Pharmaceutical composition for treating or preventing sarcopenia, comprising DUSP22 inhibitor

WO2025188077A8PCT designated stage Publication Date: 2025-10-02GWANGJU INST OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/002948
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-05
Filing Date
2025-03-05
Publication Date
2025-10-02

AI Technical Summary

Technical Problem

There are currently no FDA-approved fundamental treatments for sarcopenia, and the molecular mechanisms underlying its development remain incompletely understood, necessitating the development of new treatments based on an understanding of its pathogenesis.

Method used

A pharmaceutical composition comprising a DUSP22 inhibitor, which can be a compound, siRNA, or protein, is used to inhibit DUSP22 activity, thereby targeting FOXO3a signaling independently of the IGF-1/PI3k/Akt/mTOR pathway to treat or prevent sarcopenia.

Benefits of technology

The DUSP22 inhibitor effectively suppresses skeletal muscle loss and can be used to treat diseases associated with sarcopenia by inhibiting DUSP22 overexpression, providing a therapeutic approach that avoids adverse effects such as increased tumorigenesis and is applicable to diseases like T-cell lymphoma, Alzheimer's disease, osteoarthritis, heart failure, and type 2 diabetes.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention relates to a pharmaceutical composition for treating or preventing sarcopenia, comprising a DUSP22 inhibitor and, more specifically, to a pharmaceutical composition for treating or preventing sarcopenia, comprising a DUSP22 inhibitor, thereby allowing for downregulation of the FOXO3a signaling pathway to suppress skeletal muscle loss and being applied to the treatment of sarcopenia or diseases accompanied by skeletal muscle loss by targeting the JNK-FOXO3a axis.
Need to check novelty before this filing date? Find Prior Art

Description

Pharmaceutical composition for treating or preventing sarcopenia comprising a DUSP22 inhibitor

[0001] The present invention relates to a pharmaceutical composition for treating or preventing sarcopenia comprising a DUSP22 inhibitor and a method for inhibiting DUSP22 activity.

[0002]

[0003] Sarcopenia is a disease with diverse causes. The primary form of muscle loss is the decline in muscle mass and strength due to aging. In 1989, Irwin Rosenberg coined the term sarcopenia (from the Greek words "flesh" and "poverty"). With the aging population, sarcopenia is becoming a serious health problem. Declining physical function and frailty lead to reduced mobility, loss of independence in older adults, and ultimately increased mortality. The economic burden of sarcopenia is estimated at $40.4 billion annually in the United States alone. Sarcopenia can also be caused by various disorders, including medication side effects (e.g., glucocorticoid therapy), intensive care (called intensive care unit sequelae), infections such as HIV-AIDS, and various degenerative diseases, including heart failure, chronic kidney disease, and diabetes.

[0004] Treatment options for sarcopenia include medications, such as hormone therapy and vitamin supplementation, that aim to slow the progression of the disease. Since sarcopenia was formally recognized in the International Classification of Diseases (ICD-10-CM) in 2016, active investment and research have been underway to develop new treatments and establish treatment systems. However, there are currently no FDA-approved fundamental treatments for sarcopenia. Furthermore, the molecular mechanisms underlying the development of sarcopenia remain incompletely understood.

[0005] Dual-specificity dephosphorylation enzymes (DUSPs) are a family of enzymes that dephosphorylate serine / threonine and tyrosine residues. DUSPs target numerous protein substrates and non-protein substrates such as lipids and glucans. DUSP22 (also known as JNK-stimulating protein-1 (JSP-1)) regulates the c-Jun N-terminal kinase (JNK) signaling cascade. DUSP22 activity has been linked to several diseases, including cancer, liver failure, and allergy. DUSP22 is also expressed in skeletal muscle tissue and is associated with aging. However, the role of DUSP22 in the pathogenesis of skeletal muscle wasting remains unknown.

[0006] Therefore, there is a need for the development of fundamental treatments based on an understanding of the pathogenesis of sarcopenia.

[0007]

[0008] The purpose of the present invention is to provide a pharmaceutical composition for treating or preventing sarcopenia.

[0009] The present invention aims to provide a method for treating sarcopenia.

[0010] The present invention aims to provide a method for inhibiting DUSP22 activity.

[0011]

[0012] 1. A pharmaceutical composition for treating or preventing sarcopenia, comprising a DUSP22 inhibitor as an active ingredient.

[0013] 2. A pharmaceutical composition for treating or preventing sarcopenia, wherein the DUSP22 inhibitor in the above 1 is any one selected from the group consisting of compounds, siRNA, and proteins.

[0014] 3. A pharmaceutical composition for treating or preventing sarcopenia, wherein in the above 1, sarcopenia is selected from the group consisting of muscular atrophy, myasthenia gravis, muscular dystrophy, muscular weakness, muscular dystrophy, amyotrophic lateral sclerosis, spinal muscular atrophy, myasthenia gravis, and senile sarcopenia.

[0015] 4. In the above 1, the DUSP22 inhibitor is a compound represented by Chemical Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof, a pharmaceutical composition for treating or preventing sarcopenia:

[0016] [Chemical Formula 1]

[0017]

[0018] (During the meal,

[0019] R1 is or And,

[0020] R2 is or And,

[0021] R3 is -H, -F, -Cl, -Br, -CH3, substituted or unsubstituted C 2-5 alkyl, -OH, -NH3, -SH, -COOH or -NO2,

[0022] R4 and R5 are each independently -H, -CH3, substituted or unsubstituted C 2-5 alkyl, -CF3, -COOH, -CH2COOH, or -C(O)OC 1-3 It is alkyl,

[0023] n is an integer from 1 to 5).

[0024] 5. In the above 1, the DUSP22 inhibitor is any one compound selected from the group consisting of compounds of Table 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof, a pharmaceutical composition for treating or preventing sarcopenia:

[0025] [Table 1]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032] 6. A pharmaceutical composition for treating or preventing sarcopenia, wherein the DUSP22 inhibitor in the above 1 is an siRNA having any one or more nucleotide sequences of SEQ ID NOs: 1 to 4.

[0033] 7. A method for inhibiting DUSP22 activity, comprising a step of treating a cell or an animal other than a human with a DUSP22 inhibitor.

[0034]

[0035] The present invention has an effect of treating or preventing sarcopenia.

[0036] The present invention can be usefully utilized in the diagnosis and treatment of skeletal muscle loss.

[0037] The present invention can inhibit DUSP22 overexpression.

[0038] The present invention may provide research impetus to further discover the potential role of DUSP family members in the pathogenesis of sarcopenia.

[0039] The present invention may be useful in developing a therapeutic approach that targets FOXO3a independently of the IGF-1 / PI3k / Akt / mTOR pathway to avoid adverse effects such as increased tumorigenesis.

[0040] The present invention may be an attractive option for drug development because it can inhibit FOXO3a signaling through alternative pathways such as JNK.

[0041] The present invention may be utilized in the development of new treatments for other diseases, including T-cell lymphoma, Alzheimer's disease, osteoarthritis, heart failure, and type 2 diabetes, which are associated with abnormal expression of DUSP22.

[0042]

[0043] Figure 1a is a graph showing the differences in DUSP22 expression between elderly subjects (≥70 years) and elderly patients diagnosed with sarcopenia (data obtained from the Singapore Sarcopenia Study, GEO Accession No. GSE111016). Figure 1b is a graph showing the differences in DUSP22 expression in C2C12 myotubes treated with 10 μM dexamethasone (Dex) for 24 hours to induce skeletal muscle atrophy, compared to vehicle, analyzed by RNA-sequencing. Expression was measured using RNA Seq, and TPM stands for transcripts per million. Figure 1c shows the results of qPCR analysis for DUSP22 expression in C2C12 muscle fibers after vehicle or Dex treatment, TA (tibialis anterior) of C57BL / 6 mice after vehicle or Dex treatment, TA of young (5-month-old) or old (27-month-old) C57BL / 6 mice, and TA of C57BL / 6 mice after hindlimb fixation.

[0044] Figure 2a shows the qPCR results of DUSP22 expression in C2C12 myotubes after CRISPR-mediated DUSP22 overexpression (OE = overexpression). Figure 2b shows the Myh2 immunocytochemistry results. Figure 2c shows the fusion index, and Figure 2d shows the differentiation index.

[0045] Figure 3a shows the results of qPCR analysis of gene expression related to mitochondrial homeostasis, including PGC-1α (peroxisome proliferator-activated receptor gamma coactivator 1-alpha), UCP-3 (mitochondrial uncoupling protein 3), and Acly (ATP citrate lyase). Figure 3b shows the results of qPCR analysis of gene expression related to autophagy, including LC-3B (microtubule-associated protein 1A / 1B light chain 3B) and CtsL (cathepsin L). Figure 3c shows the results of qPCR analysis of gene expression related to UPS, including Psmd11 (proteasome 26S subunit, non-ATPase 11) and UBR2 (ubiquitin protein ligase E3). Figure 3d shows the results of qPCR analysis of the expression of genes related to myosin heavy chain levels, tested for MYH7 (β-myosin heavy chain) and MYH1 (striated muscle myosin heavy chain 1). Figure 3e shows the results of qPCR analysis of the expression of genes related to FoxO3a signaling, tested for MurF-1, atrogin-1, FoxO3a, p62, TGIF (TGFB-inducible factor homeobox 1), ATF4 (activating transcription factor 4), Bnip3 (BCL2 / adenovirus E1B 19 kDa protein-interacting protein 3), Gadd45α (growth arrest and DNA damage-induced alpha), SMART, and MUSA1 (muscle ubiquitin ligase of the SCF complex in atrophy-1). *=p<0.05, **=p<0.01, ***=p<0.001, and ****=p<0.0001, which indicate that the result value significantly increased or decreased.

[0046] Figure 4a shows the results of Myh2 immunostaining of C2C12 myoblasts cultured as follows. First, the vehicle group was treated only with DM for 120 hours, and the control group was treated with DM for 96 hours, followed by DM and 10 μM Dex for 24 hours. The BML-260 treatment group was treated with DM for 96 hours, followed by DM, 10 μM Dex, and 12.5 μM BML-260 for 24 hours (n=4, scale bar=100 μm). Figure 4b shows the average myotube diameter, and Figure 4c is a graph showing the myotube diameter distribution. In Figures 4b and 4c, the control group was treated with Dex, and the BML-260 group was treated with Dex and BML-260.

[0047] Figure 5a shows the results of the fusion index, and Figure 5b shows the differentiation index. Figure 5c shows the results of the SUnSET analysis, which measures the protein synthesis rate by measuring puromycin incorporation (n=4). Figure 5d is a quantitative graph of the SUnSET analysis.

[0048] Figure 6a is a Western blotting analysis graph of atrogin-1 and MuRF-1. Figure 6b is a quantification graph of atrogin-1 or MuRF-1. Figure 6c is the result of qPCR analysis of atrogin-1 or MuRF-1 expression. *= p<0.05, **= p<0.01, **= p<0.001, and ****= p<0.0001, indicating a significant increase or decrease in the analysis value.

[0049] Figure 7a shows the results of Myh2 immunocytochemistry of C2C12-derived myotubes cultured under the following conditions. First, the untreated group was cultured with DM for 120 hours, the siCON group was cultured with DM for 72 hours, and then cultured with scrambled siRNA for 48 hours. The Dex + siCON group was cultured with DM for 72 hours, then cultured with scrambled siRNA for 24 hours, and then additionally treated with 10 μM Dex for 24 hours. The Dex + siDUSP22 group was cultured with DM for 72 hours, then cultured with DUSP22 siRNA for 24 hours, and then additionally treated with 10 μM Dex for 24 hours (n = 4, scale bar = 100 μm). Figure 7b is a graph showing the diameter of the myotubes, and Figure 7c is a graph showing the distribution of the myotubes.

[0050] Figure 8a shows qPCR analysis of DUSP22 expression in C2C12-derived myotubes (n=6), where siCON was treated with DM and control siRNA, and siDUSP22 was cultured after treating with DUSP22 siRNA for 96 hours. Figure 8b shows the differentiation index of C2C12-derived myotubes treated under the same conditions as those in the experiment of Figure 7a, and Figure 8c shows the fusion index.

[0051] Figure 9a shows the results of Western blotting analysis of FoxO3a and AKT phosphorylation using C2C12-derived myotubes, and Figure 9b is a graph quantifying FoxO3a and AKT phosphorylation.

[0052] Figure 10a shows the results of Western blotting of the expression of atrogin-1 and MuRF-1 when siRNA was treated in the root canal, and Figure 10b shows a quantitative graph of Western blotting of atrogin-1 and MuRF-1.

[0053] Figure 11 shows the results of qPCR analysis (n=6) of the expression of atrogin-1, MuRF-1, and DUSP22.

[0054] *=p<0.05, **=p<0.01, **=p<0.001, and ****=p<0.0001, which indicate that the result value significantly increased or decreased.

[0055] Figure 12a is a schematic diagram of the experimental protocol for IP treatment of young C57BL / 6 mice with Dex and BML-260. Figure 12b is a graph of body weight changes in mice, comparing the vehicle, 15 mg / kg Dex-treated control group, and the experimental group treated with 15 mg / kg Dex and 5 mg / kg BML-260 for 13 days (n=5). Figure 12c is a graph comparing grip strength and rotarod performance in constant speed (RPM) and acceleration (latency to fall) models (n=4).

[0056] Figure 13a shows a representative H&E staining result of the TA muscle, and Figure 13b shows the results comparing the cross-sectional area of ​​muscle fibers in the vehicle, control, and BML-260 treatment groups. Figure 13c shows the measurement of the area distribution of muscle fibers.

[0057] Figure 14a shows the results of measuring TA muscle mass (n=4), and Figure 14b shows the results of Western blotting for the expression of atrogin-1 and MuRF-1 in TA muscles. GAPDH was used for normalization of expression (n=3). Figure 14c is a graph showing the quantification of MuRF-1 and atrogin-1 expression. *= p<0.05, **= p<0.01, and ****= p<0.0001, indicating a significant increase or decrease in the result value.

[0058] Figure 15a is a schematic diagram of the experimental protocol for knocking down DUSP22 in the TA of young C57BL / 6 mice. Figure 15b shows the results of Western blotting (n=3) of DUSP22 expression, measured 3 days after Dex-treated tibialis anterior (TA) muscle was treated with control or DUSP22 siRNA. Figure 15c shows the quantification of DUSP22 expression, and Figure 15d shows the results of measuring TA muscle mass (n=4).

[0059] Figure 16a shows representative H&E staining and immunohistochemical staining results for myosin heavy chain IIa (MYHIIa) and IIb (MYHIIb) of TA muscle (n=4). Figure 16b shows the cross-sectional area of ​​TA muscle fibers, and Figure 16c is a graph showing the area distribution of TA muscle fibers.

[0060] Figure 17a shows the distribution of MYHIIa muscle fibers, and Figure 17b shows the distribution of MYHIIb muscle fibers.

[0061] Figures 18a and 18b show the results of Western blotting analysis, which measured the expression of phosphorylated FoxO3a (P-FoxO3a), FoxO3a, phosphorylated c-jun (Pc-jun), c-jun, GAPDH, phosphorylated JNK (P-JNK), JNK, p62, MuRF-1, atrogin-1, DUSP22, and GAPDH after delivering control or DUSP22 siRNA to Dex-treated TA muscles.

[0062] Figure 19 shows the results of densitometry analysis (n=4) of the western blot of Figure 18 including p62, MuRF-1, atrogin-1, DUSP22, p-FoxO3a, etc. *=p<0.05, **=p<0.01, ***=p<0.001, and ****=p<0.0001, which indicate that the result value was significantly increased or decreased.

[0063] Figure 20a is a schematic diagram of the experimental protocol for knocking down DUSP22 expression in TA muscles of aged C57BL / 6 mice (n=4). Figure 20b shows the results of Western blotting analysis of MuRF-1, DUSP22, and GAPDH expression.

[0064] Figures 21a and 21b are quantitative graphs of MuRF-1 and DUSP22 expression. Figure 21c is a graph showing changes in TA muscle mass, Figure 21d is a representative H&E staining image of TA muscle, and Figure 21e is a graph measuring the cross-sectional area (CSA) of TA muscle.

[0065] Figure 22a is a schematic diagram of the experimental protocol for intraperitoneal injection of BML-260 into aged C57BL / 6 mice (n=4). Figure 22b shows changes in body weight of the mice. Figure 22c shows the results of observations of rotarod performance and grip strength in the latency to fall test.

[0066] Figure 23a shows the mass of the quadriceps femoris, gastrocnemius, TA, and soleus muscles, and Figure 23b shows the results of qPCR analysis of the expression of MuRF-1, atrogin-1, myostatin (Mstn), and PGC-1α.

[0067] [Revised on 17.03.2025 by Article 91 of the Rules] Figure 24a shows the results of immunostaining for MYHIIa (type 2A), MYHIIb (type 2B), and MYHIIx (type 2X) in TA and gastrocnemius muscles (5M = 5 months old, aged mice, bml-260 administered group to aged mice), and DAPI and laminin labeling. Figure 24b shows the results of observing the cross-sectional areas of type 2A, type 2B, and type 2X muscle fibers in TA and gastrocnemius muscles, and measuring the minimum Feret's diameter of type 2A, type 2B, and type 2X muscle fibers. Feret's diameter is a method for measuring the size of an object in biological image analysis. *=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001, which indicates that the result value significantly increased or decreased.

[0068] Figure 25a is a graph showing the correlation between DUSP22 expression and TA muscle mass in an immobilized (IM) model, and Figure 25b is the result of measuring the mass relative to body weight of the quadriceps femoris, gastrocnemius, TA, and soleus muscles in an immobilized model.

[0069] Figure 26a shows the results of DUSP22 expression in the immobilized (IM) model, and Figure 26b shows the changes in TA when BML-260 was treated in the immobilized model. Figures 26c and 26d show the results of Western blotting densitometry analysis for the expression of atrogin-1 and MuRF-1 when TA was treated with BML-260 in the immobilized model. Figure 26e shows the results of Western blotting for the phosphorylation of FoxO3a, atrogin-1, and MuRF-1 levels when TA was treated with BML-260 in the immobilized model.

[0070] Figure 27a shows micrographs of H&E-stained human myotubes treated with vehicle alone, 10 μM Dex for 24 hours, and 10 μM Dex and 12.5 μM BML-260 for 24 hours. Figure 27b shows the average myotube diameter measured, and Figure 27c shows the myotube diameter distribution (n=3). Figure 27d shows the results of qPCR analysis of MuRF-1 expression (n=3).

[0071] Figure 28a is a micrograph of H&E-stained human root canals. In the photograph, the siCON group was cultured with DM for 24 hours and then cultured with scrambled siRNA as a control for an additional 48 hours. The siDUSP22 group was cultured with DUSP22 siRNA instead of scrambled siRNA for an additional 48 hours. The siCON+Dex group was cultured with DM for 24 hours and then cultured with scrambled siRNA as a control for 24 hours and then treated with 10 μM Dex for an additional 24 hours. The siDUSP22+Dex group was cultured with DM for 24 hours and then cultured with DUSP22 siRNA for 24 hours and then treated with 10 μM Dex for an additional 24 hours. Figure 28b shows the results of qPCR analysis of DUSP22 expression (n=3), and Figure 28c shows the results of measuring root canal diameter. Figure 28d shows the distribution of root canal diameters, and Figure 28e shows the results of qPCR analysis of MuRF-1 expression (n=3).

[0072] Figure 29 shows the myotube atrophy inhibitory effect of CFTR(inh)-172 (CFTR-172), which has a similar structure to BML-260. When muscle atrophy was induced by treating myotubes with Dex, the degree of muscle atrophy was reduced when treated with this drug. To quantify the degree of muscle atrophy, the expression level of MuRF-1 in myotubes was measured.

[0073] *=p<0.05, **=p<0.01, ***=p<0.001, and ****=p<0.0001, which indicate that the result value significantly increased or decreased.

[0074] Figure 30 shows the results confirming the inhibitory effect of BML-260 on DUSP22 dephosphorylation enzyme activity.

[0075] Figure 31a shows the results of confirming whether muscle atrophy induced by dexamethasone, a muscle atrophy-inducing drug, is reduced by three drugs: STK105142, STK547767, or STL297511.

[0076] Figure 31b is the result of measuring the diameter of myotube cells after treatment, similar to Figure 31a.

[0077]

[0078] The present invention provides novel uses of DUSP22 inhibitors.

[0079] The present invention may include a DUSP22 inhibitor as an active ingredient.

[0080] The present invention provides a pharmaceutical composition for treating or preventing sarcopenia comprising a DUSP22 inhibitor.

[0081] The present invention can suppress skeletal muscle loss by downregulating the FOXO3a signal, and can also be used to treat diseases accompanied by sarcopenia or skeletal muscle loss by suppressing the JNK-FOXO3a signal, which is a major inducer of muscle fiber atrophy.

[0082] DUSP22 inhibitors are substances that inhibit the activity or expression of DUSP22. DUSP22 inhibitors are not limited to a specific type or structure.

[0083] DUSP22 inhibitors can be a variety of substances, including genes, peptides, proteins, and nucleotides, such as compounds, siRNA, shRNA, and aptamers.

[0084] In the present invention, the DUSP22 inhibitor may be a pharmaceutical composition for treating or preventing sarcopenia, which is a compound represented by Chemical Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof:

[0085] [Chemical Formula 1]

[0086]

[0087] (During the meal,

[0088] R1 is or And,

[0089] R2 is or And,

[0090] R3 is -H, -F, -Cl, -Br, -CH3, substituted or unsubstituted C 2-5 alkyl, -OH, -NH3, -SH, -COOH or -NO2,

[0091] R4 and R5 are each independently -H, -CH3, substituted or unsubstituted C 2-5 Alkyl, -CF3, -COOH, -CH2COOH, -C(O)OC 1-3 It is alkyl,

[0092] n is an integer from 1 to 5).

[0093] In the present invention, the DUSP22 inhibitor may be a pharmaceutical composition for treating or preventing sarcopenia, which is any one compound selected from the group consisting of compounds of Table 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof:

[0094] [Table 1]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102] In the present invention, the DUSP22 inhibitor may be selected from the group consisting of BML-260, CFTRinh-172, and PhenylHydrazonoPyrazolone Sulfonate 1.

[0103] In the present invention, the compound having the structure NO.1 of Table 1 is CFTRinh-172, and the compound having the structure NO.3 of Table 1 is BML-260.

[0104] In one embodiment, the DUSP22 inhibitor can be any one of the compounds set forth in Table 2.

[0105] [Table 2]

[0106]

[0107]

[0108]

[0109] In the present invention, STK547767 corresponds to NO.7 in Table 1. (4-[5-(4-Fluorobenzylidene)-4-oxo-2-thioxo-1,3-thiazolidin-3-yl]benzoic acid).

[0110] In the present invention, STK105142 corresponds to NO.9 of Table 1. (3-[(5Z)-5-(4-methylbenzylidene)-4-oxo-2-thioxo-1,3-thiazolidin-3-yl]benzoic acid).

[0111] In the present invention, STL297511 corresponds to NO.25 in Table 1. (4-({4-[(5Z)-5-benzylidene-4-oxo-2-thioxo-1,3-thiazolidin-3-yl]butanoyl}amino)benzoic acid).

[0112] In the present invention, CFTRinh-172 is a chemical that functions as a selective inhibitor of the CFTR (cystic fibrosis transmembrane conductance regulator) chloride channel. This compound has an inhibition constant (Ki) of 300 nM for CFTR inhibition. CFTRinh-172 is voltage-independent and does not affect other transporters, such as MDR1 or ATP-sensitive K+ channels. In a research setting, CFTRinh-172 is used to study CFTR function in diseases where chloride transport is disrupted, such as cystic fibrosis, and in various experimental models to understand the regulation of fluid transport and secretion in epithelial cells and tissues. CFTRinh-172 has been used to suppress fluid secretion and reduce cyst growth in animal models, and to understand the role of CFTR in diarrhea caused by pathogens such as Vibrio cholerae.

[0113] In the present invention, BML-260 is based on the chemical scaffold rhodanine (2-thioxothiazolidin-4-one), which is increasingly attracting attention in the medical and pharmaceutical fields. Rhodanine is a heterocyclic compound primarily used due to its structural modification and pioneering early development potential. It is classified as a scaffold that allows for a wide range of modifications and various decorations, making it an important player in drug development. Therefore, BML-260 should be suitable for further structural optimization to improve its pharmacological properties, biological stability, and DUSP22 targeting. Given the yellow color of BML-260 and the ability of rhodanine to interact with photometric assays in biological assessments, it could function as a biomarker or therapeutic diagnostic agent for skeletal muscle loss diagnosis.

[0114] In the present invention, stereoisomers include enantiomers and diastereomers. Diastereoisomers include configurational diastereomers and cis-trans diastereomers.

[0115] In the present invention, stereoisomers of a compound having a double bond include (E) Form and (Z) Form of the compound.

[0116] Sarcopenia is a disease characterized by a decline in muscle mass and function. This decline is caused by a variety of factors, including hormonal and metabolic imbalances. Sarcopenia can be a disease of the following groups: muscular dystrophy, myasthenia gravis, muscular dystrophy, muscular weakness, amyotrophic lateral sclerosis, spinal muscular atrophy, myasthenia gravis, and senile sarcopenia.

[0117] In one embodiment, the DUSP22 inhibitor may be an siRNA having a nucleotide sequence of any one or more of SEQ ID NOs: 1 to 4 of Table 3 below.

[0118] [Table 3]

[0119]

[0120] The above DUSP22 inhibitor or the composition can be administered orally or parenterally to mammals, including humans, and can be formulated and administered by mixing the active ingredient with a pharmaceutically acceptable carrier. When formulating, commonly used fillers, bulking agents, binders, wetting agents, disintegrants, surfactants, diluents, or excipients can be used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations can be prepared by adding at least one excipient, such as starch, calcium carbonate, sucrose, lactose, and / or gelatin, to the composition of the present invention. In addition, lubricants such as magnesium and talc can also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups, and may contain various additives such as wetting agents, sweeteners, flavoring agents, and / or preservatives in addition to commonly used simple diluents such as water and liquid paraffin. Preparations for parenteral administration include injectable solutions, suspensions, emulsions, lyophilisates, nasal washes, and suppositories. Injectable solutions, suspensions, and emulsions can be prepared by mixing the active ingredient with water, a non-aqueous solvent, or a suspending solvent. The non-aqueous solvent and suspending solvent can be propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Bases for suppositories can include witepsol, macrogol, Tween 61, cacao butter, laurin butter, glycerol, and / or gelatin. When administered parenterally, it can be administered by subcutaneous injection, intravenous injection, or intramuscular injection.

[0121] The above DUSP22 inhibitor can be formulated by adding additives such as pharmaceutically acceptable carriers, excipients or diluents, and information regarding formulation can be found in literature widely known in the field.

[0122] Therefore, the composition of the present invention may further include a pharmaceutically acceptable additive, and may be composed of the effective ingredient and the pharmaceutically acceptable additive.

[0123] The composition of the present invention may contain 0.01 to 99.99 wt% of the above effective ingredient.

[0124] The DUSP22 inhibitor included in the composition of the present invention or used in the purpose or method may be administered at a dosage of 50 to 2,000 mg per day for an adult (60 kg). Administration may be administered once a day or in several divided doses. However, the scope of the present invention is not limited by the dosage or frequency of administration.

[0125] The present invention provides a method for inhibiting DUSP22 activity, comprising the step of treating a cell or an animal, including a human or a non-human, with a DUSP22 inhibitor.

[0126] The cells may be muscle cells in which DUSP22 is expressed or overexpressed.

[0127] Animals, including humans, include, but are not limited to, mammals such as cattle, pigs, dogs, banten, yaks, buffaloes, sheep, goats, dromedaries, Bactrian camels, llamas, alpacas, reindeer, horses, donkeys, minks, parrots, cats, hamsters, mice, rats, guinea pigs, rabbits, etc.; birds such as chickens, quails, turkeys, guinea fowls, pigeons, domestic ducks, baboons, geese, canaries, etc.; fish such as carp and goldfish; and insects such as silkworms and bees.

[0128] In the method for inhibiting DUSP22 activity of the present invention, the DUSP22 inhibitor may be any one selected from the group consisting of compounds, siRNA, and proteins.

[0129] In the method for inhibiting DUSP22 activity of the present invention, the DUSP22 inhibitor may be a compound described in Table 1 above.

[0130] In the method for inhibiting DUSP22 activity of the present invention, the DUSP22 inhibitor may be an siRNA having any one of the nucleotide sequences of SEQ ID NOs: 1 to 4.

[0131] The present invention provides a use for preparing a formulation of a DUSP22 inhibitor for treating or preventing sarcopenia.

[0132] Hereinafter, the present invention will be described in more detail with examples.

[0133]

[0134] Example

[0135] 1. Experimental materials and experimental methods

[0136] (1) Reagent

[0137] BML-260 and dexamethasone (Dex) were purchased from Santa Cruz Biotechnology (SC-223822 and SC-204715A, USA). Puromycin was purchased from Abcam (ab141453).

[0138] (2) Molecular docking analysis

[0139] The binding of BML-260 to human DUSP22 was analyzed using CB-Dock2 software. The Vina score was calculated using human DUSP22 (PDB: 6lvq) and BML-260 (CID: 1565747).

[0140] (3) Cell culture

[0141] C2C12 mouse skeletal muscle myoblasts (Koram Biotech Co., Ltd., Korea) were cultured in growth medium (GM) containing DMEM, 10% fetal bovine serum, and 1% penicillin and streptomycin (PenStrep). C2C12 myoblasts were differentiated into myotubes at ≥80% confluence by culturing in differentiation medium (DM) containing DMEM supplemented with 2% horse serum and PenStrep for 96 h. To induce atrophy, myotubes were treated with DM and 10 μM Dex for 24 h.

[0142] Human skeletal muscle myoblasts (Thermo-Fisher Scientific, USA) were resuspended in DM and seeded at 4.8 x 10 4 The cells were seeded in 12-well culture plates at a density of 10 cells / well. After 48 h, the differentiated myotubes were treated with 10 μM Dex for 24 h and stained with hematoxylin and eosin (H&E) using a kit (Merck, Germany). The diameters of the myotubes were measured by optical microscopy analysis of DIC captured images (Olympus CKX41, Olympus Life Science, Japan) and NIH imaging software Image J 64 (National Institutes of Health, MD, USA).

[0143] (4) Measurement of root canal diameter

[0144] Myosin heavy chain 2 (Myh2) immunocytochemistry was used to visualize mouse myotubes and measure their diameters according to published protocols. After mounting, fluorescence images were captured from five different fields using a DMI 3000 B microscope (Leica, Germany) and analyzed using NIH imaging software Image J 64. One hundred myotubes containing at least three nuclei were identified in each group.

[0145] (5) SUnSET analysis

[0146] The surface sensing of translation (SUnSET) assay was used to measure protein synthesis according to a published protocol. 1 μg / mL puromycin was added to the myotube culture medium, and cell lysates were collected 10 min later. Western blotting was performed using anti-puromycin 12D10 antibody (MABE343; Millipore).

[0147] (6) Western blotting

[0148] Western blotting was performed using a published protocol. Densitometry analysis of gel bands was performed using NIH imaging software Image J 64. The primary and secondary antibodies used in this study are listed in Tables 4 and 5 below.

[0149] [Table 4]

[0150]

[0151] [Table 5]

[0152]

[0153] (7) Real-time polymerase chain reaction (RT-qPCR)

[0154] The StepOnePlus Real-Time PCR System (Applied Biosystems, UK) was used to measure mRNA levels of the genes of interest. AccuPower RT PreMix (Bioneer, Korea) was used to synthesize cDNA from total RNA. RT-qPCR was performed according to the manufacturer's instructions and published protocol. The primers used in this study are listed in Table 6.

[0155] [Table 6]

[0156]

[0157]

[0158] (8) siRNA-mediated gene knockdown in root canals

[0159] Gene knockdown was performed using a 6-well culture plate format (Thermo Fischer Scientific, Waltham, USA) according to the manufacturer's protocol. Lipofectamine 3000 and Lipofectamine RNAiMax (Thermo Fischer Scientific, Waltham, USA) were used for the transfection step. C2C12 myotubes and primary human myotubes were transfected with 50 pmol siRNA duplex.

[0160] (9) CRISPR / Cas9-mediated gene overexpression

[0161] To induce endogenous overexpression, C2C12 myoblasts were transfected with the DUSP22 CRISPR-activating plasmid (Santa Cruz, SC-430587-ACT, SEQ ID NO: 67: TGCAGTTTGCGCACGCGCGC). Myoblasts were infected for 48 h and then selected by treatment with puromycin dihydrochloride (2 μg / ml), hygromycin B (200 μg / ml), and blastidin S HCl (20 μg / ml). Expression levels were then determined using qPCR to confirm overexpression.

[0162] (10) Root canal fusion and differentiation index

[0163] To confirm that myoblasts fuse into multinucleated myotubes, nuclei were counted and the fluorescence intensity of Myh2 immunostaining was measured using NIH imaging software Image J 64. Myotubes containing four or more nuclei were classified as Myh2-positive cells. The differentiation index was calculated using the following formula:

[0164] [Calculation Formula 1]

[0165] Differentiation index (%) = Number of nuclei in Myh2-positive cells in myotubes / Total number of nuclei × 100

[0166] (11) Animal studies

[0167] This study was conducted in accordance with the Institute for Laboratory Animal Research Guide for the Care and Use of Laboratory Animals and was approved by the Institutional Animal Care and Use Committee of the Gwangju Institute of Science and Technology (Approval No. GIST-2021-117). Animal experiments were approved by the relevant ethics committee and conducted in accordance with the 1964 Helsinki Declaration and its subsequent amendments. Animals were provided by Damool Science (Korea).

[0168] (12) Skeletal muscle atrophy Dex treatment model

[0169] Three samples were prepared for the Dex muscle atrophy model. Twelve-week-old male C57BL / 6J mice were treated as follows. The first sample, Vehicle, was prepared by treating only DMSO in PBS pH 7.4 containing 5% Tween 80. The second sample was treated with Vehicle plus 15 mg / kg Dex. The third sample was treated with 15 mg / kg Dex and 5 mg / kg BML-260 (n=4 per group). Mice were treated with daily intraperitoneal injections for 14 days, and then muscle condition was assessed.

[0170] (13) DUSP22 knockdown in skeletal muscle

[0171] Intramuscular delivery of DUSP22 siRNA (ID: 287290, Thermo Fisher Scientific, MA, USA) was performed using Invivofectamine 3.0 reagent (Thermo Fisher Scientific) according to the manufacturer's instructions and published protocol. Briefly, in the muscle wasting Dex model, 12-week-old C57BL / 6 mice (n=4 per group) were injected with 35 μg siRNA complex into the TA muscle 24 h before IP treatment with 25 mg / kg Dex. Mice were treated with 25 mg / kg Dex every 24 h for 10 days, and a second injection of 35 μg siRNA complex into the TA muscle on day 3 of Dex treatment. Muscles were harvested for analysis after 10 days of Dex treatment.

[0172] (14) Skeletal muscle aging model

[0173] To knockdown DUSP22 expression in aged skeletal muscle, DUSP22 siRNA was delivered intramuscularly using Invivofectamine 3.0 reagent (n=6 per group) in 27-month-old male C57BL / 6 mice. A 35 μg siRNA complex was injected into the TA muscle, followed by a second injection 4 days later. TA muscles were harvested for analysis on day 10 of the experiment.

[0174] To evaluate the pharmacological targeting of DUSP22, male C57BL / 6 mice aged 24–26 months were treated with BML-260 as follows: the first sample (Vehicle) was treated with 5% DMSO and 5% Tween 80, and the second sample was treated with 5 mg / kg BML-260 (n=4 per group). Mice were treated by IP delivery every 24 hours for 4 weeks, and skeletal muscle function and status were assessed.

[0175] (15) Fixed model

[0176] Fourteen-week-old mice were anesthetized with isoflurane, and both hind legs were secured with plastic EP tubes (Axygen, MCT-175-C). The junction between the tube and hind legs was wrapped with insulating tape to prevent slippage. Mice were monitored daily and sacrificed after 14 days.

[0177] (16) Grip strength test

[0178] Grip strength was measured using the BIO-GS3 device (Bioseb, FL, USA). The mouse was placed on a grid, all four paws were attached, and grip strength was measured by gently pulling back until the grid was released. The maximum grip strength value, used to represent muscle strength, was calculated from three trials performed at 30-second intervals.

[0179] (17) Muscle fatigue test

[0180] Muscle fatigue was measured using a Rotarod according to the protocol described above, using two models: a constant model and an accelerating model built into the Rotarod device. Before the muscle fatigue experiment, mice were acclimated to training using an accelerating Rotarod (Ugo Basile, Italy). Mice were trained at a constant speed of 13 RPM for 15 minutes. After a 15-minute recovery period, the mice were placed on the Rotarod, which was adjusted to accelerate from 13 to 25 RPM every 3 minutes, for 15 minutes. Twenty-four hours later, a muscle fatigue test was performed, increasing the speed from 13 to 25 RPM for 3 minutes and maintaining 25 RPM for 30 minutes. The latency to fall from the Rotarod was measured for each mouse. If a mouse fell more than four times within 1 minute, it was classified as fatigued and the test was terminated.

[0181] (18) Skeletal muscle anatomy and histology

[0182] Mice were anesthetized by intraperitoneal injection of ketamine (22 mg / kg, Yuhan, Korea) and xylazine (10 mg / kg, Bayer, Korea) in saline. The quadriceps femoris, gastrocnemius, soleus, and TA muscles were then dissected and weighed. For histological analysis, muscles were fixed overnight in 4% paraformaldehyde (PBS pH 7.4, 4°C). Paraffin sections and H&E staining were provided by the animal facility of the Gwangju Institute of Science and Technology, Republic of Korea. 5 μm muscle sections were prepared using a Thermo Scientific HistoStar (Thermofisher, USA). H&E staining was performed using a kit (Merck, Germany). For immunohistochemistry, TA muscle sections were permeabilized for 15 minutes (in PBS containing 0.5% Triton X-100), blocked for 1 hour (in 5% BSA), and incubated with primary antibodies overnight at 4°C. After washing three times with PBS for 5 minutes each, the sections were incubated with secondary antibodies at RT for 1 hour. Nuclei were counterstained with DAPI in ProLong™ Gold Antifade Mountant (Invitrogen, P36935). Digital images were acquired using a Leica DM 2500 (Leica Microsystems). Cross-sectional area and fiber size distribution were measured using NIH imaging software Image J 64.

[0183] (19) RNA-Seq

[0184] Total RNA concentration was measured using Quant-IT RiboGreen (Invitrogen, #R11490). To assess the overall integrity of the RNA, a TapeStation RNA screentape (Agilent, #5067-5576) was used. To ensure high-purity RNA preparation, only RNA with an RIN value of 7.0 or higher was used for RNA library construction.

[0185] Only 0.5 μg of total RNA from each sample was used for library preparation using the Illumina TruSeq Stranded Total RNA Library Prep Gold Kit (Illumina, Inc., San Diego, CA, USA, #20020599). The first step in the workflow was to remove rRNA from the total RNA. Following this step, the remaining mRNA was fragmented into smaller fragments using divalent cations at elevated temperature. The fragmented RNA fragments were cloned into double-stranded cDNA using SuperScript II reverse transcriptase (Invitrogen, #18064014) and random primers: DNA polymerase I, RNase H, and dUTP. These cDNA fragments then underwent final repair, single 'A' base addition, adapter ligation, and product purification and enrichment by PCR to create the final cDNA library.

[0186] Libraries were quantified using the KAPA Library Quantification Kit for Illumina sequencing platforms according to the qPCR Quantification Protocol Guide (KAPA BIOSYSTEMS, #KK4854) and qualified using TapeStation D1000 ScreenTape (Agilent Technologies, #5067-5582). Indexed libraries were then submitted to Illumina NovaSeq (Illumina, Inc., San Diego, CA, USA), and paired-end (2 × 100 bp) sequencing was performed at Macrogen Incorporated.

[0187] (20) Test of the muscle atrophy inhibitory effect of CFTR(inh)-172 (CFTR-172)

[0188] The vehicle group was treated only with DM for 120 hours, and the control group was treated with DM for 96 hours, followed by DM and 10 μM Dex for 24 hours. The CFTR-172 treatment group was treated with DM for 96 hours, followed by DM, 10 μM Dex, and 0.1 μM CFTR-172 for 24 hours (n=3). Afterwards, mRNA was collected, cDNA was synthesized, and the MuRF-1 gene was quantified using qPCR.

[0189] (21) Statistical analysis

[0190] To determine statistical significance, Student's t test or Dunnett's test and analysis of variance (ANOVA) were performed (GraphPad 7.0 Software, Inc., CA, USA). A p value less than 0.05 was considered statistically significant. Unless otherwise specified, experiments were performed three times, and error bars represent the mean ± standard error of the mean (SEM).

[0191] (22) Phosphatase activity assay for DUSP22 and confirmation of inhibition by BML-260

[0192] For the assay, a 200 μM 6,8-difluoro-4-methyllumbelliferyl phosphate (DiFMUP) working solution was prepared. Fifty microliters of DiFMUP solution was added to each well of a black-walled microplate, followed by 50 μL of sample containing GST-tagged-DUSP22 (SRP5021, Sigma-Aldrich, MO, USA) or 1X reaction buffer to bring the total reaction volume to 100 μL per well. BML-260 and 1X reaction buffer were then added to each well in a 50 μL volume. The microplate was incubated in the dark at room temperature for 45 min, and fluorescence was measured at an excitation wavelength of 360 nm and an emission wavelength of 455 nm (SpectraMAX Gemini XS, Molecular Devices, CA, USA).

[0193]

[0194] Example 1: Verification of expression of DUSP22, a target for sarcopenia treatment.

[0195] The expression of DUSP22 in humans with skeletal muscle loss was investigated using the Sarcopenia Gene Expression Database for muscle biopsies from elderly individuals aged 70 years or older from various ethnicities (Singapore Sarcopenia Study; (GEO accession number GSE111016). DUSP22 expression was found to be upregulated in sarcopenia patients (Fig. 1a). The Dex-treated model of myofibrillar atrophy was used to study the effect of DUSP22 on muscle loss in vitro. As a result, DUSP22 expression was found to be upregulated in muscle fibers undergoing Dex-induced muscle atrophy (Figs. 1b and 1c). In addition, DUSP22 expression was investigated in three mouse models of skeletal muscle loss: the Dex-treated model, aged mice (27 months old), and the tibialis anterior (TA) of immobilized mice. The average DUSP22 expression level was upregulated in all three models (Fig. 1c).

[0196] The above experiment revealed that DUSP22 is a marker that regulates muscle loss.

[0197]

[0198] Example 2: Confirmation of the effect of DUSP22 overexpression

[0199] DUSP22 was overexpressed in C2C12 myotubes using the endogenous CRISPR-cas9 editing tool. DUSP22 overexpression was confirmed by qPCR (Fig. 2a). Overexpression disrupted myotube morphology and significantly reduced fusion and differentiation indices (Figs. 2b-2d). Expression analysis of genes involved in mitochondrial function, autophagy, the ubiquitin-proteasome system (UPS), Myh2 isoforms, and FoxO3a signaling was performed (Fig. 3). Overexpression of DUSP22 was found to downregulate peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α), a master regulator of mitochondrial biogenesis, and upregulate the uncoupling protein UCP-3, while not affecting acyl-CoA synthetase long-chain family member 1 (Acyl). Autophagy genes, microtubule-associated protein 1A / 1B light chain 3B (LC-3B) and cathepsin L1 (Ctsl), were both upregulated by DUSP22 overexpression. The UPS gene, ubiquitin protein ligase E3 component N-recognin 2 (UBR2), was upregulated by DUSP22 overexpression, whereas the expression of the proteasome 26S subunit, non-ATPase 11 (Psmd11), was not significantly affected. The Myh2 isoform MYH7 was downregulated by DUSP22 overexpression, whereas MYH11 expression was decreased. Of the 10 genes tested for FoxO3a signaling, 7 were upregulated by DUSP22 overexpression. The 7 genes are listed in Table 7 below.

[0200] [Table 7]

[0201]

[0202] The remaining three genes showed no significant changes in expression. The three genes are listed in Table 8 below.

[0203] [Table 8]

[0204]

[0205]

[0206] Example 3: Confirmation of the effect of BML-260 in Dex-treated root canals

[0207] BML-260 is a small-molecule DUSP22 inhibitor based on rhodanine. Dex was treated in myotubes in the presence or absence of BML-260. Dex-treated myotubes showed a decrease in diameter. BML-260 treatment preserved myotube diameter and maintained the proportion of larger myotubes (Figures 4a-4c). BML-260 prevented the Dex-induced decrease in myotube fusion and differentiation index (Figures 5a and 5b). Furthermore, BML-260 increased the protein synthesis rate in Dex-treated myotubes beyond that observed in normal myotubes (Figures 5c and 5d). The E3 ubiquitin ligases atrogin-1 (FBXO32, MAFbx) and MuRF-1 (TRIM63) act as effectors of skeletal muscle atrophy downstream of the master regulator FOXO3a. Western blotting and qPCR analyses showed that atrogin-1 and MuRF-1 were upregulated in Dex-treated myotubes and downregulated by BML-260 (Figs. 6a to 6c).

[0208]

[0209] Example 4: Confirmation of the effect of siRNA-mediated DUSP22 gene knockdown in Dex-treated root canals.

[0210] To investigate the effect of DUSP22 gene targeting on myotube atrophy, siRNA-mediated knockdown was performed. DUSP22 knockdown suppressed atrophy in the Dex-treated model, as evidenced by increased myotube diameter and the proportion of larger-sized myotubes (Figs. 7a–c). Gene knockdown in myotubes was confirmed by qPCR (Fig. 8a). Furthermore, knockdown restored myotube fusion and differentiation indices (Figs. 8b and 8c).

[0211] Forkhead box O3a (FOXO3a) is a key factor regulating skeletal muscle wasting. FOXO3a signaling activity is inhibited through phosphorylation by Akt (also known as protein kinase B), which is part of the IGF-1 / PI3k / Akt / mTOR pathway that stimulates muscle hypertrophy. FOXO3a phosphorylation in myotubes was decreased by Dex treatment and increased by DUSP22 knockdown (Figs. 9A and 9B). In contrast, Akt phosphorylation was decreased by Dex treatment but was not affected by DUSP22 knockdown. pPCR and Western blot analyses showed that the upregulation of MuRF-1 and atrogin-1 by Dex treatment was suppressed by DUSP22 knockdown (Figs. 10 and 11).

[0212]

[0213] Example 5: Confirmation of the effect of BML-260 in a Dex-treated mouse (in vivo) model

[0214] The effects of pharmacological targeting of DUSP22 via BML-260 were investigated using a Dex-treated mouse model of skeletal muscle wasting (Fig. 12a). Dex significantly decreased mean body weight, whereas BML-260 treatment increased it (Fig. 12b). BML-260 treatment also increased mean grip strength (Fig. 12c). Rotarod test results showed that BML-260 significantly restored muscle performance in both constant and accelerated models (Fig. 12c). Histological analysis of TA muscles revealed that BML-260 significantly increased muscle fiber cross-sectional area (CSA) (Figs. 13a and 13b). Furthermore, BML-260 shifted the muscle fiber area distribution toward larger fibers (Fig. 13c). These changes in TA histology were consistent with increased muscle mass (Fig. 14a). Dex-induced upregulation of atrogin-1 and MuRF-1 was also inhibited by BML-260 (Fig. 14b and 14c).

[0215]

[0216] Example 6: Confirmation of the siRNA-mediated DUSP22 gene knockdown effect in a Dex-treated mouse (in vivo) model.

[0217] DUSP22 siRNA was injected into the TA muscles of Dex-treated mice (Fig. 15a). Western blotting confirmed DUSP22 knockdown in TA muscles (Figs. 15b and 15c). Knockdown prevented TA muscle mass loss (Fig. 15d). Histological analysis revealed that DUSP22 knockdown increased muscle fiber cross-sectional area (CSA) (Figs. 16a and 16b) and the proportion of larger fibers (Fig. 16c). Fast-twitch type 2 muscle fibers appeared to be more susceptible to atrophy. DUSP22 knockdown preserved the CSA of type 2A and type 2B muscle fibers (Figs. 16a, 17a, and 17b). FOXO3a phosphorylation was reduced after Dex treatment and restored by DUSP22 knockdown. Inhibitory phosphorylation of FoxO3a was also restored by DUSP22 knockdown. Upregulation of atrogin-1 and MuRF-1 was also attenuated by DUSP22 knockdown. DUSP22 knockdown downregulated JNK and its downstream effector c-jun (Figs. 18 and 19).

[0218]

[0219] Example 7: Confirmation of the effect of siRNA-mediated DUSP22 gene knockdown in aged mice.

[0220] DUSP22 was knocked down in the TA muscle of aged mice (27 months old) via siRNA delivery (Fig. 20a). Western blotting confirmed that DUSP22 was knocked down in the TA muscle, which also led to a decrease in MuRF-1 levels (Figs. 20b, 21a, and 21b). TA muscle mass increased in the DUSP22 knockdown group (Fig. 21c). Histological analysis revealed that the cross-sectional area increased in the DUSP22 knockdown group (Figs. 21d and 21e).

[0221]

[0222] Example 8: Confirmation of the effect of BML-260 in aged mice.

[0223] [Revised on March 17, 2025, pursuant to Rule 91] BML-260 was administered to aged mice (24–26 months of age) for 4 weeks (Fig. 22a). Body weight was not affected by BML-260 treatment (Fig. 22b). Latency to fall and grip strength in the rotarod test were increased by BML-260 treatment (Fig. 22c). BML-260 increased the average mass values ​​of the quadriceps femoris, gastrocnemius, TA, and soleus muscles (Fig. 23a). qPCR analysis revealed that BML-260 decreased the expression of atrogin-1 and MuRF-1 in the TA muscle. Furthermore, BML-260 decreased the expression of myostatin, a key promoter of muscle aging, and increased the expression of PGC-1α, a key inhibitor of muscle aging (Fig. 23b). Immunostaining results of TA muscle and gastrocnemius muscle showed that BML-260 increased fast twitch type 2A, type 2B, and 2X muscle fiber cross-sectional area (CSA) and Feret diameter in aged mice (Figs. 24a to 24b).

[0224]

[0225] Example 9: Confirmation of DUSP22 Targeting in Immobilized Models and Human Root Canals

[0226] Using a hindlimb immobilization model, we evaluated whether DUSP22 pharmacological targeting was effective in different types of skeletal muscle loss. DUSP22 expression was inversely correlated with TA mass (Fig. 25a). Immobilization decreased the average mass of the quadriceps femoris, gastrocnemius, TA, and soleus muscles, reaching significance in the gastrocnemius (Fig. 25b). DUSP22 expression was upregulated in the TA muscle (Fig. 26a). BML-260 treatment increased the average TA mass value (Fig. 26b). Atrogin-1 and MuRF-1 expression in the TA were upregulated by immobilization and downregulated by BML-260 (Figs. 26c-e).

[0227] We treated human donor myotube cultures undergoing Dex-induced atrophy with the DUSP22 inhibitor BML-260. BML-260 increased the average myotube diameter and the proportion of larger myotubes (Fig. 27a). qPCR analysis showed that BML-260 also blocked the upregulation of MuRF-1 (Fig. 27d). Furthermore, DUSP22 gene knockdown significantly increased the average myotube diameter and the proportion of larger myotubes, thereby blocking atrophy (Figs. 28a-28d). DUSP22 knockdown also inhibited the upregulation of MuRF-1 (Fig. 28e).

[0228] These experimental results demonstrate that pharmacological and genetic targeting of DUSP22, a multi-signal transduction kinase, is effective in preventing skeletal muscle loss in humans and animal models through inhibition of JNK-FOXO3a signaling, a major inducer of muscle fiber atrophy.

[0229]

[0230] Example 10: Confirmation of the myotube atrophy inhibitory effect of CFTRinh-172.

[0231] When muscle atrophy was induced by treating the root canal with Dex, it was confirmed that the degree of muscle atrophy was reduced by treating it with CFTRinh-172. To quantify the degree of muscle atrophy, the expression level of MuRF-1 in the root canal was measured (Fig. 29).

[0232]

[0233] Example 11: Confirmation of the inhibitory effect of BML-260 on DUSP22 dephosphorylation enzyme activity.

[0234] The activity of DUSP22 was measured using the EnzChek® Phosphatase Assay Kit (E12020, ThermoFisher, MA, USA). Phosphatase activity was measured using GST-tagged-DUSP22 protein and DiFMUP substrate.

[0235] BML-260 showed a concentration-dependent effect of reducing the activity of DUSP22 (IC50: 54 μM, Figure 30).

[0236]

[0237] Example 12: Confirmation of the effect of STK547767, STK105142, or STL297511 in Dex-treated root canals.

[0238] After differentiating myoblasts into myotubes, the muscle atrophy-inducing drug Dex was co-treated with STK547767 (No. 7 in Table 1), STK105142 (No. 9 in Table 1), or STL297511 (No. 25 in Table 1) to determine whether Dex-induced muscle atrophy was reduced by drug treatment. A similar therapeutic effect was observed compared to BML-260, which was used as a positive control (Fig. 31a).

[0239] In addition, the myotube cells were visualized by staining with fast-type myosin heavy chain using immunochemical staining, and the diameter of each myotube cell was measured to quantify the effect of muscle atrophy treatment (Fig. 31b).

[0240]

[0241] Example 13: Measurement of DUSP22 protein-ligand blind docking

[0242] The vina scores of the compounds in Table 1 for DUSP22 were measured using CB-DOCK2. A lower vina score indicates better binding affinity.

[0243] As a result of the measurement, it was confirmed that BML-260 (NO. 3) binds to positions C88 and L89 of DUSP22.

[0244] Additionally, it was confirmed that all compounds in Table 1 with a structure similar to BML-260 bind to the same position in DUSP22 as the position where BML-260 binds.

[0245] In addition, it was confirmed that all compounds in Table 1 had good binding affinity to DUSP22. This suggests that compounds in Table 1 with a structure similar to BML-260 can also bind to DUSP22 and be used as inhibitors of DUSP22.

[0246] The vina scores of compounds bound to position C88 of DUSP22 are shown in Table 9, and the vina scores of compounds bound to position L89 are shown in Table 10. The NO. in Tables 9 and 10 are the same as the NO. in Table 1.

[0247] [Table 9]

[0248]

[0249] [Table 10]

[0250]

[0251] From the above results, it was confirmed that DUSP22 inhibitors are effective in treating sarcopenia and can be used for the diagnosis and treatment of skeletal muscle loss. In other words, compounds, siRNAs, and / or proteins exhibiting DUSP22 inhibitory effects can be included as active ingredients in compositions for treating and / or preventing sarcopenia, and can also be used for the diagnosis and treatment of skeletal muscle loss.

[0252] In addition, compounds such as BML-260, which have been confirmed to have a DUSP22 inhibitory effect, are effective in treating sarcopenia, and such effect was found to be due to the strong binding of BML-260 to the C88 and / or L89 positions of DUSP22. This is because other substances that strongly bind to the C88 and / or L89 positions of DUSP22 also exhibited the same effect. Therefore, it can be seen that substances that strongly bind to the C88 and / or L89 positions of DUSP22 exhibit a DUSP22 inhibitory effect, and as a result, are effective in treating sarcopenia and can also be utilized in the diagnosis and treatment of skeletal muscle loss.

[0253]

[0254] Preparation example: Preparation of injection

[0255] BML-260 500 mg

[0256] Mannitol 180 mg

[0257] 2793 mg of sterile distilled water for injection

[0258] Sodium dihydrogen phosphate 26 mg

[0259] According to the manufacturing method of a conventional injection, it is manufactured with the above ingredient content per 1 ampoule (2 ml).

Claims

1. A pharmaceutical composition for treating or preventing sarcopenia, comprising a DUSP22 inhibitor as an active ingredient.

2. A pharmaceutical composition for treating or preventing sarcopenia, wherein the DUSP22 inhibitor according to claim 1 is any one selected from the group consisting of compounds, siRNA, and proteins.

3. A pharmaceutical composition for treating or preventing sarcopenia according to claim 1, wherein the sarcopenia is selected from the group consisting of muscular atrophy, myasthenia gravis, muscular dystrophy, muscular weakness, muscular dystrophy, amyotrophic lateral sclerosis, spinal muscular atrophy, myasthenia gravis, and senile sarcopenia.

4. In claim 1, the DUSP22 inhibitor is a compound represented by the following chemical formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof, a pharmaceutical composition for treating or preventing sarcopenia: [Chemical Formula 1] (During the meal, R1 is or And, R2 is or And, R3 is -H, -F, -Cl, -Br, -CH3, substituted or unsubstituted C 2-5 alkyl, -OH, -NH3, -SH, -COOH or -NO2, R4 and R5 are each independently -H, -CH3, substituted or unsubstituted C 2-5 alkyl, -CF3, -COOH, -CH2COOH, or -C(O)OC 1-3 It is alkyl, n is an integer from 1 to 5).

5. In claim 1, the DUSP22 inhibitor is any one compound selected from the group consisting of compounds in Table 1 below, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof, a pharmaceutical composition for treating or preventing sarcopenia: [Table 1] 6. A pharmaceutical composition for treating or preventing sarcopenia according to claim 1, wherein the DUSP22 inhibitor is an siRNA having any one or more nucleotide sequences of SEQ ID NOs: 1 to 4.

7. A method for inhibiting DUSP22 activity, comprising the step of treating a cell or an animal other than a human with a DUSP22 inhibitor.