular vesicles coated with adiponectin and GLP1R agonist has an improved effect as compared to each compound administered alone (i.e., extracellular vesicles coated with adiponectin alone or GLP1R agonist alone). Indeed, the combination of extracellular vesicles coated with adiponectin and GLP1R agonist induces a greater (1) decrease in body weight, (2) decrease of total fat mass percentage and relative eWAT weight, (3) increase of total lean mass percentage and relative gastrocnemius weight, (4) reduction of insulin resistance, and (5) impact on lipogenesis and gluconeogenesis, as compared to mice treated with either extracellular vesicles coated with adiponectin alone, or GLP1R agonist alone.

[0444] Taken together, these results indicate that the combination of extracellular vesicles coated with adiponectin and GLP1R agonist as described herein, could be a valuable therapeutic tool for the treatment of various human conditions that benefit from adiponectin, such as, for example, obesity, insulin resistance, type 1 diabetes, type 2diabetes, non-alcoholic fatty liver disease (NAFLD), and non-alcoholic steatohepatitis (NASH).Materials and methodsProduction of extracellular vesicles harboring adiponectin in mammalian cells

[0445] Extracellular vesicles were produced in HEK293T cells (obtained from M C Dokhelar, Institut Cochin, France). Cells were cultured in a complete medium made of DMEM supplemented with 5 % of heat- inactivated fetal bovine serum (iFBS), 2 mM of GlutaMAX and 5 pg / mL of gentamicin at 37 °C in a 5 % CO2 humidified incubator. HEK293T cells were routinely tested and found negative by MycoStrip™ kit (Invivogen).

[0446] Different nucleic acid sequences were inserted in a DNA-based eucaryotic expression vector (plasmid vector or Adenovirus Associated Vector) under the control of a CMV / HTLV chimeric promoter. These nucleic acids encode either (i) a adiponectin polypeptide comprising a pilot peptide, CD40L transmembrane domain and human wild-type adiponectin (SEQ ID NO: 18), (ii) a GLP-1 polypeptide comprising a pilot peptide, CD40L transmembrane domain and human GLP-1 (SEQ ID NO: 28), or (iii) a GLP-1 polypeptide comprising a signal peptide, human GLP-1, CD8 transmembrane domain and a pilot peptide (SEQ ID NO: 27).

[0447] Nucleic acid sequences expressing one or two of the above encoded proteins, were transfected into HEK293T cells using Polyethyleneimine. In order to obtain established cell lines Zeocine (Invivogen) selection pressure was applied.

[0448] In order to generate large-scale exosome production, HEK293T transfected cells were plated into cell chambers of 10 trays in 1 L of complete medium. 24 hours later, cultures were fed with an extracellular vesicle free synthetic medium and incubated for a further 48 hours.Adioonect in-extracellular vesicles, GLP-1 -extracellular vesicles, and extracellular vesicle purification

[0449] Cell culture medium was harvested from transfected HEK293T cells and adiponectin extracellular vesicle isolation was performed as previously described (Taylor & Shah, 2015. Methods. 87:3-10; Desplantes et al., 2017. Sci Rep. 7(l):1032; Corso G. et al. 2017. Scientific Reports. 7: 11561. D01:10.1038 / s41598-017-10646-x). Briefly, cell culture supernatant was clarified by two consecutive centrifugations: 10 minutes at 1 300 rpm and 15 minutes at 4 000 rpm, both at 4°C, followed by filtration through 0.22 pm membrane filters. The supernatant was then concentrated either by ultracentrifugation or by ultra filtration and diafiltration using Tangential Flow Filtration and load onto either size exclusion chromatography (SEC) or BE-SEC columns (CL2 B or Sephacryl S1000 or Captocore, GE Healthcare). Fractions containing extracellular vesicle biomarkers (CD81 and CD63) were identified by ELISA. Extracellular vesicle fractions containing adiponectin identified by Western Blot were pooled, concentrated when necessary and used for analysis.SDS-PAGE, Western-blotting and antibodies

[0450] To prepare cell extracts, cells were harvested and centrifuged at 300 g for 10 min at 4°C, washed in IX Phosphate Buffered Saline (PBS) and lysed in 1% IGEPAL (Sigma).

[0451] Protein concentrations of cell extracts and EV batches were determined using the BCA assay (Thermo Scientific). For SDS-PAGE, 5 pg of pure EVs or 10 pg of cell extracts were adjusted in Laemmli sample buffer and heated for 5 min at 95°C. EV and cell extract preparations were separated by SDS-PAGE on a 4-15% gradient polyacrylamide gel (Bio-Rad) and proteins were subsequently transferred onto PVDF membrane. For Western-Blotting in non-reducing conditions, a Laemmli sample buffer without reductor (DTT) was used.

[0452] Immunodetection of adiponectin was carried out with primary antibodies against either adiponectin (anti- adiponectin monoclonal antibody, clone ABM52A3, AbeomicsRef. #10-7597; or anti-adiponectin rabbit polyclonal antibody, InvitrogenRef. #PA1-O54), or anti-Ciloa Pilot Peptide (PP) (in-house antibody raised in rabbit).

[0453] Membranes were then incubated with the corresponding secondary Horseradish Peroxidase (HRP)-conjugated antibodies (donkey anti-mouse HRP or donkey anti-rabbit HRP, Jackson ImmunoResearch).

[0454] The signals were detected using an enhanced chemiluminescence detection kit (Thermo Scientific) and membranes were imaged with a Chemidoc Imaging System (BioRad).Results

[0455] Figure 8 shows the expression by immunoblots of N-GLP1, C-GLP1, the combination of N-GLP1 and adiponectin or the combination of C-GLP1 and adiponectin by cell lines which have stably integrated in their genomes DNA encoding either (i) a chimeric GLP1 polypeptide anchored in EVs by its N-terminus (N-GLP1 - SEQ ID NO: 28 - Lane 1), (ii) a chimeric GLP1 polypeptide anchored in EVs by its C-terminus (C-GLP1 - SEQ ID NO: 27 - Lane 2), (iii) N-GLP1 and a chimeric adiponectin (SEQ ID NO: 18 - Lane 5), or (iv) C-GLP1 and a chimeric adiponectin (SEQ ID NO: 18 - Lane 6). In addition, Figure 8 shows the sorting of the corresponding proteins (i.e., N-GLP1, C-GLP1, N-GLPl+adiponectin, C-GLPl+adiponectin) with extracellular vesicles (EVs) by each of these stable cell lines respectively: Lane 3 shows N-GLP1 -coated EVs, Lane 4 shows C-GLPl-coated EVs, Lanes 7 and 9 show N-GLPl+adiponectin-coated EVs in reduced and non-reduced conditions respectively, and Lanes 8 and 10 show C- GLPl+adiponectin-coated EVs in reduced and non-reduced conditions respectively. Immunoblots 9 and 10, conducted under non-reduced conditions allow to visualize the adiponectin multimerization. These results demonstrate that cells can be stably transfected with DNA encoding GLP1 with or without DNA encoding adiponectin, and produce extracellular vesicles coated with GLP1 with or without adiponectin.

Claims

CLAIMS1. A composition comprising (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle.

2. The composition according to claim 1, further comprising at least one pharmaceutically acceptable excipient.

3. The composition according to claim 1 or claim 2, wherein the (i) at least one GLP1R agonist is at least one chimeric GLP1 polypeptide exposed at the outer surface of at least one engineered extracellular vesicle.

4. The composition according to claim 3, wherein the at least one chimeric GLP1 polypeptide and the at least one adiponectin polypeptide are exposed at the outer surface of the same engineered extracellular vesicle or at the outer surface of different engineered extracellular vesicles.

5. The composition according to claim 1 or claim 2, wherein the at least one GLP1R agonist is selected from albenatide, albiglutide, beinaglutide, cotadutide, danuglipron, dulaglutide, ecnoglutide, efinopegdutide, efpeglenatide, exenatide, froniglutide, gulgafafusp alfa, liraglutide, lixisenatide, lotiglipron, maridebart cafraglutide, mazdutide, orforglipron, pegloxenatide, pegsebrenatide, pegapamodutide, pemvidutide, retatrutide, semaglutide, survodutide, taspoglutide, tirzepatide, utreglutide, vurolenatide, and combinations thereof.

6. The composition according to claim 5, wherein the at least one GLP1R agonist is semaglutide.

7. The composition according to any one of claims 1 to 6, wherein the at least one adiponectin polypeptide is at least one wild-type adiponectin polypeptide, or at least one chimeric adiponectin polypeptide.

8. The composition according to claim 7, wherein the at least one chimeric adiponectin polypeptide comprises: i) an amino acid sequence of adiponectin or a variant thereof, preferably of wild-type adiponectin or a variant thereof, ii) an amino acid sequence of a transmembrane domain of a transmembrane protein, and iii) an amino acid sequence of a pilot peptide.

9. The composition according to claim 7 or claim 8, wherein the at least one chimeric adiponectin polypeptide comprises: i) an amino acid sequence of wild-type human adiponectin, comprising the amino acid sequence with SEQ ID NO: 1, SEQ ID NO: 3, or a variant thereof, ii) an amino acid sequence of a transmembrane domain of CD8 comprising the amino acid sequence with SEQ ID NO: 6, SEQ ID NO: 7, or a variant thereof, or an amino acid sequence of a transmembrane domain of CD40L comprising the amino acid sequence with SEQ ID NO: 4, SEQ ID NO: 5, or a variant thereof, and iii) an amino acid sequence of a pilot peptide comprising the amino acid sequence with SEQ ID NO: 8, or a variant thereof.

10. The composition according to any one of claims 7 to 9, wherein the (ii) at least one chimeric adiponectin polypeptide comprises the amino acid sequence with SEQ ID NO: 16, SEQ ID NO: 18, or a variant thereof.

11. A kit-of-parts comprising: (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle.

12. The composition according to any one of claims 1 to 10, or the kit-of-parts according to claim 11, or a combination of (i) at least one GLP1 receptor (GLP1R)agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, for use as a medicament.

13. The composition according to any one of claims 1 to 10, or the kit-of-parts according to claim 11, or a combination of (i) at least one GLP1 receptor (GLP1R) agonist, and (ii) at least one engineered extracellular vesicle harboring at least one adiponectin polypeptide exposed at the outer surface of the at least one engineered extracellular vesicle, for use in the treatment of a disease, disorder, or condition selected from obesity, insulin resistance, type 1 diabetes, type 2 diabetes, metabolic syndrome, cardiovascular disease, non-alcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), metabolic dysfunction-associated steatotic liver disease (MASLD), metabolic dysfunction-associated steatohepatitis (MASH), polycystic ovary syndrome, Alzheimer’s disease, cancer, hypertension, dyslipidemia, hyperuricemia, atherosclerosis, coronary artery disease, stroke, peripheral artery disease, fibrosis, inflammatory pulmonary diseases, nephrotic disease, sleep apnea, dry eye diseases, inflammatory ocular diseases, retinopathies, gastritis, gastro-esophageal reflux disease, inflammatory bowel disease, pancreatitis, osteoporosis, inflammatory bone diseases, inflammatory joint diseases, Myasthenia gravis, inflammatory skin disease, inherited myopathies, acquired myopathies, and bone repair.

14. The composition, the kit-of-parts or the combination for use according to claim 13, wherein the disease, disorder, or condition is selected from obesity, insulin resistance, type 1 diabetes, type 2 diabetes, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), metabolic dysfunction- associated steatotic liver disease (MASLD), and metabolic dysfunction-associated steatohepatitis (MASH).

15. The combination or the kit-of-parts for use according to claim 13 or 14, wherein the (i) at least one GLP1R agonist, and the (ii) at least one engineered extracellular vesicle are to be administered simultaneously, separately or sequentially.