Method for treating muscular dystrophy by targeting LAMA1 gene
By upregulating the LAMA1 gene using a CRISPR-based method, the deficiencies in MDC1A are addressed, improving muscle function and pathology in MDC1A models.
Patent Information
- Application Number
- PCT/JP2025/008637
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-02
- Filing Date
- 2025-03-07
- Publication Date
- 2025-09-11
AI Technical Summary
There is no effective fundamental therapeutic drug for muscular dystrophy, particularly Merosin-Deficient Congenital Muscular Dystrophy (MDC1A), and existing treatments only provide symptomatic relief.
Upregulate the expression of the LAMA1 gene in muscle tissues using a guide RNA targeting a specific sequence of the human LAMA1 gene and a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, such as dCas9 and VP64, delivered via vectors like AAV, to compensate for the lack of laminin α2 chain.
This approach significantly improves muscle histopathology and function, increasing lifespan and ameliorating muscle pathology in MDC1A models, including mice and non-human primates, by inducing functional laminin-111 protein expression.
Smart Images

Figure JPOXMLDOC01-APPB-T000001 
Figure 00000040_0000 
Figure 00000041_0000
Abstract
Description
METHOD FOR TREATING MUSCULAR DYSTROPHY BY TARGETING LAMA1 GENE
[0001] The present invention relates to a method for treating muscular dystrophy, particularly Merosin-Deficient Congenital Muscular Dystrophy (MDC1A), which also known as, LAMA2-congenital muscular dystrophy, by targeting a Laminin-α1 chain (LAMA1) gene and the like. More particularly, the present invention relates to a method for treating or preventing muscular dystrophy, the method including complementing LAMA2 or its function deleted by mutation by upregulating the expression of human LAMA1 gene, which is not inherently expressed in muscle tissues, by the use of guide RNA targeting a specific sequence of human LAMA1 gene, and a fusion protein of a transcription activator and a CRISPR effector protein, and an agent for treating or preventing muscular dystrophy and the like.
[0002] Muscular dystrophy is a generic term for a hereditary disease with progressive muscular atrophy and loss of muscle strength. At present, there is no effective fundamental therapeutic drug for muscular dystrophy, and only symptomatic treatment is given. As one type of muscular dystrophy, the autosomal recessive disease Merosin-Deficient Congenital Muscular Dystrophy (MDC1A) is known.
[0003] MDC1A is a congenital muscular dystrophy of the western type lacking mental retardation, and is caused by a deficiency of merosin in the skeletal muscle basement membrane component. Merosin is a heterotrimer composed of laminin chains and is bound to α-dystroglycan via a sugar chain structure. When it is deleted, the connection between the cytoskeleton and the extracellular matrix via the dystrophin glycoprotein complex is broken. It is the most frequent congenital muscular dystrophy in Europe and the United States (about 50%). It is caused by a mutation in the laminin α2 chain gene (LAMA2 gene) at 6q22.33.
[0004] Cohn et al. reported a method for correcting a splice site mutation that leads to mutation in the LAMA2 gene in MDC1A dy2J / dy2Jmouse model through systemic delivery of adeno-associated virus (AAV) with CRISPR / Cas9 genome editing component. The dy2J / dy2Jmouse after treatment showed substantial improvement in muscle histopathology and function with no signs of paralysis (NPL 1). In addition, Bassi showed that the LAMA1 gene could be a disease modifying gene for MDC1A. LAMA1 gene encodes a laminin α1 chain protein that is structurally similar to laminin α2 chain. Specifically, experiments using mice have shown the possibility that the CRISPR / Cas9 system of S. aureus may be used to upregulate expression of LAMA1 and compensate for the lack of laminin α2 chain (NPL 2, NPL 3). Furthermore, Arockiaraj AI et al. reported that CRISPRa-mediated LAMA1 upregulation may be a feasible mutation-independent therapeutic approach for MDC1A. As the results from previous studies using the CRISPRa system to activate gene expression have revealed that combination of three to four sgRNAs are typically considered more effective than one sgRNA alone, in this strategy combination(s) of multiple sgRNAs were administered (NPL 4).
[0005] [NPL 1] Kemaladewi, D. U., Maino, E., Hyatt, E., Hou, H., Ding, M., Place, K. M., Zhu, X., Bassi, P., Baghestani, Z., Deshwar, A. G., Merico, D., Xiong, H. Y., Frey, B. J., Wilson, M. D., Ivakine, E. A., Cohn, R. D. Nat Medicine. 23:8. 2017: Correction of a splicing defect in a mouse model of congenital muscular dystrophy type 1A using a homology-directed-repair-independent mechanism [NPL 2] Prabhpreet Singh Bassi, A thesis submitted in conformity with the requirements for the degree of Master of Science, Department of Molecular Genetics, University of Toronto. 2017: Assessing the Therapeutic Potential of CRISPR / Cas9-Mediated Gene Modulation in Merosin-Deficient Congenital Muscular Dystrophy Type 1A [NPL 3] Dwi U. Kemaladewi, Prabhpreet S. Bassi, Steven erwood, Dhekra Al-Basha, Kinga I. Gawlik, Kyle Lindsay, elzbieta Hyatt, rebekah Kember, Kara M. Place, ryan M. Marks, Madeleine Durbeej, Steven A. Prescott, evgueni A. Ivakine & ronald D. Cohn, Nature 572, p125, 2019: A mutation-independent approach for muscular dystrophy via upregulation of a modifier gene [NPL 4] Annie I Arockiaraj, Marie A Johnson, Anushe Munir, Prasanna Ekambaram, Peter C Lucas, Linda M McAllister-Lucas, Dwi U Kemaladewi. bioRxiv [Preprint]. 2023: CRISPRa-induced upregulation of human LAMA1 compensates for LAMA2-deficiency in Merosin-deficient congenital muscular dystrophy
[0006] The present invention aims to provide a novel therapeutic approach to human muscular dystrophy (particularly MDC1A).
[0007] The present inventors have conducted intensive studies of the above-mentioned problem and found that the expression of human LAMA1 gene can be upregulated with myocytes by using guide RNA targeting a specific sequence of human LAMA1 gene (Gene ID: 284217), and a fusion protein of a transcription activator and a CRISPR effector protein lacking nuclease activity. The present inventors have completed the present invention based on these findings.
[0008] The present invention may include the following invention. [1] A polynucleotide comprising the following base sequences: (a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (b) a base sequence encoding a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, in the expression regulatory region of human LAMA1 gene. [2] The polynucleotide of the above-mentioned [1], wherein the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 8, or said base sequence in which (i) 1 to 6 bases are deleted or added from the 5’ -end, and / or (ii) 1 base are substituted within the 9 bases from the 5’ -end. [3] The polynucleotide of the above-mentioned [1] or [2], wherein the transcription activator is selected from the group consisting of VP64, VP160, VPH, VPR, VP64-miniRTA (miniVR), and microVR, a variant thereof having transcription activation ability. [4] The polynucleotide of the above-mentioned [3], wherein the transcription activator is miniVR. [5] The polynucleotide of any of the above-mentioned [1] to [4], wherein the nuclease-deficient CRISPR effector protein is dCas9. [6] The polynucleotide of the above-mentioned [5], wherein the dCas9 is derived from Staphylococcus aureus. [7] The polynucleotide of any of the above-mentioned [1] to [6], further comprising a promoter sequence for the base sequence encoding the guide RNA and / or a promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator. [8] The polynucleotide of the above-mentioned [7], wherein the promoter sequence for the base sequence encoding the guide RNA is selected from the group consisting of U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, and H1 promoter. [9] The polynucleotide of the above-mentioned [8], wherein the promoter sequence for the base sequence encoding the guide RNA is U6 promoter.
[0010] The polynucleotide of any of the above-mentioned [7] to [9], wherein the promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator is ubiquitous promoter or muscle specific promoter.
[0011] The polynucleotide of the above-mentioned
[0010] , wherein the ubiquitous promoter is selected from the group consisting of EFS promoter, CMV promoter and CAG promoter.
[0012] The polynucleotide of the above-mentioned
[0011] , wherein the muscle specific promoter is selected from the group consisting of CK8 promoter, myosin heavy chain kinase (MHCK) promoter, muscle creatine kinase (MCK) promoter, synthetic C5-12(Syn) promoter and unc45b promoter.
[0013] A vector comprising a polynucleotide of any of the above-mentioned [1] to
[0012] .
[0014] The vector of the above-mentioned
[0013] , wherein the vector is a plasmid vector or a viral vector.
[0015] The vector of the above-mentioned
[0014] , wherein the viral vector is selected from the group consisting of adeno-associated virus (AAV) vector, adenovirus vector, and lentivirus vector.
[0016] The vector of the above-mentioned
[0015] , wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV6, AAV7, AAV8, AAV9, and a variant thereof (e.g., MyoAAV).
[0017] An agent for treating or preventing MDC1A, comprising a polynucleotide of any of the above-mentioned [1] to
[0012] or a vector of any of the above-mentioned
[0013] to
[0016] .
[0018] A method for treating or preventing MDC1A, comprising administering a polynucleotide of any of the above-mentioned [1] to
[0012] or a vector of any of the above-mentioned
[0013] to
[0016] to a subject in need thereof.
[0019] Use of a polynucleotide of any of the above-mentioned [1] to
[0012] or a vector of any of the above-mentioned
[0013] to
[0016] for the treatment or prevention of MDC1A.
[0020] Use of a polynucleotide of any of the above-mentioned [1] to
[0012] or a vector of any of the above-mentioned
[0013] to
[0016] in the manufacture of a pharmaceutical composition for the treatment or prevention of MDC1A.
[0021] A method for upregulating expression of human LAMA1 gene in a cell, comprising expressing (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, in the expression regulatory region of human LAMA1, in the aforementioned cell.
[0022] A ribonucleoprotein comprising the following: (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (d) a guide RNA targeting (i) a continuous region set forth in SEQ ID NO: 8, in the expression regulatory region of human LAMA1 gene.
[0023] A kit comprising the following for upregulation of the expression of the human LAMA1 gene: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting (i) a continuous region set forth in SEQ ID NO: 8 in the expression regulatory region of human LAMA1 gene, or a polynucleotide encoding the guide RNA.
[0024] A method for treating or preventing MDC1A, comprising administering the following (e) and (f): (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting (i) a continuous region set forth in SEQ ID NO: 8 in the expression regulatory region of human LAMA1 gene, or a polynucleotide encoding the guide RNA.
[0025] Use of the following (e) and (f): (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting (i) a continuous region set forth in SEQ ID NO: 8 in the expression regulatory region of human LAMA1 gene, or a polynucleotide encoding the guide RNA, in the manufacture of a pharmaceutical composition for the treatment or prevention of MDC1A.
[0009] According to the present invention, the expression of human LAMA1 gene can be upregulated, as a result of which the present invention is expected to be able to treat MDC1A.
[0010] [Fig.1] Fig.1 shows the location of the targeted genomic region in the human LAMA1 gene. [Fig.2] Fig.2 shows the evaluation results of an expression enhancing action on human LAMA1 gene in primary skeletal muscle myoblasts (HSMM cells) derived from donor #3 by using sgRNA containing crRNA encoded by the targeting sequence shown in SEQ ID NOs: 1 to 15 and mini-VR. The horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence, and the vertical axis shows the ratio of the expression level of LAMA1 gene when using each sgRNA to that when using control sgRNA as 1. For control, sgLAMA1-25 (SEQ ID NO: 15), sgLAMA1-207 (SEQ ID NO: 8), and sgLAMA1-208 (SEQ ID NO: 9), experiments were repeated four times and the average and SD were shown. [Fig.3] Fig.3 shows the evaluation results of an expression enhancing effect on human LAMA1 gene in an immortalized human myoblast cell in (iCM cells) by using sgRNA containing crRNA encoded by the targeting sequence in SEQ ID NOs: 8 and 15 (sg207 and sg25, respectively) and mini-VR. The horizontal axis shows MOIs of AAV9-pED261-sg25 or sg207, and the vertical axis shows the ratio of the expression level of LAMA1 gene when using each sgRNA to that when using control sgRNA as 1. Experiments were repeated three times and the average and SD were shown. Left column; AAV9-GNDM1-h25, Right column; AAV9-GNDM1-h207. [Fig.4A] Fig.4 shows the induction of LAMA1 expression via GNDM with high specificity in vitro and in Vivo. (A) Genomic features of GNDM target site. Mouse genome (mm9 genome assembly) at the Lama1 locus. Tracks indicate mouse Lama1 gene annotation, chromosome 17 coordinates as well as enrichment of H3K4me histone mark in C2C12 cells determined by ChIP-seq assay. Dot-line highlighted region was selected for gRNA screening for Lama1 upregulation in C2C12 cells. [Fig.4B] Fig.4 shows the induction of LAMA1 expression via GNDM with high specificity in vitro and in Vivo. (B) Summary of gRNA screening results in C2C12 cells. Relative Lama1 mRNA level is determined by QPCR where each sample expression values were normalized to the non-targeting gRNA (NTG) sample values. Bars represent mean values and SEM is represented by error bars (n=3). [Fig.4C] Fig.4 shows the induction of LAMA1 expression via GNDM with high specificity in vitro and in Vivo. (C) 7-week-old wildtype C57BL6 mice were administered systemically via tail vein with AAV9s containing NTG or m31 gRNA at the indicated dose. A schematic of CRISPR-GNDM vector is shown here. [Fig.4D] Fig.4 shows the induction of LAMA1 expression via GNDM with high specificity in vitro and in Vivo. (D) QPCR analysis of Lama1 expression in carious organ / tissue. Bars represent mean values and SEM is represented by error bars (n=4). [Fig.4E] Fig.4 shows the induction of LAMA1 expression via GNDM with high specificity in vitro and in Vivo. (E) RNA-seq plots of mouse gastrocnemius muscle tissue from systemically administration with AAV9-GNDM. The volcano plots (bottom) display the Lama1 as the most significantly repressed transcripts globally. The data are representative of the average of four independent replicates. [Fig.4F] Fig.4 shows the induction of LAMA1 expression via GNDM with high specificity in vitro and in Vivo. (F) A comparison of RNAseq reads alignment across the Lama1 gene between AAV9-GNDM-NTG and AAV9-GNDM-m31 treated mouse gastrocnemius muscle tissues. [Fig.5A] Fig.5 shows that AAV9-GNDM upregulates Lama1 and significantly improves lifespan and ameliorates muscle pathology in dyw mice. (A) PND2 mice were administered systemically via temporal vein with AAV9s containing NTG or m31 gRNA at the indicated dose. After 28 days, mice were euthanized and multiple tissues were harvested for various endpoint analysis. [Fig.5B] Fig.5 shows that AAV9-GNDM upregulates Lama1 and significantly improves lifespan and ameliorates muscle pathology in dyw mice. (B) Levels of Lama1 mRNA was assessed by RT-PCR and normalized to Hprt. Relative level of Lama1 was presented as compared to age-matched wildtype C57BL6 mice. [Fig.5C] Fig.5 shows that AAV9-GNDM upregulates Lama1 and significantly improves lifespan and ameliorates muscle pathology in dyw mice. (C) Immunofluorescence images of Lama1 an Lama2 of cross-sections of gastrocnemius (Left) and heart (right) from each treatment group. [Fig.5D] Fig.5 shows that AAV9-GNDM upregulates Lama1 and significantly improves lifespan and ameliorates muscle pathology in dyw mice. (D) Haematoxylin and eosin (H&E) staining of cross-sections of gastrocnemius muscles from each treatment group. [Fig.5E] Fig.5 shows that AAV9-GNDM upregulates Lama1 and significantly improves lifespan and ameliorates muscle pathology in dyw mice. (E) Measurements of Minimum feret diameter and Central nuclei from each treatment group. [Fig.5F] Fig.5 shows that AAV9-GNDM upregulates Lama1 and significantly improves lifespan and ameliorates muscle pathology in dyw mice. (F) Measurements of serum creatine kinase from each treatment group. [Fig.6A] Fig.6 shows that AAV9-CRISPR-GNDM-m31 induces functional laminin-111 protein in muscle tissues and effectively alleviates pathophysiology of dyw disease model, resulting in a significantly increased lifespan and body weight. (A) PND2 mice were administered systemically via temporal vein with AAV9s containing NTG or m31 gRNA at the indicated dose. Grip strength evaluation, body weight and survival monitoring were carried out over time. [Fig.6B] Fig.6 shows that AAV9-CRISPR-GNDM-m31 induces functional laminin-111 protein in muscle tissues and effectively alleviates pathophysiology of dyw disease model, resulting in a significantly increased lifespan and body weight. (B) Body weight and survival monitoring. [Fig.6C] Fig.6 shows that AAV9-CRISPR-GNDM-m31 induces functional laminin-111 protein in muscle tissues and effectively alleviates pathophysiology of dyw disease model, resulting in a significantly increased lifespan and body weight. (C) Grip strength evaluation. [Fig.7] Fig.7 shows that AAV9-GNDM induces durable expression of GNDM and LAMA1 in dy2j mice up to 12 months but with only transient immune response against transgene. Durable mRNA level of GNDM and LAMA1. [Fig.8A] Fig.8 shows that MyoAAV-CRISPR-GNDM-m31 demonstrated robust efficacy in dyw mice at significantly lower dose compared to AAV9. (A) BioD for MyoAAV. [Fig.8B] Fig.8 shows that MyoAAV-CRISPR-GNDM-m31 demonstrated robust efficacy in dyw mice at significantly lower dose compared to AAV9. (B) BW improvement and grip strength. [Fig.9A] Fig.9 shows that systemic administration of MyoAAV-GNDM-c58 in NHPs is safe and well-tolerated. (A) cyno gRNA screening in vitro. [Fig.9B] Fig.9 shows that systemic administration of MyoAAV-GNDM-c58 in NHPs is safe and well-tolerated. (B) Study design and blood chemistry. [Fig.9C] Fig.9 shows that systemic administration of MyoAAV-GNDM-c58 in NHPs is safe and well-tolerated. (C) NHP-3 Histology data. [Fig.10] Fig.10 shows that systemic administration of MyoAAV-GNDM in NHPs leads to widespread and selective biodistribution within skeletal muscle tissues and demonstrate successful epigenetic editing, as evidenced by significant target engagement and LAMA1 gene upregulation across muscle tissues. [Fig.11A] Fig.11 shows that systemic administration of MyoAAV-GNDM in juvenile NHPs is safe and well-tolerated. (A) Study design. [Fig.11B] Fig.11 shows that systemic administration of MyoAAV-GNDM in juvenile NHPs is safe and well-tolerated. (B) Liver enzymes. [Fig.12A] Fig.12 shows that systemic administration of MyoAAV-GNDM demonstrate higher efficacy in Juvenile NHPs even with a lowered dose. (A) VCN. [Fig.12B] Fig.12 shows that systemic administration of MyoAAV-GNDM demonstrate higher efficacy in Juvenile NHPs even with a lowered dose. (B) LAMA1 and GNDM mRNA.
[0011] The embodiments of the present invention are explained in detail below.
[0012] 1. Polynucleotide The present invention provides a polynucleotide comprising the following base sequences (hereinafter sometimes to be also referred to as “the polynucleotide of the present invention”): (a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (b) a base sequence encoding a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, in the expression regulatory region of human LAMA1 gene. The polynucleotide of the present invention is introduced into a desired cell and transcribed to produce a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and a guide RNA targeting a particular region of the expression regulatory region of the human LAMA1 gene. These fusion protein and guide RNA form a complex (hereinafter the complex is sometimes referred to as “ribonucleoprotein; RNP”) and cooperatively act on the aforementioned particular region, thus activating transcription of the human LAMA1 gene.
[0013] (1) Definition In the present specification, “the expression regulatory region of human Laminin-α1 chain (LAMA1) gene” means any region in which the expression of human LAMA1 gene can be activated by binding RNP to that region. In the present specification, when the expression regulatory region is shown by the particular sequence, the expression regulatory region includes both the sense strand sequence and the antisense strand sequence conceptually. In the present invention, a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator is recruited by a guide RNA into a particular region in the expression regulatory region of the human LAMA1 gene. In the present specification, the “guide RNA targeting ...” means a “guide RNA recruiting a fusion protein into ...”. In the present specification, the “guide RNA (to be also referred to as ‘gRNA’)” is an RNA comprising a genome specific CRISPR-RNA (to be referred to as “crRNA”). crRNA is an RNA that binds to a complementary sequence of a targeting sequence (described later). When Cpf1 is used as the CRISPR effector protein, the “guide RNA” refers to an RNA comprising an RNA consisting of crRNA and a specific sequence attached to its 5’-terminal (for example, an RNA sequence set forth in SEQ ID NO: 16 in the case of FnCpf 1). When Cas9 is used as the CRISPR effector protein, the “guide RNA” refers to chimera RNA (to be referred to as “single guide RNA(sgRNA)”) comprising crRNA and trans-activating crRNA attached to its 3’-terminal (to be referred to as “tracrRNA”) (see, for example, Zhang F. et al., Hum Mol Genet. 2014 Sep 15; 23(R1):R40-6 and Zetsche B. et al., Cell. 2015 Oct 22; 163(3): 759-71, which are incorporated herein by reference in their entireties). In the present specification, a sequence complementary to the sequence to which crRNA is bound in the expression regulatory region of the human LAMA1 gene is referred to as a “targeting sequence”. That is, in the present specification, the “targeting sequence” is a DNA sequence present in the expression regulatory region of the human LAMA1 gene and adjacent to PAM (protospacer adjacent motif). PAM is adjacent to the 5’-side of the targeting sequence when Cpf1 is used as the CRISPR effector protein. PAM is adjacent to the 3’-side of the targeting sequence when Cas9 is used as the CRISPR effector protein. The targeting sequence may be present on either the sense strand sequence side or the antisense strand sequence side of the expression regulatory region of the human LAMA1 gene (see, for example, the aforementioned Zhang F. et al., Hum Mol Genet. 2014 Sep 15; 23(R1):R40-6 and Zetsche B. et al., Cell. 2015 Oct 22; 163(3): 759-71, which are incorporated herein by reference in their entireties).
[0014] (2) Nuclease-deficient CRISPR effector protein In the present invention, using a nuclease-deficient CRISPR effector protein, a transcriptional activator fused thereto is recruited to the expression regulatory region of the human LAMA1 gene. The nuclease-deficient CRISPR effector protein (hereinafter to be simply referred to as “CRISPR effector protein”) to be used in the present invention is not particularly limited as long as it forms a complex with gRNA and is recruited to the expression regulatory region of the human LAMA1 gene. For example, nuclease-deficient Cas9 (hereinafter sometimes to be also referred to as “dCas9”) or nuclease-deficient Cpf1 (hereinafter sometimes to be also referred to as “dCpf1”) can be included. Examples of the above-mentioned dCas9 include, but are not limited to, a nuclease-deficient variant of Streptococcus pyogenes-derived Cas9 (SpCas9; PAM sequence: NGG (N is A, G, T or C. hereinafter the same)), Streptococcus thermophilus-derived Cas9 (StCas9; PAM sequence: NNAGAAW (W is A or T. hereinafter the same)), Neisseria meningitidis-derived Cas9 (NmCas9; PAM sequence: NNNNGATT), or Staphylococcus aureus-derived Cas9 (SaCas9; PAM sequence: NNGRRT (R is A or G. hereinafter the same)) and the like (see, for example, Nishimasu et al., Cell. 2014 Feb 27; 156(5): 935-49, Esvelt KM et al., Nat Methods. 2013 Nov; 10(11):1116-21, Zhang Y. Mol Cell. 2015 Oct 15; 60(2):242-55, and Friedland AE et al., Genome Biol. 2015 Nov 24; 16:257, which are incorporated herein by reference in their entireties). For example, in the case of SpCas9, a double mutant in which the 10th Asp residue is converted to Ala residue and the 840th His residue is converted to Ala residue (sometimes referred to as “dSpCas9”) can be used (see, for example, the aforementioned Nishimasu et al., Cell. 2014). Alternatively, in the case of SaCas9, a double mutant in which the 10th Asp residue is converted to Ala residue and the 580th Asn residue is converted to Ala residue (SEQ ID NO:17), or a double mutant in which the 10th Asp residue is converted to Ala residue and the 557th His residue is converted to Ala residue (SEQ ID NO: 18) (hereinafter any of these double mutants is sometimes to be referred to as “dSaCas9”) can be used (see, for example, the aforementioned Friedland AE et al., Genome Biol. 2015, which is incorporated herein by reference in its entirety). In addition, in one embodiment of the present invention, as dCas9, a variant obtained by modifying a part of the amino acid of the aforementioned dCas9, which forms a complex with gRNA and is recruited to the expression regulatory region of the human LAMA1 gene, may also be used. Examples of such variant include a truncated variant with a partly deleted amino acid sequence or a variant obtained by modification (deletion, addition and / or substitution) of a part of the amino acid of the aforementioned dCas9. In one embodiment of the present invention, as dCas9, variants disclosed in WO219049913A1, WO2019235627A1, and WO2020085441A1, which are incorporated herein by reference in there entireties, can be used. Specifically, dSaCas9 obtained by deleting the 721st to 745th amino acids from dSaCas9 that is a double mutant in which the 10th Asp residue is converted to Ala residue and the 580th Asn residue is converted to Ala residue (SEQ ID NO: 19), or dSaCas9 in which the deleted part is substituted by a peptide linker (e.g., one in which the deleted part is substituted by GGSGGS linker (SEQ ID NO: 20) is set forth in SEQ ID NO: 21), or dSaCas9 obtained by deleting the 482nd to 648th amino acids of dSaCas9 that is the aforementioned double mutant (SEQ ID NO: 22), or dSaCas9 in which the deleted part is substituted by a peptide linker (one in which the deleted part is substituted by GGSGGS linker is set forth in SEQ ID NO: 23) may also be used. In another embodiment, dSaCas9 (dSaCas9-PFv51)) obtained by amino acid substitution (E782K_L800R_T927K_K929N_N968R_N985A_R991A_A1021S_I1017F) of dSaCas9 that is a double mutant in which the 10th Asp residue is converted to Ala residue and the 580th Asn residue is converted to Ala residue. In this specification, the alphabet displayed on the left side of the number indicating the number of amino acid residues up to the substitution site indicates a single letter code of the amino acid before substitution of the amino acid sequence of SaCas9, and the alphabet displayed on the right side indicates a single letter code of the amino acid after substitution. Examples of the above-mentioned dCpf1 include, but are not limited to, a nuclease-deficient variant of Francisella novicida-derived Cpf1 (FnCpf1; PAM sequence: NTT), Acidaminococcus sp.-derived Cpf1 (AsCpf1; PAM sequence: NTTT), or Lachnospiraceae bacterium-derived Cpf1 (LbCpf1; PAM sequence: NTTT) and the like (see, for example, Zetsche B. et al., Cell. 2015 Oct 22; 163(3):759-71, Yamano T et al., Cell. 2016 May 5; 165(4):949-62, and Yamano T et al., Mol Cell. 2017 Aug 17; 67(4):633-45, which are incorporated herein by reference in their entireties). For example, in the case of FnCpf1, a double mutant in which the 917th Asp residue is converted to Ala residue and the 1006th Glu residue is converted to Ala residue can be used (see, for example, the aforementioned Zetsche B et al., Cell. 2015, which is incorporated herein by reference in its entirety). In one embodiment of the present invention, as dCpf1, a variant obtained by modifying a part of the amino acid of the aforementioned dCpf1, which forms a complex with gRNA and is recruited to the expression regulatory region of the human LAMA1 gene, may also be used. In one embodiment of the present invention, dCas9 is used as the CRISPR effector protein and, in a particular embodiment, dSaCas9 is used. A polynucleotide comprising a base sequence encoding a CRISPR effector protein can be cloned by, for example, synthesizing an oligoDNA primer covering a region encoding a desired part of the protein based on the cDNA sequence information thereof, and amplifying the polynucleotide by PCR method using total RNA or mRNA fraction prepared from the cells producing the protein as a template. In addition, a polynucleotide comprising a base sequence encoding a CRISPR effector protein can be obtained by introducing a mutation into a nucleotide sequence encoding a cloned CRISPR effector protein by a known site-directed mutagenesis method to convert the amino acid residues (e.g., 10th Asp residue, 557th His residue, and 580th Asn residue in the case of SaCas9; 917th Asp residue and 1006th Glu residue in the case of FnCpf1, and the like can be included, but are not limited to these) at a site important for DNA cleavage activity to other amino acids. Alternatively, a polynucleotide comprising a base sequence encoding CRISPR effector protein can be obtained by chemical synthesis or a combination of chemical synthesis and PCR method or Gibson Assembly method, based on the cDNA sequence information thereof, and can also be further constructed as a base sequence that underwent codon optimization to give codons suitable for expression in human.
[0015] (3) Transcription activator In the present invention, human LAMA1 gene expression is activated by the action of the transcription activator fused with the CRISPR effector protein. In the present specification, the “transcription activator” means a protein having ability to activate gene transcription of human LAMA1 gene or a peptide fragment retaining the function thereof. The transcription activator to be used in the present invention is not particularly limited as long as it can activate expression of human LAMA1 gene. For example, it includes VP64, VP160, VPH, VPR, miniVR, and microVR, a variant thereof having transcription activation ability and the like. VP64 is exemplified by a peptide consisting of 50 amino acids set forth in SEQ ID NO: 24. VP160 is exemplified by a peptide consisting of 131 amino acids set forth in SEQ ID NO: 25. VPH is a fusion protein of VP64, p65 and HSF1, specifically, exemplified by a peptide consisting of 376 amino acids set forth in SEQ ID NO: 26. VPR is a fusion protein of VP64, p65, and a replication and transcription activator of Epstein-Barr virus (RTA), specifically, exemplified by a peptide consisting of 523 amino acids set forth in SEQ ID NO: 27. VP64, VPH, and VPR are known and disclosed in detail in, for example, Chavez A. et al., Nat Methods. 2016 Jul; 13(7):563-7 and Chavez A. et al., Nat Methods. 2015 Apr; 12(4):326-8, which are incorporated herein by reference in their entireties. MiniVR and microVR are peptides comprising VP64 and a transcription activation domain of RTA. The transcription activation domain of RTA is known and disclosed in, for example, J Virol. 1992 Sep;66(9):5500-8, which is incorporated herein by reference in its entirety and the like. Specifically, miniVR is exemplified by a peptide consisting of 167 amino acids set forth in SEQ ID NO: 28, and microVR is exemplified by a peptide consisting of 140 amino acids set forth in SEQ ID NO: 29. The amino acid sequence set forth in SEQ ID NO: 28 is composed of an amino acid sequence in which the 493rd - 605th amino acid residues of RTA and VP64 are linked with a G-S-G-S linker (SEQ ID NO: 30). The amino acid sequence set forth in SEQ ID NO: 29 is composed of an amino acid sequence in which the 520th - 605th amino acid residues of RTA and VP64 are linked with a G-S-G-S linker. The detail of miniVR and microVR is described in WO2020 / 032057A1, which is incorporated herein by reference in its entirety. Any of the aforementioned transcriptional activators may be subjected to any modification and / or alteration as long as it maintains its transcription activation ability. A polynucleotide comprising a base sequence encoding a transcription activator can be constructed by chemical synthesis or a combination of chemical synthesis and PCR method or Gibson Assembly method. Furthermore, a polynucleotide comprising a base sequence encoding a transcription activator can also be constructed as a codon-optimized DNA sequence to be codons suitable for expression in human. A polynucleotide comprising a base sequence encoding a fusion protein of a transcription activator and a CRISPR effector protein can be prepared by ligating a base sequence encoding a CRISPR effector protein to a base sequence encoding a transcription activator directly or after adding a base sequence encoding a linker, NLS (nuclear localization signal) and / or a tag. In the present invention, the transcription activator may be fused with either N-terminal or C-terminal. As the linker, a linker with an amino acid number of about 2 to 50 can be used, and specific examples thereof include, but are not limited to, a G-S-G-S linker in which glycine (G) and serine (S) are alternately linked and the like.
[0016] (4) Guide RNA In the present invention, a fusion protein of CRISPR effector protein and transcription activator can be recruited to the expression regulatory region of the human LAMA1 gene by guide RNA. As described in the aforementioned “(1) Definition”, guide RNA comprises crRNA, and the crRNA binds to a complementary sequence of the targeting sequence. crRNA may not be completely complementary to the complementary sequence of the targeting sequence as long as the guide RNA can recruit the fusion protein to the target region, and may be a sequence in which (i) 1 to 6 bases are deleted or added from the 5’ end, and / or (ii) 1 base are substituted within the 9 bases from the 5’ end. When dCas9 is used as the CRISPR effector protein, for example, the targeting sequence can be determined using a published gRNA design web site (CRISPR Design Tool, CRISPR direct etc.). To be specific, from the sequence of the object gene (i.e., human LAMA1 gene), candidate targeting sequences of about 20 nucleotides in length for which PAM (e.g., NNGRRT in the case of SaCas9) is adjacent to the 3’-side thereof are listed, and one having a small number of off-target sites in human genome from among these candidate targeting sequences can be used as the targeting sequence. The base length of the targeting sequence is 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length. As a primary screening for the prediction of the off-target site number, a number of bioinformatic tools are known and publicly available, and can be used to predict the targeting sequence with the lowest off-target effect. Examples thereof include bioinformatics tools such as Benchling (https: / / benchling.com), and COSMID (CRISPR Off-target Sites with Mismatches, Insertions and Deletions) (Available on https: / / crispr.bme.gatech.edu on the internet). Using these, the similarity to the base sequence targeted by gRNA can be summarized. When the gRNA design software to be used does not have a function to search for off-target site of the target genome, for example, the off-target site can be searched for by subjecting the target genome to Blast search with respect to 8 to 12 nucleotides on the 3’-side of the candidate targeting sequence (seed sequence with high discrimination ability of targeted nucleotide sequence). In one embodiment of the present invention, in the region existing in the GRCh38.p13 position of human chromosome 18 (Chr 18), the following region can be the expression regulatory regions of the human LAMA1 gene. This region is strongly suggested to be expression regulatory regions by histone modification patterns. Therefore, in one embodiment of the present invention, the targeting sequence can be 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length, in at least one region of the following region existing in the GRCh38.p13 position of human chromosome 18 (Chr 18): 7,117,996-7,118,428. In one embodiment of the present invention, the targeting sequence can be the base sequence set forth in SEQ ID NO: 8. When the targeting sequence set forth in SEQ ID NO: 8 (CCGAGCCTGGGTGGCTTCCCG) is introduced into the cell as a base sequence encoding crRNA, crRNA transcribed from the sequence is GCCGAGCCUGGGUGGCUUCCCG (SEQ ID NO: 31) and is bound to CGGGAAGCCACCCAGGCTCGG (SEQ ID NO: 32), which is a sequence complementary to the base sequence set forth in SEQ ID NO: 8 and is present in the expression regulatory region of the human LAMA1 gene. In gRNA, the seed region adjacent to the PAM sequence is important, and mutations near the 5’-end have little effect on activity (Cem Kuscu et al., Nat Biotechnol. 2014 Jul; 32(7): 677-83.; Xuebing Wu et al., Nat Biotechnol. 2014 Jul; 32(7): 670-6.). Therefore, in another embodiment, a base sequence which is a targeting sequence in which at least 1 to 6 bases are deleted or added from the 5’ -end can be used as the base sequence encoding crRNA as long as guide RNA can recruit a fusion protein to the target region. In further another embodiment, a base sequence which is a targeting sequence in which 1 base are substituted within the 9 based from the 5’ -end can be used as the base sequence encoding crRNA as long as guide RNA can recruit a fusion protein to the target region. Therefore, in one embodiment of the present invention, as a base sequence encoding crRNA, the base sequence set forth in SEQ ID NO: 8, or such sequence in which (i) 1 to 6 bases are deleted or added from the 5’ -end, and / or (ii) 1 base are substituted within the 9 bases from the 5’ -end can be used. As shown in the example, the gRNA of the present invention has a potent upregulation effect on LAMA1 mRNA expression. Therefore, what required the use of multiple vectors and multiple gRNAs can now be achieved with a single vector and a single gRNA. When dCpf1 is used as the CRISPR effector protein, a base sequence encoding gRNA can be designed as a DNA sequence encoding crRNA with particular RNA attached to the 5’-terminal. RNA attached to the 5’-terminal of crRNA and a DNA sequence encoding said RNA can be appropriately selected by those of ordinary skill in the art according to the dCpf1 to be used. For example, when dFnCpf1 is used, a base sequence in which SEQ ID NO: 33; AATTTCTACTGTTGTAGAT is attached to the 5’-end of the targeting sequence can be used as a base sequence encoding gRNA (when transcribed to RNA, the sequences of the underlined parts form a base pairs to form a stem-loop structure). The sequence to be added to the 5’-terminal may be a sequence generally used for various Cpf1 proteins in which at least 1 to 6 bases are deleted, substituted, inserted and / or added, as long as gRNA can recruit a fusion protein to the expression regulatory region after transcription. When dCas9 is used as the CRISPR effector protein, a base sequence encoding gRNA can be designed as a DNA sequence in which a DNA sequence encoding known tracrRNA is linked to the 3’-terminal of a DNA sequence encoding crRNA. Such tracrRNA and a DNA sequence encoding the tracrRNA can be appropriately selected by those of ordinary skill in the art according to the dCas9 to be used. For example, when dSaCas9 is used, the base sequence set forth in SEQ ID NO: 34 is used as the DNA sequence encoding tracrRNA. The DNA sequence encoding tracrRNA may be a base sequence encoding tracrRNA generally used for various Cas9 proteins in which at least 1 to 6 bases are deleted, substituted, inserted and / or added, as long as gRNA can recruit a fusion protein to the expression regulatory region after transcription. A polynucleotide comprising a base sequence encoding gRNA designed in this way can be chemically synthesized using a known DNA synthesis method. In another embodiment of the present invention, the polynucleotide of the present invention may comprise two or more kinds of gRNA with different crRNA.
[0017] (5) Promoter sequence In one embodiment of the present invention, a promoter sequence may be operably linked to the upstream of each of a base sequence encoding fusion protein of CRISPR effector protein and transcription activator and / or a base sequence encoding gRNA. The promoter to be possibly linked is not particularly limited as long as it shows a promoter activity in the target cell. Examples of the promoter sequence possibly linked to the upstream of the base sequence encoding the fusion protein include, but are not limited to, EFS promoter, CMV (cytomegalovirus) promoter, CK8 promoter, MHC promoter, MYOD promoter, hTERT promoter, SRa promoter, SV40 promoter, LTR promoter, CAG promoter, RSV (Rous sarcoma virus) promoter and the like. Examples of the promoter sequence possibly linked to the upstream of the base sequence encoding gRNA include, but are not limited to, U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, H1 promoter, and tRNA promoter, which are pol III promoters, and the like. In one embodiment of the present invention, a muscle specific promoter can be used as the promoter sequence linked to the upstream of a base sequence encoding the aforementioned fusion protein. Examples of the muscle specific promoter include, but are not limited to, CK8 promoter, CK6 promoter, CK1 promoter, CK7 promoter, CK9 promoter, cardiac muscle troponin C promoter, a actin promoter, myosin heavy chain kinase (MHCK) promoter, myosin light chain 2A promoter, dystrophin promoter, muscle creatine kinase promoter, dMCK promoter, tMCK promoter, enh348 MCK promoter, synthetic C5-12(Syn) promoter, unc45b promoter, Myf5 promoter, MLC1 / 3f promoter, MYOD promoter, Myog promoter, Pax7 promoter and the like (for the detail of the muscle specific promoter, see, for example, US2011 / 0212529A, McCarthy JJ et al., Skeletal Muscle. 2012 May; 2(1):8, Wang B. et al., Gene Ther. 2008 Nov; 15(22):1489-99, which are incorporated herein by reference in their entireties and the like). Preferably, the promoter sequence that can be linked upstream of the nucleotide sequence encoding the fusion protein is the CK8 promoter, and the promoter sequence that can be linked upstream of the nucleotide sequence encoding the gRNA is the U6 promoter.
[0018] (6) Other base sequence Furthermore, the polynucleotide of the present invention may further comprise known sequences such as Polyadenylation signal, Kozak consensus sequence and the like besides those mentioned above for the purpose of improving the translation efficiency of mRNA produced by transcription of a base sequence encoding a fusion protein of CRISPR effector protein and transcription activator. In addition, the polynucleotide of the present invention may comprise a base sequence encoding a linker sequence, a base sequence encoding NLS and / or a base sequence encoding a tag.
[0019] 2. Vector The present invention provides a vector comprising the polynucleotide of the present invention (hereinafter sometimes referred to as “the vector of the present invention”). The vector of the present invention may be a plasmid vector or a viral vector. When the vector of the present invention is a plasmid vector, the plasmid vector to be used is not particularly limited and may be any plasmid vector such as cloning plasmid vector and expression plasmid vector. The plasmid vector is prepared by inserting the polynucleotide of the present invention into a plasmid vector by a known method. When the vector of the present invention is a viral vector, the viral vector to be used is not particularly limited and examples thereof include, but are not limited to, adenovirus vector, adeno-associated virus (AAV) vector, lentivirus vector, retrovirus vector, Sendaivirus vector and the like. In the present specification, the “virus vector” or “viral vector” also includes derivatives thereof. Considering the use in gene therapy, AAV vector is preferably used for the reasons such that it can express transgene for a long time, and it is derived from a non-pathogenic virus and has high safety. A viral vector comprising the polynucleotide of the present invention can be prepared by a known method. In brief, a plasmid vector for virus expression into which the polynucleotide of the present invention has been inserted is prepared, the vector is transfected into an appropriate host cell to allow for transient production of a viral vector comprising the polynucleotide of the present invention, and the viral vector is collected. In one embodiment of the present invention, when AAV vector is used, the serotype of the AAV vector is not particularly limited as long as expression of the human LAMA1 gene in the target can be activated, and any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and variant thereof, and the like may be used (for the various serotypes of AAV, see, for example, WO 2005 / 033321, which is incorporated herein by reference in its entirety). Examples of the variants of AAV include, but are not limited to, new serotype with a modified capsid (e.g., WO 2012 / 057363, which is incorporated herein by reference in its entirety) and the like. MyoAAV (sometimes denoted as MYOAAV) are some of the derivatives of the AAV9 capsid and can be used in muscle-directed gene transfer. MyoAAV can provide gene therapy more efficiently and at lower doses using a modified outer protein shell of AAV known as a capsid (Tabebordbar M. et al., Cell. 2021 Sep 16;184(19):4919-4938). There are several types of MyoAAV, specifically MyoAAV 3A-3F and MyoAAV 4A-4E. MyoAAV 3A is cited as a preferable example of MyoAAV. In one example of preparing an AAV vector, first, a vector plasmid comprising inverted terminal repeat (ITR) at both ends of wild-type AAV genomic sequence and the polynucleotide of the present invention inserted in place of the DNA encoding Rep protein and capsid protein is prepared. On the other hand, the DNA encoding Rep protein and capsid protein necessary for forming virus particles is inserted into other plasmid. Furthermore, a plasmid comprising genes (E1A, E1B, E2A, VA and E4orf6) responsible for the helper action of adenovirus necessary for proliferation of AAV is prepared as an adenovirus helper plasmid. Co-transfection of these three kinds of plasmids into the host cell causes production of recombinant AAV (i.e., AAV vector) in the cell. As the host cell, a cell capable of supplying a part of the gene products (proteins) of the genes responsible for the aforementioned helper action (e.g., 293 cell etc.) is preferably used. When such cell is used, it is not necessary to carry the gene encoding a protein that can be supplied from the host cell in the aforementioned adenoviral helper plasmid. The produced AAV vector is present in the nucleus. Thus, a desired AAV vector is prepared by destroying the host cell with freeze-thawing, collecting the virus and then subjecting the virus fraction to separation and purification by density gradient ultracentrifugation method using cesium chloride, column method or the like. AAV vector has great advantages in terms of safety, gene transduction efficiency and the like, and is used for gene therapy. However, it is known that the size of polynucleotide that can be packaged is limited. For example, the entire length including the base length of a polynucleotide comprising a base sequence encoding a fusion protein of dSaCas9 and miniVR or microVR, a base sequence encoding gRNA targeting the expression regulatory region of the human LAMA1 gene, and EFS promoter sequence and U6 promoter sequence as the promoter sequences, which is one embodiment of the present invention, and ITR parts is about 4.85 kb, and they can be packaged in a single AAV vector.
[0020] 3. Treating or preventing agent for MDC1A The present invention also provides a treating or preventing agent for MDC1A comprising the polynucleotide of the present invention or the vector of the present invention (hereinafter sometimes referred to as “the agent of the present invention”). The agent of the present invention comprises the polynucleotide of the present invention or the vector of the present invention as an active ingredient, and may be prepared as a formulation comprising such active ingredient (i.e., the polynucleotide of the present invention or the vector of the present invention) and, generally, a pharmaceutically acceptable carrier. The agent of the present invention is administered parenterally, and may be administered topically or systemically. The agent of the present invention can be administered by, but are not limited to, for example, intravenous administration, intraarterial administration, subcutaneous administration, intraperitoneal administration, or intramuscular administration. The dose of the agent of the present invention to a subject is not particularly limited as long as it is an effective amount for the treatment and / or prevention. It may be appropriately optimized according to the active ingredient, dosage form, age and body weight of the subject, administration schedule, administration method and the like. In one embodiment of the present invention, the agent of the present invention can be not only administered to the subject affected with MDC1A but also prophylactically administered to subjects who may develop MDC1A in the future based on the genetic background analysis and the like. The term “treatment” in the present specification also includes remission of disease, in addition to cure of diseases. In addition, the term “prevention” may also include delaying onset of disease, in addition to prophylaxis of onset of disease. The agent of the present invention can also be referred to as “the pharmaceutical composition of the present invention” or the like.
[0021] 4. Method for treatment or prevention of MDC1A The present invention also provides a method for treating or preventing MDC1A, comprising administering the polynucleotide of the present invention or the vector of the present invention to a subject in need thereof (hereinafter sometimes referred to as “the method of the present invention”). In addition, the present invention includes the polynucleotide of the present invention or the vector of the present invention for use in the treatment or prevention of MDC1A. Furthermore, the present invention includes use of the polynucleotide of the present invention or the vector of the present invention in the manufacture of a pharmaceutical composition for the treatment or prevention of MDC1A. The method of the present invention can be practiced by administering the aforementioned agent of the present invention to a subject affected with MDC1A, and the dose, administration route, subject and the like are the same as those mentioned above. Measurement of the symptoms may be performed before the start of the treatment using the method of the present invention and at any timing after the treatment to determine the response of the subject to the treatment. The method of the present invention can improve the functions of the skeletal muscle and / or cardiac muscle of the subject. Muscles to be improved in the function thereof are not particularly limited, and any muscles and muscle groups are exemplified.
[0022] 5. Ribonucleoprotein The present invention provides a ribonucleoprotein comprising the following (hereinafter sometimes referred to as “RNP of the present invention”): (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, in the expression regulatory region of human LAMA1 gene. As the CRISPR effector protein, transcription activator, and guide RNA comprised in the RNP of the present invention, the CRISPR effector protein, transcription activator, and guide RNA explained in detail in the above-mentioned section of “1. Polynucleotide” can be used. The fusion protein of CRISPR effector protein and transcription activator to be comprised in the RNP of the present invention can be produced by, for example, introducing a polynucleotide encoding the fusion protein into the cell, bacterium, or other organism to allow for expression, or an in vitro translation system by using the polynucleotide. In addition, guide RNA comprised in the RNP of the present invention can be produced by, for example, chemical synthesis or an in vitro transcription system by using a polynucleotide encoding the guide RNA. The thus-prepared CRISPR effector protein and guide RNA are mixed to prepare the RNP of the present invention. Where necessary, other substances such as gold particles may be mixed. To directly deliver the RNP of the present invention to the target cell, tissue and the like, the RNP may be encapsulated in a lipid nanoparticle (LNP) by a known method. The RNP of the present invention can be introduced into the target cell, tissue and the like by a known method. For example, Lee K., et al., Nat Biomed Eng. 2017; 1:889-901, WO 2016 / 153012, which are incorporated herein by reference in their entireties, and the like can be referred to for encapsulation in LNP and introduction method. In one embodiment of the present invention, the guide RNA comprised in RNP of the present invention targets continuous 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length, in at least one region of the following region existing in the GRCh38.p13 position of human chromosome 18 (Chr 18): 7,117,996-7,118,428. In one embodiment, the guide RNA targets a region comprising all or a part of the sequence set forth in SEQ ID NO: 8.
[0023] 6. Others The present invention also provides a composition or kit comprising the following for activation of the expression of the human LAMA1 gene: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8; in the expression regulatory region of human LAMA1 gene, or a polynucleotide encoding the guide RNA. The present invention also provides a method for treating or preventing MDC1A, comprising administering the following (e) and (f): (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, in the expression regulatory region of human LAMA1 gene, or a polynucleotide encoding the guide RNA. As the CRISPR effector protein, transcription activator, guide RNA, as well as polynucleotides encoding them and vectors in which they are carried in these inventions, those explained in detail in the above-mentioned sections of “1. Polynucleotide”, “2. Vector” and “5. Ribonucleoprotein” can be used. The dose, administration route, subject, formulation and the like of the above-mentioned (e) and (f) are the same as those explained in the section of “3. Treating or preventing agent for MDC1A”. Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof.
[0024] Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof.
[0025] Experimental MethodsSelection of LAMA1 Targeting Sequences Based on the H3K4me3, H3K27Ac pattern of the genome in human skeletal muscle cells, an expanded region of the human LAMA1 gene regulatory region near TSS (TSS-2) was scanned for sequences that can be targeted by a catalytically-inactive SaCas9 (D10A and N580A mutant; dSaCas9) complexed with gRNA, defined herein as a targeting sequence. The location of the targeted genome regions relative to the LAMA1 gene is depicted in Fig.1 and their coordinates are noted below: Chr18: GRCh38 / hg38;7,117,996-7,118,428 -> ~0.5kb (TSS-2)
[0026] Targeting sequences were specified by the 21-nucleotide segment adjacent to a protospacer adjacent motif (PAM) having the sequence NNGRRT (5’-21nt targeting sequence-NNGRRT-3’) (Table 1) wherein N=A / C / T / G and R=A / G.
[0027] Table 1 Targeting sequences used to screen expression regulatory region of LAMA1 gene.
[0028]
[0029] In Table 1, “Position” indicates the potential SaCas9 cleavage site for all shown gRNAs when SaCas9 is used. SEQ ID NOs: 1 to 14 are located in the TSS-2 region ( Fig.1).
[0030] Construction of Lentiviral transfer plasmid (pED176 and derivative plasmid) pLentiCRISPR v2 was purchased from Genscript (https: / / www.genscript.com) and the following modifications were made: the SpCas9 gRNA scaffold sequence was replaced by SaCas9 gRNA scaffold sequence; SpCas9-FLAG was replaced with dSaCas9 fused to codon optimized VP64-miniRTA (also referred to as mini-VR). VP64-miniRTA transcriptional activation domains can activate gene expression when localized to promoters by activating transcription. VP64-miniRTA was tethered to the C-terminus of dSaCas9 (D10A and N580A mutant), which is referred to as dSaCas9-VR hereinafter, and targeted to human LAMA1 gene regulatory regions as directed by targeting sequences (Table 1, Fig.1). The generated backbone plasmid was named pED176.
[0031] Construction of Adeno-associated virus transgene plasmid (pED261 and derivative plasmid) pAAV-CMV vector was purchased from Takara (https: / / www.takara.com) and the sequence between ITRs were replaced by CK8 promoter driven dSaCas9 fused with VP64-miniRTA and U6 promoter driven SaCas9 gRNA scaffold sequence. The generated backbone plasmid was named pED261.
[0032] gRNA cloning Three control non-targeting targeting sequences and 14 targeting sequences (Table 1) were cloned into pED176 or pED261. The following sequence was also used as targeting sequence. SEQ ID NO: 15 (sgLAMA1-25 / sg25); Position: 7116449, Strand: -1; Sequence (5’ ® 3’): ACCGGAGCTGGAAACGCAGCA, PAM: TTGAAT Forward and reverse oligos were synthesized by Integrated DNA Technologies in the following format: Forward; 5’ CACC(G)-20 basepair targeting sequence - 3’, and Reverse: 5’ AAAC-19-21 basepair reverse complement targeting sequence - (C) - 3’, where bases in parenthesis were added if the target did not begin with a G. Oligos were resuspended in Tris-EDTA buffer (pH 8.0) at 100 μM. 1 μl of each complementary oligo were combined in a 10 μl reaction in NE Buffer 3.1 (NEB catalog number: B7203S). The reaction was heated to 95°C and allowed to cool to 25°C in a thermocycler, thus annealing oligos with sticky end overhangs compatible with cloning to pED176 or pED261. Annealed oligos were combined with pED176 or pED261 which had been digested with BsmBI(BsaI for pED261) and gel purified, and ligated with T4 DNA ligase (NEB catalog number: M0202S) according to manufacturer’s protocol. 2 μl of the ligation reaction was transformed into 10 μl of NEB Stable Competent cells (NEB catalog number: C3040I) according to the manufacturer’s protocol. The resulting construct drives expression of sgRNAs comprising crRNA encoded by individual targeting sequences fused with tracrRNA (SEQ ID NO: 35) by a U6 promoter.
[0033] Lentivirus Generation HEK293TA cells were seeded at 0.75x106cells / well in 6 well cell culture dishes (VWR catalog number: 10062-892) in 2 ml growth medium (DMEM media supplemented with 10% FBS and 2 mM fresh L-glutamine, 1 mM sodium pyruvate and non-essential amino acids) and incubated at 37°C / 5% CO2for 24 hours. The next day TransIT-VirusGEN transfection reactions were set up according to manufacturer’s protocol with 1.5 μg packaging plasmid mix [1 μg packaging plasmid (see pCMV delta R8.2; addgene #12263) and 0.5 μg envelope expression plasmid (see pCMV-VSV-G; addgene #8454)] and 1 μg of transfer plasmid containing sequence encoding dSaCas9-VR and indicated sgRNAs. Lentivirus was harvested 48 hours following transfection by passing media supernatant through a 0.45 μM PES filter (VWR catalog number: 10218-488). Until ready to use, the purified and aliquoted lentiviruses were stored in -80°C freezer.
[0034] rAAV9 virus Generation All rAAV9 virus were made by Umass Chan Medical School viral vector core using pED261-sg25 or sg207 transgene vectors.
[0035] Lentiviral Transduction of HSMM cells Primary skeletal muscle myoblast cells (HSMM) from 2 different human donors of age varying from 0-26 years (referred to as Donor #3, Donor #617 respectively) were obtained from Lonza Inc. The cells were cultured in primary skeletal muscle cell growth medium [SkGM-2 Skeletal Muscle Growth BulletKit medium (Lonza #CC-3244 & CC-3246)]. For transduction, cells were seeded at 0.125-0.33x106cells / well in 6 well cell culture dishes (VWR catalog number: 10062-894) containing growth medium and incubated at 37°C / 5% CO2for 24 hours. The next day, 1.5 ml growth medium supplemented with 8 μg / ml Polybrene (Sigma catalog number: TR-1003-G) and 1.0 ml lentivirus supernatant (see above) corresponding to each sgRNA comprising crRNA encoded by individual targeting sequences (Table 1) and tracrRNA was added to each well. Cells were incubated with lentivirus for 6 hours before viral media was removed and replaced with fresh growth medium. 72 hours after transduction, cells were fed selection medium [growth media supplemented with 0.5 μg / ml puromycin (Sigma Aldrich catalog number: P8833)]. Cells were given fresh selection medium every 2-3 days. Following 7-10 days of cells being in selection medium, cells were harvested and RNA extracted with RNeasy 96 kit (Qiagen catalog number: 74182) as directed by manufacturer.
[0036] AAV9 Transduction of immortalized human myoblast cells (iCM) Immortalized Primary skeletal muscle myoblast cells (iCM) were obtained from Association Institut de Myologie, France. The cells were cultured in primary skeletal muscle cell growth medium [SkGM-2 Skeletal Muscle Growth BulletKit medium (Lonza #CC-3244 & CC-3246)]. For AAV9 transduction, cells were seeded at 0.3x106cells / well in 24 well cell culture dishes containing growth medium and incubated at 37°C / 5% CO2for 24 hours. Cells were then transduced with AAV9-pED261-sg25 or sg207 at MOIs of 1.5x105, 4.5x105, 1.35x106and 4.05x106vg. Cells were incubated with AAV for 24 hours before viral media was removed and replaced with fresh growth medium. Cells were given fresh selection medium every 2-3 days. Following 6-8 days of cells being in growth medium, cells were harvested and RNA extracted with RNeasy 96 kit (Qiagen catalog number: 74182) as directed by manufacturer.
[0037] Gene expression analysis cDNA was generated from ~0.5-1.0 μg of total RNA according to High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems; ThermoFisher catalog number: 4368813) protocol in a 10 μl volume. cDNA was diluted 10-fold and used as template for subsequent assays. For gene expression analysis using QPCR, Taqman Fast Advanced Master Mix was used according to manufacturer’s protocol. Taqman probes (LAMA1: Assay Id Hs01074489_m1 FAM; HPRT: Assay Id Hs99999909_m1 VIC_PL) were obtained from Life Technologies. Taqman probe-based real-time PCR reactions were processed and analyzed by QuantStudio 5 Real-Time PCR system as directed by Taqman Fast Advanced Master Mix protocol. For gene expression analysis using ddPCR, PCR reaction mixture was assembled from a 2× ddPCR Supermix for probes (Bio-Rad catalog number: 186-3026), 20× Taqman probes (LAMA1: Assay Id Hs01074489_m1 FAM; HPRT: Assay Id Hs99999909_m1 VIC_PL) and cDNA template (variable volume) in a final volume of 20 μL. Each assembled ddPCR reaction mixture was then loaded into the sample well of an eight-channel disposable droplet generator cartridge (Bio-Rad). A volume of 60 μL of droplet generation oil (Bio-Rad) was loaded into the oil well for each channel. The cartridge was placed into the droplet generator (Bio-Rad). The cartridge was removed from the droplet generator, where the droplets that collected in the droplet well were then manually transferred with a multichannel pipet to a 96-well PCR plate. The plate was heat-sealed with a foil seal and then placed on a conventional thermal cycler and amplified to the end-point (40-55 cycles). After PCR, the 96-well PCR plate was loaded on the droplet reader (Bio-Rad), which automatically reads the droplets from each well of the plate. Analysis of the ddPCR data was performed with QX Manager analysis software (Bio-Rad) that accompanied the droplet reader.
[0038] QPCR Data analysis For each sample and three controls, deltaCt values were calculated by subtracting the average Ct values from 3 technical replicates of the LAMA1 probe from the HPRT probe (Average Ct LAMA1 - Average Ct HPRT). Expression values were determined for each sample using the formula 2-(deltaCt). Sample expression values were then normalized to the average of 3 control expression values for each experiment to determine the relative LAMA1 expression for each sample.
[0039] Cell Culture C2C12 cell line (ATCC) was maintained in DMEM (Invitrogen) containing 10% fetal bovine serum (FBS) and antibiotics (penicillin / streptomycin) at 37 °C with 5% CO2. For the transfection experiments, 12-well plates were seeded with approximately 100,000 cells per well to achieve 70%-80% confluency. Cells were transfected using 1 μg of plasmid DNA and 2 μL of Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions. Successful transfection was assessed by cell survival following 48 hours of selection with 2 μg / mL puromycin, after which RNA was harvested for gene expression analysis.
[0040] Lentivirus Transduction of Cynomolgus Macaque Myoblast Cells Primary cynomolgus macaque skeletal muscle myoblast cells were obtained from BioIVT. Cells were cultured in SkGM-2 Skeletal Muscle Growth BulletKit medium (Lonza). For transduction, cells were seeded at 125,000 cells / well in 12 well plates containing growth medium and incubated at 37°C / 5% CO2for 24 hours. The next day, 1.5 ml growth medium supplemented with 8 μg / ml Polybrene (Sigma catalog number: TR-1003-G) and 1.0 ml lentivirus supernatant (see above) corresponding to each sgRNA comprising crRNA encoded by individual targeting sequences and tracrRNA was added to each well. To enhance transduction efficiency, cells were centrifuged at 1200 x g for 1 hour before viral media was removed and replaced with fresh growth medium. 72 hours after transduction, cells were fed fresh 0.5 μg / ml puromycin selection medium every 2-3 days. Following 7-10 days of cells being in selection medium, cells were harvested and RNA extracted with RNeasy 96 kit (Qiagen) as directed by the manufacturer.
[0041] RNA and DNA extraction from animal tissues To isolate mRNA from mouse tissue, a hybrid protocol using TRIzolTM-chloroform phase separation and the Qiagen RNeasy 96 (Qiagen) was used. First, the tissue was lysed in lysing matrix A tubes (MP Biomedicals) with 1 mL of TRIzolTM(Invitrogen) in a bead mill. After centrifugation for 10 minutes at 12,000 x g, the supernatant was transferred to PhasemakerTM tubes (Invitrogen) and 160 μL of chloroform was added. Tubes were vigorously hand shaken for 20 seconds and then centrifuged at 4°C for 18 minutes at 10,000 x g for phase separation. Next, the aqueous supernatant was mixed with an equal volume of 70% ethanol. The mixture was then transferred to a Qiagen RNeasy 96 plate and the isolation was continued according to the manufacturer’s protocol. Genomic DNA isolation was carried out by following the Qiagen DNeasy Blood and Tissue Kit (Qiagen). Briefly, tissue was lysed overnight in buffer ATL with Proteinase K and moderate agitation at 56°C. The lysates were mixed with buffer AL / E and transferred to a DNeasy 96 plate where, after centrifugation, columns were washed with buffer AW1 and then AW2. Buffer AE was added to elute genomic DNA.
[0042] Gene expression analysis by QPCR cDNA was generated from no more than 1 μg of total RNA according to High-Capacity cDNA Reverse Transcription Kit (ThermoFisher) protocol in a 10 μL volume. cDNA was then diluted 10-fold and analyzed using Taqman Fast Advanced Master Mix according to manufacturer’s instructions. Taqman probe-based real-time PCR reactions were processed and analyzed by QuantStudio 5 Real-Time PCR system as directed by Taqman Fast Advanced Master Mix protocol. For each sample, deltaCt values were calculated by subtracting the average Ct values of the target gene (derived from 3 technical replicates) from those of the housekeeping gene. Expression values for each sample were determined using the formula 2^-(deltaCt). These sample expression values were then normalized to the control sample expression values of each experiment to ascertain the relative expression of the target gene.
[0043] RNA and VCN quantification by ddPCR mRNA isolated from animal tissues were reverse transcribed using a high-capacity RT kit (Thermo Scientific) following the manufacturer protocol. The resulting cDNA was used in Droplet Digital PCR (ddPCR) analysis to assess target gene expression using mouse HPRT as the housekeeping reference. Isolated genomic DNA was used to assess vector copy number using mouse TFRC as the reference, with a genomic copy number of two. All ddPCR was carried out using the QX200 Automated Droplet Generator and QX200 Droplet Digital PCR System (Bio-Rad) for dual-color analysis according to the manufacturer’s instructions. Reaction mixtures consisting of the appropriate primer-probe sets, RNase-free water, ddPCR Supermix (Bio-Rad, 1863024), and diluted cDNA or gDNA were made and loaded in the QX200 AutoDG to partition DNA into droplets. DNA was then amplified by PCR and droplets were individually counted and assessed for positive or negative FAM and VIC signal in the QX200 Droplet Reader. Target gene expression was analyzed by dividing the number of positive FAM droplets (target gene) by the number of positive VIC droplets (housekeeper gene) for each sample. For genomic DNA analysis, the number of positive FAM droplets was divided by the number of positive VIC droplets and multiplied by 2 to determine the vector copy number per diploid genome.
[0044] NHP and injections Twelve healthy female two year old cynomolgus monkeys were enrolled in the first arm of the study. A second arm included four eight or nine month old juvenile (N=3 male and N=1 female) cynomolgus monkeys. Animals were confirmed seronegative for relevant AAV serotype and Cas9 prior to enrollment. All enrolled animals were treated with immunosuppression one day prior to AAV dosing and once weekly throughout the duration of the in-life period. All treatment animals were anesthetized and AAV was infused intravenously over 30 minutes. Animals were closely monitored post injection for any acute reaction. At the close of the in life period, animals were anesthetized and terminal blood was collected. Animals were humanely euthanized and necropsy and tissue collection of various organs was performed. All animal care and protocols were performed and approved under relevant Institutional Animal Care and Use Committee guidelines.
[0045] AAV production and purification Suspension HEK293 cells were transfected with plasmids necessary for AAV production-an Ad helper plasmid, GNDM gene of interest plasmid, and a rep / cap plasmid. Three days post-transfection cells were lysed, treated with Benzonase (Millipore Sigma), and clarified through depth filtration and sterile filtration. Clarified lysates were purified over affinity chromatography and Anion-Exchange (AEX) chromatography for enrichment of genome containing capsids before final concentration and buffer exchange.
[0046] Immunofluorescence and H&E staining OCT-embedded mouse muscle tissue was sectioned at 7 μm on glass slides and a hydrophobic barrier was drawn around the tissue with a PAP pen (Vector Labs). The tissue was then rehydrated in PBS and subsequently fixed at 4°C for 8 minutes with 4% Formal Fixx (Epredia). Slides were washed in PBS and then permeabilized at room temperature for 10 minutes in a solution of 0.2% Triton in TBS (50 mM Tris pH 7.4, 90 mM NaCl). Next, the sections were blocked for 1 hour at room temperature with 10% normal goat serum (Invitrogen). Slides were incubated overnight at 4°C with primary antibody in 10% normal goat serum with 1% bovine serum albumin (Fisher Scientific, BP1600-100). The next morning, slides were washed in TBS and incubated for 1 hour at room temperature with secondary antibody. Slides were washed in TBS and then mounted and coverslipped with anti-fade mounting medium with DAPI (Vector Labs). Primary antibodies used in this study include: rabbit monoclonal anti-mouse laminin-α1 (Custom made by Genscript, 1:200); mouse monoclonal anti-mouse laminin-α2 (4H8-2, Santa Cruz Biotechnology, 1:50); rat monoclonal anti-CD8 (clone 4SM16, Invitrogen, 1:200); CD11b. All Photomicrographs were taken with a ECHO Revolution color camera (ECHO revolution microscope, USA), using the ECHO Application Suite software (Version 2).
[0047] SaCas9 enzyme linked immune absorbent spot (ELISpot) assay Frequencies of SaCas9 specific T cells were determined using the IFN-γ ELISpot assay. Splenocytes were isolated from the spleens of control and treated mice at each time point and 200k splenocytes seeded into each well. Cells were stimulated in vitro for 48 h with 10 mg / ml of SaCas9 protein (Genscript Inc.). IFN-γ producing cells were indirectly detected as spots using the mouse-specific IFN-γ ELISpot kit (Immunospot, Cleveland OH, USA) as per the manufacturer’s instructions. Spots were analyzed and counted using the ImmunoSpot software (Version 7, Cellular Technology Limited, Cleaveland, OH, USA) on the ImmunoSpot(Registered Trademark) S6 Analyzer (Cellular Technology Limited). The number of cells producing IFN-γ was presented as spot forming unit (SFU) per million cells. PHA was used as the positive control in each assay. Media was used as the negative control in each assay. Untreated naive mice were evaluated as the baseline. Assays were performed in triplicates.
[0048] Monkey IFNg ELISPOT assay PBMCs were isolated from each treated and control animal and 25k PBMCs were seeded into each well and stimulated in vitro for 48 h with 10 mg / ml of SaCas9 protein (Genscript Inc.). IFN-γ producing cells were indirectly detected as spots using the Monkey-specific IFN-γ ELISpot kit (MabTech, USA) as per the manufacturer’s instructions. Spots were analyzed and counted using the ImmunoSpot software (Version 7, Cellular Technology Limited, Cleaveland, OH, USA) on the ImmunoSpot(Registered Trademark) S6 Analyzer (Cellular Technology Limited). The number of cells producing IFN-γ was presented as spot forming unit (SFU) per million cells. PHA was used as the positive control in each assay. Media was used as the negative control in each assay. Untreated naive mice were evaluated as the baseline. Assays were performed in duplicates.
[0049] Antibody assay Serum anti-AAV9 or anti-SaCas9 antibody levels were evaluated using an enzyme-linked immunosorbent assay (ELISA). Briefly, 2.5 ng / ml of the AAV9 or SaCas9 protein (Genscript Inc, USA) in carbonate buffer was coated on a microtiter plate. The serum was diluted two-fold starting from at 1:25 dilution. Horseradish peroxidase (HRP) conjugated goat anti-mouse IgG was used (1:10000; Southern Biotech, USA) for mice serum samples and goat anti-Cyno IgG for monkey serum samples (Southern Biotech, USA) to detect anti-Cas9 IgG. The absorbance of each sample was measured at 450 nm in the GloMax Microplate Spectrophotometer (Promega, USA). Each sample was run in triplicate and data was plotted as absorbance value at 450 nm vs 1:100 serum dilution.
[0050] RNA sequencing Illumina sequencing was performed by GeneWiz, LLC, where gene expression libraries were prepared using the NEBNext Ultra RNA Library Prep Kit (NEB, Ipswich, MA, USA) according to the manufacturer’s protocol. Sequencing libraries were clustered on three lanes of an Illumina HiSeq flow cell and sequenced using a 2X150 Paired End configuration. Resulting raw sequence data (.bcl files) was converted to fastq files and demultiplexed using Illumina’s bcl2fastq 2.17 software, where one mismatch was allowed for index sequence identification. Fastq files were aligned to human genome assembly GRCh38.p12, which contains the modification of GNDM sequence, using the STAR aligner (Dobin, A., et al., 2013). Differential analysis was conducted using DESeq2 (Love, M., et al., 2014) and plots were generated with plotly (https: / / plot.ly) using custom R scripts. Additionally read were mapped and visualized on the genome using Integrated Genomics Viewer (https: / / igv.org / )
[0051] ResultsActivation of LAMA1 gene expression by the dSaCas9-VR:sgRNA Lentivirus was produced that deliver expression cassettes for VP64-miniRTA and sgRNAs for each targeting sequence to primary HSMM cells. Transduced cells were selected for resistance to puromycin, and LAMA1 expression was quantitated using the Taqman Assay. Expression values from each sample were normalized to an average of LAMA1 expression in cells transduced with control sgRNAs. As shown in Fig.2, out of 14 tested sequences, sg207 showed ~15-20 folds upregulation of LAMA1 mRNA expression in HSMM donor #3 cells (Fig.2), and over-performed the previously best sg25 in the same experiments. To further validate the superior potency of the newly identified sg207, we cloned sg207 into the all-in-one GNDM AAV vector pED261 and tested its ability for LAMA1 upregulation in an immortalized human myoblast cell line side by side with sg25. As shown in Fig.3, across all the four MOIs tested, sg207 vector consistently induced more LAMA1 than sg25 by average 3-5 folds.
[0052] AAV9-CRISPR-GNDM-m31 induces LAMA1 transcription and demonstrated high specificity. To discover the most potent guide RNAs (gRNAs) for upregulating mouse LAMA1 expression, we transfected C2C12 cells with plasmids expressing both GNDM and an arrayed library comprising 45 gRNAs spanning a 2kb region surrounding the LAMA1 transcription start site (Figs.4A and 4B). This region was chosen due to its higher likelihood of harboring key regulatory elements. qPCR analysis revealed that several gRNAs significantly increased LAMA1 expression compared to control gRNAs, leading to the selection of gRNA m31 for further validation. Optimization of the AAV vector for efficient epigenetic editing is crucial due to inherent packaging size limitation of the AAV genome. Following extensive optimization efforts of individual vector elements, we have developed a final vector with streamlined components to maximize efficiency and specificity. This included the use of a CK8 promoter for muscle-specific expression, a codon-optimized GNDM transgene for enhanced expression, compact polyadenylation signal, and a gRNA m31 expression cassette, collectively called GNDM-m31. 7-week-old wild-type mice were injected with AAV9 encapsulating GNDM-m31 at a dose of 1.5E14 vg / kg (Fig.4C). At 11 weeks post-administration, the animals were sacrificed, and various tissues were collected for qPCR analysis. Our results demonstrate that animals treated with AAV9-GNDM exhibited significant upregulation of LAMA1 mRNA specifically in skeletal muscle and cardiac tissue, with no observed upregulation in non-target tissues such as the liver (Fig.4D). To assess the specificity of CRISPR-GNDM-m31 in vivo, total RNA from gastrocnemius muscle were isolated and whole transcriptome RNA sequencing analysis was performed (Figs.4E and 4F ). Reads from untransduced tissue, and tissues transduced with GNDM and control and Lama1-targeting sgRNAs, were mapped to the Lama1 gene and resulted in increased expression of Lama1 mRNA. Upregulation of Lama1 had no observable impact on expression of genes located just up- or down-stream of Lama1. Global analysis of mRNA expression from control or Lama1 sgRNA transduced animals also show minimal impact on total gene expression, with Lama1 mRNA having uniquely high and significant expression. These data highlight the transcriptional specificity of CRISPR-GNDM-m31. Along with its targeted delivery and expression in specific tissues, this underscores the potential of CRISPR-GNDM technology for precise gene therapy applications.
[0053] AAV9-GNDM-m31 induces Lama1 protein expression in muscle tissues and alleviates pathophysiology in dywdisease model (Figs.5A - 5F and 6A - 6C). Homozygous dyW mice are deficient in functional Lama2 expression, and show a severe muscular dystrophy phenotype that recapitulates the clinical features for LAMA2-CMD. To assess the efficacy of AAV9-GNDM-m31, postnatal day 2 (PND2) dyW mice were treated with 4.5E11 vector genomes (vg) (roughly 3E14vg / kg) via the temporal vein. Four weeks later, substantial Lama1 protein expression was detected by immunofluorescent staining in the treated mice. This expression pattern closely resembled that of Lama2 protein in wild-type mice, with Lama1 protein localizing at the basement membranes of muscle fibers and cardiomyocytes. These results suggest that the induced LAMA1 protein forms functional laminin complexes, integrating effectively into the extracellular matrix of these tissues. DyW mice exhibit elevated serum creatine kinase (CK) levels, an indicator of muscle damage, compared to wild-type mice. However, when treated with AAV9-GNDM-m31, serum CK levels significantly decreased. Next, we examined the morphology of skeletal muscle. In dyW mice treated with AAV9-GNDM-NTG, H&E staining revealed large groups of small-sized muscle fibers with many centrally localized nuclei, indicative of active muscle degeneration. In contrast, muscles from mice treated with AAV9-GNDM-m31 exhibited near-normal morphology with significantly fewer central nuclei, suggesting GNDM-induced LAMA1 expression protected myofibers from degeneration. We next investigated whether the observed histopathological improvements in dyW mice also led to an extended lifespan and enhanced growth. The dyW mice were divided into four groups and received the following treatments at PND2: 1. Mock treatment; 2. AAV9-GNDM-NTG high dose (3.6E11 vg / mouse); 3. AAV9-GNDM-m31 low dose (1.8E11 vg / mouse); and 4. AAV9-GNDM-m31 high dose (3.6E11 vg / mouse). After 80 days, 100% of the dyW mice treated with both low and high doses of AAV9-GNDM-m31 were alive, compared to 50% survival in the mock or NTG-treated groups. The survival improvement with treatment became more pronounced at around 120 days post-treatment. At this point, dyW mice treated with AAV9-GNDM-m31 showed extended survival (95% in the low dose group and 100% in the high dose group), compared to only a 5% survival rate in the AAV9-GNDM-NTG mice. Notably, over 50% of mice in the low dose group survived past 300 days, and over 400 days in the high dose group. Additionally, mice treated with AAV9-GNDM-m31 gained significant body weight compared to those receiving mock or AAV9-GNDM-NTG treatments, which was maintained throughout their life. We measured forelimb and combined limb (all-limb) grip strengths at 5, 7, and 9 weeks of age. The treatment of dyW mice with AAV9-GNDM-m31 led to a significant improvement in grip strength at all experimental timepoints, in a dose-dependent manner, indicative of enhanced muscle function. Collectively, these results underscore the efficacy of GNDM technology when applied to the muscle-related symptoms of LAMA2-CMD.
[0054] AAV9-GNDM induces durable expression of GNDM and LAMA1 in dy2j mice up to 12 months with only transient immune response against the transgene (Fig.7). To evaluate the durability of transgene expression and effect of transgene mediated immunogenicity, we used the dy2j LAMA1 disease mice model. Unlike the dyW mice that have shorter life span, Dy2j mice, have normal life span like C57B / 6 mice, with weaker phenotype. Systemic administration of AAV9-GNDM at 3x10e14 dose induced robust expression of GNDM and LAMA1 in muscle tissue starting from week 1 to up to 1 year (Fig.7). Quantification of GNDM specific T cell responses using IFNg ELISPOT assay showed that there was a transient induction of GNDM specific T cell responses at week 2 and these responses sharply declined by week 4 and remained very low throughout the study period. Analysis of serum samples for antibody responses by IgG ELISA showed that AAV9-GNDM administration induced antibody responses to GNDM. Further we evaluated the effect of GNDM specific systemic level immune responses on targeted muscle tissue. Immunohistochemistry analysis of GC muscle tissue using CD8 specific and CD11b specific antibodies showed increased CD8 T cell infiltration at week 2 after AAV9-GNDM administration and this infiltration declined significantly following the week 4 time point and remained at low levels throughout the study period. On the other hand, the CD11b positive population was unchanged between control and treated animals. qPCR analysis for different immune markers in the muscle tissue using TaqMan probes revealed elevated CD8, IFNg and GranB levels at week 2 and followed a similar declining trend of T cell responses in ELISPOT data. On the other hand, Foxp3 expression increased in AAV9-GNDM administered animals at week 2 and remained high until 1 year. In agreement with previous reports, muscle targeted AAV administration induced persistent Foxp3 T cells in the muscle tissue, indicating a counter balance of immune response in the muscle tissue. This data indicates that, though AAV9-GNDM administration induces transient T cell and antibody responses to the transgene, these responses have minimal to no effect on targeted muscle tissue.
[0055] MyoAAV-GNDM-m31 demonstrated robust efficacy in dyw mice at significantly lower dose compared to AAV9 (Figs.8A and 8B). In recent years, engineered myotropic AAV capsids, MyoAAVs, have emerged as promising vectors for efficient gene payload delivery to muscle tissue. MyoAAV is a modification of AAV9 obtained through directed evolution, which involved adding a 7-mer peptide insertion containing the RGD sequence at the 588 position. This modification significantly increases muscle tropism and potentially allows for the administration of viral vectors at much lower doses compared to conventional AAV9 vectors. To evaluate the efficacy of MyoAAV-GNDM-m31, DyW mice were intravenously administered a dose of 2E13 vg / kg at postnatal day 15 (PND15). This dose was significantly lower than that of AAV9-GNDM-m31. In this example, MyoAAV 3A was used. We chose PND15 because it parallels a stage of human development of under 36 months, aligning better with our target LAMA2-CMD patient demographic for intervention. After a six-week period, the mice were taken down for analysis. Notably, the outcomes of this study were consistent with our previous findings utilizing AAV9 vectors. Specifically, we observed robust expression levels of the GNDM transgene and a significant upregulation of LAMA1 mRNA exclusively within skeletal muscle tissue, while non-targeting tissues such as the liver remained unaffected. Immunofluorescent staining revealed significant LAMA1 protein expression at the basement membrane of muscle fibers. Consistent with our prior findings, treated dyW mice demonstrated a notable increase in body weight compared to untreated counterparts, indicative of enhanced overall health and muscle growth. Furthermore, treated mice exhibited significantly improved grip strength, providing compelling evidence of enhanced muscle function following intervention. Of particular significance is the fact that these results were achieved utilizing a dose that is more than five times lower than studies utilizing AAV9 vectors. This underscores the enhanced efficiency and potency of the novel MyoAAV capsid in targeting muscle tissue and its considerable advantage over conventional AAV9 vectors in gene therapy applications.
[0056] Systemic administration of MyoAAV-GNDM-c58 in NHPs is safe and well-tolerated (Figs.9A-9C). Although successful epigenetic editing has been demonstrated in mouse models with no obvious toxicity, there are safety and efficacy concerns in translating this technology to patients. Despite positive evidence in mice, concerns have been raised that systemically overexpressing foreign proteins such as Cas9 in primates could result in severe immune toxicity due to the complexity of their immune systems and outbread nature of the population. However, no studies have yet addressed these concerns in primates. Also, there have been issues in allometric scale translation of gene therapy vectors in large animals and humans. Thus, we conducted a non-GLP study in adult cynomolgus macaques to evaluate the safety and biodistribution, of our vector. A similar in vitro gRNA screening was conducted to identify the most potent gRNA in primary monkey myoblast cells, resulting in the selection of gRNA c58 for in vivo evaluation. After one week of standard immunosuppressive treatment, three female cynomolgus macaques were administered MyoAAV-GNDM-c58 through peripheral vein injection at a dose of 1e14 vg / kg. (One animal was subsequently removed from further analysis due to retrospective identification of seroconversion to AAV positivity prior to dosing.) MyoAAV-GNDM-c58 was well tolerated with no obvious adverse events and no detectable changes in body weight and wellbeing of animals throughout the study. Blood chemistry revealed only a temporary elevation of liver enzymes, which normalized within 2 to 3 weeks. Other clinical pathology findings were comparable between treated and control animals, indicating a favorable safety profile for CRISPR-GNDM vector. We observed serum antibodies against MyoAAV capsid and GNDM protein (Cas9) a few weeks after the injection, with slower and attenuated antibody response against GNDM protein compared to those against MyoAAV capsid. We also observed T cell responses against GNDM protein in ELISPOT assay, peaking at week 2 and declining thereafter. Thus, both the humoral and cellular immune systems recognized GNDM protein and mounted responses. However, there was only minimal lymphocyte infiltration in the target muscle tissues and we did not observe any obvious tissue damage. We speculate that the constitutive expression of GNDM may induce anergy in T cells, potentially rendering these GNDM-specific T cells non-functional. This aspect will be addressed in future studies. These results support the safety of our CRISPR-GNDM construct from an immunological perspective.
[0057] Administration of MyoAAV-GNDM in NHPs leads to widespread and selective biodistribution within skeletal muscle tissues and demonstrates successful epigenetic editing, as evinced by significant target engagement and LAMA1 gene upregulation across muscle tissues (Fig.10). The ddPCR analysis of the AAV genome in a range of muscle and non-muscle tissues showed that MyoAAV-GNDM-cy58 had widespread biodistribution throughout the body following a single administration. The GNDM expression analysis revealed that a muscle-specific promoter used in the vector allowed for strong GNDM expression only in muscle tissues but not in non-muscle tissues such as the liver. Notably, MyoAAV-GNDM-cy58 vector showed up to 60-fold enhanced GNDM mRNA expression in muscle tissues as compared to our historical datasets generated in NHPs with AAV9 vector (data not shown). These data indicate that despite the high expression of the transgene and the mounted immune responses against the protein, GNDM expression remained robustly high after 43 days post injection. As previously mentioned, successful epigenetic editing in NHPs has not previously been demonstrated. More broadly, whether epigenetic editing approaches such as ours could induce robust target gene expression from silenced loci of large animal’s genome have never previously been addressed. MyoAAV-GNDM-cy58, administration resulted in significant levels of monkey LAMA1 mRNA induced in different types of muscle tissues. To demonstrate the induced LAMA1 mRNA levels in relation to a housekeeping gene, LAMA1 mRNA levels were normalized to endogenous HPRT mRNA levels. The induced LAMA1 levels were approximately between 3-6% relative to the endogenous HPRT levels in all muscle tissues analyzed. As untreated animals otherwise have nearly undetectable levels of LAMA1 expression in muscle tissues, and given the high expression of HPRT gene, this represents a significant increase of LAMA1 mRNA. LAMA1 / HPRT mRNA levels were also elevated in the heart (~0.04). The liver displayed some LAMA1 mRNA expression (~0.03), though not significantly above the endogenous level in the liver, indicating muscle-specific induction of LAMA1 with MyoAAV-GNDM-cy58. This is a clear demonstration that the CRISPR-GNDM technology is able to reactivate gene expression from a physiologically silenced locus in large animals.
[0058] Systemic administration of MyoAAV-GNDM in juvenile NHPs is safe and well-tolerated (Figs.11A and 11B). LAMA2-CMD is a congenital disorder and its symptoms manifest at birth. Patients initially undergo a somewhat normal physiological development path and experience body and muscle growth. However, muscle wasting begins shortly after birth and early intervention is expected to yield superior clinical benefit. Thus the clinical application of our vector is anticipated to be targeted to infants and young children. We extended our studies to assess the safety and efficacy of MyoAAV-GNDM in 8-month-old juvenile NHPs. This age group in NHPs closely resembles the developmental stage of our target patient demographic. We administered 5e13 vg / kg of MyoAAV-GNDM-cy58 to these juvenile NHPs. A dose carefully chosen to presumably strike an optimal balance between efficacy and safety for this younger and more vulnerable patient group. Also we extended the study period to 13 weeks (as opposed to 6 weeks in adult NHP study), which allowed for a more thorough observation of the treatment’s effects over time, enhancing our understanding of the safety, efficacy and durability of the MyoAAV-GNDM treatment. Similar to our prior study with 2-year-old NHPs, all juvenile animals in this extended 13-week study tolerated the MyoAAV-GNDM treatment well, with no observed toxicity. Histopathological evaluation revealed no adverse macroscopic findings in the tissues examined. Microscopic examination only showed minimal mononuclear cell inflammation in the biceps brachii and gastrocnemius muscle, which was likely due to mechanical injury rather than the treatment. All other microscopic findings were considered unrelated to administration of AAV, as they occurred at a low incidence / severity, were present in the control group or were consistent with expected background findings in Cynomolgus macaques. These findings, consistent with expected background observations in Cynomolgus macaques, further corroborate the treatment’s safety profile.
[0059] The lower dose of MyoAAV-GNDM in juvenile NHPs demonstrate a superior pharmacodynamic profile compared to adults (Figs.12A and 12B). In our analysis of vector copy numbers (VCN) in various tissues, we observed that the VCN was approximately half that recorded in our previous study. This aligns with the halved dose used in the current study. Surprisingly, even with this lower dose, the mRNA levels of the GNDM transgene in juvenile NHPs were significantly higher compared to those in older NHPs across all muscle tissue types. This indicates a more efficient GNDM transgene expression in juvenile NHPs. Additionally, higher expression of the GNDM transgene leads to significantly increased induction of LAMA1 mRNA. These findings emphasize the need for age-specific dosing considerations and suggest a potential for increased efficacy at lower dosages in younger subjects.
[0060] According to the present invention, the expression of LAMA1 gene in muscle cell derived from a MDC1A patient can be upregulated. Thus, the present invention is expected to be extremely useful for the treatment and / or prevention of MDC1A. This application is based on US provisional patent applications No. 63 / 563,050 (filing date: March 8, 2024) and No. 63 / 641,618 (filing date: May 2, 2024) filed in US, the contents of which are incorporated in full herein.
Claims
1. A polynucleotide comprising the following base sequences: (a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (b) a base sequence encoding a guide RNA targeting a continuous region set forth in SEQ ID 8, in the expression regulatory region of human LAMA1 gene.
2. The polynucleotide according to claim 1, wherein the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 8, or said base sequence in which (i) 1 to 6 bases are deleted or added from the 5’ -end, and / or (ii) 1 base are substituted within the 9 bases from the 5’ -end.
3. The polynucleotide according to claim, wherein the transcription activator is selected from the group consisting of VP64, VP160, VPH, VPR, VP64-miniRTA (miniVR), and microVR, a variant thereof having transcription activation ability.
4. The polynucleotide according to claim 3, wherein the transcription activator is miniVR.
5. The polynucleotide according to claim 1, wherein the nuclease-deficient CRISPR effector protein is dCas9.
6. The polynucleotide according to claim 5, wherein the dCas9 is derived from Staphylococcus aureus.
7. The polynucleotide according to claim 1, further comprising a promoter sequence for the base sequence encoding the guide RNA and / or a promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator.
8. The polynucleotide according to claim 7, wherein the promoter sequence for the base sequence encoding the guide RNA is selected from the group consisting of U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, and H1 promoter.
9. The polynucleotide according to claim 8, wherein the promoter sequence for the base sequence encoding the guide RNA is U6 promoter.
10. The polynucleotide according to claim 7, wherein the promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcription activator is ubiquitous promoter or muscle specific promoter.
11. The polynucleotide according to claim 10, wherein the ubiquitous promoter is selected from the group consisting of EFS promoter, CMV promoter and CAG promoter.
12. The polynucleotide according to claim 11, wherein the muscle specific promoter is selected from the group consisting of CK8 promoter, myosin heavy chain kinase (MHCK) promoter, muscle creatine kinase (MCK) promoter, synthetic C5-12(Syn) promoter and unc45b promoter.
13. A vector comprising a polynucleotide of any one of claims 1 to 12.
14. The vector according to claim 13, wherein the vector is a plasmid vector or a viral vector.
15. The vector according to claim 14, wherein the viral vector is selected from the group consisting of adeno-associated virus (AAV) vector, adenovirus vector, and lentivirus vector.
16. The vector according to claim 15, wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV6, AAV7, AAV8, AAV9, and a variant thereof (e.g., MyoAAV).
17. An agent for treating or preventing MDC1A, comprising a polynucleotide of any one of claims 1 to 12 or a vector comprising the same.
18. A method for treating or preventing MDC1A, comprising administering a polynucleotide of any one of claims 1 to 12 or a vector comprising the same to a subject in need thereof.
19. Use of a polynucleotide of any one of claims 1 to 12 or a vector comprising the same for the treatment or prevention of MDC1A.
20. Use of a polynucleotide of any one of claims 1 to 12 or a vector comprising the same in the manufacture of a pharmaceutical composition for the treatment or prevention of MDC1A.
21. A method for upregulating expression of human LAMA1 gene in a cell, comprising expressing (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, in the expression regulatory region of human LAMA1, in the aforementioned cell.
22. A ribonucleoprotein comprising the following: (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, in the expression regulatory region of human LAMA1 gene.
23. A kit comprising the following for upregulation of the expression of the human LAMA1 gene: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, in the expression regulatory region of human LAMA1 gene, or a polynucleotide encoding the guide RNA.
24. A method for treating or preventing MDC1A, comprising administering the following (e) and (f): (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, in the expression regulatory region of human LAMA1 gene, or a polynucleotide encoding the guide RNA.
25. Use of the following (e) and (f): (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8 in the expression regulatory region of human LAMA1 gene, or a polynucleotide encoding the guide RNA, in the manufacture of a pharmaceutical composition for the treatment or prevention of MDC1A.
Citation Information
Patent Citations
Method for treating muscular dystrophy by targeting LAMA1 gene
WO2021033635A1