Polymer modified nanoparticles for cytokine or other payload delivery

Abstract

Disclosed herein are cytokine constructs that include a delivery vehicle, and at least one cytokine or one decoy receptor. By adjusting the types and density of cytokines on the constructs, they can be tailored for both local and systemic treatment of patients with cancers and other immune-related diseases, such as autoimmune diseases. Additionally, the cytokine constructs can be used ex vivo to expand and activate cells from patients or healthy subjects before re-infusing the activated cells back into patients, which benefits adoptive and stem cell therapies. These constructs display improved half-life and stability of cytokines, enabling reducing doses, and minimizing toxicity from unintended effects of free cytokines. Furthermore, the constructs allow for co-delivery of other therapeutics, such as antibodies, small molecule inhibitors, chemotherapeutics, oligonucleotides, adjuvants, and antigens.

Description

POLYMER MODIFIED NANOPARTICLES FOR CYTOKINE OR OTHER PAYLOAD DELIVERYCROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to and the benefit of the earlier filing of U.S. Provisional Application No. 63 / 561 ,263, filed on March 4, 2024, which is incorporated by reference herein in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under grant R44CA265751 , R44CA265752, and R44CA285233 awarded by the National Institutes of Health. The government has certain rights in the invention.INCORPORATION OF SEQUENCE LISTING BY REFERENCE

[0003] A computer readable XML file, entitled “0046-6001 PCT_SeqList.xml” created on February 20, 2025, with a file size of 12,288 bytes, contains the sequence listing for this application and is hereby incorporated by reference in its entirety.FIELD

[0004] The current disclosure relates to compositions and methods for nano-based therapy, including nano-based cytokine therapy. Cytokine constructs (CK-NPs) are based on nanoparticles delivering of cytokines, for instance to various immune cells to treat cancer, auto-immune, and inflammatory diseases. These (cytokine) constructs overcome limitations of current cytokine therapy, such as short half-life, off-target delivery, unintended effects, and high toxicity.BACKGROUND

[0005] Cytokines (CK) play significant roles in the immune systems by regulating immune response and inflammation, thereby impacting various diseases ranging from cancer, autoimmune diseases, sepsis, anemia, allergy, etc. Cytokines have been used as therapeutics such as: interferons (IFNs) for treating viral infections and cancer, interleukins (e.g., IL-2 or IL2, IL-15, IL-12) for treating cancer by activating immune cells that kill cancer cells, such as T cells and natural killer (NK) cells, growth factors such as erythropoietin (EPO) for stimulating the production of red blood cells to treat anemia, granulocyte colony-stimulating factor (G-CSF) for inducing the production of white blood cells (e.g., in cancer patients receiving chemotherapy), and tumor necrosis factor (TNF) for inducing tumor cell death and stimulating anti-cancer immune response. Cytokines typically have short half-life and adverse side effects, limiting their use in clinics. Certain cytokines also have pleiotropic effects and could activate different (occasionally opposing) pathways. Modifying cytokines and / or loading cytokines on nanoparticles in a certain manner can promote cytokines’ intended effects and avoid unintended effects. Intended effects and unintended effects may be defined differently for different indications, as will be described throughout the application as non-exhaustive examples.Filed February 21 , 2025

[0006] Limitations of cytokine therapy are short half-life and toxicity. The short half-life of cytokines requires high doses and frequent dosing of cytokine therapy to achieve desired efficacy. This can lead to systemic toxicity and side effects such as fever, fatigue, nausea, and life-threatening cytokine release syndrome (CRS). Cytokines may have multiple effects (sometimes opposing or pleiotropy effects) on different cell types. Therefore, nanoparticles that can effectively deliver cytokines to activate target tissues or cells while minimizing exposure to or activation of non-target cells will have significant benefits on cytokine therapy.

[0007] Due to its significance, IL-2-based cancer immunotherapy has become a recent focus of drug development. Many research groups have bio-engineered IL-2 to bind less to a receptors, reducing potency for Tregs’ activation (e.g., FIGs. 1A & 1C). However, these IL-2 variants do not increase potency toward CD8+ T cells’ activation compared to the wildtype IL-2 (e.g., FIGs. 1 A & 1 D). Consequently, high doses of IL-2 are still required, and Tregs are still activated. In addition, effector CD8+ T cells are shown to upregulate a receptors, thus the non-alpha binding IL-2 is less efficacious than wildtype IL-2 at expanding them. Frick et al. (2016) conjugated up to 1 ,660 IL-2 molecules onto the surface of hydroxyethyl starch nanocapsules (HES-D-IL2) to take advantage of binding avidity (i.e., the increased binding strength resulting from multiple receptors binding to the high density of IL- 2 on the nanoparticle surface). However, the HES-D-IL2 did not improve the expansion of CD8+ T cells over free IL2 (FIG. 1 E). Clearly, better cytokine delivery strategies are needed.SUMMARY

[0008] Described herein in embodiments is the development of cytokine constructs (CK-NPs) based on nanoparticle loaded with one or more cytokines, which CK-NPs can be used to treat various diseases including cancer, autoimmune, and inflammatory diseases. CK-NPs can be used as therapy or to improve therapy involving various immune cell types.

[0009] The cytokine constructs (CK-NPs) are developed to improve half-life of cytokines, deliver them to activate the target cells, and reduce the adverse side effects. This is achieved by tuning the size of nanoparticles, the density of cytokines on the particles, the dose of CK-NPs, the route of administration, the methods of cytokine loading on the particles (e.g., on the external surface or encapsulated within the pores of the particles, by non-covalent or covalent bonding (or binding)), the release mechanism of cytokines from the particles, and / or the incorporation of targeting agents and other therapeutics.

[0010] Cytokines of molecular weight ranging from 5 to 100 kDa can be delivered on the nanoparticles regardless of types.

[0011] Based on solubility, size, and charge, cytokines can be readily loaded on the polymer e.g., polyethylenimine, PEI) coated on the nanoparticles or on the nanoparticle cores via non-covalent bonding / binding (e.g., electrostatic binding, hydrogen bonding, dipolar interaction, hydrophobic interactions, Van der Waals force, or precipitation).Filed February 21 , 2025

[0012] Certain cytokines can also be loaded on the core of the nanoparticles or on the polymer coating via covalent bonding (e.g., chemical conjugation). Certain cytokines can also be conjugated on to the functional groups (e.g., maleimide, amine, azide, thiol) on the polymer coatings (e.g., PEI and PEG).

[0013] The nanoparticles enable co-delivering of cytokines and other therapeutics such as oligos, immunogenic cell death agents (ICDs), targeted therapy, antibody, chemotherapy, small molecule inhibitors, and adjuvants which provide additive or synergistic effects for best treatment outcomes.

[0014] Cytokines are well known in the art, and any cytokine can be loaded on the herein provided NP. Example cytokines, and uses of the cytokines, are provided in the Poster of Human Cytokines and Chemokines (Cell Sources, Cell Targets and Major Functions by Sino Biological, accessed in 01 / 2024; it summarizes exemplary cytokines (including their molecular weights, cell sources, cell targets, receptors, and functions) that can be loaded on the NP. The Cytokine Atlas (eBioscience, First Edition) also provides examples of diseases influenced by cytokine function, each of which can be treated with a CK-NP.

[0015] The CK-NPs can be administered locally or intratumorally for instance to readily accessible tumors such as melanoma, head and neck cancer, breast cancer, and lymphoma; or systemically for other cancers such as lung cancer, liver cancer, pancreatic cancer, prostate cancer, brain cancer, kidney cancer, blood cancer, gastric cancer, colon cancer, rare cancer, and metastatic cancers.

[0016] Engineered cytokine constructs can have a diameter in the nanometers or micrometer range, and can be made of any materials (e.g., lipid, organic materials, inorganic materials, polymers, and hybrids or combinations thereof) capable of loading cytokines and other therapeutics, delivering them to the target sites (cancer cells, immune cells, extracellular matrices, etc.), and allowing them to have the desired functions.

[0017] Adjuvants or immunostimulants can optionally be co-delivered on the same cytokine construct to activate antigen presenting cells to generate adaptive immunity against disease cells, such as cancer.

[0018] Optionally, cytokine constructs also contain one or more homing agents (antibodies, aptamers, ligands, peptides, etc.) that enable them to preferentially deliver to and / or be taken up by target cancer cells or various immune cell types (e.g., DCs, B cells, macrophages, monocytes, T cells, NK cells, stem cells).

[0019] The herein provided cytokine constructs may be used alone or in combination with standard therapeutics, including, but not limited to, chemotherapy, surgery, targeted therapies, immunotherapy, and radiation therapy.

[0020] Alternatively, other targeted therapeutics (e.g., oligonucleotides, small molecule inhibitors or antibodies targeting other oncoproteins, or medical radioactive isotopes) can be loaded directly on / in the cytokine constructs as a therapeutically active agent.

[0021] For local delivery, the cytokine constructs optionally can be formulated into topical or microneedle formulations.

[0022] Provided herein are cytokine constructs that include: a delivery system or vehicle and at least one cytokine. In examples of this embodiment of the cytokine construct, the delivery system includesFiled February 21 , 2025 a liposome, a lipid-based particle, a polymeric particle, an inorganic or organic nanoparticle or microparticle, or a hybrid thereof. In particular embodiments, the provided cytokine constructs have a hydrodynamic size of 5 nm to 999 nm (e.g., 80 nm to 200 nm, 90 nm to 130 nm; or less than 150 nm), as measured in an aqueous solution (such as PBS, Tris buffer, or water). In yet other examples, the cytokine constructs have a hydrodynamic size of 1 micron to 1000 micron. In some embodiments, the delivery system has a size of 5 nm to 200 nm, 5 nm to 90 nm, 5 nm to 20 nm, 30 nm to 100 nm, 30 nm to 80 nm, 30 nm to 60 nm, 40 nm to 80 nm, 70 nm to 90 nm, or 5 nm, 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, or 100 nm.

[0023] Also provided herein are cytokine constructs that include an immune checkpoint inhibitor. In some embodiments, the immune checkpoint inhibitor is an antibody (e.g., one that is against PD-L1 , PD-1 , TIM-3, LAG-3, or CTLA-4).

[0024] In some embodiments, the cytokines are co-delivered with mitotic kinase inhibitor such as an inhibitor of PLK1 (e.g., GSK461364, BI2536, Tak960, NMS-P937, volasertib), Chk 1 kinase (e.g., LY2603618, prexasertib, or AZD7762), an RHA helicase A (e.g., YK-4-279), cyclin-dependent kinase 1 / 2 (e.g., / Z.7O3), Aurora kinase A (e.g., alisertib), CDK4 / 6 inhibitors (palbociclib, ribociclib, and abemaciclib).

[0025] In some embodiments, the cytokines are co-delivered with oligonucleotides such as siRNA, miRNA, or an antisense oligonucleotide (ASOs or AONs) against cancer, immunosuppressive, or immunostimulant genes.

[0026] Also provided are compositions that include at least one cytokine construct as described herein. Optionally, such compositions further include at least one pharmaceutically acceptable carrier, excipient, or diluent.

[0027] Another embodiment is a method of treating cancer, which method includes administering to a subject (such as a human subject) with cancer an effective amount of a provided cytokine construct, or a composition containing such a cytokine construct, to reduce one or more symptoms of the cancer.

[0028] Another embodiment is a method of treating other immune-related diseases, such as autoimmune, inflammatory, and infectious diseases, which method includes administering to a subject (such as a human subject) with the disease an effective amount of a provided cytokine construct, or a composition containing such a cytokine construct, to reduce one or more symptoms of the disease.

[0029] Also provided are methods of treating a cell exhibiting symptoms of cancer or other immune- related diseases including contacting the cell with a therapeutically effective amount of a provided therapeutic.

[0030] Also provided are methods of treating a cell obtained from a subject exhibiting symptoms of cancer or other immune-related diseases, the methods including contacting the cell with a therapeutically effective amount of a provided cytokine construct, or a composition containing such a cytokine construct.

[0031] Also provided are methods of treating a cell obtained from a subject exhibiting symptoms of cancer or other immune-related diseases or a heathy subject, the methods including contacting a cell ex vivo with a therapeutically effective amount of a provided cytokine construct, or a compositionFiled February 21 , 2025 containing such a cytokine construct. The cells are then infused into a patient and serve in cell therapy applications.

[0032] In any of the cell-based embodiments, it is contemplated that the cell in some instances is a cancer or other immune-related diseased cell. In other instances, the cell is not a cancer or diseased cell. In various embodiments, the cell is an immune cell. Optionally, in any of the cell-based embodiments, the cell may be from a human subject, or from another mammalian subject.

[0033] Yet another embodiment is a method of treating a subject diagnosed as having a hyperproliferative disease or condition, which method includes administering to the subject an effective amount of a composition including at least one of the provided cytokine constructs.

[0034] Also provided are methods of enhancing effect of an anti-cancer therapy in a subject (such as a human subject) in need thereof, including administering to a subject in need thereof: an effective amount of a provided cytokine construct, or a composition containing such a cytokine construct; and at least one anti-cancer agent or therapeutic (e.g., a chemotherapeutic agent, targeted therapeutic agent, or an immune checkpoint inhibitor). Optionally, the cytokine construct or composition and the anti-cancer therapy are administered sequentially or concurrently.

[0035] Also provided are methods of enhancing effect of therapeutics in a subject (such as a human subject with immune-related diseases) in need thereof, including administering to a subject in need thereof: an effective amount of a provided cytokine construct, or a composition containing such a cytokine construct; and at least one therapeutic {e.g., a chemotherapeutic agent, targeted therapeutic agent, or an immune checkpoint inhibitor). Optionally, the cytokine construct or composition and the other therapy are administered sequentially or concurrently.

[0036] Yet another embodiment is a method of enhancing radiation therapy effect in a subject (such as a human subject) diagnosed as having a neoplasia or cancer, including administering to a subject in need thereof: an effective amount of a provided cytokine construct, or a composition containing such a cytokine construct; and at least one radiation therapy. Optionally, the cytokine construct or composition and the radiation therapy are administered sequentially or concurrently.

[0037] Provided herein are cytokine constructs that include: a delivery vehicle, including a core coated with a polymer including polyethylenimine (PEI) and polyethylene glycol (PEG); and at least one cytokine or one decoy receptor attached to the PEI / PEG coat.

[0038] Another provided embodiment is a composition including any one (or more) cytokine construct(s) of this disclosure, and a pharmaceutically acceptable carrier, excipient, or diluent.

[0039] Methods of treating cancer or other immune-related diseases are provided, as are methods of treating diseases that involve inflammatory response(s), autoimmune diseases, and / or infectious diseases, which methods include administering to a subject with the disease an effective amount of any one (or more) cytokine construct(s) of this disclosure, or a composition including such cytokine construct(s).

[0040] Methods of treating a cell exhibiting symptoms of cancer are provided, as are methods of treating a cell exhibiting an element of an inflammatory response(s), and autoimmune disease, or an infectious disease, which methods include administering to a subject with the disease an effectiveFiled February 21 , 2025 amount of any one (or more) cytokine construct(s) of this disclosure, or a composition including such cytokine construct(s).

[0041] Also provided are methods of treating a cell obtained from a subject exhibiting symptoms of cancer or other immune-related disease, or exhibiting symptoms of a disease that involves inflammatory response(s), an autoimmune disease, or an infectious disease, which methods include administering to a subject with the disease an effective amount of any one (or more) cytokine construct(s) of this disclosure, or a composition including such cytokine construct(s).

[0042] A method of treating a cell obtained from a healthy subject is also provided, which method includes contacting the cell with a therapeutically effective amount of any one (or more) cytokine construct(s) of this disclosure, or a composition including such cytokine construct(s). In embodiments of these methods, the term “treating” does not refer to an action taken to ameliorate a disease or condition in the (healthy) subject from which the cell is obtained.

[0043] Another provided method embodiment is a method of enhancing an effect of an anti-cancer therapy in a subject in need thereof, which methods include administering to a subject with the disease an effective amount of any one (or more) cytokine construct(s) of this disclosure, or a composition including such cytokine construct(s); and at least one anti-cancer agent. Similar methods are provided for enhancing the effect of another anti-disease or anti-condition therapy, where the disease or condition involves inflammatory response(s), autoimmune diseases, or infectious diseases, and where the accompanying agent is directed to the corresponding disease or condition.

[0044] Also provided are methods of increasing stability (e.g., thermal stability, such as stability through one or more freeze-thaw cycles) of a cytokine, which methods include loading the cytokine onto or into nanoparticle construct including a delivery vehicle coated with polyethylenimine (PEI) and polyethylene glycol (PEG), wherein the cytokine is attached to the PEI / PEG coat of the delivery vehicle.

[0045] Also described are embodiments of constructs that do not necessarily include a cytokine, which may be referred to as cytokine-optional constructs. These include for instance constructs in which oligonucleotides can be loaded onto constructs separately from a cytokine (which may be included in a construct), or given separately. Other therapeutics can also be co-delivered with the cytokine or decoy receptor on the same cytokine construct or separately, including on a different construct that does not include a cytokine.BRIEF DESCRIPTION OF THE DRAWINGS

[0046] FIGs. 1A-1 E. IL-2 variants, IL-2na (FIGs. 1 A & 1 B from Wu etal., 2023 and ALKS 4230 (FIGs. 1 C & 1 D from Jared et al., 2020), reduced potency for Tregs’ activation (FIGs. 1 A & 1 C) compared to wildtype (WT) IL-2, but did not enhance the activation of CD8+ T cells (FIGs. 1 B & 1 D). (FIG. 1 E) A particle based IL-2 (HES-D-IL2) by Frick et al., 2016 was not more efficacious than free IL-2 at proliferating CD8+ T cells (CTLL-2).

[0047] FIGs. 2A-2F. (FIG. 2A) IL-2 loaded nanoparticle (IL2-NP) synthesis consisting of coating mesoporous silica nanoparticle core (50 nm by TEM) with polyethylenimine (PEI) and polyethyleneFiled February 21 , 2025 glycol (PEG) and loading IL-2 via electrostatic interaction with the PEI layer. (FIG. 2B) The hydrodynamic size in PBS of IL2-NP (134.4 + 2.3 nm) vs. bare NP. The IL2-NP has a zeta potential of 15.3 ± 0.5 mV. It contains 20.4 wt.% PEI, 18.9 wt.% PEG (each by MSNP weight), and 1 .6 wt.% IL-2 (by NP weight). (FIG. 2C) IL2-NP containing 1.6 wt.% IL-2 (6,400 IL-2 molecules per particle) induced better activation and proliferation of CTLL-2 (a CD8+ T cell line) compared to IL2-NP with 0.6 wt.% IL-2 (2,400 IL-2 molecules per particle), effectively lowering the EC50 dose of IL-2 by 2-fold. Consequently, the 1.6 wt.% formulation was used in all subsequent studies, unless specified otherwise. In FIG. 2D, IL2-NP proved more effective than free or soluble IL-2 in promoting CD8+ T cell proliferation, reducing the EC50 dose of IL-2 by 12-fold. CTLL-2 cells were treated with various doses of IL-2 or IL2-NP for 48 hours, and cell viability was assessed using the CTG viability assay. Confocal microscopy images of CTLL-2 cells (not shown) after a 1 -hour treatment show that free IL- 2 (labeled with AF647 dye) was only visualized inside the cells at a dose five times higher than that of IL-2 on NP (IL2-NP), indicating more efficient uptake of IL-2 when loaded on nanoparticles. FIG. 2E demonstrates that nanoparticles can protect IL-2 from enzymatic degradation. The proliferation of T cells (isolated from C57BL / 6 mouse spleens) was assessed after treatment with IL-2 or IL2-NP (200 ng IL-2 / mL) that had been pre-treated with 5 pg / mL proteinase K or PBS for 10 minutes. Cell proliferation was measured 2 days post-treatment using the CTG viability assay. FIG. 2F NP retains siRNA in B16F10 tumors of mice 8-fold (area under the curve, AUG) higher than free siRNA over 10 days (0.22 mg NP with 2.2 pg Dy677 tagged siRNA) and retains IL-2 in MC38 tumors in a similar manner (per injected dose) at Day 1 (0.5 mg NP with 6.8 pg AF680-IL-2), and expected to have similar tumor accumation (AUG) with siRNA-NP.

[0048] FIGs. 3A-3Q (FIG. 3A) Treatment regimen involved administering IL2-NP to one of the two MC38 tumors in C57BL / 6 mice, with a total of three doses (0.5 mg IL2-NP per mouse, 8 pg IL-2 per dose). An anti-tumor effect was observed in both the treated tumor (representing a primary tumor, FIG. 3B) and the untreated tumor (representing a metastatic tumor, FIG. 3C). This effect was especially pronounced when combined with immune checkpoint inhibitors (ICIs; 200 pg anti-PD1 + 100 pg anti-CTLA4, i.p., every three days for three doses), leading to a 100% cure rate versus 29% with ICIs alone, 43% with IL2-NP alone, and no cure with free IL-2 (FIG. 3D). (FIG. 3E) No apparent toxicity was observed, as indicated by normal body weight. The combination also generated cancerspecific memory CD8+ T cells; i.e. , when each of the 7 cured mice was inoculated at 3 months with matched MC38 cancer on one flank and mismatched LLC-JSP lung cancer on another flank, only the mismatched LLC-JSP tumors grew and the MC38 tumors did not, indicating cancer specific T cell memory that may prevent cancer relapse. This memory effect was not observed in mice treated by ICIs alone as both tumor types still grew, demonstrating the benefit of IL2-NP. Data were plotted as mean ± SEM and *p < 0.05, **p < 0.01 , ***p < 0.001 , and ****p < 0.0001 (throughout all studies). (FIG. 3F) Binding and / or uptake of IL2-NP in CD8+ T cells increased in intratu morally injected MC38 tumors at 24 hours, compared to free IL-2, but not in regulatory T cells (Tregs). (FIG. 3G) Mice treated with IL2-NP exhibited decreased PD-1 expression in tumor-associated Tregs, while PD-1 expression in tumor CD8+ T cells remained unchanged. In tumors treated with free IL-2, no change in PD-1Filed February 21 , 2025 expression was observed in either CD8+ T cells or Tregs. IL-2 was labeled with AF480 fluorescent dye for monitoring purposes.. Mice with MC38 tumors received treatments similar to those described in FIG. 3A. One day after the third dose (day 7), both local and distant tumors, along with their corresponding tumor-draining lymph nodes, were harvested to analyze changes in immune cell populations via flow cytometry. FIG. 3H shows a greater population of CD8+ T cells in the tumors of mice treated with IL2-NP compared to those treated with free IL-2. FIG. 31 shows no change in the Treg population. FIG. 3J indicates that the CD8+ T cellsTTreg ratio in both local and distant tumors was higher with IL2-NP treatment than with free IL-2 treatment, suggesting that the effect of IL2-NP on CD8+ T cells is systemic (i.e., not confined to the treated tumors only). This systemic effect aligns with the observed cancer-killing activities of CD8+ T cells in both tumors (FIGs. 3B-3C). IL2-NP treatment also led to a significant increase in CD80+MHCII+ dendritic cells in local tumors (FIG. 3K) and in the local tumor-draining lymph nodes (FIG. 3L), indicating enhanced dendritic cell maturation. Furthermore, FIG. 3M shows a significant increase in the ratio of M1 -like macrophages (CD80+F4 / 80+) to M2-like macrophages (CD206+F4 / 80+) in the local tumor-draining lymph nodes, highlighting the importance of dendritic cells and macrophages as antigen-presenting cells in eliciting a potent anti-tumor immune response. FIG. 3N shows that IL-2 treatment increased PD-L1 level in non-immune / cancer cells and did not affect PD-1 level of CD8+ T cells in local tumors.. MC38 tumor cells were inoculated into C57BL / 6 mice in a manner similar to that described in FIG. 3A. Seven days after tumor inoculation, the mice received four doses of a CD8 depleting antibody (i.p., 200 pg per dose) administered twice weekly. On day 8, the local tumors were treated intratumorally with three doses of IL2-NP (0.5 mg NP, 8 pg IL-2) administered every three days, while the distant tumor remained untreated. Tumor growth of both the locally treated tumor (FIG. 30) and the distant tumor (FIG. 3P) was plotted as average ± SEM. FIG. 30 presents a Kaplan-Meier survival curve, which shows that the addition of CD8 depleting antibodies negated the survival benefits of IL2-NP, suggesting that the anti-tumor effect of IL2-NP is dependent on CD8+ T cells.

[0049] FIG. 4. IL2-NP exhibits high binding avidity to dimeric IL2 receptors on CD8+ T cells and enhances delivery to CD8+ T cells via anti-PD1 binding, to tumor cells via anti-PDL1 binding, and bridges both cell types through anti-PD1 / anti-PDL1 bindings (Top left). Material scheme (Top right): IL2 electrostatically binds to PEI (coated on MSNP) and is protected by a dense PEG layer, while antibodies are conjugated to PEG (which is conjugated to the PEI). Proposed mechanisms (Bottom panel): In addition to the direct action of IL-2 in expanding CD8+ T cells over Tregs, Ab-IL2-NP will activate dendritic cells (DCs) and promotes M1 over M2 polarization, reducing immunosuppressive TME and presenting antigens to facilitate adaptive T cell generation. The anti-PD1 / anti-PDL1 antibodies on NP also inhibit immune checkpoints on both cancer and CD8+ T cells, releasing the brake for CD8+ T cells to kill cancer cells.

[0050] FIGs. 5A-5B. (FIG. 5A) Anti-PD-L1 Avelumab (A) conjugated nanoparticles loaded with IL-2 (A-IL2-NP) synthesis scheme consisting of coating MSNP core (50 nm) with PEI (22.1 wt.%) and PEG (20.3 wt.%), followed by conjugating with the 4.7 wt.% avelumab antibody (A-NP), and electrostatic loading of IL-2 (1 .6 wt.%). (FIG. 5B) The size in saline of the A-NP and A-IL2-NP (131 .6 ± 2.5 nm).Filed February 21 , 2025

[0051] FIGs. 6A-6E. NP loaded with avelumab (“A” or anti-PDL1 ) from 0-10 wt.% showing similar size (FIG. 6A) but various degrees of PD-L1 blockade on PDL1 -high H1975 cancer cells after 30 min (10 pg NP with varying % avelumab, per 1 M cells) (FIG. 6B). On NP, IL2 did not interfere with avelumab for blocking PD-L1 on LLC-JSP (FIG. 6C) or anti-PD1 for blocking PD-1 on CD8+ T cells after 2 hrs (FIG. 6D); 0.1 mg NP with 4 pg avelumab+1 .4 pg IL2 or 6 pg anti-PD1 +1 .6 pg IL2, per 1 M cells). On NP, avelumab did not interfere with splenocyte expansion by IL2 (2.3 pg / ml NP with 93 ng / ml avelumab and 32 ng / ml IL2 for 2 days) (FIG. 6E).

[0052] FIGs. 7A-7D. Ex vivo expansion of T cells by IL2-NP vs. free IL-2. Flow cytometry data were obtained from carboxyfluorescein succinimidyl ester (CFSE)-labeled, activated pmel-1 T cells (derived from pmel mice - B6.Cg-Thy1 a / Cy Tg(TcraTcrb)8Rest / J; Jackson Lab) treated with free IL-2 at concentrations of 0.1 and 1 pg / mL, as well as with IL2-NP (with an equivalent IL-2 dose of 0.1 pg / mL). The cells were stained for CD4, CD8, and FOXP3. FIG. 7A shows the percentages of CD8+ cells and CD4+ cells (of all T (CD45+CD3+) cells) 4 days post-treatment (left), and the total numbers of CD8+ and CD4+ cells (right). FIG. 7B presents the fold changes in T cell numbers from day 0 to day 4. Flow cytometry data were obtained from isolated T cells from the spleens of C57BL / 6 mice. The T cells were rested in RPMI 1640 Medium with 10% fetal bovine serum (FBS) for 2 hours and then treated with free IL-2, IL2-NP at an equivalent dose of IL-2 (32 ng / mL), NP at equivalent dose (2 pg / mL) or PBS. (FIG. 70) Lymphocyte populations on day 3. (FIG. 7D) A greater CD8+ T cells / Treg ratio was observed in T cells treated with IL2-NP compared to those treated with free IL-2 and NP alone.

[0053] FIG. 8. A cytokine construct (siSTAT3 / CpG / IL2-NP) can co-deliver IL-2 (2 wt.%), STAT3 siRNA (siSTAT3, 5 wt.%), and CpG (5 wt.%), achieving over 70% knockdown of STAT3 mRNA, similar to an equivalent construct without IL-2 (siSTAT3 / CpG-NP). A375 cells (human melanoma cells) were treated with the specified treatments or left untreated (UT) for 48 hours; the dose of siSTAT3 was 180 nM. RNA was harvested using the GeneJET RNA Purification Kit (Thermo Fisher) and mRNA levels were analyzed by qRT-PCR using TaqMan 1 -Step Master Mix on a Rotor-Gene Q (Qiagen), following the manufacturer’s protocol. Constructs containing scrambled siRNA (siSCR) or IL-2 alone served as controls.

[0054] FIG. 9. A cytokine construct (STAT3 ASO / IL2-NP) co-delivers IL-2 (2 wt.%) and STAT3 ASO (3 wt.%), leading to the knockdown of STAT3 mRNA by over 80%, similar to the equivalent construct without IL-2 (siSTAT3-NP). A549 cells (lung cancer cells) were treated with specified treatments or untreated (UT) for 48 hours; dose of STAT3 ASO (AZD9150, Medchemexpress, NJ) was 166 nM. RNA was harvested and analyzed as described in FIG. 8. Free ASO of equivalent dose and the construct without ASO and IL-2 (NP alone) were used as controls.

[0055] FIG. 10. Hydrodynamic size measurements were taken for nanoparticles (NP) alone or NPs loaded with STING agonists: 5 wt% CdG (cyclic di-GMP) or 5 wt% ADU-S100 (2’3'-c-di-AM(PS)2 (Rp,Rp), a bisphosphorothioate analog of c-di-AMP, Rp isomers). The sizes of NP, CdG-NP, and ADU-S100-NP are 103 ± 0.4 nm, 108 ± 1 .0 nm, and 110 ± 0.8 nm, respectively.

[0056] FIGs. 11A-11C. A-PLK1 i / STING-NP (nanoparticles co-delivering PLK1 inhibitor (volasertib), ADU-S100 (STING agonist), and avelumab (PD-L1 antibody)) is effective in C57BL / 6 mice bearingFiled February 21 , 2025 aggressive LLC-JSP bilateral tumors. 250,000 and 100,000 LLC-JSP cells were inoculated in the right and left flanks of the mice, respectively. Seven days after tumor inoculation, the mice were grouped (n=7) and received intratumoral injections in the local tumor (right flank tumor) with either saline or A- PLK1 i / STING-NP (500 pg NP containing 5 wt.% avelumab, 2 wt.% volasertib, and 5 wt.% ADU-S100). Treatments were administered every three days for three doses. Tumor volumes are plotted as mean and SEM for both the locally treated tumor (FIG. 11 A) and the distant untreated tumor (FIG. 11 B). (FIG. 1 1 C) The Kaplan-Meier survival curve comparing saline-treated mice to A-PLK1 i / STING-NP- treated mice.REFERENCE TO SEQUENCE LISTING

[0057] The nucleic acid sequences described herein are shown using standard letter abbreviations for nucleotide bases, as defined in 37 C.F.R. §1 .822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included in embodiments where it would be appropriate. In the Sequence Listing:

[0058] SEQ ID NO: 1 is a representative sense sequence of an siRNA specific for STAT3 (siSTAT3): 5' GGAUCUAGAACAGAAAAUGdTdT 3’ (the last two positions of which are deoxy bases).

[0059] SEQ ID NO: 2 is a representative antisense sequence of an siRNA specific for STAT3 (siSTAT3): 5' CAUUUUCUGUUCUAGAUCCdTdG 3' (the last two positions of which are deoxy bases).

[0060] SEQ ID NO: 3 is a representative sense sequence of an siRNA specific for HER2 (siHER2): 5' CACGUUUGAGUCCAUGCCCAAUU 3'.

[0061] SEQ ID NO: 4 is a representative antisense sequence of an siRNA specific for HER2 (siHER2): 5' UUGGGCAUGGACUCAAACGUGUU 3'.

[0062] SEQ ID NO: 5 is a representative sense sequence of an siRNA specific for SCR (siSCR): 5' UGGUUUACAUGUCGACUAA 3'.

[0063] SEQ ID NO: 6 is a representative antisense sequence of an siRNA specific for SCR (siSCR): 5' UUAGUCGACAUGUAAACCA 3'.

[0064] SEQ ID NO: 7 is the sequence of CpG ODN 1826, which was used throughout the examples (mouse system): 5'-TCCATGACGTTCCTGACGTT-3’. This ODN contains a full phosphorothioate backbone and is nuclease resistant.

[0065] SEQ ID NO: 8 is the sequence of CpG ODN 2006 / 7909, which was used in examples with monkey and human system: 5’- TCGTCGTTTTGTCGTTTTGTCGTT-3’. This ODN contains a full phosphorothioate backbone and is nuclease resistant.DETAILED DESCRIPTION

[0066] Described herein are the synthesis and characterization of representative cytokine constructs, as well as an example of their application in cancer treatment. Optimized cytokine (IL-2) loaded nanoparticles (IL2-NP) are described; its synthesis scheme and characterization are shown in FIG. 2.Filed February 21 , 2025

[0067] In some embodiment, nanoparticle (NP) includes a mesoporous silica nanoparticle (MSNP) core {e.g., ~50 nm) coated with a bioreducible cross-linked cationic polymer, e.g., polyethylenimine (PEI) for cytokine loading and endosomal escape; and a stabilizer, e.g., polyethylene glycol (PEG), which prevents nanoparticle aggregation, serves as a linker for cytokine and antibody loading, protects drug cargos from degradation by blood enzymes, and shields the charge of PEI, enhancing safety. Synthesis of mesoporous silica nanoparticles and polymer modified nanoparticles can be found in Ngamcherdtrakul et al., 2015 and Ngamcherdtrakul et al., 2018. Cross-linking of the cationic polymer is optional in certain constructs (cytokine constructs or cytokine-optional constructs); such constructs can be referred to as including uncross-linked polymer or non-cross-linked polymer, for instance. Cationic polymer and stabilizer can be coated on the particle at different wt.% of the particle core (e.g., MSNP); e.g., above 10 wt.%, above 11 wt.%, above 12 wt.%, above 13 wt.%, above 14 wt.%, above 15 wt.%, above 16 wt.%, above 17 wt.%, above 18 wt.%, above 19 wt.%, above 20 wt.%, above 21 wt.%, above 22 wt.%, above 23 wt.%, above 24 wt.%, above 25 wt.%, above 26 wt.%, above 27 wt.%, above 28 wt.%, above 29 wt.%, above 30 wt.% or 5 to 30 wt.%, 10 to 20 %, 10 to 25%, 5 to 15%, 5 to 20%, 15 to 25%, 18 to 25%, 18 to 30 %, 20 to 30%, 5 to 25%, 20 to 50 %, or 1 to 10%, e.g., about 5, 10, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40 or 45%.

[0068] Loading of cytokines {e.g., IL-2) can be done as follows: 10 mg / mL to 20 mg / ml NP and 1 -4 wt.% IL-2 is mixed in PBS for 2 hrs. Next, the IL-2 loaded NP (IL2-NP) is centrifuged down and washed with PBS to remove the unbound IL-2. In some embodiment, the loading is near completion and the material can be used without washing. Characterization of NP and IL2-NP is done with TGA for polymer (PEI and PEG) and MSNP contents, IL-2 loading is measured by BCA assay, and size and charge of the constructs are measured by a Zetasizer. The compositions, size, and charge are shown in FIG. 2. When calculated as number of cytokines per particle (as described below), the number of cytokine molecules per particle could be about, above, or less than 10, 25, 50, 75, 100, 200, 300, 400, 500, 1000, 1 100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 6000, 7000, 8000, 9000, 10000, 25000, 30000, 50000, or 100000 molecules per particle. Cytokines, other therapeutics, or other molecules, which are described throughout the application as examples, can be loaded at different wt.% on the particle; e.g., about, above, or less than 0.1 %, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1 %, 1 .4%, 1 .5%, 1 .6%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%; or 0.1 to 30%, 1 to 30%, 1 to 20%, 1 to 10%, 1 to 5%, 0.1 to 1%, 0.5 to 5%, or 0.5 to 10%.

[0069] Characterization for other cytokine constructs: a) Nanoparticle size and charge: Nanoparticle primary / dry size is measured by TEM as explained with examples in our prior publications (Ngamcherdtrakul et al., 2015 and Ngamcherdtrakul et al., 2018). Hydrodynamic size and zeta potential of the nanoparticle is measured by Dynamic Light Scattering (DLS) technique {e.g., using Zetasizer Malvern, ZS-90), following our prior works (Ngamcherdtrakul etal., 2015; Ngamcherdtrakul et al., 2018; Ngamcherdtrakul et al., 2021 ). b) Measurement of nanoparticle’s composition: the amount of polymer loading on the nanoparticle is measured by thermogravimetry (TGA) analysis by heating the nanoparticle fromFiled February 21 , 2025 room temperature to 700-900 °C {e.g., at 20°C / min). Changes in weight as the temperature rises are plotted and compared between nanoparticle alone and polymer-loaded nanoparticle to determine the nanoparticle and polymer contents (Ngamcherdtrakul et al., 2015). Polymer can also be released from the nanoparticle with solvent {e.g., DMSO, DMF, methanol, ethanol) and analyzed with HPLC-based system {e.g., HPLC-UV, HPLC-MS), NMR, FT-IR, or other standard polymer characterization techniques. c) Measurement of cargos on the nanoparticle: loading of proteins e.g., antibody, cytokine) was determined by protein quantification of initial loading solution and NP supernatant (after loading and upon centrifugation) with Pierce BCA protein assay (Thermo Fisher) or ELISA-based method, following our and other prior works (Ngamcherdtrakul et al., 2015; Ngamcherdtrakul et al., 2018; Ngamcherdtrakul et al., 2021 ; Leng et al., 2008; Hank et al., 2009; Kim et al., 2021 ). The difference can be used to determine the amount of cargo on the nanoparticle. Other cargos {e.g., drug, oligonucleotide, small molecule inhibitor, or other molecules with absorbance properties) are quantified by releasing the cargo from the nanoparticle in low or high pH aqueous buffer solution {e.g., pH<6 or pH>8), in the presence of surfactant {e.g., Tween-80), or in solvent solution {e.g., DMSO, DMF, methanol, ethanol); and subjected to quantitative analysis of those cargos by Spectrophotometer {e.g., Nanodrop (ThermoFisher), Infinite 200 Pro plate reader (Tecan)), HPLC-UV, or HPLC-MS system as described in our prior works (Ngamcherdtrakul et al., 2022; Reda et al., 2022). In other cases, cargos can be conjugated or tagged with fluorescence dyes; or later hybridized / reacted with fluorescent dye-tagged compounds or beads, to allow for their quantification with fluorescence-based methods {e.g., spectrophotometer, HPLC-fluorescence, flow cytometry, fluorescent microscope). Alternatively, the cargo amounts in the initial loading solution and supernatant (after cargo loading and upon centrifugation) can be measured with the same aforementioned techniques, and the difference can be used to determine the amount of cargo loaded on the nanoparticle.

[0070] Table 1 provides an example of how IL-2 loading on NP can be varied by simply varying the concentrations and ratios of IL-2 per nanoparticles. In addition, solvent types, pH, temperature, and binding time can also be adjusted to achieve desired cytokine contents on the NP. Table 1 also includes TGF-p loading on NP.

[0071] Table 1. Various CK-constructs.Filed February 21 , 2025In Table 1 , cytokine constructs prepared in PBS (and acidified PBS in case of TGF- ), all achieved after 2 hours of mixing at room temperature. ‘Provided by manufacturer, Peprotech (Cranbury, NJ); “Calculated based on charge of amino acid chain using bachem.com / knowledge-center / peptide- calculator / .#NP is MSNP coated with PEI (23.2 wt.% MSNP) and PEG (19.7 wt.% MSNP).

[0072] It is contemplated that low density of IL-2 on the cytokine construct or free IL-2 will preferentially activate Treg, while a higher density of IL-2 on the cytokine construct will preferentially activate effector T cells (e.g., CD8+ T cells) due to high binding avidity. Low density of cytokine in some embodiments is <0.05 wt.%, <0.1 wt.%, or <0.5 wt.% (by NP weight). It is contemplated that different densities and types of cytokines on the cytokine construct can have different effects on different cells, at least in part because of the pleiotropic effect cytokines can have on cellular processes. In some cases (e.g., FIG. 2), the cytokine construct with higher cytokine loadings (or density) will produce stronger effect than the cytokine construct with lower cytokine loadings (or density). In some cases, the cytokine construct with higher cytokine loadings (or density) will produce weaker effect (for instance, lower pleiotropic effect(s)) than the cytokine construct with lower cytokine loadings (or density).

[0073] It is contemplated that cytokine constructs can be taken up by and / or activate cells (e.g., T cells, B cells, neutrophils, stem cells, macrophages, DCs, monocytes, other APCs, and other immune cells) more effectively than free cytokine counterparts; hence providing more rapid and stronger effects than control release system. In certain case, the cytokine construct can better redirect the pleotropic effect of cytokines to the intended effect (e.g., activating CD8 instead of Treg), when compared to free cytokines or cytokines released from other constructs. In some embodiment, cytokines being more accessible (e.g., on the surface of cytokine constructs) to targeted cells are more desirable for better target engagement, when compared to cytokines being encapsulated within the construct

[0074] In some embodiment, the cytokine construct can be engineered to release cytokine in a controlled sustained manner (e.g., as nanoparticle dissolves over time, or controlled by certain chemical linkers) to generate different phenotypes and effects (e.g., activating Tregs instead of CD8+ T cells for autoimmune or other immune-related diseases).

[0075] In some embodiment, loading of cytokines can be done via covalent bonding. Specifically, cytokines can be thiolated and conjugated to the maleimide group on the polymer. Certain cytokines may already have thiol groups and can be readily conjugated to the maleimide group. Certain cytokines with disulfide groups can be cleaved to generate thiol groups and conjugated to the maleimide group. Other conjugation chemistry known in the field can also be utilized on our cytokine constructs (e.g., Hermanson, 2013).Filed February 21 , 2025

[0076] Our IL2-NP has been tested in a colon cancer (MC38) mouse model and achieved 100% cure rate, when combined with standard immune checkpoint inhibitors (see FIG. 3). In FIG. 3, we also show that the IL2-NP offers much greater efficacy compared to the free IL-2 counterpart. Although only one tumor of the bilateral tumors was treated, the anti-tumor effect was observed in both tumors, indicating the systemic effect. This is due to the systemic activity of CD8+ T cells and not the transporting of IL2-NP from the local to the distant tumor. We found that our NP can retain a therapeutic (e.g., an oligonucleotide) in the treated tumors for 8-fold greater than the free therapeutic counterpart (based on area under the curve of signal vs. time from 0-10 days). From FIG. 3 data, MC38 is somewhat responsive to ICIs, but achieving 100% cure in this model (especially having bilateral tumors and only one tumor is treated) is still very rare (from our literature review of many therapeutics; see, e.g., Chmid etal., 2017; Torrejon eta!., 2020; Sow etal., 2019; Nagaya etal., 2019; Lewis et al., 2018; Wang etal., 2018), indicating a great promise of our IL2-NP.

[0077] The described IL2-NP overcomes the limitations of IL-2 therapy (low binding affinity toward CD8+ T cells over Treg, lack of targeting specificity, and short half-life). Demonstrated herein is higher CD8+ / Treg than free IL-2 counterpart (FIG. 3J), leading to greater cancer death. The mechanism of action can be illustrated in FIG. 4.

[0078] In addition to increasing CD8+ / Treg ratio, the IL2-NP treatment also increased recruitment of antigen presenting cells (APCs) such as dendritic cells and M1 -macrophages (FIGs. 3K-3M), benefiting adaptive immunity process (e.g., generating cancer specific T cells).

[0079] The total dose of IL-2 used in FIG. 3 was 3.3-fold lower than that of the reported BALLkine-2 (IL-2 encapsulated in large mesoporous silica nanoparticles; Kim et al., 2022) that did not result in cure perhaps due to too large size (4-7 times greater than our nanoparticle core of 50 nm), too positively charge (+35.2 mV), and / or the release of IL-2 prior T cell engagement of BALLkine-2. We hypothesize that our IL2-NP having smaller size (50 nm core size, 130 nm hydrodynamic size) can be taken up by or engaged to CD8+ T cells as a IL2-NP (vs. the released IL-2 in BALLkine-2 case), increasing the efficacy (by taking advantage of high IL-2 density on the NP surface). IL-2 in BALLkine- 2 is encapsulated within the pores, while IL-2 is on external surface of our NP making it more accessible to IL-2 receptors on the immune cells, which may also contribute to our greater efficacy. Our NP also has near-neutral charge and contains PEG for stealth effect, which would be less taken up by macrophages than highly positively charged BALLkine-2. High density of IL-2 on our nanoparticles (e.g., 6400 molecules per particle) should be more effective at engaging IL-2 receptors on CD8+ T cells than the low-density counterpart (e.g., 80-1660 IL-2 per HES-D-IL2 nanocapsule; Frick et al., 2016). The HES-D-IL2 did not improve the expansion of CD8+ T cells over free IL2 (FIG. 1 E), perhaps due to too low IL2 density, the covalently attached IL2 (not ideal for signaling), too large particle size (215 nm), and / or the material being negatively charged (not ideal for cell uptake). The size, charge, cytokine density, loading approaches of cytokine on our NP may be tuned to achieve the opposite spectrum (e.g., lower IL-2 density) in order to preferentially upregulate Treg for treating autoimmune and graft-versus-host diseases.Filed February 21 , 2025

[0080] Because some diseases such as metastatic cancer cannot be easily treated via intratumoral or local injection, we also develop a systemic IL2-NP therapeutic. We found IL-2 treatment enhanced PD-L1 level of non-immune / cancer cells and PD-1 level of CD8+ T cells (FIG. 3N) compared to saline. Thus, we will first employ avelumab (an anti-PD-L1 drug, which has cross reactivity in both mice and humans for convenient translation) to serve as the tumor homing agent and immune checkpoint inhibitor on our NP, followed by IL-2 loading to achieve the final product namely A-IL2-NP. Atezolizumab (an anti-PD-L1 drug) and anti-PD1 can also be loaded on NP in a similar manner as avelumab. FIGs. 5A-5B shows its synthesis scheme and characterization. Table 2 shows material composition, hydrodynamic size in PBS and in serum, as well as zetapotential of materials from various synthesis batches.

[0081] Table 2. CK-constructs containing IL-2, anti-PD-L1 , anti-PD-1 , or both antibodies.*By MSNP weight; #By NP weight (NP = MSNP coated with PEI & PEG)

[0082] Table 2 includes composition, hydrodynamic size in PBS and in serum, as well as zetapotential of materials from various synthesis batches. Data in Table 2 confirms synthesis reproducibility, as shown by consistent composition (PEI, PEG, antibody, and IL2 contents), hydrodynamic size, and charge across four batches. To our knowledge, no other nanoparticle platforms are able to load this high levels of IL2 and antibodies on the surface without aggregation. Dual antibodies (e.g., anti-PD- L1 and anti-PD-1 ) can be loaded simultaneously for equal contents and at 100% loading efficiency as shown in Table 2.

[0083] FIG. 6A shows how the levels of anti-PD-L1 on the construct can be varied from 0-10 wt.% without aggregation (maintaining size), which affects the levels of PD-L1 blockade (FIG. 6B). Antibody conjugation on our nanoparticle follows our published works (Ngamcherdtrakul et al., 2015; Ngamcherdtrakul et al., 2018; Ngamcherdtrakul et al., 2022; Reda et al., 2022) with some modifications (e.g., varied concentrations of NP and antibody in the loading solution to achieve antibody loading content from 0 to 10 wt.%). As shown in FIG. 6B, NPs with 5 wt.% and 10 wt.%Filed February 21 , 2025 avelumab reduced PD-L1 expression of PD-L1 -high H1975 cancer cells similarly and more effectively than NP with 2.5 wt.% avelumab. Therefore, we selected an antibody content of about 4-6% (>2,000 antibodies per particle), which was found to be effective across various antibodies and cancer cell types.

[0084] Antibodies are loaded first, followed by IL-2 loading. Since both antibodies and IL-2 are loaded on the NP surface, we ensure negligible leakage of antibodies upon IL-2 loading (see %anti-PDL1 before and after IL-2 loading in Table 2), owing to the strong covalent bonding of antibody on our NP. We also conducted two experiments to confirm no functional interference between IL-2 and antibodies. Specifically, we confirm similar blockade of PD-L1 on LLC-JSP cells by avelumab(A)-IL2- NP and A-NP (indicating no interference from IL-2) (FIG. 6C). Likewise, we confirm similar blockade of PD-1 on CD8+ T cells by anti-PD1 -IL2-NP and anti-PD1 -NP (indicating no interference from IL-2). Such blockade is also greater than blockade by free anti-PD1 of equal dose (FIG. 6D), showing evidence of binding avidity. Lastly, IL2-NP and A-IL2-NP could expand splenocytes similarly, indicating that avelumab did not interfere with IL-2’s activity (FIG. 6E).

[0085] Owing to the steric effect of dense PEG layer (>3x105molecules per particle), even with 12% total antibody and 1 .5%-1 .6% IL-2 loading (see B1 & B2 in Table 2), the nanoparticles remain small (about 130 nm) with a narrow size distribution (PDI < 0.2) in PBS alone and with 50% serum, indicating no aggregation and negligible protein binding. This agrees with an assessment by the NCI’s Nanotechnology Characterization Laboratory (NCL), which found negligible absorption of serum proteins on our NP loaded with 5% avelumab, 3% siRNA, and 5% CpG. Overall, the materials have a slightly positive charge (about +13 mV; +10 mV is considered neutral by the NCL), which should enhance cellular uptake without toxicity concerns. Table 2 also shows good reproducibility of material synthesis.

[0086] The mesoporous silica nanoparticle size can also be adjusted by varying the amount and concentration of reagents (e.g., CTAC, TEA, TEOS), pH condition (e.g., pH of 6-13), which impacts cellular uptake to T cells and other cell types (e.g., larger particles may be taken up better by macrophages than by T cells) as well as solubility of the particles (e.g., larger particles need longer time to dissolve than smaller particles). Pore size can also be adjusted by varying chain lengths of surfactant (e.g., CTAC), use of pore-expanding (swelling) agents (e.g., alkane, heptane, ethanol, gelatin, 1 ,3,5-trimethylbenzene) as reported in prior works (Park et al., 2009; Ma et al., 2015; Mohammed et al., 2021 ; Guo et al., 2019; Ulfa et al., 2022; Kao et al., 2013).

[0087] Large pore size (>10 nm or >20 nm) can be used to encapsulate the cytokines within. Particles with small pore size (<3 nm, <5 nm or <10 nm) can load cytokines on the external surface of the particles. Particles without pores such as iron oxide, carbon, calcium phosphate, and gold can be used as the cores for polymer coating and cytokine loading on external surface.

[0088] Solubility of porous silica nanoparticles depends on pore size, particle size, and concentration (Ngamcherdtrakul et al., 2022), which in turn affects the release of the cytokines. PEI coated on our NP allows non-covalent bonding of certain cytokines, while maleimide groups at the end of functional PEG can also be used for covalent bonding (conjugation) of certain cytokines.Filed February 21 , 2025

[0089] Release of cytokines can be engineered to provide rapid or slow release. For example, once bound on PEI, some cytokines are not readily released from the particles, especially in tumors with lower pH where amines are more protonated, facilitating high avidity of interaction between cytokines and their receptors on cells, and / or cellular uptake of cytokines while still on nanoparticles. Releasing of cytokines can occur over time as NPs dissolve, and NPs at lower concentration (e.g., 0.2 mg / ml) or in higher pH conditions (pH >7.4) dissolve faster than at higher concentration (e.g., 2 mg / ml) or at lower pH (pH <7) as reported in Ngamcherdtrakul et al., 2022.

[0090] Our NP is flexible because the density and types of cytokines, the particle size, the pore size, the cytokine loading approaches (non-covalent bonding, covalent bonding, encapsulation within the pore, or loading on external surface), the concentration of the CK-NP, and the route of administration can be controlled or tuned to achieve desirable properties (e.g., preferential activating CD8+ T cells over T reg for cancer treatment or vice versa for autoimmune disease treatment).

[0091] What’s more, our NP can also be attached with targeting agents to target specific cell types (Table 2 and FIG. 6) or co-loaded with other therapeutics to achieve synergistic activities with the cytokines.

[0092] Other antibodies such as anti-PD1 that target T cells, as well as anti-EGFR, anti-HER2, and other antibodies that target cancer cells can also be conjugated on the nanoparticles in the same aforementioned manner as anti-PD-L1 antibody conjugation.

[0093] Oligo (siRNA, AON, and / or CpG) can be loaded on the cytokine construct with a few minutes (e.g., 5 minutes) mixing in PBS at room temperature (FIGs. 8 and 9); it electrostatically binds to PEI in an oligo sequence-independent manner and is protected under the PEG layer from enzymatic degradation. PEG may also protect some cytokines in a similar manner. The nanoparticle (NP) was highly optimized for siRNA delivery efficacy in terms of MSNP sizes, PEI and PEG molecular weights and compositions, (optionally) PEI crosslinking conditions (to enhance buffering capacity and lower charge), oligo and (optionally) antibody loadings (Ngamcherdtrakul et al., 2015). See also US Patent Publication 2017 / 0173169.

[0094] The cytokine construct can also be used for proliferating cell therapy (NK, T cells, DCs, B cells, stem cells) ex vivo prior to infusion or piggyback onto the adoptive cells to promote their proliferation and activities in vivo. An example is shown in FIG. 7, in which the IL2-NP was used to proliferate T cells ex vivo and shown to be more effective than free IL-2 at same dose and at 10-fold higher dose (FIGs. 7A-7B), maybe due to toxicity of high dose of free IL-2. IL2-NP is also more effective than free IL-2 at proliferate CD8+ T cells over Treg ex vivo (FIGs. 7C-7D).

[0095] NP can also deliver various STING agonists and RIG-1 agonists and maintain good hydrodynamic sizes (FIG. 10).

[0096] NP can also deliver an antibody, an anti-cancer agents such as PLK1 inhibitor, and a STING agonist, leading to tumor growth inhibition in both local tumor (FIG. 1 1 A) and distal tumor (FIG. 11 B), as well as increased survival (FIG. 1 1 C). These constructs maybe used alone or in combination with aforementioned cytokine constructs to improve efficacy (e.g., for cancer therapy)Filed February 21 , 2025

[0097] Provided herein are cytokine constructs that include: a delivery system and at least one cytokine and / or one decoy receptor (Mantovani et al., Trends in Immunology, 22(6): 328-336, 2001 ). The cytokines can be standard cytokines or their variants, including muteins, protein mutants, superkines (engineered cytokines with improved affinity for intended receptors and decoupling undesired pleiotropic effects), and pegylated cytokines (Zheng et al., 2022). Decoy receptors (or receptor decoys; e.g., IL-18BP, IL-22BP, DcR1 , DcR2, DcR3, IL-13R2, IL-1 RII, TGF-p decoy receptor) act as molecular traps for cytokines, ligands, agonists, or other signaling receptor components, preventing them from interacting with the signaling receptors. Some decoy receptors can be structurally identical to cytokine receptors but are inactive in certain target cells (e.g., CXCR4 in germinal center B cells, CCR6 in circulating B cells). Silent non-signaling receptors (e.g., D6, Duffy, ANF) in the chemokine system can also serve as decoy receptors. Examples and functions of decoy receptors can be found in Mantovani et al., 2001. The resulted cytokine construct can stimulate or suppress immune response, depending on the target diseases (e.g., cancer or other immune-related diseases).

[0098] Other therapeutics can also be co-delivered with the cytokine or decoy receptor on the same cytokine construct or separately. In examples of this embodiment of the cytokine construct, the delivery system includes a liposome, a lipid-based particle, a polymeric particle, an inorganic or organic nanoparticle or microparticle, or a hybrid thereof. For instance, in various examples the delivery vehicle includes one or more of fullerenes, endohedral metallofullerenes, trimetallic nitride templated endohedral metallofullerenes, single-walled and multi-walled carbon nanotubes, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled and multi-walled boron / nitrate nanotubes, carbon nanotube peapods, carbon nanohorns, carbon nanohorn peapods, liposomes, nanoshells, calcium phosphate, dendrimers, microparticles, quantum dots, superparamagnetic nanoparticles, nanorods, cellulose nanoparticles, silicon, silica and polymer micro- and nano-spheres, silica nanoparticle, silica-shells, biodegradable PLGA micro- and nanospheres, gold nanoparticles, cerium oxide particles, zinc oxide particles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, and / or modified micelles.

[0099] In some embodiment, other therapeutics can be a mitotic inhibitor, a mitotic kinase inhibitor, immune checkpoint inhibitor, an oligonucleotide (e.g., a siRNA or an antisense oligonucleotide), a polynucleotide, a small molecule inhibitor, an adjuvant, or an antibody.

[0100] In examples of the cytokine construct, the mitotic kinase inhibitor includes an inhibitor of at least one of a polo-like kinase (PLK), an Aurora kinase, cyclin-dependent kinase (CDK)1 , CDK2, HASPIN, monopolar spindle 1 kinase (Mps1 ), or a NimA-related kinase (NEK). In various embodiments, the mitotic kinase inhibitor includes one or more of GSK461364, BI2536, Tak960, NMS- P937, BI6727 (volasertib), Chk 1 Kinase Inhibitor LY2603618, prexasertib, AZD7762, AU14022, YK- 4-279, or AZ703.

[0101] In various embodiments, the mitotic inhibitor includes one or more of etoposide, vinorelbine, mitoxantrone, doxorubicin, estramustine, carboplatin, vinblastine, docetaxel, paclitaxel, and cabazitaxel.Filed February 21 , 2025

[0102] In various embodiments, the immune checkpoint inhibitor includes a siRNA, inhibitor, or antibody against one or more of PD-L1 , PD-1 , TIM-3, LAG-3, or CTLA-4. By way of example, the therapeutic agent is an immune checkpoint inhibitor selected from an antibody against PD-L1 , PD-1 , or CTLA-4. In yet more examples, the immune checkpoint inhibitor includes at least one of: nivolumab, pembrolizumab, ipilimumab, tremelimumab, atezolizumab, avelumab, durvalumab, cemiplimab, pidilizumab, or spartalizumab (PDR001 ).

[0103] In certain embodiments, the immune checkpoint inhibitor is an oligonucleotide, a polynucleotide, a small molecule inhibitor, or an antibody. In some embodiments, the mitotic kinase inhibitor is an oligonucleotide, a polynucleotide, a small molecule inhibitor, or an antibody. In some embodiments, the cytokine construct is, or an antibody-oligonucleotide conjugate (Wiener etal. 2020), a small molecule-oligonucleotide conjugate (Winkler, 2013), or a small molecule-small molecule conjugate.

[0104] The cytokine constructs provided herein may optionally further include an adjuvant. It is specifically contemplated that example adjuvants used with the provided cytokine constructs exhibit immunostimulatory activity. By way of example, an adjuvant useful in embodiments of the provided cytokine constructs includes one or more of a STING agonist, CpG oligonucleotide, a DNA TLR agonist containing a CpG sequence, a non-CpG DNA TLR agonist, an RNA TLR agonist, an aluminum salt, an anti-CD40 antibody, a fusion protein, a cytokine, a small molecule TLR agonist, an oil- or surfactant-based adjuvant, a lipopolysaccharide, a plant extract, or a derivative thereof. In specific examples, the adjuvant compound includes a CpG oligonucleotide, imiquimod, resiquimod, gardiquimod, poly IC, poly ICLC, dSLIM, or EnanDIM.

[0105] In some embodiments, the cytokine construct includes a tumor-specific antigen.

[0106] Also provided are compositions that include at least one cytokine construct as described herein. Optionally, such compositions further include at least one pharmaceutically acceptable carrier, excipient, or diluent.

[0107] Another embodiment is a method of treating cancer or other immune-related diseases, which method includes administering to a subject (such as a human subject) with cancer or other immune- related diseases an effective amount of a provided cytokine construct, or a composition containing such a cytokine construct, to reduce one or more symptoms of the cancer or other immune-related diseases.

[0108] Also provided are methods of treating a cell exhibiting symptoms of cancer or other immune- related diseases including contacting the cell with a therapeutically effective amount of a provided therapeutic.

[0109] Also provided are methods of treating cells with a therapeutically effective amount of a provided cytokine construct, or a composition containing such a cytokine construct.

[0110] Also provided are methods that include contacting cells ex vivo with a therapeutically effective amount of a provided cytokine construct, or a composition containing such a cytokine construct.

[0111] In any of the cell-based embodiments, it is contemplated that the cell in some instances is a cancer cell. In other instances, the cell is not a cancer cell. In various embodiments, the cell is anFiled February 21 , 2025 immune cell. Optionally, in any of the cell-based embodiments, the call may be from a human subject (patients or heathy donors), or from another mammalian subject.

[0112] Yet another embodiment is a method of treating a subject diagnosed as having a hyperproliferative disease or condition, which method includes administering to the subject an effective amount of a composition including at least one of the provided cytokine constructs. In various examples of this embodiment, the hyperproliferative disease includes one or more of cancer, precancer, or cancer metastasis. In examples of these methods, the hyperproliferative disease includes one or more of melanoma, lung cancer, breast cancer, colon cancer, pancreatic cancer, brain cancer, prostate cancer, head and neck cancer, kidney cancer, colorectal cancer, ovarian cancer, lymphoma, leukemia, mesothelioma, sarcoma, liver cancer, or other rare cancers / malignancies (Cancer Types, available online at cancer.gov / types, referenced in March, 2024).

[0113] In another embodiment is a method of using cytokine constructs to treat a subject diagnosed as having autoimmune diseases such as Rheumatoid arthritis (RA), Systemic lupus erythematosus (SLE), Type 1 diabetes mellitus, Multiple sclerosis (MS), Psoriasis and psoriatic arthritis, Inflammatory bowel disease (including Crohn's disease and ulcerative colitis), Hashimoto's thyroiditis, Graves' disease, Sjogren's syndrome, Addison's disease, Myasthenia gravis, Autoimmune hepatitis, Pernicious anemia, Vitiligo, Scleroderma, Alopecia areata, Guillain-Barre syndrome, Autoimmune vasculitis, Celiac disease, Antiphospholipid syndrome (APS), Ankylosing spondylitis, Dermatomyositis, Polymyositis, Primary biliary cirrhosis.

[0114] In another embodiment is a method of using cytokine constructs to treat cancer (e.g., Interleukin-2 (IL-2) and Interferon-alpha (IFN-a) constructs), Hepatitis C (e.g., IFN-a construct), Multiple Sclerosis (MS) (e.g., Interferon-beta (IFN-p) construct), Chronic Granulomatous Disease (e.g., Interferon-gamma (IFN-y) constructs), Osteopetrosis (e.g., IFN-y constructs), Hairy Cell Leukemia (e.g. IFN-a constructs), Kaposi's Sarcoma (e.g., IFN-a constructs), and thrombocytopenia (e.g., IL-11 constructs).

[0115] Cytokine constructs containing cytokine decoy receptors can be used to treat various diseases such as Psoriasis and Psoriatic Arthritis, Inflammatory Bowel Disease (IBD) such as Crohn's Disease and Ulcerative Colitis (e.g., with decoy receptors for TNF, IL-12 / 23, IL-17); Rheumatoid Arthritis, Ankylosing Spondylitis and Juvenile Idiopathic Arthritis (e.g., with decoy receptors for TNF); Asthma and Atopic Dermatitis (e.g., with decoy receptors for IL-4, IL-5, and IL-13); Systemic Lupus Erythematosus (SLE), Giant Cell Arteritis, and COVID-19 (e.g., with decoy receptors for IL-6).

[0116] In any of the provided methods of treating a subject, it is contemplated that administration can be by a variety of methods. For instance, in examples of treatment methods, administering includes one or more of: injection to or at a tumor or diseased site in the subject; infusion locally to or at a tumor or diseased site in the subject; systemic injection in the subject; systemic infusion in the subject; topical application to the subject; or other parenteral route of administration. In other examples, administering includes microneedle application.

[0117] Also provided are methods of enhancing effect of an anti-cancer therapy or other therapeutics in a subject (such as a human subject) in need thereof, including administering to a subject in needthereof: an effective amount of a provided cytokine construct, or a composition containing such a cytokine construct; and at least one anti-cancer agent or other therapeutics (e.g., a chemotherapeutic agent, a targeted therapeutic agent, or an immune checkpoint inhibitors). Optionally, the cytokine construct or composition and the anti-cancer therapy or therapy for other immune-related diseases are administered sequentially or concurrently.

[0118] Yet another embodiment is a method of enhancing radiation therapy effect in a subject (such as a human subject) diagnosed as having a neoplasia, including administering to a subject in need thereof: an effective amount of a provided cytokine construct, or a composition containing such a cytokine construct; and at least one radiation therapy. Optionally, the cytokine construct or composition and the radiation therapy are administered sequentially or concurrently.

[0119] As used herein, the term “enhancing,” in the context of the therapeutic effects of an anti-cancer therapy or other therapeutics, refers to an increase in the therapeutic effects of the anti-cancer therapy or other therapeutics (e.g., treatment with an anti-cancer agent, radiation therapy, targeted therapy, or checkpoint immunotherapy) above those normally obtained when the anti-cancer therapy is administered without the cytokine constructs of the disclosure. “An increase in the therapeutic effects” is manifested when there is an acceleration and / or increase in intensity and / or extent of the therapeutic effects obtained with an anti-cancer therapy. It also includes extension of the longevity of therapeutic benefits. It can also manifest where a lower dosage of the anti-cancer therapy is required to obtain the same benefits and / or effects when it is co-administered with the cytokine constructs provided by the present disclosure as when a higher dosage of the anti-cancer therapy is administered alone. The enhancing effect preferably, but not necessarily, results in treatment of acute symptoms for which the anti-cancer therapy alone is not effective or is less effective therapeutically. Enhancement is achieved when there is at least a 10% increase (e.g., at least 25%, at least 50%, at least 75%, or at least 100%) in the therapeutic effects when a cytokine construct of the present disclosure is co-administered with an anti-cancer therapy compared with administration of the anticancer therapy alone.

[0120] Also provided herein is a kit including a cytokine construct described herein and at least one anti-cancer agent or other therapeutic. In some embodiments, the anti-cancer agent or other therapeutic is a chemotherapeutic agent, a targeted therapeutic agent, or an immune check point inhibitor.

[0121] Aspects of the disclosure are now described with additional detail and options to support the teachings of the disclosure, as follows: (I) Cytokines; (II) Cytokine Constructs; (III) Cytokine-Optional Constructs; (IV) Mitotic Kinases and Inhibitors Thereof; (V) Immune Checkpoint Inhibitors; (VI) Optional Additional Component(s); (VII) Delivery Systems; (VIII) Antibodies; (IX) Pharmaceutical Compositions and Administration Formulations; (X) Exemplary Methods of Use; (XI) Kits; (XII) Exemplary Embodiments; (XIII) Examples, and (XIV) Closing Paragraphs.(I) Cytokines

[0122] Cytokines (CK) play significant roles in the immune systems by regulating immune response and inflammation, thereby impacting various diseases ranging from cancer, autoimmune diseases, sepsis, anemia, allergy, etc. Cytokines have been used as therapeutics such as: interferons (IFNs) for treating viral infections and cancer, interleukins (e.g., IL-2, IL-15, IL-12) for treating cancer by activating immune cells that kill cancer cells, such as T cells and natural killer (NK) cells, growth factors such as erythropoietin (EPO) for stimulating the production of red blood cells to treat anemia, granulocyte colony-stimulating factor (G-CSF) for inducing the production of white blood cells (e.g., in cancer patients receiving chemotherapy), and tumor necrosis factor (TNF) for inducing tumor cell death and stimulating anti-cancer immune response. Cytokines typically have short half-life and adverse side effects, limiting their use in clinics. Certain cytokines also have pleiotropic effects and could activate different (occasionally opposing) pathways. Modifying cytokines and / or loading cytokines on nanoparticles in a certain manner can promote cytokine’s intended effects and avoid unintended effects. Intended effects and unintended effects may be defined differently for different indications, as will be described throughout the application as non-exhaustive examples.

[0123] Cytokines may be categorized into various classes, including (I) pro-inflammatory cytokines, such as lnterleukin-1 (IL-1 ), lnterleukin-6 (IL-6), Tumor Necrosis Factor-alpha (TNF-a), lnterleukin-8 (IL-8), Interleukin-12 (IL-12), Interferon-gamma (IFN-y), (II) anti-inflammatory cytokines such as Interleukin-10 (IL-10), Transforming Growth Factor-beta (TGF-p), lnterleukin-4 (IL-4), Interleukin-13 (IL-13), (III) chemokines such as C-C Motif Chemokine Ligand 2 (CCL2 / MCP-1 ), CXCL8 (IL-8), C-X- C Motif Chemokine Ligand 10 (CXCL10 / IP-10), (IV) Colony-Stimulating Factors (CSFs) such as Granulocyte Colony-Stimulating Factor (G-CSF), Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF), Macrophage Colony-Stimulating Factor (M-CSF), (V) Interferons (IFNs) such as Interferon-alpha (IFN-a), Interferon-beta (IFN-p), Interferon-gamma (IFN-y), (VI) Growth Factors such as Epidermal Growth Factor (EGF), Vascular Endothelial Growth Factor (VEGF), Fibroblast Growth Factors (FGFs), and (VII) Tumor Necrosis Factors (TNFs) such as Tumor Necrosis Factor-alpha (TNF-a), Lymphotoxin-alpha (LT-a). Some cytokines belong to more than one class. More examples of cytokines, their roles, sources of cells, and target cells can be found in Poster of Human Cytokines and Chemokines (Cell Sources, Cell Targets and Major Functions by Sino Biological, Accessed in 01 / 2024). All these known cytokines can be utilized in the disclosed technology herein.

[0124] Cytokines may be categorized into various molecular weights (MW). Examples of Low MW (<30 kDa) cytokines include Epidermal Growth Factor (EGF), lnterleukin-1 p (IL-1 p), lnterleukin-2 (IL- 2), lnterleukin-4 (IL-4), lnterleukin-6 (IL-6), lnterleukin-7 (IL-7), Interleukin-10 (IL-10), interferon-alpha (IFN-a), and Interferon-beta (IFN-p), and Tumor Necrosis Factor-alpha (TNF-a). Examples of high MW (>30 kDa) cytokines include Interferon-gamma (IFN-y), lnterleukin-5 (IL-5), and Interleukin-12 (IL-12) including p35 (approximately 35 kDa) and p40 (approximately 40 kDa) subunits. Some cytokines can come in many isoforms. For example, Interleukin-17 (IL-17) has a subunit of approximately 20 kDa, but can form dimers to MW of around 40 kDa. Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF) is approximately 22 kDa, but can form dimers. MacrophageColony-Stimulating Factor (M-CSF) can exist in several forms; and its dimeric form can be around 70- 90 kDa. Likewise, Vascular Endothelial Growth Factor (VEGF) can exist in multiple isoforms, with MWs ranging from 18 kDa to 45 kDa. Cytokines of > 80 kDa are less common, but some examples include chemokine C-X3-C motif ligand 1 (CXCL1 ) and C-reactive protein (CRP). More information on MW of cytokines can be found in (Poster of Human Cytokines and Chemokines - Cell Sources, Cell Targets and Major Functions by Sino Biological, Accessed in 01 / 2024), and Longphre eta!., 1999.

[0125] Cytokines can be used as therapy or to improve therapy involving T cells, NK, Stem cells, B cells, neutrophils, monocytes, macrophages, dendritic cells, other antigen presenting cells (APCs), and other immune cells via ex vivo expansion and activation of the cells before they are infused into patients and in vivo by stimulating their survival, expansion, and activities. Likewise, adoptive cell therapy such as CAR-T, CAR-Macrophages, CAR-NK-cells, CAR-Neutrophils can also benefit from cytokine therapy.

[0126] Cytokines can be used as therapy or to improve therapy involving T cells such as cytotoxic (CD8+) T cells, regulatory T cells (Tregs), and adoptive cell transfer (ACT) therapy. ACT such as CAR-T (Chimeric Antigen Receptor T) cell therapy and TCR (T Cell Receptor)-engineered T cell therapy involves the modification of T cells to recognize and attack cancer cells. Cytokines are used in various stages of T cell therapy, from the activation and expansion of T cells in vitro (e.g., IL-2, IL- 7, IL-15, IL-12) to the modulation of the immune response in vivo post-infusion (e.g., IL-2, IL-12, IFN- y). Cytokines such as IL-7 and IL-15 can be used to support T cell persistence and long-term survival of infused T cells, while cytokines such as IL-12 can be used to modulate the tumor microenvironment enhancing antitumor immune response of infused T cells by recruiting and activating innate and adaptive immune cells.

[0127] Among cytokines, interleukin-2 (IL-2) is potent at proliferating T cells and has been FDA approved for treating metastatic melanoma and renal cell carcinoma (List of Products by lovance Biotherapeutics, Accessed 05 / 2023). However, IL-2 not only proliferates CD8+ T cells, but also activates regulatory T cells (Treg) at lower concentration since Treg has receptors with stronger affinity to IL-2 than CD8+ T cells. This is undesirable for cancer therapy since Treg can inhibit CD8+ T cell function (de Picciotto etal., 2022; Li et al., 2020). Current IL-2 has a short circulation half-life of only 1 .5 hours in patients due to its small size and is rapidly cleared by the kidneys (List of Products by lovance Biotherapeutics, Accessed 05 / 2023). To achieve optimal immunomodulatory effect, high dosage and frequent dosings of IL-2 are used, but associated with severe toxicity (Jiang et al., 2016), limiting its use in clinics. To overcome these limitations, IL-2-based cancer immunotherapy has been a subject of intense drug development and multi-billion-dollar investments (Satyanarayana M., “IL-2 treatment can be dangerous. Here’s how drug firms are trying to fix it.” by C&EN, accessed 05 / 2023). Some candidates are based on engineering IL-2 to increase the binding affinity to CD8+ T cells over Tregs (Lopes etal., 2020; Naing etal., 2021 ; Study Details provided by Neoleukin Therapeutics, Inc., accessed 06 / 2023; Ptacin et al., 2021 ). Others employ fusion of IL-2 and PD-L1 or PD-1 antibody for targeted delivery to cancer and T cells, respectively (Codarri et al., 2022; Chen et al., 2016). A recent strategy incorporated polyethylene glycol (PEG) to extend circulation half-life of IL-2; however, it failedin late-stage clinical trials due to inferior efficacy compared to standard-of-care (Update on Phase 3 PIVOT 10-001 Trial announced by Bristol Myers Squibb, 2022). Other research groups have engineered hydrogels for IL-2 delivery, which could prolong half-life of IL-2, but they did not improve the proliferation of CD8+ T cells over Tregs (Xiong et al., 2023; Liu et al., 2022). IL-2 encapsulated inside the pores of large silica nanoparticles (BALLkine-2) (Kim et al., 2022), but did not result in any cure in mouse tumor models when combined with immune checkpoint inhibitor. IL-2 conjugated starch nanocapsules have also been attempted to proliferate CD4+ T cells, but achieved loading of only 180 to 1 ,660 IL-2 molecules per nanocapsule (Frick et al., 2016).

[0128] Regulatory T cells, also known as Tregs, play a crucial role in maintaining immune system balance by suppressing immune responses. When Treg function is not properly regulated, it can lead to a variety of diseases. For example, autoimmune diseases such as Type 1 diabetes, multiple sclerosis (MS), rheumatoid arthritis (RA), and systemic lupus erythematosus (SLE) occur when Tregs fail to suppress the immune response effectively and the immune system can attack the body's own tissues. Allergic diseases such as asthma atopic dermatitis (Eczema) occur when there are dysfunction or insufficient numbers of Tregs to control allergic response.

[0129] In cancer, Tregs can suppress anti-tumor immunity, allowing cancer cells to grow and spread more easily. High levels of Tregs in the tumor microenvironment are often associated with poorer prognoses in various cancers, such as breast cancer, ovarian cancer, and melanoma.

[0130] In infectious diseases, by suppressing immune responses, Tregs can help control inflammation and prevent tissue damage but can also hinder the clearance of pathogens, contributing to chronic infections such as HIV and Hepatitis B and C.

[0131] After allogeneic bone marrow or stem cell transplants, donor T cells can attack the recipient’s body tissues, causing Graft-versus-host disease (GvHD). Tregs can suppress this immune response, potentially preventing or treating GvHD.

[0132] Inflammatory bowel disease (IBD) including Crohn's disease and ulcerative colitis, where improper immune response leads to inflammation of the gastrointestinal tract. Tregs are involved in maintaining tolerance to gut antigens and regulating inflammatory responses in the gut.

[0133] Important cytokines for the development, function, and maintenance of Tregs include lnterleukin-2 (IL-2), Transforming Growth Factor-beta (TGF-p), Interleukin-10 (IL-10), and Interleukin- 35 (IL-35). IL-2 signaling promotes the survival and expansion of Tregs and enhances their suppressive capabilities. TGF-p plays a critical role in the differentiation of naive CD4+ T cells into Tregs and contributes to the maintenance of Treg function. IL-10 is an anti-inflammatory cytokine that plays a role in the suppressive function of Tregs, helping to limit immune responses and prevent tissue damage during inflammation and infection. IL-10 production by Tregs is crucial for their ability to suppress effector T cell responses and maintain immune homeostasis. IL-35 is a cytokine produced by Tregs and is essential for their suppressive activity. It contributes to the immunosuppressive environment by inhibiting T cell proliferation and effector functions, further promoting Treg-mediated immune tolerance. These cytokines and / or their decoy receptors can potentially be used to treat the aforementioned Treg-related diseases.

[0134] Cytokines can be used as therapy or to improve therapy involving NK cells ex vivo and in vivo. Examples of cytokines involved in NK cell therapy include lnterleukin-2 (IL-2) for the proliferation and activation of NK cells, Interleukin-15 (IL-15) for the development, survival, and function of NK cells, Interleukin-12 (IL-12) and Interleukin-18 (IL-18) for enhancing the cytotoxic activity of NK cells and inducing the production of IFN-y (interferon-gamma), which further stimulates NK cell activity, IL-21 can promote survival and cytotoxic activity of NK cells, and enhance the expansion and function of NK cells in combination with cytokines such as IL-15.

[0135] Cytokine can be used as therapy or to improve therapy involving stem cells ex vivo and in vivo. Common types of stem cells that can be treated with cytokine constructs include totipotent stem cells; pluripotent stem cells such as embryonic stem cells (ESCs), and induced pluripotent stem cells (iPSCs); multipotent stem cells such as hematopoietic stem cells (HSCs) and mesenchymal stem cells (MSCs); Oligopotent stem cells such as myeloid stem cells; Unipotent stem cells such as muscle stem cells and induced pluripotent stem cells (IPSCs); Cancer stem cells; Tissue-specific stem cells such as neural stem cells, skin stem cells, intestinal stem cells. Cytokines play crucial roles in regulating stem cells' self-renewal, differentiation, migration, and survival. Examples of important cytokines for regulating hematopoietic stem cells (HSCs) include Stem Cell Factor (SCF), Granulocyte Colony-Stimulating Factor (G-CSF), Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF), lnterleukin-3 (IL-3), lnterleukin-6 (IL-6), and Thrombopoietin (TPO). For regulating mesenchymal stem cells (MSCs), examples of important cytokines include Transforming Growth Factor-beta (TGF-p), Fibroblast Growth Factors (FGFs), and lnterleukin-6 (IL-6). For neural stem cells (NSCs), examples of important cytokines include Epidermal Growth Factor (EGF), Fibroblast Growth Factor-2 (FGF-2), Ciliary Neurotrophic Factor (CNTF), Brain-Derived Neurotrophic Factor (BDNF). Cytokines such as TGF-p and Bone Morphogenetic Proteins (BMPs) are involved in the maintenance of stem cell niches, self-renewal, and differentiation. Inflammatory cytokines, such as TNF-a and IL-1 p, can influence stem cell behavior during tissue injury and inflammation and promote tissue regeneration. Chemokines, a subset of cytokines, can regulate the migration of stem cells to sites of injury or inflammation, helping with tissue repair. Cytokines may also be used for differentiation of islet stem cells into functional islet cells. Example include IL-6 for proliferation and differentiation of pancreatic progenitor cells into insulin-producing beta cells, Fibroblast Growth Factor (FGF) (e.g., FGF10 and FGF7) for the development and differentiation of pancreatic cells, including islet cells, Transforming Growth Factor-beta (TGF-p) for the islet development, function, and differentiation of progenitor cells into islet cells, Epidermal Growth Factor (EGF) for promoting the proliferation and differentiation of pancreatic progenitor cells into islet cells, Ciliary Neurotrophic Factor (CNTF) for protective effects on islet cells and promoting the regeneration of beta cells, and Hepatocyte Growth Factor (HGF) for stimulating the proliferation and differentiation of pancreatic progenitor cells into islet cells.

[0136] Cytokines can be used as therapy or to improve therapy involving B cells. Some cytokines such as lnterleukin-4 (IL-4) and Interleukin-21 (IL-21 ) promote B cell proliferation, differentiation, and antibody production, benefiting vaccination. Some cytokines such as BAFF (B cel I -activating factor) and APRIL (a proliferation-inducing ligand) support B cell survival and differentiation, benefitingimmunodeficiency disorders. Cytokines like Interleukin-10 (IL-10) and Transforming Growth Factorbeta (TGF-p) can be therapeutically used to suppress B cell activity, benefiting autoimmune diseases where B cells produce autoantibodies. In cancers involving B cells, like Non-Hodgkin's Lymphoma and Chronic Lymphocytic Leukemia (CLL), cytokine therapies might aim to either boost the immune response (T cells and NK cells) against cancerous B cells or directly suppress the malignant B cells. In chronic infections, cytokine therapy might aim to enhance B cell-mediated antibody responses to clear pathogens. For example, cytokines that promote B cell differentiation and antibody production can be beneficial in creating a more effective immune response against chronic viral or bacterial infections.

[0137] Cytokines can be used as therapy or to improve therapy involving antigen presenting cells (APCs). Cytokines also play roles in enhancing or suppressing APCs such as dendritic cells (DCs) (e.g., GM-CSF, IL-4, IL-12, TNF-ct), macrophages (e.g., IFN-y, IL-4, IL-13, IL-1 ), and B cells (e.g., IL- 4, IL-5, IL-6, IL-21 ).(II) Cytokine Constructs

[0138] Described herein is a new class of cytokine therapeutics (generally, “cytokine constructs”) that includes an engineered particle which delivers at least a cytokine and / or a decoy receptor. The cytokine constructs may also include additional therapeutics such as chemotherapeutics, small molecule inhibitors, antibodies, immune checkpoint inhibitors, oligos, adjuvants, and / or antigens. The cytokine can be present at 0.01 wt.% to 50 wt.% of the cytokine construct (e.g., 0.01 to 0.5 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, 0.5 to 1 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, 10 to 20 wt.%, 10 to 30 wt.%, 10 to 40 wt.%, 10 to 50 wt.%), and the other therapeutics can be present at 0.01 wt.% to 50 wt.% (e.g., 0.01 to 0.5 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, 0.5 to 1 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, 10 to 20 wt.%, 10 to 30 wt.%, 10 to 40 wt.%, 10 to 50 wt.%). These cytokine constructs reduce the doses required to achieve the efficacy (e.g., by ten-fold for IL2-NP), allowing the drugs to be given together without reaching their dose-limiting toxicity.

[0139] In some embodiment, cytokine constructs create adaptive immunity that enhances tumor inhibition and development at local (treated) and distant (non-treated) sites (e.g., metastasis), and survival of the treated subject. Once treated with the cytokine constructs, cancer undergoes cell death, while the surviving cells may overexpress immune checkpoint molecules such as PD-L1 , upon immune activation. This enables more targeted delivery of the constructs (containing PD-L1 -antibody) to the remaining cancers, that otherwise may not have significant expression of receptors for targeted delivery, in a feed-forward manner. The cytokine constructs are also applicable to broad cancer types.

[0140] Cytokines may be linked to anti-cancer agents, other therapeutics, or on the cytokine construct via chemical linkers. The chemical linker may include one or more a hydrazine; a disulfide; N- succinimidyl-4-(2-pyridyldithio)butanoate; N-succinimidyl-4-(2-pyridyldithio)-2-sulfo butanoate; perfluorophenyl 3-(pyridin-2-yldisulfanyl)propanoate; 2,5-dioxopyrrolidin-1 -yl 3-methyl-3-(pyridin-2-yldisulfanyl)butanoate; Gly-Phe-Leu-Gly; Ala-Leu-Ala-Leu; Val-Cit; Phe-Lys; Val-Ala; Ala-Phe-Lys; Phe-Lys; (Gly)n, wherein n is 1 -20; a p-glucuronide linker; maleimidocaproyl; N- (maleimidomethyl)cyclohexane-l -carboxylate; 4-(4-acetylphenoxy)butanoic acid; dibromomaleimide; para-aminobenzoic acid; 4-nitrophenol; acetic acid; formic acid; 4-maleimidobutyric acid N- succinimidyl ester; N-(4-maleimidobutyryloxy)succinimide; N-(6-maleimidocaproyloxy)succinimide; 3- maleimidopropionic acid N-succinimidyl ester; N-(3-maleimidopropionyloxy)succinimide; 5- maleimidovalericacid-NHS; linear, branched, or multi-arm polyethylene glycol having a molecular weight of 100-10000 Da; propargyl-N-hydroxysuccinimidyl ester; pyrophosphate; succimimidyl-4- azidobutyrate; 4-azidobenzoic acid N-hydroxysuccinimide ester; tert-butyl 1 -(4-formylphenyl)-1 -oxo- 5,8,1 1 -trioxa-2-azatridecan-13-oate; or a residue thereof. In some embodiments, the chemical linker includes N-(maleimidomethyl)cyclohexane-1 -carboxylate or a residue thereof {e.g., sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1 -carboxylate). In some embodiments, the chemical linker includes a polyethyleneglycol {e.g. a linear polyethyleneglycol) having a molecular weight of 100- 10000 Da or 5 kDa, or a residue thereof.

[0141] This strategy will have many key features; they are efficacious, safe due to lower doses needed (vs. free drug counterparts), durable because they train and harness body immune cells to attack cancer or diseased cells with memory effects, applicable to many types of cancer or diseased cells, and can be given both locally for easily accessible tumors or other diseased sites, and systemically for deeper tumors, metastatic tumors, and other immune-related diseases.

[0142] In some embodiments, cytokine constructs may dampen the inflammation and immune response, and promote tissue repairs to treat certain immune-related diseases. In some embodiments, cytokine constructs may stimulate immune response to treat certain immune-related diseases.

[0143] In some cases, the cytokine construct may include more than one type of cytokines {e.g., IL-2 + IFN-a; IL-12 + IL-18) for enhanced effects in cancer and infectious diseases. The cytokine construct containing IL-17 and TNF can be useful for other immune-related diseases. Inhibitors against IL-17 and TNF {e.g., siRNA or decoy receptors) can be used to treat cancer and infectious diseases.

[0144] Examples of cytokines non-exhaustively include Interleukins {e.g., IL-1 , IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-1 1 , IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21 , IL- 22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31 , IL-32, IL-33, IL-34, IL-35, IL-36, IL-37, IL-38, and IL-39), Interferons (IFNs) {e.g., IFN-a (alpha), IFN-p (beta), IFN-y (gamma), and IFN-A (lambda)), Tumor Necrosis Factors (TNFs) {e.g., TNF-a (alpha) and TNF-p (beta)), CXC chemokines {e.g., CXCL1 , CXCL8, CXCL10), CC chemokines {e.g., CCL2, CCL3, CCL5), C chemokines {e.g., XCL1 ), CX3C chemokines {e.g., CX3CL1 ), Growth factors {e.g., include Epidermal Growth Factor (EGF), Platelet-Derived Growth Factor (PDGF), Vascular Endothelial Growth Factor (VEGF), Fibroblast Growth Factors (FGFs), and Transforming Growth Factor-p (TGF-P)), and others {e.g., Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF), Granulocyte Colony-Stimulating Factor (G-CSF), Macrophage Colony-Stimulating Factor (M-CSF), Osteopontin, and Lymphotoxin).(III) Cytokine-Optional Constructs

[0145] Also described are embodiments of constructs that do not necessarily include a cytokine, which may be referred to as cytokine-optional constructs. These include for instance constructs in which oligonucleotides or any other therapeutic(s) listed in this application can be loaded onto constructs separately from a cytokine (which may be included in a construct), or given separately. Other therapeutics can also be co-delivered with the cytokine or decoy receptor on the same cytokine construct or separately, including on a different construct that does not include a cytokine. Cytokine- optional constructs may consist of an antibody (e.g., an immune checkpoint inhibitor against PD-1 and PD-L1 ), an anti-cancer agent or immunogenic cell death agent (e.g., PLK1 inhibitor volasertib, paclitaxel, docetaxel, platinum based chemotherapy, siRNA) and adjuvants (e.g., STING agonist, TLR9 agonist CpG). Example is shown in FIG. 1 1 , in which A-PLK1 i / STING-NP (NP containing 5 wt.% avelumab, 2 wt.% volasertib, and 5 wt.% ADU-S100) was used successfully at inhibiting tumors. Optionally, NP containing PD-L1 antibody atezolizumab and CpG 1018 or a STING agonist or other adjuvants; e.g., paragraph

[0190] -

[0201] , can also be used without volasertib.

[0146] Optionally, nanoparticles (MSNP coated with PEI and PEG, similar to Table 2) loaded with an adjuvant, including RIG-I agonists, CpG, cyclic di-GMP (cdG), or ADU-S100, have been successfully developed in our lab. Specifically, the adjuvants (CpG, cdG, or ADU-S100) were loaded onto the nanoparticles electrostatically at 5 wt.% of the nanoparticles by mixing them with the respective agonists in PBS (pH 7.2). 5’ triphosphate hairpin RNA (a RIG-I agonist) was similarly loaded onto the nanoparticles at 2 wt.% in PBS. All adjuvants were loaded with near-complete efficiency (>94%, measured with Nanodrop Spectrophotometer). The sizes of the resulting constructs are provided in FIG. 10. The size of the RIG-I agonist-loaded NP was 126.6 nm. To assess the ability of these constructs to activate dendritic cells in vivo, a single dose of each was administered to C57BL / 6 mice (n=4-5) via injection in both rear footpads (100 pg of nanoparticles per injection, totaling 200 pg). Draining lymph nodes were harvested 48 hours post-treatment and processed into single cells for flow cytometry analysis. It was found that all constructs induced dendritic cell activation (i.e. CD80+ MHC-II+ dendritic cells (CD1 1c+)) at a rate 5-6 times greater than the saline-treated group (50-60% vs. 10%, p-value < 0.05).(IV) Mitotic Kinases and Inhibitors Thereof

[0147] Cancer is characterized by uncontrolled cell reproduction. Mitosis is a stage in the cell cycle during which a series of complex events ensure the fidelity of chromosome separation into two daughter cells. Several current cancer therapies, including taxanes and vinca alkaloids, act to inhibit the mitotic machinery. Mitotic progression is largely regulated by proteolysis and by phosphorylation events that are mediated by mitotic kinases. Aurora kinase family members e.g., Aurora A, Aurora B, Aurora C) regulate mitotic progression through modulation of centrosome separation, spindle dynamics, spindle assembly checkpoint, chromosome alignment, and cytokinesis (Dutertre et al., 2002; Berdnik et al., 2002). Overexpression and / or amplification of Aurora kinases have been linked to oncogenesis in several tumor types including those of colon and breast (Warner et al., 2003;Bischoff et al, 1998; Sen et al., 2002). Moreover, Aurora kinase inhibition in tumor cells results in mitotic arrest and apoptosis, suggesting that these kinases are important targets for cancer therapy (Ditchfield, 2003; Harrington et al., 2004).

[0148] Mitotic Kinases: In particular embodiments, mitotic kinases include kinases in the Aurora family of serine / threonine kinases essential for cell proliferation (Bischoff & Plowman, 1999; Giet & Prigent, 1999; Nigg, 2001 ; Adams et al., 2001 ). Since its discovery in 1997 the mammalian Aurora kinase family has been closely linked to tumorigenesis. The most compelling evidence for this is that overexpression of Aurora-A transforms rodent fibroblasts (Bischoff et al., 1998). Inhibitors of the Aurora kinase family therefore have the potential to block growth of all tumor types.

[0149] The three known mammalian family members, Aurora-A (“1 ”), B (“2”) and C (“3”), are highly homologous proteins responsible for chromosome segregation, mitotic spindle function and cytokinesis. They are highly conserved in the C-terminal region, where the kinase domain is located, and show sequence differences in the N-terminal domain. Aurora expression is low or undetectable in resting cells, with expression and activity peaking during the G2 and mitotic phases in cycling cells. In mammalian cells proposed substrates for Aurora include histone H3, a protein involved in chromosome condensation, and CENP-A, myosin II regulatory light chain, protein phosphatase 1 , TPX2, all of which are required for cell division.

[0150] Aurora B is expressed between the late G2-phase and telophase. It is located in the inner centromere region and in the spindle middle zone. It regulates the orientation of the chromosomes at the metaphase plate and corrects wrong kinetochore-microtubule interactions. It phosphorylates histone H3, which allows the histone to interact with the DNA. This is important for the following chromosome condensation. Aurora C shows high sequence homologies with Aurora B and has functions in the meiosis.

[0151] As used herein, the term “Aurora A kinase” refers to a serine / threonine kinase involved in mitotic progression. Aurora A kinase is also known as AIK, ARK1 , AURA, BTAK, STK6, STK7, STK15, AURORA2, MGC34538, and AURKA. A variety of cellular proteins that play a role in cell division are substrates for phosphorylation by the Aurora A kinase enzyme, including, TPX-2, XIEg5 (in Xenopus), and D-TACC (in Drosophila). The Aurora A kinase enzyme is also itself a substrate for autophosphorylation, e.g., at Thr288. In some instances, the Aurora A kinase is a human Aurora A kinase.

[0152] In particular embodiments, mitotic kinases include Polo-like kinases (“PLKs”). PLKs, including polo-like kinase 1 (“PLK1”), polo-like kinase 2 (“PLK2”), polo-like kinase 3 (“PLK3”) and polo-like kinase 4 (“PLK4”), are involved in the formation and changes in the mitotic spindle and in the activation of CDK / cyclin complexes during mitosis (Strebhardt & Ullrich, 2006). PLKs are overexpressed in tumors, and the overexpression is associated with a poor prognosis and lower overall survival. Therefore, inhibitors of PLKs have been developed as cancer drug therapies.

[0153] In particular embodiments, mitotic kinases include cyclin-dependent protein kinases (CDKs). CDKs are regulators of the timing and coordination of eukaryotic cell cycle events (Norbury & Nurse, 1992; Sher, 1996). As such, CDKs, their regulators, and their substrates are the targets of geneticalterations in many human cancers (Kamb etal., 1994; Nobori etal., 1994; Spruck etal., 1994; Hunter & Pines, 1991 ; Keyomarsi & Pardee, 1993; Wang, 1994). Members of the cyclin dependent kinase family include Cdk2 and Cdk4. Both are active in the G1 phase of cell cycle and regulate entry into the G1 / S phase transition. In one pathway, these kinases regulate the phosphorylation of the retinoblastoma protein. Substrate phosphorylation releases the E2F transcription factor which in turn regulates the expression of genes required for S phase entry. Inhibition of these kinases, therefore, blocks cell entry into the S phase and downstream proliferative events.

[0154] In particular embodiments, mitotic kinases include monopolar spindle 1 (MPS1 ) kinase. MPS1 kinase, also known as TTK, is a dual serine / threonine kinase that controls chromosome alignment and influences the stability of the kinetochore-microtubule interaction as a key regulator of the spindle assembly checkpoint (SAC). SAC is essential for proper chromosomal alignment and segregation. MPS1 is expressed only in proliferating cells and is activated upon phosphorylation during mitosis, where it is required for proper kinetochore recruitment of essential SAC proteins such as Mad1 (mitotic arrest deficient protein 1 ) and Mad2 (mitotic arrest deficient protein 2). MPS1 is also overexpressed in a wide range of human tumors and is necessary for tumor cell proliferation.

[0155] In particular embodiments, mitotic kinases include Nek ((never in mitosis gene a)-related kinase) 2. Nek2 is a serine / threonine kinase that localizes to the centrosome and regulates spindle pole organization and separation through phosphorylation of substrates including C-Nap1 (nucleosome assembly protein-1 ), rootletin, and Nip (ninein-like protein). In addition to its centrosomal role, Nek2 has also been implicated in chromatin condensation and spindle checkpoint control. Nek2 expression and activity are tightly regulated in a cell cycle dependent manner. Expression levels are low in G1 and increased in S / G2. Nek2 is abnormally expressed in cancer cells.

[0156] In particular embodiments, mitotic kinases include Wee1 kinase. Wee1 kinase is a mitotic inhibitor and maintains G2-cell-cycle checkpoint arrest for pre-mitotic DNA repair. Wee1 is overexpressed in cancers such as advanced hepatocellular carcinoma, breast cancer, colon cancer, lung carcinoma, seminoma, and glioblastoma, and its expression correlated with patient survival in mantle cell lymphoma.

[0157] One of ordinary skill in the art will understand how to access representative sequences for mitotic kinases, which are readily available in public sequence databases. The following table provides sample sequence information:

[0158] Mitotic Kinase Inhibitors: Examples of mitotic kinase inhibitors include inhibitors for PLK1 (e.g., GSK461364, BI2536, Tak960, NMS-P937, BI6727 or volasertib), PLK2, PLK3, PLK4, Aurora kinases 1 / 2 (e.g., alisertib), CDK1 / 2, CHK1 / 2 (e.g., AZD7762, prexasertib), BUB1 , BUBR1 , MPS1 , NEK2, HASPIN (Schmit et al., Mol Cancer Ther. 6(7):1920-31 , 2007). These mitotic kinases can be targeted with small molecule inhibitors, oligonucleotides (e.g., siRNA, miRNA, antisense oligonucleotides), and / or antibodies, all are contemplated in this application.

[0159] Non-specific Aurora A inhibitors include: MLN8054 (Millennium Pharmaceuticals, Cambridge, MA; Jones etal., 2007); MK-0457 (VX-680; Harrington etal., Nat Med 0(3) 262-267, 2004); SU6668 (Sugen; Lapenna & Giordano, Nature Rev Drug Discovery 8: 547-566, 2009, and supplementary information); and ZM447439, an inhibitor based on the quinazoline scaffold (Girdler etal., J. Cell Sci., 1 19, 3664-3675, 2006).

[0160] In particular embodiments, selective inhibitors of Aurora A kinase include: compounds disclosed in, for example, US 2008 / 0045501 , US 7,572,784, WO 2005 / 11 1039, WO 2008 / 021038, US 7,718,648, WO 2008 / 063525, US 2008 / 0167292, US 8,026,246, WO 2010 / 134965, US 2010 / 0310651 , WO 201 1 / 014248, US 201 1 / 0039826, and US 201 1 / 0245234; sodium 4- {[9-chloro-7- (2-fluoro-6-methoxyphenyl)-5H-pyrimido[5,4-(i][2]benzazepin-2-yl]amino}-2-methoxybenzoate; KW- 2449 (Kyowa Hakko), ENMD-2076 (ENMD-981693; EntreMed); and MK-5108 (Vertex / Merck).

[0161] Other Aurora kinase inhibitors include: Hesperadin (Hauf et al., 2003), AZD1152 (quinazoline prodrug, active metabolite is AZD-1152-HQPA; AstraZeneca, Cambridge, UK; Schellens et a / ., 2006; Yang et al., 2007), MLN8237 (Alisertib, selective, competitive, and reversible small-molecule inhibitor of Aurora A kinase; Millennium Pharmaceuticals, Cambridge, MA; Gorgun et al., 2010; Friedberg et al., 2014); CYC-1 16 (Cyclapolin 1 ; Cyclacel Ltd., Cambridge, UK; Taylor & Peters, 2008); AS-703569 (R-763; Rigel Pharmaceuticals, San Francisco, CA); AT9283 (Astex; Howard et al., 2009); PHA- 739358 (3-aminopyrazole derivative; Nerviano Medical Sciences; Carpinelli et al., 2007); PHA- 680632 (Soncini et al., 2006); SNS-314 (Sunesis Pharmaceuticals, San Francisco, CA; Lapenna & Giordano, 2009, and supplementary information); and PF-3814735 (Bhattacharya et al., 2008). Reviewed in Gautschi et a!., 2008. WO 01 / 21596 describes quinazoline derivatives to inhibit aurora- 2 kinase. More than 30 small molecule Aurora kinase inhibitors are in different stages of preclinical and clinical development (Lapenna & Giordano, 2009, and supplementary information; Kollareddy et al., 2012).

[0162] A cell cycle inhibitor, JNJ-7706621 , shows potent inhibition of several cyclin-dependent kinases (CDKs) and Aurora kinases, and selectively blocks proliferation of tumor cells of various origins. At low concentrations, JNJ-7706621 slows the growth of cells and at high concentrations induces cytotoxicity. JNJ-7706621 treatment of cells has shown a delayed progression through G1 of the cell cycle and an arrest of the cell cycle at the G2-M phase (Emanuel etal., 2005).

[0163] Inhibitors of CDKs are described in, for example, EP1244668, EP1507780, EP153976, EP1590341 EP1615926, WO 03 / 63764, US 6,107,305, US 6,413,974, WO 1999 / 02162, WO 2000 / 12486, WO 2000 / 39101 , WO 2001 / 14375, WO 2002 / 10162, WO 2002 / 04429, WO 2002 / 096888, and WO 2003 / 7076437. A number of adenosine 5'-triphosphate (ATP) competitive small organic molecules as well as peptides have been reported in the literature as CDK inhibitors for the potential treatment of cancers.

[0164] Small molecular cyclin dependent kinase inhibitors are also described in: Glab et al., 1994; Kitagawa etal., 1993; Losiewicz et al., 1994; Carlson etal., 1996; Kelland, 2000; Senderowicz, 1999; and Vassilev et al., 2006. In particular embodiments, CDK inhibitors can include: flavopiridol (Senderowicz, 1999); olomoucine (Vesely et al., 1994); roscovitine (Meijer et al., 1997); CDKi-277 (Amgen, Thousand Oaks, CA; Payton et al., 2006); RO-3306 (Vassilev et al., 2006); purvalanol A (Villerbu et al., 2002); NU6140 (Pennati et al., 2005); S-CR8 (Bettayeb et al., 2008a); N-&-N1 (GP0210; Greenpharma S.A.S., Orleans, France; Bettayeb etal., 2008b); AZ703 (AstraZeneca; Byth ef al., 2006); JNJ-7706621 (Emanuel et al., 2005); RGB-286199 (GPC Biotech AG, Planegg, Germany; Wang et al., 2005); and SNS-032 (Sunesis Pharmaceuticals, San Francisco, CA; Choong et al., 2008; Fan et al., 2008).

[0165] Polo-like kinase inhibitors include: Scytonemin (Stevenson et al., 2002); Wortmannin (Liu et al., 2005); ON-01910 (or ON 01910. Na; multitargeted intravenous cell cycle inhibitor; Onconova Therapeutics Inc., Newtown, PA; Gumireddy et al., 2005); BI-2536 (an ATP-competitive inhibitor of PLK1 ; Boehringer Ingelheim, Ingelheim, Germany; Steegmaier et al., 2007); Bl 6727 (dihydropteridinone derivative inhibitor of PLK; Boehringer Ingelheim, Ingelheim, Germany; Rudolphetal., 2009; GSK-61364 (or GSK-461364A; selective intravenous thiophene amide inhibitor of PLK1 ); HMN-214 (oral stilbene derivative inhibitor of PLK1 ; prodrug of the active agent HMN-176; Nippon Shinyaku Co. Ltd, Kyoto, Japan; Garland et al., 2006); ZK-thiazolidinone (TAL; ATP-competitive inhibitor of PLK1 ; Bayer Schering Pharma AG, Berlin, Germany; Santamaria et al., 2007); NMS-1 (an orally available selective PLK1 inhibitor; Nerviano Medical Sciences, Milano, Italy; Beria et al. 2008); CYC-800 (a benzthiazole-3-oxide derivative selective PLK1 inhibitor; Cyclacel Ltd., Cambridge, UK; Mclnnes et al., 2005); DAP-81 (a diaminopyrimidine derivative that targets PLKs; Rockefeller University, New York; Peters etal., 2006); LC-445 (a specific non-ATP competitive allosteric inhibitor of PLKS; Avalon Pharmaceuticals, Germantown, MD; Horrigan etal. 2008); centrinone (LCR-263) and centrinone-B (LCR-323) (inhibitors of PLK4; Wong et al., 2015). PLK inhibitors are described in Schoffski, 2009.

[0166] Inhibitors of MPS1 kinase include NMS-P715 (a pyrazolo-quinazoline; Colombo et al., 2010); Mps-1 -IN-1 and Mps1 -IN-2 (Kwiatkowski et al., 2010; Mps-1 -IN-3 (Bakhos et al., 2013); and MPI- 0479605 (Tardif et al., 201 1 ).

[0167] In particular embodiments, a mitotic kinase inhibitor includes aminopyrazine inhibitors of Nek2 (Whelligan etal., 2010).

[0168] Inhibitors of Wee1 kinase include PD0166285 (pyrido-pyrimidine derivative that is a nonselective inhibitor of WEE1 ); PD0407824 (pyrrolo-carbazole derivative that is a more selective inhibitor of WEE1 ); WEE1 inhibitor II (pyrrolo-carbazole derivative); and 4-(2-phenyl)-9- hydroxypyrrolo[3,4-c]-carbazole-1 ,3-(2H,6H)-dione (PHCD) in De Witt Hamer et al., 2011 ; Palmer et al., 2006.

[0169] The terms “inhibitor of [a target protein]” or “[a target protein] inhibitor” are used to signify a compound that is capable of interacting with the target protein and inhibiting its activity, such as an enzymatic activity. By way of example, inhibiting a target kinase enzymatic activity means reducing the ability of that target kinase to phosphorylate a substrate peptide or protein. In various embodiments, such reduction of kinase activity is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In various embodiments, the concentration of kinase inhibitor (or another inhibitor) required to reduce kinase enzymatic activity of a target kinase (or the activity of another target) is less than 1 pM, less than 500 nM, less than 100 nM, or less than 50 nM. In embodiments, the concentration that is required to inhibit the enzymatic activity of a target (such as a target kinase) is lower than the concentration of the inhibitor that is required to inhibit the enzymatic activity of other kinase(s), or other proteins in the same family or sharing an activity. In various embodiments, the concentration of an inhibitor that is required to reduce the enzymatic activity of a target protein is at least 2-fold, at least 5-fold, at least 10-fold, at least 20- fold, at least 50-fold, at least 100-fold, at least 500-fold, or at least 1000-fold lower than the concentration of the inhibitor that is required to reduce enzymatic activity of other proteins, particularly other similar proteins (such as other kinases). Inhibitors can also induce the reduction of the target proteins or the mRNA encoding the target protein using oligonucleotides (e.g., siRNA, antisense) byat least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the original mRNA and / or protein level.

[0170] In particular embodiments, inhibition of a mitotic kinase, such as PLK1 , can modulate the immune suppressive tumor microenvironment via reduction of, for example, phosphorylated STAT3, or other immune suppressive pathway, thereby benefiting antitumor immune response.(V) Immune Checkpoint Inhibitors

[0171] Checkpoint inhibitor therapy is a recently developing form of cancer immunotherapy. The therapy targets immune checkpoints, key regulators of the immune system that stimulate or inhibit its actions, which tumors can use to protect from immune system attacks. Checkpoint therapy can block inhibitory checkpoints, restoring immune system function (Pardoll, 2012). The first anti-cancer drug targeting an immune checkpoint was ipilimumab, a CTLA-4 blocker approved in the United States in 2011 (Cameron et al., 201 1 ). See also Wieder et al., 2018.

[0172] Immune checkpoint inhibitors indirectly treat cancer by treating the immune system. Inhibitors of immune checkpoints inhibit the normal immunosuppressive function of immune checkpoint molecules, for example, by down regulation of expression of the checkpoint molecules or by binding thereto and blocking normal receptor / ligand interactions. As the immune checkpoint molecules put brakes on an immune system response to an antigen, so an inhibitor of an immune checkpoint molecule reduces this immunosuppressive effect and enhances the immune response. Molecules that play a role in immune checkpoints include cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4) and programmed death 1 T cell receptor (PD-1 ).

[0173] CTLA-4, PD-1 , and their ligands are members of the CD28-B7 family of co-signaling molecules that play important roles throughout all stages of T-cell and other cell functions. The PD-1 receptor is expressed on the surface of activated T cells (and B cells) and, under normal circumstances, binds to its ligands (PD-L1 and PD-L2) that are expressed on the surface of antigen-presenting cells, such as dendritic cells or macrophages. This interaction sends a signal into the T cell and essentially switches the T cell off or inhibits the T cell. Cancer cells take advantage of this system by driving high levels of expression of PD-L1 on their surface. This allows cancer cells to gain control of the PD-1 pathway and switch off T cells expressing PD-1 that may enter the tumor microenvironment, thus suppressing the anticancer immune response. The immunotherapy ipilimumab, a monoclonal antibody that targets CTLA-4 on the surface of T cells, has been approved for the treatment of melanoma. Various new targeted immunotherapies aimed at the programmed death-1 (PD-1 ) T-cell receptor, or its ligands (PD-L1 or PD-L2) may also prove to be effective. Additional immune checkpoint targets may also prove to be effective, such as T-cell Immunoglobulin domain and Mucin domain 3 (TIM-3), Lymphocyte Activation Gene-3 (LAG-3), various B7 ligands, BTLA, adenosine A2A receptor (A2AR), and others.

[0174] Currently approved immune checkpoint inhibitor targets include: CTLA-4, PD-1 , and PD-L1. PD-1 is the transmembrane programmed cell death 1 protein (also called PDCD1 and CD279), which interacts with PD-L1 (PD-1 ligand 1 , or CD274). PD-L1 on the cell surface binds to PD-1 on an immunecell surface, which inhibits immune cell activity. A key PD-L1 function is regulation of T cell activities (Butte et al., 2007; Karwacz et al., 201 1 ). It appears that cancer-mediated upregulation of PD-L1 on the cell surface may inhibit T cells that might otherwise attack cancer cells. Antibodies that bind to either PD-1 or PD-L1 and therefore block the interaction may allow the T-cells to attack the tumor (Syn etal., 2017).

[0175] In the immune system, the critical balance between rejection and self-tolerance is maintained by a finely tuned series of co-regulatory receptor-ligand interactions. Recent attention has focused on the programmed death (PD)-1 / PD-1 ligand (PD-L1 , B7-H1 ) pathway as a key mediator of tumor immune tolerance. Under physiologic conditions, the inhibitory PD-1 receptor is expressed on activated immune effector cells, including T, B and NK cells. Through interactions with its ligands PD- L1 and PD-L2, normally expressed on antigen presenting cells (APCs), immune effector activity in peripheral tissues during inflammatory processes is self-limited. This inhibitory system is fundamental to protecting healthy tissues and non-infected cells during clearance of viral and bacterial intracellular infections. However, many human cancers have been shown to express PD-1 ligands, thus inducing immune tolerance locally in the tumor microenvironment (TME) and facilitating tumor cell escape from immune attack. Two general mechanisms promoting expression of PD-L1 on tumor cells have been postulated. In some tumors, aberrant signaling pathways can constitutively up-regulate PD-L1 expression, a phenomenon termed “innate immune resistance”; in others, the expression of PD-L1 is an adaptive mechanism that occurs in response to inflammatory cytokines produced in the TME during an antitumor immune response (“adaptive immune resistance”). These mechanisms of PD-L1 expression are not mutually exclusive, i.e., constitutive PD-L1 expression on tumor cells may be further up-regulated by cytokines such as interferon-gamma (IFN-g).

[0176] PD-L1 expression by tumor cells prior to treatment correlates highly with response to anti-PD- 1 monotherapy (for example, nivolumab (Bristol-Myers Squibb; OPDIVO™), pembrolizumab (Merck; KEYTRUDA®)) and anti-PD-L1 therapy (for example, MPDL3280A (Genentech / Roche)). Additional checkpoint inhibitors include: ipilimumab and tremelimumab (which target CTLA-4); atezolizumab (Genentech / Roche; Tecentriq), avelumab (Merck; Bavencio), and durvalumab (Medimmune / Strazeneca; Imfinzi) (which target PD-L1 ); and cemiplimab (REGN-2810), nivolumab, pembrolizumab, and pidilizumab (which target PD-1 ). Spartai izumab (PDR001 ; Novartis) is also under development as a PD-1 inhibitor.

[0177] Methods of PD-1 blockade treatment, including treatment of cancers, are well known in the art. See, for instance, WO 2016 / 201425, US 2019 / 0275705, Kvistborg et al., 2014; Zou et al. 2016; and Sakuishi et al., 2010.

[0178] PD-1 blocking agents include those used to treat cancer (i.e., to inhibit the growth or survival of tumor cells). Cancers whose growth may be inhibited using antibodies or anti-PD-1 agents or other check point inhibitors include cancers typically responsive to immunotherapy, but also cancers that have not hitherto been associated with immunotherapy. Examples of cancers for treatment include melanoma (e.g., metastatic malignant melanoma), renal cancer (e.g., clear cell carcinoma), prostate cancer (e.g., hormone refractory prostate adenocarcinoma), pancreatic adenocarcinoma, breastcancer, colon cancer, lung cancer (e.g., non-small cell lung cancer), esophageal cancer, squamous cell carcinoma of the head and neck, liver cancer, ovarian cancer, cervical cancer, thyroid cancer, glioblastoma, glioma, leukemia, lymphoma, and other neoplastic malignancies. The herein described treatments are applicable to malignancies that demonstrate improved disease-free and overall survival in relation to the presence of tumor-infiltrating lymphocytes in biopsy or surgical material, e.g., melanoma, colorectal, liver, kidney, stomach / esophageal, breast, pancreas, and ovarian cancer. Such cancer subtypes are known to be susceptible to immune control by T lymphocytes. Additionally, the provided technology is useful for treating refractory or recurrent malignancies whose growth may be inhibited using the PD-1 or other check point blockade treatments. Particularly cancers include those characterized by elevated expression of PD-1 and / or its ligands PD-L1 and / or PD-L2 in tested tissue samples, including: ovarian, renal, colorectal, pancreatic, breast, liver, glioblastoma, non-small cell lung cancer, gastric, esophageal cancers and melanoma. Cancers also include those associated with persistent infection with viruses such as human immunodeficiency viruses, hepatitis viruses class A, B and C, Epstein Barr virus, human papilloma viruses that are known to be causally related to for instance Kaposi's sarcoma, liver cancer, nasopharyngeal cancer, lymphoma, cervical, vulval, anal, penile, and oral cancers.

[0179] The PD-1 / PD-L1 pathway is a well-validated target for the development of antibody therapeutics for cancer treatment. Anti-PD-1 antibodies may also be useful in chronic viral infection. Memory CD8+ T cells generated after an acute viral infection are highly functional and constitute an important component of protective immunity. In contrast, chronic infections are often characterized by varying degrees of functional impairment (exhaustion) of virus-specific T-cell responses, and this defect is a principal reason for the inability of the host to eliminate the persisting pathogen. Although functional effector T cells are initially generated during the early stages of infection, they gradually lose function during the course of a chronic infection. Barber et al., 2006 showed that mice infected with a laboratory strain of LCMV developed chronic infection resulting in high levels of virus in the blood and other tissues. These mice initially developed a robust T cell response, but eventually succumbed to the infection upon T cell exhaustion. The authors found that the decline in number and function of the effector T cells in chronically infected mice could be reversed by injecting an antibody that blocked the interaction between PD-1 and PD-L1 .

[0180] In particular embodiments, immune checkpoint molecules include CTLA-4, PD-1 , PD-L1 , PD- L2, LAG-3, TIM-3, Killer-cell Immunoglobulin- like Receptor (KIR), CD160, B7-H3 (CD276), BTLA (CD272), IDO (Indoleamine 2,3-dioxygenase), adenosine A2A receptor (A2AR), and C1 OORF54.

[0181] The term “immune checkpoint protein” or “immune checkpoint molecule” refers to a molecule that is expressed by T cells and that either turn up a signal (stimulatory checkpoint molecules) or turn down a signal (inhibitory checkpoint molecules). Immune checkpoint molecules are recognized in the art to constitute immune checkpoint pathways similar to the CTLA-4 and PD-1 dependent pathways (see e.g., Pardoll, 2012; Mellman et al., 201 1 ). Examples of inhibitory checkpoint molecules include A2AR, B7-H3, B7-H4, BTLA, CTLA-4, CD277, IDO, KIR, PD-1 , LAG-3, TIM-3 and VISTA. The Adenosine A2A receptor (A2AR) is regarded as an important checkpoint in cancer therapy becausethe tumor microenvironment has relatively high levels of adenosine, which lead to a negative immune feedback loop through the activation of A2AR. B7-H3, also called CD276, was originally understood to be a co-stimulatory molecule but is now regarded as co-inhibitory. B7-H4, also called VTCN1 , is expressed by tumor cells and tumor-associated macrophages and plays a role in tumor escape. B and T Lymphocyte Attenuator (BTLA), also called CD272, is a ligand of HVEM (Herpesvirus Entry Mediator). Cell surface expression of BTLA is gradually downregulated during differentiation of human CD8+ T cells from the naive to effector cell phenotype; however, tumor-specific human CD8+ T cells express high levels of BTLA. CTLA-4, also called CD152, is overexpressed on regulatory T (Treg) cells and serves to control T cell proliferation. IDO is a tryptophan catabolic enzyme in the tryptophan to kynurenine metabolic pathway that regulates innate and adaptive immunity. IDO is known to suppress T and natural killer (NK) cells, generate and activate Tregs and myeloid-derived suppressor cells, and promote tumor angiogenesis. Another important molecule is TDO, tryptophan 2,3- dioxygenase, a key enzyme in the tryptophan to kynurenine metabolic pathway (Flatten et al., Front Immunol. 5: 673, 2014). KIR is a receptor for MHC Class I molecules on NK cells. LAG-3 works to suppress an immune response by action on Tregs as well as direct effects on CD8+ T cells. PD-1 , Programmed Death 1 (PD-1 ) receptor, has two ligands, PD-L1 and PD-L2. This checkpoint is the target of melanoma drug Keytruda® (pembrolizumab, Merck & Co., Kenilworth, NJ), which gained FDA approval in September 2014. An advantage of targeting PD-1 is that it can restore immune function in the tumor microenvironment. TIM-3 is expressed on activated human CD4+ T cells and regulates Th1 and Th17 cytokines. TIM-3 acts as a negative regulator of Th1 / Tel function by triggering cell death upon interaction with its ligand, galectin-9. V-domain Ig suppressor of T cell activation (VISTA) is primarily expressed on hematopoietic cells so that consistent expression of VISTA on leukocytes within tumors may allow VISTA blockade to be effective across a broad range of solid tumors.

[0182] The term “immune checkpoint inhibitor” refers to any compound inhibiting the function of an immune inhibitory checkpoint protein. Inhibition includes reduction of function and full blockade. In particular embodiments, immune checkpoint inhibitors are antibodies that specifically recognize an immune checkpoint protein. In particular embodiments, immune checkpoint inhibitors include peptides, antibodies, nucleic acid molecules, and small molecules. In particular embodiments, an immune checkpoint inhibitor is administered for enhancing the proliferation, migration, persistence and / or cytotoxic activity of CD8+ T cells in the subject and in particular the tumor-infiltrating CD8+ T cells of the subject.

[0183] Immune checkpoint inhibitors include agents that inhibit (directly or indirectly) at least one of CTLA-4, PD-1 , PD-L1 , and the like. Suitable anti-CTLA-4 therapy agents for use in the methods of the disclosure include anti-CTLA-4 antibodies, human anti-CTLA-4 antibodies, mouse anti-CTLA-4 antibodies, mammalian anti-CTLA-4 antibodies, humanized anti-CTLA-4 antibodies, monoclonal anti- CTLA-4 antibodies, polyclonal anti-CTLA-4 antibodies, chimeric anti-CTLA-4 antibodies, ipilimumab, tremelimumab, anti-CD28 antibodies, anti-CTLA-4 adnectins, anti-CTLA-4 domain antibodies, single chain anti-CTLA-4 fragments, heavy chain anti-CTLA-4 fragments, light chain anti-CTLA-4 fragments,inhibitors of CTLA-4 that agonize the co-stimulatory pathway, the antibodies disclosed in WO 2001 / 014424, the antibodies disclosed in WO 2004 / 035607, the antibodies disclosed in US 2005 / 0201994, and the antibodies disclosed in EP1212422B1 . Additional anti-CTLA-4 antibodies are described in US 5,81 1 ,097; US 5,855,887; US 6,051 ,227; US 6,984,720; WO 01 / 14424; WO 00 / 37504; US 2002 / 0039581 ; and US 2002 / 086014. Other anti-CTLA-4 antibodies that can be used in a method of the present disclosure include, for example, those disclosed in: WO 98 / 42752; US 6,682,736; US 6,207,156; Hurwitz et al., Proc. Natl. Acad. Sci. USA, 95(17): 10067-10071 , 1998; Camacho et al., 2004 (antibody CP-675206); Mokyr et al., 1998; US 5,977,318: US 6,682,736; US 7,109,003; and US 7,132,281.

[0184] Suitable anti-PD-1 and anti-PD-L1 therapy agents for use in the methods of the disclosure include anti-PD-1 and anti-PD-L1 antibodies, human anti-PD-1 and anti-PD-L1 antibodies (e.g., those developed by QLSF Biotherapeutics, San Francisco), mouse anti-PD-1 and anti-PD-L1 antibodies, mammalian anti-PD-1 and anti-PD-L1 antibodies, humanized anti-PD-1 and anti-PD-L1 antibodies, monoclonal anti-PD-1 and anti-PD-L1 antibodies, polyclonal anti-PD-1 and anti-PD-L1 antibodies, chimeric anti-PD-1 and anti-PD-L1 antibodies. In particular embodiments, anti-PD-1 therapy agents include nivolumab, pembrolizumab, pidilizumab, MEDI0680 (AstraZeneca, Cambridge, UK), and combinations thereof. In particular embodiments, anti-PD-L1 therapy agents include atezolizumab, BMS-936559 (Bristol-Myers Squibb, New York, NY), durvalumab (MEDI4736), avelumab (MSB0010718C), and combinations thereof.

[0185] Suitable anti-PD-1 and anti-PD-L1 antibodies are described in Topalian et al., 2015.

[0186] In particular embodiments, immune checkpoint inhibitors can include a modified ligand or an oligonucleotide such as antisense, miRNA, and siRNA designed to inhibit a particular immune checkpoint molecule. In particular embodiments, the siRNA prevents the translation of the immune checkpoint molecule, thus preventing the expression of the protein. Given that the genomic sequences of many immune checkpoint molecules are known, one of ordinary skill in the art would be able to use routine methods to design suitable inhibitory antisense nucleic acid molecules. The oligonucleotides can be loaded onto the cytokine constructs or given separately (e.g., on another construct).

[0187] In certain embodiments, checkpoint inhibitors can be siRNA, small molecule inhibitors, or antibody against (specific for) an immune checkpoint molecule in order to benefit cancer treatment. Such targets include PD-L1 , PD-1 , CTLA-4, LAG-3, TIM-3, B7-H3, VISTA, A2AR, and IDO (Khair et al., 2019).

[0188] One of ordinary skill in the art will understand how to access representative sequences for such targets, which are readily available in public sequence databases. The following table provides sample GenBank Accession information:(VI) Optional Additional Components

[0189] In addition to the mitotic kinase inhibitor and the immune checkpoint inhibitor, the cytokine constructs provided herein can optionally contain or be administered with one or more optional components. These optional components include, for instance, adjuvant(s), therapeutic oligonucleotides, additional anti-cancer agent(s), targeting moieties, and therapeutics or therapies for other immune-related diseases.Adjuvants

[0190] The cytokine constructs provided herein optionally may include at least one adjuvant component, contained within, or otherwise associated with the delivery vehicle. Some delivery vehicles have adjuvant property. The cytokine construct embodiments are not limited to a particular type of adjuvant, though specific examples are provided herein.

[0191] Generally, adjuvants are any substance whose admixture into a vaccine composition increases or otherwise modifies the immune response to the (cancer) antigen. The ability of an adjuvant to increase the immune response to an antigen is typically manifested by a significant increase in immune-mediated reaction, or reduction in disease symptoms. For example, an increase in humoral immunity is typically manifested by a significant increase in the titer of antibodies raised to the antigen, and an increase in T-cell activity is typically manifested in increased antigen-specific T cell proliferation, death of target cells, or cytokine secretion. An adjuvant may also alter an immune response, for example, by changing a primarily humoral or Th2 response into a primarily cellular, or Th1 response.

[0192] Suitable adjuvants include, but are not limited to, stimulator of interferon genes (STING) agonists including natural cyclic dinucleotide (CDN) STING agonists (e.g., 2'3'-cGAMP, 3'3'-cGAMP, c-di-AMP, c-di-GMP), synthetic CDN STING agonists (e.g., ADU-S100 (MIW815), MK-1454, BMS- 986301 , BI-1387446, TAK-676, E7766, SB11285, STINGVAX) and non-CDN small molecule STING agonists (e.g., DMXAA (Vadimezan), MK-2118, GSK3745417, SNX281 , E7766, TTI-10001 , JNJ-'6196, CRD5500, CS-1018, CS-1020, CS-1010, MSA-1 , ALG-031048, HG-381 ), and other STING agonists as reviewed in Amouzegar et al, (2021 ) and Hines et al. (2023). Other suitable adjuvants include, but are not limited to, TLR-binding DNA substituents such as CpG oligonucleotides (e.g., ISS 1018; Amplivax; CpG ODN 7909, CpG ODN 1826, CpG ODN D19, CpG ODN 1585, CpG ODN 2216, CpG ODN 2336, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2395, ODN M362, and SD- 101 ), DNA TLR agonists that contain a CpG sequence (e.g., dSLIM), non-CpG DNA TLR agonists (e.g., EnanDIM), and cationic peptide-conjugated CpG oligonucleotides (e.g., IC30, IC31 ); RNA TLR agonists (e.g., Poly l:C and Poly-ICLC); aluminum salts (e.g., aluminum hydroxide, aluminum phosphate, aluminum chloride, and aluminum potassium sulfate); anti-CD40 antibodies (e.g., CP- 870,893); cytokines, such as granulocyte-macrophage colony-stimulating factor (GM-CSF); small molecule TLR agonists (e.g., imiquimod, resiquimod, gardiquimod, and 3M-052); fusion proteins (e.g., ImuFact IMP321 , CyaA, and ONTAK); oil- orsurfactant-based adjuvants such as MF59, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, and Montanide ISA-51 ; a plant extract such as QS21 stimulon (Aquila Biotech, Worcester, Mass., USA), which is derived from saponin; mycobacterial extracts and synthetic bacterial cell wall mimics, such as lipopolysaccharides (e.g., monophosphoryl lipid A, OM-174, OM-197-MP-EC, and Pam3Cys); xanthenone derivatives (e.g., vadimezan); mixtures thereof (e.g., AS-15); and other proprietary adjuvants such as Ribi's Detox, Quil, or Superfos. Several immunological adjuvants (e.g., MF59 specific for dendritic cells and their preparation have been described previously (Dupuis et al., 1998; Allison, 1998). Also, cytokines may be used as adjuvants. Several cytokines have been directly linked to influencing dendritic cell migration to lymphoid tissues (e.g., TNF-alpha), accelerating the maturation of dendritic cells into efficient antigen-presenting cells for T-lymphocytes (e.g., GM-CSF, IL-1 and IL-4) (U.S. Pat. No. 5,849,589) and acting as immunoadjuvants (e.g., IL-12) (Gabrilovich et al., 1996). Toll like receptors (TLRs) or agents that activate TLRs may also be used as adjuvants, and are important members of the family of pattern recognition receptors (PRRs) which recognize conserved motifs shared by many micro-organisms, termed “pathogen-associated molecular patterns” (PAMPS).

[0193] In some embodiments, the adjuvant includes a CpG oligonucleotide. CpG 40ipoar-stimulatory oligonucleotides have also been reported to enhance the effects of adjuvants in a vaccine setting. Without being bound by any particularly mechanistic theory, CpG oligonucleotides act at least in part by activating the innate (non-adaptive) immune system via Toll-like receptors (TLR), mainly TLR9. CpG triggered TLR9 activation enhances antigen-specific humoral and cellular responses to a wide variety of antigens, including peptide or protein antigens, live or killed viruses, dendritic cell vaccines, autologous cellular vaccines, and polysaccharide conjugates in both prophylactic and therapeutic vaccines. More importantly, it enhances dendritic cell maturation and differentiation, resulting in enhanced activation of TH1 cells and strong cytotoxic T-lymphocyte (CTL) generation, even in the absence of CD4 T-cell help. The TH1 bias induced by TLR9 stimulation is maintained even in the presence of vaccine adjuvants such as alum or incomplete Freund’s adjuvant (IFA) that normally promote a TH2 bias. CpG oligonucleotides show even greater adjuvant activity when formulated or co-administered with other adjuvants or in formulations such as microparticles, nano particles, lipidemulsions or similar formulations, which are especially necessary for inducing a strong response when the antigen is relatively weak. They also accelerate the immune response and enabled the antigen doses to be reduced by approximately two orders of magnitude, with comparable antibody responses to the full-dose vaccine without CpG in some experiments (Krieg, 2006). U.S. Pat. No. 6,406,705 describes the combined use of CpG oligonucleotides, non-nucleic acid adjuvants and an antigen to induce an antigen-specific immune response. A commercially available CpG TLR9 agonist is dSLIM (double Stem Loop Immunomodulator) by Mologen (Berlin, GERMANY). Other TLR binding molecules such as RNA binding TLR 7, TLR 8 and / or TLR 9 may also be used.

[0194] Xanthenone derivatives such as, for example, vadimezan or AsA404 (also known as 5,6- dimethylaxanthenone-4-acetic acid (DMXAA)), may also be used as adjuvants according to embodiments of the disclosure. Alternatively, such derivatives may also be administered in parallel to the vaccine of the disclosure, for example via systemic or intratumoral delivery, to stimulate immunity at the tumor site. Without being bound by theory, it is believed that such xanthenone derivatives act by stimulating interferon (IFN) production via the stimulator of IFN gene (STING) receptor (see e.g., Conlon et al., 2013; and Kim et al., 2013). Other examples of useful adjuvants include, but are not limited to, chemically modified CpGs {e.g. CpR, Idera), Poly(l:C) {e.g. polyi :CI2U), non-CpG bacterial DNA or RNA as well as immunoactive small molecules and antibodies such as cyclophosphamide, sunitinib, bevacizumab, Celebrex™, NCX-4016, sildenafil, tadalafil, vardenafil, sorafenib, XL-999, CP- 547632, pazopanib, AZD2171 , ipilimumab, tremelimumab, and SC58175, which may act therapeutically and / or as an adjuvant. The amounts and concentrations of adjuvants and additives useful in the context of the present disclosure can readily be determined by the skilled artisan without undue experimentation. Additional adjuvants include colony-stimulating factors, such as Granulocyte Macrophage Colony Stimulating Factor (GM-CSF, sargramostim).

[0195] Poly-ICLC is a synthetically prepared double-stranded RNA consisting of polyi and polyC strands of average length of about 5000 nucleotides, which has been stabilized to thermal denaturation and hydrolysis by serum nucleases by the addition of poly-lysine and carboxymethylcellulose. The compound activates TLR3 and the RNA helicase-domain of MDA5, both members of the PAMP family, leading to DC and natural killer (NK) cell activation and production of a “natural mix” of type I interferons, cytokines, and chemokines. Furthermore, poly-ICLC exerts a more direct, broad host-targeted anti-infectious and possibly antitumor effect mediated by the two IFN- inducible nuclear enzyme systems, the 2' 5’-OAS and the PI / elF2a kinase, also known as the PKR (4-6), as well as RIG-I helicase and MDA5.

[0196] Examples of immunological adjuvants that can be associated with the cytokine constructs include TLR ligands, C-Type Lectin Receptor ligands, NOD-Like Receptor ligands, RLR ligands, and RAGE ligands. TLR ligands can include lipopolysaccharide (LPS) and derivatives thereof, as well as lipid A and derivatives thereof including, but not limited to, monophosphoryl lipid A (MPL), glycopyranosyl lipid A, PET-lipid A, and 3-O-desacyl-4’-monophosphoryl lipid A. In a specific embodiment, the immunological adjuvant is MPL. In another embodiment, the immunological adjuvantis LPS. TLR ligands can also include, but are not limited to, TLR3 ligands (e.g., polyinosinic- polycytidylic acid (poly(l :C)), TLR7 ligands (e.g., imiquimod and resiquimod), and TLR9 ligands.

[0197] As used herein, the term “TLR-binding DNA substituent” refers to a substituent or moiety capable of binding to a toll-like receptor (“TLR”), including at least one deoxyribonucleic acid. In embodiments, a TLR-binding DNA substituent is a nucleic acid. In embodiments, the TLR-binding DNA substituent includes at least one nucleic acid analog. In embodiments, the TLR-binding DNA substituent includes at least one nucleic acid analog having an alternate backbone (e.g. phosphodiester derivative (e.g., phosphoramidate, phosphorodiamidate, phosphorothioate, phosphorodithioate, phosphonocarboxylic acids, phosphonocarboxylates, phosphonoacetic acid, phosphonoformic acid, methyl phosphonate, boron phosphonate, or O-methylphosphoroamidite), peptide nucleic acid backbone(s), LNA, or linkages). In embodiments, a TLR-binding DNA substituent includes DNA. In embodiments, all nucleotide sugars in a TLR-binding DNA substituent are deoxyribose (e.g., all nucleotides are DNA). In embodiments, a TLR-binding DNA substituent consists of DNA. In embodiments, a TLR-binding DNA substituent includes or is DNA having internucleotide linkages selected from phosphodiesters and phosphodiester derivatives (e.g., phosphoramidate, phosphorodiamidate, phosphorothioate, phosphorodithioate, phosphonocarboxylic acids, phosphonocarboxylates, phosphonoacetic acid, phosphonoformic acid, methyl phosphonate, boron phosphonate, O-methylphosphoroamidite, or combinations thereof). In embodiments, a TLR-binding DNA substituent consists of DNA having internucleotide linkages selected from phosphodiesters and phosphorothioates. In embodiments, a TLR-binding DNA substituent includes or is DNA having backbone linkages selected from phosphodiesters and phosphorodithioates. In embodiments, a TLR- binding DNA substituent includes or is DNA including phosphodiester backbone linkages. In embodiments, a TLR-binding DNA substituent includes or is DNA including phosphorothioate backbone linkages. In embodiments, a TLR-binding DNA substituent includes or is DNA including phosphorodithioate backbone linkages. In embodiments, a TLR-binding DNA substituent preferentially binds TLR9 over other TLR. In embodiments, a TLR-binding DNA substituent specifically binds TLR9. In embodiments, a TLR-binding DNA substituent specifically binds TLR3. In embodiments, a TLR-binding DNA substituent specifically binds TLR7. In embodiments, a TLR- binding DNA substituent specifically binds TLR8. In embodiments, a TLR-binding DNA substituent specifically binds a cellular sub-compartment (e.g., endosome) associated TLR (e.g., TLR3, TLR7, TLR8, or TLR9). In embodiments, a TLR-binding DNA substituent includes or is a G-rich oligonucleotide. In embodiments, a TLR-binding DNA substituent includes a CpG motif, wherein C and G are nucleotides and p is the phosphate connecting the C and G. In embodiments, the CpG motif is unmethylated. In embodiments, a TLR-binding DNA substituent is a Class A CpG oligodeoxynucleotide (ODN). In embodiments, a TLR-binding DNA substituent is a Class B CpG oligodeoxynucleotide (ODN). In embodiments, a TLR-binding DNA substituent is a Class C CpG oligodeoxynucleotide (ODN). In embodiments, a TLR-binding DNA substituent (e.g., TLR9-binding DNA substituent) consists of deoxyribonucleic acids with A, G, C, or T bases and phosphodiester linkages and / or phosphodiester derivative linkages (e.g., phosphorothioate linkage(s)).

[0198] The phrase “CpG motif” refers to a 5’ C nucleotide connected to a 3’ G nucleotide through a phosphodiester internucleotide linkage or a phosphodiester derivative internucleotide linkage. In embodiments, a CpG motif includes a phosphodiester internucleotide linkage. In embodiments, a CpG motif includes a phosphodiester derivative internucleotide linkage.

[0199] As used herein, the term “Class A CpG ODN” or “A-class CpG ODN” or “D-type CpG ODN” or “Class A CpG DNA sequence” is used in accordance with its common meaning in the biological and chemical sciences and refers to a CpG motif including oligodeoxynucleotide including one or more of poly-G sequence at the 5’, 3’, or both ends; an internal palindrome sequence including CpG motif; or one or more phosphodiester derivatives linking deoxynucleotides. In embodiments, a Class A CpG ODN includes poly-G sequence at the 5’, 3’, or both ends; an internal palindrome sequence including CpG motif; and one or more phosphodiester derivatives linking deoxynucleotides. In embodiments, the phosphodiester derivative is phosphorothioate. Examples of Class A CpG ODNs include ODN D19, ODN 1585, ODN 2216, and ODN 2336.

[0200] The terms “Class B CpG ODN” or “B-class CpG ODN” or “K-type CpG ODN” or “Class B CpG DNA sequence” are used in accordance with their common meaning in the biological and chemical sciences, and refer to a CpG motif including oligodeoxynucleotide including one or more of a 6mer motif including a CpG motif; phosphodiester derivatives linking all deoxynucleotides. In embodiments, a Class B CpG ODN includes one or more copies of a 6mer motif including a CpG motif and phosphodiester derivatives linking all deoxynucleotides. In embodiments, the phosphodiester derivative is phosphorothioate. In embodiments, a Class B CpG ODN includes one 6mer motif including a CpG motif. In embodiments, a Class B CpG ODN includes two copies of a 6mer motif including a CpG motif. In embodiments, a Class B CpG ODN includes three copies of a 6mer motif including a CpG motif. In embodiments, a Class B CpG ODN includes four copies of a 6mer motif including a CpG motif. Examples of Class B CpG ODNs include ODN 1668, ODN 1826, ODN 2006, and ODN 2007.

[0201] The terms “Class C CpG ODN” or “C-class CpG ODN” or “C-type CpG DNA sequence” are used in accordance with their common meaning in the biological and chemical sciences and refers to an oligodeoxynucleotide including a palindrome sequence including a CpG motif and phosphodiester derivatives (phosphorothioate) linking all deoxynucleotides. Examples of Class C CpG ODNs include ODN 2395 and ODN M362.Therapeutic Oligonucleotides.

[0202] Optionally, the provided cytokine constructs may contain one or more therapeutic oligonucleotides. Different types of therapeutic oligonucleotides can be used and non-exhaustively include siRNA, miRNA, antisense oligonucleotide, ribozyme, aptamer, DNA, mRNA, sgRNA (for CRISPR), and CRISPR-cas9 elements. In other words, any chain of nucleotides can be utilized as long as they can specifically modulate (interfere or boost) the action or synthesis of certain gene(s) and protein(s). Each particular oligonucleotide may have a single or multiple targets. Examples of gene / protein targets of interest to the disclosure include immune checkpoints (discussed elsewhereherein), transcription factors, phosphatases, kinases, etc. Specific targets include, but are not limited to, STAT3, Axl, PI3K, IDO-6, PD-L1 , PD-1 , LAG-3, TIM-3, B7-H3, VISTA, A2AR, FOXP3, CTLA-4, STAT5, IL-2Ra, TGFBR, IKZF4, TGF-p, CD47, N0X1 -5, HSP47, XBP1 , BCL2, BCL-XL, AKT1 , AKT2, AKT3, MYC, HER2, HER3, AR, Survivin, GRB7, EPS8L1 , RRM2, PKN3, EGFR, IRE1 -alpha, VEGF- R1 , RTP801 , proNGF, Keratin K6A, LMP2, LMP7, MECL1 , HIF1 a, Furin, KSP, eiF-4E, p53, p-catenin, ApoB, PCSK9, SNALP, CD39, CD73, MIF, VEGF, PIGF, CXCR4, CCR2, PLK1 , MTDH, Twist, Lcn2, IL-6, IL-10, p65, and mitotic kinases (e.g., PLK1 , PLK2, PLK3, PLK4, CDK1 , CDK2, CHK1 , CHK2, BUB1 , BUBR1 , MPS1 , NEK2, HASPIN, Aurora A) as previously mentioned. In certain cases, inflammation-related genes can also be inhibited with oligonucleotide (e.g., siRNA or antisense). Examples of inflammation-related genes include TNF, TNF-a, IL-1 A, IL-1 B, IL-12 / 23, IL-4, IL-5, IL-6, IL-8, IL-13, IL-17, NF-KB1 , NF-KB2, COX2, PTGS2, TLR4, MARK, STAT3, CCL2, CXCL10, IFN-y, and MMP9. These genes encode corresponding cytokines (TNF, TNF-a, IL-1 A, IL-1 B, IL-12 / 23, IL-4, IL-5, IL-6, IL-8, IL-13, IL-17, NF-KB1 , NF-KB2, 00X2, PTGS2, TLR4, MAPK, STAT3, CCL2, CXCL10, IFN-y, and MMP9), which can also be inhibited by decoy receptors. Therapeutic oligonucleotides can also contain two strands that target two genes (such as siRNA against BCL2 and AKT 1 , siRNA against AR and MYC). They can also contain immunostimulatory sequences / elements that can thus simultaneously boost the immune response and regulate expression of target genes. They can also be designed to target the aforementioned genes that have mutations. The known or knowable cognate ligands or cognate receptors to all these listed gene / protein targets can also be targeted.

[0203] In certain embodiments, the cytokine constructs include as an active agent an oligonucleotide that mediates RNA interference. RNA interference is a highly conserved mechanism triggered by double-stranded RNA (dsRNA) and able to downregulate transcript of genes homologous to the dsRNA. The dsRNA is first processed by Dicer into short duplexes of 21 -23 nucleotides, called short interfering RNAs (siRNAs). Incorporated in RNA-induced silencing complex (RISC), they are able to mediate gene silencing through cleavage of the target mRNA. “siRNA” or “small-interfering ribonucleic acid” refers to two strands of ribonucleotides which hybridize along a complementary region under physiological conditions. The siRNA molecules include a double-stranded region which is substantially identical to a region of the mRNA of the target gene. A region with 100% identity to the corresponding sequence of the target gene is suitable. This state is referred to as “fully complementary”. However, the region may also contain one, two or three mismatches as compared to the corresponding region of the target gene, depending on the length of the region of the mRNA that is targeted, and as such may be not fully complementary. Methods to analyze and identify siRNAs with sufficient sequence identity in order to effectively inhibit expression of a specific target sequence are known in the art. A suitable mRNA target region would be the coding region. Also suitable are untranslated regions, such as the 5’-UTR, the 3’-UTR, and splice junctions as long as the regions are unique to the mRNA target and not directed to a mRNA poly A tail.

[0204] In some embodiments, siRNA encapsulated within or associated with cytokine constructs are utilized in methods and systems involving RNA interference. Such embodiments are not limited to a particular size or type of siRNA molecule. The length of the region of the siRNA complementary to thetarget, for example, may be from 15 to 100 nucleotides, 18 to 25 nucleotides, 20 to 23 nucleotides, or more than 15, 16, 17 or 18 nucleotides. Where there are mismatches to the corresponding target region, the length of the complementary region is generally required to be somewhat longer.

[0205] In certain embodiments, it is contemplated that the siRNA delivery approach using cytokine constructs disclosed herein (e.g., through loading of the siRNA on a cytokine constructs) can be used to inhibit production of any gene of interest. Specific targets include, but are not limited to, STAT3, Axl, PI3K, IDO-6, PD-L1 , PD-1 , LAG-3, TIM-3, B7-H3, VISTA, A2AR, FOXP3, CTLA-4, STAT5, IL- 2Ra, TGFBR, IKZF4, TGF-p, CD47, NOX1 -5, HSP47, XBP1 , BCL2, BCL-XL, AKT1 , AKT2, AKT3, MYC, HER2, HER3, AR, Survivin, GRB7, EPS8L1 , RRM2, PKN3, EGFR, IRE1 -alpha, VEGF-R1 , RTP801 , proNGF, Keratin K6A, LMP2, LMP7, MECL1 , HIF1 a, Furin, KSP, eiF-4E, p53, p-catenin, ApoB, PCSK9, SNALP, CD39, CD73, MIF, VEGF, PIGF, CXCR4, CCR2, PLK1 , MTDH, Twist, Lcn2, IL-6, IL-10, p65, and mitotic kinases as previously mentioned among genes known as drivers in cancer and other diseases. Further, it is specifically contemplated that siRNA can be directed to a variant or mutated gene, rather than a wildtype gene. The known or knowable cognate ligands or cognate receptors to all these listed gene / protein targets can also be targeted.

[0206] One of ordinary skill in the art will understand how to access representative sequences for these targets, which are readily available in public sequence databases. The following table provides sample GenBank Accession information:

[0207] Such embodiments are not limited to a particular manner of assessing the delivery profile of the siRNA in vitro and / or in vivo. In some embodiments, labelling the siRNA molecules with an imaging agent (e.g., fluorescent dye FITC, RITC, Cy™ dyes, Dylight® dyes, Alexa Fluor® dyes, or lanthanide probes) or a radiotracer permits visualization of the biodistribution of siRNA molecules at the organ level and also the intracellular delivery profile. In some embodiments, RT-PCR and western blot are used to analyze the target protein at the mRNA level and protein level, respectively.

[0208] In certain embodiments, the present disclosure provides methods for inhibiting a target gene in a cell including introducing into the cell (associated with an cytokine construct) an siRNA capable of inhibiting the target gene by RNA interference, wherein the siRNA includes two RNA strands that are complementary to each other, wherein the siRNA is loaded onto a cytokine construct. In someembodiments, the siRNA is modified with cholesterol at the 3’ sense strand. In some embodiments, the cell is within a human being or an animal subject {e.g., horses, dogs, cats, or other domestic, farm, or other animals with cancer).

[0209] MicroRNAs (miRNAs) or miRNA mimics are short, non-coding RNAs that can target and substantially silence protein coding genes through 3’-UTR elements. Important roles for miRNAs in numerous biological processes have been established, but comprehensive analyses of miRNA function in complex diseases are lacking. miRNAs are initially transcribed as primary miRNAs (pri- miRNAs) that are then cleaved by the nuclear RNAses Drosha and Pasha to yield precursor-miRNAs (pre-miRNAs). These precursors are further processed by the cytoplasmic RNAse III dicer to form short double stranded miR-miR* duplexes, one strand of which (miR) is then integrated into the RNA Induced Silencing Complex (RISC) that includes the enzymes dicer and Argonaute (Ago). The mature miRNAs (~17-24 nt) direct RISC to specific target sites located within the 3’UTR of target genes. Once bound to target sites, miRNAs repress translation through mRNA decay, translational inhibition and / or sequestration into processing bodies (P-bodies) (Eulalio etal., 2008; Behm-Ansmant eta / ., 2006; Chu and Rana, 2006). Recent estimates find that over 60% of protein coding genes carry 3’-UTR miRNA target sites (Friedman et al., 2009). In this regard, miRNAs act as key regulators of processes as diverse as early development (Reinhart et al., 2000), cell proliferation and cell death (Brennecke et al., 2003), apoptosis and fat metabolism (Xu et al., 2003), and cell differentiation (Chen et al., 2004; Dostie et al., 2003). In addition, studies of miRNA expression in chronic lymphocytic leukemia (Calin etal., 2008), colonic adenocarcinoma (Michael etal., 2003), Burkitt’s lymphoma (Metzler etal., 2004), cardiac disease (Zhao et al., 2007) and viral infection (Pfeffer etal., 2004) suggest vital links between miRNA and numerous diseases.

[0210] miRNAs thus far observed have been approximately 21 -22 nucleotides in length and they arise from longer precursors, which are transcribed from non-protein-encoding genes (Carrington and Ambros, 2003). The precursors form structures that fold back on each other in self-complementary regions; they are then processed by the nuclease Dicer in animals (or DCL1 in plants). miRNA molecules interrupt translation through precise or imprecise base-pairing with their targets. In some embodiments, a miRNA may be used as acomponent of a provided cytokine construct, therapeutically or administered to a subject, such as a human patient, to treat a disease such as, e.g., cancer; alternately, in some embodiments, a nucleic acid that is complementary to the miRNA may be therapeutically administered to a subject in vivo or used in vitro to generate the desired therapeutic miRNA {e.g., miRNA-142-3p, miRNA-142-3p, miRNA-124, or miRNA-138). In this way, the complementary nucleic acid may be used as a template to generate the desired therapeutic miRNA {e.g., miRNA-142-3p, miRNA-142-3p, miRNA-124, or miRNA-138).

[0211] Oligonucleotides can be loaded on the cytokine construct at different loading {e.g., 0.01 to 0.5 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, 0.5 to 1 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, 10 to 20 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 1 wt.%, 2 wt.%, 3 wt.%, 4 wt.%, 5 wt.%, 6 wt.%, 10 wt.%, 15 wt.%, and 20 wt.% of the delivery vehicle).Additional Anti-Cancer Agent(s).

[0212] The phrase “anti-cancer agent” is used in accordance with its plain ordinary meaning and refers to a composition (e.g., compound, drug, antagonist, inhibitor, modulator) having antineoplastic properties or the ability to inhibit the growth or proliferation of cells. In some embodiments, an anticancer agent is a chemotherapeutic agent. In some embodiments, an anti-cancer agent is a targeted therapeutic agent. In some embodiments, an anti-cancer agent is an immune checkpoint inhibitor. In some embodiments, an anti-cancer agent is an agent identified herein having utility in methods of treating cancer. In some embodiments, an anti-cancer agent is an agent approved by the FDA or similar regulatory agency of a country other than the USA, for treating cancer.

[0213] Examples of anti-cancer agents include, but are not limited to, MEK (e.g., MEK1 , MEK2, or MEK1 and MEK2) inhibitors {e.g., XL518, CI-1040, PD035901 , selumetinib / AZD6244, GSK1120212 / trametinib, GDC-0973, ARRY-162, ARRY-300, AZD8330, PD0325901 , U0126, PD98059, TAK-733, PD318088, AS703026, BAY 869766, PD184352, SB239063, BAY 43-9006); alkylating agents such as nitrogen mustards {e.g., mechloroethamine, cyclophosphamide, uramustine, chlorambucil, melphalan, ifosfamide), ethylenimine and methylmelamines (e.g., hexamethlymelamine and thiotepa), alkyl sulfonates {e.g., busulfan and hepsulfam), nitrosoureas {e.g., carmustine, lomustine, semustine, and streptozocin), and triazenes (e.g., dacarbazine); antimetabolites such as folic acid analogs (e.g., methotrexate, leucovorin, raltitrexed, and pemetrexed), pyrimidine analogs (e.g., fluorouracil, floxouridine, cytarabine, capecitabine, and gemcitabine), and purine analogs (e.g., mercaptopurine, thioguanine, pentostatin, fludarabine, and 5-azathioprine); plant alkaloids (e.g., vincristine, vinblastine, vinorelbine, vindesine, podophyllotoxin, paclitaxel, docetaxel, and homoharringtonine); topoisomerase inhibitors such as camptothecin derivatives (e.g., irinotecan and topotecan), amsacrine, and epipodophyl lotoxins (e.g., etoposide (VP16), etoposide phosphate, and teniposide); antibiotics such as anthracenediones (e.g., mitoxantrone), anthracyclines (e.g., doxorubicin, daunorubicin, epirubicin, and fluorodaunorunicin hydrochloride), streptomyces-derived antibiotics or derivatives thereof (e.g., dactinomycin, bleomycin, mitomycin, geldanamycin, plicamycin, and 17-N-allylamino-17-demethoxygeldanamycin (17-AAG; tanespimycin), clofazimine, and beta lactam derivatives; platinum-based compounds (e.g., cisplatin, oxaliplatin, carboplatin); substituted urea (e.g., hydroxyurea); methyl hydrazine derivative (e.g., procarbazine), adrenocortical suppressant (e.g., mitotane and aminoglutethimide); angiogenesis-inhibiting enzymes (e.g., L- asparaginase and arginine deiminase); PI3K inhibitors (e.g., wortmannin and LY294002); mTOR inhibitors (e.g., sertraline); DNA methyltransferase inhibitors (e.g., 5-aza-2’-deoxycytidine); antisense oligonucleotides; apoptosis gene modulators; apoptosis regulators (e.g., deoxyadenosine and triptolide); BCR / ABL antagonists; bFGF inhibitor; casein kinase inhibitors (IGOS); gallium nitrate; gelatinase inhibitors; glutathione inhibitors (e.g., etanidazole); immunostimulant peptides; insulin-like growth factor-1 receptor inhibitor; leukemia inhibiting factor; matrilysin inhibitors; matrix metalloproteinase inhibitors; MIF inhibitor; mismatched double stranded RNA; mycobacterial cell wall extract; nitric oxide modulators; phosphatase inhibitors; plasminogen activator inhibitor; proteasomeinhibitors (e.g., bortezomib); protein A-based immune modulator; protein kinase C inhibitors; protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; ras farnesyl protein transferase inhibitors; ras inhibitors; ras-GAP inhibitor; ribozymes; signal transduction inhibitors / modulators (e.g., itraconazole); single chain antigen-binding protein; stem cell inhibitor; stem-cell division inhibitors; stromelysin inhibitors; synthetic glycosaminoglycans; telomerase inhibitors; thyroid stimulating hormones; translation inhibitors; urokinase receptor antagonists; gonadotropin-releasing hormone agonists (GnRH) such as goserelin and leuprolide (leuprorelin); steroids such as adrenocorticosteroids (e.g., prednisone and dexamethasone); progestins (e.g., hydroxyprogesterone caproate, megestrol acetate, medroxyprogesterone acetate); antiprogestrogens (e.g., mifepristone); estrogens (e.g., di-ethlystilbestrol and ethinyl estradiol); antiestrogens such as aromatase inhibitors (e.g., exemestane, fadrozole, letrozole, pentrozole, and anastrozole), selective estrogen receptor modulators (e.g., tamoxifen, tamoxifen methiodide, panomifene, and clomifene analogues); androgens (e.g., testosterone propionate and fluoxymesterone); antiandrogen (e.g., flutamide, finasteride, and bicalutamide); immunostimulants such as levamisole, interleukins (e.g., interleukin-2) and interferons / interferon agonists (e.g., alphainterferon); monoclonal antibodies such as anti-CD20 (e.g., rituximab), anti-HER2 (e.g., trastuzumab), anti-CD52, anti-CD25 (e.g., daclizumab), anti-HLA-DR, and anti-VEGF monoclonal antibodies); immunotoxins (e.g., anti-CD33 monoclonal antibody-calicheamicin conjugate, anti-CD22 monoclonal antibody-pseudomonas exotoxin conjugate, etc.); radioimmunotherapeutic agents (e.g., anti-CD20 monoclonal antibody conjugated to111ln,90Y, or131l, etc.); statins e.g., cerivastatin and pitavastatin); 5-T1 B receptor agonists (e.g., 5-nonyloxytryptamine); BRAF kinase inhibitors (e.g., vemurafenib and dabrafenib); tyrosine kinase inhibitors such as inhibitors of one or more of EGFR, HER2, KDR, FLT4, EphB4, and Src (e.g., gefitinib (Iressa™), erlotinib (Tarceva™), cetuximab (Erbitux™), lapatinib (Tykerb™), panitumumab (Vectibix™) vandetanib (Caprelsa™), afatinib / BIBW2992, Cl- 1033 / canertinib, neratinib / HKI-272, CP-724714, TAK-285, AST-1306, ARRY334543, AG-1478, dacomitinib / PF299804, OSI-420 / desmethyl erlotinib, AZD8931 , ARRY-380, AEE788, pelitinib / EKB- 569, CUDC-101 , WZ8040, WZ4002, WZ3146, AG-490, XL647, PD153035, BMS-599626, sorafenib, imatinib (Gleevec®), sunitinib, and dasatinib; immune-checkpoint inhibitors (e.g., anti-CTLA-4, anti- PD1 / L1 antibodies); PLK1 inhibitors (GSK461364, BI2536, Tak960, NMS-P937, BI6727), mitotic kinase inhibitors, or the like, or mixtures thereof (e.g., leuprolide+estrogen+progesterone).

[0214] Additionally, the cytokine constructs described herein can be co-administered with conventional immunotherapeutic agents including, but not limited to, immunostimulants (e.g., Bacille Calmette-Guerin (BCG), levamisole, interleukin-2, alpha-interferon, etc.), therapeutic monoclonal antibodies (e.g., anti-CD20, anti-HER2, anti-CD52, anti-HLA-DR, and anti-VEGF monoclonal antibodies), immunotoxins (e.g., anti-CD33 monoclonal antibody-calicheamicin conjugate, anti-CD22 monoclonal antibody-pseudomonas exotoxin conjugate, etc.), immune-checkpoint inhibitors (e.g., anti-CTLA4, anti-PD-1 , anti-PD-L1 antibodies), and radioimmunotherapy (e.g., anti-CD20 monoclonal antibody conjugated to111In,90Y, or1311, etc.). These immunotherapeutic agents can also be loadeddirectly onto the cytokine constructs to enhance their therapeutic effect, reduce toxicity, and reduce administration time.

[0215] In a further embodiment, the cytokine constructs described herein can be co-administered with conventional radiotherapeutic agents including, but not limited to, radionuclides such as47Sc,64Cu,67Cu,89Sr,86Y,87Y,90Y,105Rh,11 1Ag,11 11n,117mSn,149Pm,153Sm,166Ho,177Lu,186Re,188Re,21 1At and212Bi. These radiotherapeutic agents can also be loaded directly onto the cytokine constructs to enhance the therapeutic effect, reduce toxicity, and reduce administration time.

[0216] Specific combination of cytokines and other cargos on the cytokine construct. For example, a cytokine construct containing IL-2 and TGF-p inhibitor (such as siRNA) can be used for cancer treatment, while a cytokine construct containing IL-2 and TGF-p can be used to promote Treg activity and thus useful in other immune-related diseases. We also contemplate a cytokine construct containing of IL-2, peptide antigen, and adjuvant (e.g., CpG) for a vaccine application. We also contemplate a cytokine construct containing of IL-15 instead of IL-2, for more CD8-focused activation for cancer treatment.

[0217] These other cargos or therapeutics (e.g., adjuvants, oligonucleotides, anti-cancer agents, therapeutics for other immune-related diseases) can be present on the cytokine construct at 0.01 wt.% to 20 wt.% (e.g., 0.01 to 0.5 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, 0.5 to 1 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, 10 to 20 wt.%, 1 to 10 wt.%, 1 to 20 wt.%).Targeting Moi eties

[0218] One or more targeting moieties (a.k.a., targeting molecules) can be loaded into, attached to the surface of, and / or enclosed within the delivery vehicle. In embodiments, the targeting moiety is displayed on the exterior surface of the delivery vehicle. Such targeting moieties may be particularly beneficial for systemic delivery.

[0219] Exemplary target molecules include proteins, peptides, ligands, nucleic acids, lipids, saccharides, or polysaccharides that bind to one or more targets associated with an organ, tissue, cell, or extracellular matrix, or specific type of tumor or infected cell. The degree of specificity with which the delivery vehicles are targeted can be modulated through the selection of a targeting molecule with the appropriate affinity and specificity. For example, antibodies are very specific. These can be polyclonal, monoclonal, fragments, recombinant, or single chain, many of which are commercially available or readily obtained using standard techniques. T-cell specific molecules, antigens, and tumor targeting molecules can be bound to the surface of the cytokine constructs. The targeting molecules may be conjugated to the terminus of one or more PEG chains present on the surface of the particle.

[0220] In some embodiments, the targeting moiety is an antibody or antigen binding fragment (e.g., single chain variable fragments) thereof that specifically recognizes a cell or tumor marker that is present exclusively or in elevated amounts on a target cell, such as a malignant cell (e.g., a tumor antigen). Suitable targeting molecules that can be used to direct cytokine constructs to cells andtissues of interest, as well as methods of conjugating target molecules to nanoparticles, are known in the art. See Ruoslahti et al., 2002 for example.

[0221] In certain cases, therapeutic agents can be toxic to both cancer and immune cells, resulting in suboptimal efficacy. Thus, in certain embodiments, cytokine constructs can be conjugated with a targeting moiety to enrich the delivery of at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor to only cancer cells. Examples nonexclusively include antibodies against HER2, EGFR, PD-L1 , etc. that are overexpressed on cancer cells. In some embodiments, cytokine constructs can be conjugated with a targeting moiety to enrich the delivery of at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor to only immune cells.

[0222] Targeting molecules can also include neuropilins and endothelial targeting molecules, integrins, selectins, adhesion molecules, bone targeting molecules such as zoledronic acid and alendronic acid (e.g., to target cancer metastasized to bone), stroma, and fibroblast targeting molecules.

[0223] In some embodiments, the targeting moiety targets the cytokine construct to antigen- presenting cells (APCs), and particularly to a subclass of APCs known as dendritic cells. Dendritic cells express a number of cell surface receptors that can mediate endocytosis. In some embodiments, cytokine construct enhances the activity of DC to process tumor antigen. Targeted delivery to DC may be performed. Targeting exogenous antigens to internalizing surface molecules on systemically- distributed antigen presenting cells facilitates uptake of the particle and can overcome a major ratelimiting step in the therapy.

[0224] Dendritic cell targeting molecules include monoclonal or polyclonal antibodies or fragments thereof that recognize and bind to epitopes displayed on the surface of dendritic cells. Dendritic cell targeting molecules also include ligands which bind to a cell surface receptor on dendritic cells. One such receptor, the lectin DEC-205, has been used in vitro and in mice to boost both humoral (antibodybased) and cellular (CD8 T cell) responses by 2-4 orders of magnitude (Hawiger et al., 2001 ; Bonifaz et al., 2002; Bonifaz et al., 2004). In these reports, antigens were fused to an anti-DEC205 heavy chain and a recombinant antibody molecule was used for immunization.

[0225] A variety of other endocytic receptors, including a mannose-specific lectin (mannose receptor) and IgG Fc receptors, have also been targeted in this way with similar enhancement of antigen presentation efficiency. Other suitable receptors which may be targeted include, but are not limited to, DC-SIGN, 33D1 , SIGLEC-H, DCIR, CD1 1c, heat shock protein receptors and scavenger receptors. Targeting moieties for these receptors can be attached to the cytokine constructs for their preferential uptake into immune cells that express these receptors. Example is mannose attached on the cytokine constructs for targeted delivery to macrophages and DCs that have high levels of mannose receptors.

[0226] Other receptors which may be targeted include the toll-like receptors (TLRs). TLRs recognize and bind to pathogen-associated molecular patterns (PAMPs). PAMPs target the TLR on the surface of the dendritic cell and signals internally, thereby potentially increasing DC antigen uptake, maturation, and T-cell stimulatory capacity. PAMPs conjugated to the particle surface or coencapsulated include unmethylated CpG DNA (bacterial), double-stranded RNA (viral),lipopolysaccharide (bacterial), peptidoglycan (bacterial), lipoarabinomannan (bacterial), zymosan (yeast), mycoplasmal lipoproteins such as MALP-2 (bacterial), flagellin (bacterial) poly(inosinic- cytidylic) acid (bacterial), lipoteichoic acid (bacterial) or imidazoquinolines (synthetic).

[0227] Targeting molecules can be covalently bound to delivery vehicles using a variety of methods known in the art. In preferred embodiments the targeting moiety is attached to the delivery vehicle by PEGylation or a biotin-avidin bridge.

[0228] CD40 Agonist. In a particular embodiment, the targeting moiety targets CD40. The moiety can be a CD40 agonist. The cell surface molecule CD40 is a member of the tumor necrosis factor receptor superfamily and is broadly expressed by immune, hematopoietic, vascular, epithelial, and other cells, including a wide range of tumor cells. As a potential target for cancer therapy, CD40 may mediate tumor regression through both an indirect effect of immune activation and a direct cytotoxic effect on the tumor, resulting in a “two-for-one” mechanism of action of CD40 agonists. CD40 agonists are known in the art and reviewed in Vonderheide (2007). Exemplary agonists include recombinant CD40L (recombinant human trimer), CD-870, 893 (fully human lgG2 mAb), SGN-40 (humanized lgG1 ), and HCD 122 (fully human lgG1 mAb). Soluble agonistic CD40 antibodies have been shown to substitute for T-cell help provided by CD4+ lymphocytes in murine models of T cell-mediated immunity (Khalil et al., 2007).

[0229] Integrin Ligand. In another embodiment, the targeting moiety is a ligand for an integrin. Studies show that integrins are overexpressed on the surface of tumor cells and can thus serve as a marker that distinguishes between tumor cells and normal cells. Certain integrins also activate TGF-p through an extracellular pathway. After latent TGF-p is released from a tumor cell, it binds with integrin on the surface of the tumor cell, leading to the activation of the latent TGF-p. Increased TGF-p concentrations in the tumor microenvironment support immune suppression and recruit regulatory T cells to the tumor environment.

[0230] RGD peptide can serve a dual function: it is not only a typical integrin-targeting ligand (Ruoslahti et al., 1996) but also serves as an immune danger signal, activating APCs (Altincicek et al., 2009). Therefore, in a preferred embodiment, RGD peptide is loaded into, attached to the surface of, and / or enclosed within the delivery vehicle.

[0231] T Cell Receptor that Recognizes the p53 Antigen. In a particular embodiment, the targeting moiety is a T cell receptor (TCR) that recognizes the p53 antigen within the context of human MHC. T cell receptor recombinant proteins derived from bacterial, eukaryotic or yeast cells including T cell receptors composed of the alpha, beta chains or gamma / delta chains (a / p TCR or y / A TCRs).

[0232] IL-15 / IL-15Ra. In another embodiment, the targeting moiety is an IL-15 / IL-15Ra complex. Interleukin-15 (IL-15) is a cytokine that shares certain receptor subunits with IL-2 and thus has some overlapping mechanisms of action. IL-15 is expressed by dendritic cells and provides a critical signal for the proliferation and priming of natural killer (NK) cells. Accordingly, IL-15 / IL-15Ra complex can be used to target nanoparticulate compositions to, for example, natural killer (NK) cells.(VII) Delivery Systems or Vehicles

[0233] Embodiments of the herein-provided cytokine constructs are agnostic as to the delivery system employed for co-delivery of at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor. Thus, in various embodiments, the delivery system can use or be based on any type of known or to-be-developed particulate delivery vehicle. These include nanoparticles, fullerenes, endohedral metallofullerenes, trimetallic nitride templated endohedral metal lofu llerenes, single-walled and multi-walled carbon nanotubes, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled and multi-walled boron / nitrate nanotubes, calcium phosphate particles, aluminum salt particles, carbon nanotube peapods, carbon nanohorns, carbon nanohorn peapods, liposomes, lipid-based nanoparticles, lipoplex, polymeric nanoparticles, polyplex, nanoshells, dendrimers, microparticles, quantum dots, superparamagnetic nanoparticles, nanorods, cellulose nanoparticles, glass and polymer micro- and nano-spheres, biodegradable PLGA micro- and nanospheres, gold nanoparticles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, porous and non-porous silica nanoparticles, and modified micelles. Hybrid particles that consist of several classes of materials can also be used. Particles in nanometer and micron sizes can be used. Therapeutic agents, adjuvants, and any additional compounds can be included with the delivery agent by any suitable means, e.g., loaded into, attached to the surface of, coupled to, enclosed within, or contained within the delivery system. Such agents may be encapsulated, covalently bound, or non- covalently bound e.g., by electrostatic, hydrophobic, van der Waals, or compound-specific interaction (such nucleic acid base pairing, ligand-receptor, antibody-antigen, biotin-avidin, etc.))

[0234] In some embodiments, the delivery system includes a mesoporous silica nanoparticle (MSNP), such as those described in U.S. Patent Publication No. US2017 / 0172923 and No. 2017 / 0173169, the MSNPs of which are hereby incorporated by reference.

[0235] In some embodiments, the mean particle size of the mesoporous nanoparticle (or a different nanoparticle) is 5 nm to 200 nm, 5 nm to 90 nm, 5 nm to 20 nm, 30 nm to 100 nm, 30 nm to 80 nm, 30 nm to 60 nm, 40 nm to 80 nm, 70 nm to 90 nm, or 5 nm, 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, or 100 nm. In some embodiments, the mesoporous silica nanoparticle is coated with cationic polymers or other compounds. The cationic polymer may bind to the surface of the nanoparticle using any appropriate means. In some embodiments, the cationic polymer binds to the nanoparticle via electrostatic interaction. The cationic polymer may be any polymer with a positive charge, such as, but not limited to, PEI, Poly(p-amino esters) (PBAEs), polyamidoamine, poly(allylamine), poly(diallyldimethylammonium chloride), chitosan, poly(N-isopropyl acrylamide-co- acrylamide), poly(N-isopropyl aery lam ide-co-acrylic acid), poly(L-lysine), Poly(L-arginine), Poly(L- histidine), Poly(aspartic acid), Poly(glutamic acid), Poly(2-hydroxypropyl methacrylamide) (PHPMA) derivatives, Poly(ester amines) (PEAs), Poly(ester urethane) (PEUs), Poly(glycoamidoamines) (PGAAs), Poly(amidoamine) (PAA)-based polymers, diethylaminoethyl-dextran, poly-(N-ethyl- vinylpyridinium bromide), poly(dimethylamino)ethyl methacrylate), or polyethylene glycol)-co- poly(trimethylaminoethylmethacrylate chloride). Neutral or anionic polymers, such as, but not limited to, Poly(a-hydroxy esters) (PLA, PLGA, PCL), Poly(2-hydroxypropyl methacrylamide) (PHPMA)derivatives, dextran, hyaluronic acid, polyethyleneglycol, poly(acrylic acid), polymaleic acid, alginate, or polynucleotides, can also bind to a nanoparticle as-is or upon further modification of mesoporous silica nanoparticle. Other polymers will be apparent to those of skill in the art, and may be found, for example, in Polymer Handbook, 4thEdition, Edited by: Brandrup, E.H. Immergut, and E.A. Grukle; John Wiley & Sons, 2003).

[0236] The cationic polymers may be linear or branched. In some embodiments, the cationic polymers may range in size from 500 Da to 25 kDa and may be branched or linear. For example, branched PEI with an average size of 1 .8 kDa to 10 kDa, 1 .8 kDa to 25 kDa, 1 .8 kDa, 2.5 kDa, 5 kDa, 7.5 kDa, 10 kDa, 22 kDa, and 25 kDa, may be loaded onto the nanoparticle core. The ratio of cationic polymer to nanoparticle may be varied depending on the desired result. The cationic polymer may be present at 1 to 50 wt.% of the nanoconstruct, e.g., 5 to 40 wt.%, 10 to 30 wt.%, 20 to 30 wt.%, 5 to 15 wt.%, 5 to 20 wt.%, 5 to 25 wt.%, 5 to 30 wt.%, 10 to 20 wt.%, 10 to 25 wt.%, or 25 to 40 wt.%, e.g., 5, 10, 15, 20, 25, 30, or 35 wt.%. In some embodiments, the cationic polymer is present at 10 to 20 wt.%.

[0237] In some embodiments, the cationic polymer is crosslinked, e.g., with a cleavable disulfide bond, pre- or post-coating on the nanoparticle. In some embodiments, the attached cationic polymer is crosslinked after binding to the nanoparticles, e.g., MSNP, using, for example, DSP (dithiobis[succinimidyl propionate]), DTSSP (3,3’-dithiobis(sulfosuccinimidyl propionate), and DTBP (dimethyl 3,3’-dithiobispropionimidate). The crosslinking may occur in the absence or presence of free cationic polymer in solution. In other embodiments, the cationic polymer is not crosslinked.

[0238] A stabilizer may be conjugated to the MSNP (or a different nanoparticle) and / or the cationic polymer, e.g., by any appropriate means. In some embodiments, a stabilizer is conjugated to an amine or other reactive group of a cross-linked cationic polymer coated on the nanoparticle (e.g., a MSNP). Exemplary stabilizers include, but are not limited to, PEG, dextran, polysialic acid, hyaluronic acid, polyvinyl pyrrolidone, polyvinyl alcohol, and polyacrylamide, or a combination thereof.

[0239] A stabilizer may have multiple chemically reactive groups, e.g., for attachment to the nanoparticle, cationic polymer, and / or other component(s). For example, a reactive stabilizer, e.g., a PEG derivative, may have two electrophilic moieties, such as maleimide-PEG-N-hydroxysuccinimidyl ester (Mal-PEG-NHS), which contains both a Michael acceptor and an activated ester. The stabilizer, e.g., PEG, used in conjunction with the compositions and methods of the disclosure generally has a molecular weight ranging between 500 Da - 40 kDa, e.g., 2 - 10 kDa, 2 - 6 kDa, 1 kDa, 2 kDa, 5 kDa, 10 kDa, 20 kDa, 30 kDa, and 40 kDa. The stabilizer may be present at 1 to 50 wt.% of the nanoconstruct, e.g., 5 to 30 wt.%, 10 to 20 wt.%, 10 to 25 wt.%, 5 to 15 wt.%, 5 to 20 wt.%, 5 to 25 wt.%, 15 to 25 wt.%, or 1 to 10 wt.%, e.g., 5, 10, 15, 20, 25, 35, 40 or 45 wt.%.

[0240] “Mean particle size” as used herein, generally refers to the statistical mean particle size (diameter) of the particles in a population of particles. The diameter of an essentially spherical particle may refer to the physical or hydrodynamic diameter. The diameter of a non-spherical particle may refer preferentially to the hydrodynamic diameter. As used herein, the diameter of a non-spherical particle may refer to the largest linear distance between two points on the surface of the particle. Meanhydrodynamic particle size can be measured using methods known in the art, such as dynamic light scattering.

[0241] “Monodisperse” and “homogeneous size distribution”, are used interchangeably herein and describe a population of nanoparticles or microparticles where all of the particles are the same or nearly the same size. As used herein, a monodisperse distribution refers to particle distributions in which 90% of the distribution lies within 15% of the median particle size, more preferably within 10% of the median particle size, most preferably within 5% of the median particle size.

[0242] “Nanoparticle”, as used herein, generally refers to a particle having a diameter from 5 nm up to, but not including, 1 micron, for instance from 20 nm to 1 micron. The particles can have any shape. Nanoparticles having a spherical shape are generally referred to as “nanospheres”. The present disclosure is not limited to specific types or kinds of nanoparticles for complexing with at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor configured for treating or preventing cancer and related hyperprol iterative disorders.

[0243] Examples of nanoparticles include fullerenes (a.k.a. Geo, C70, C76, Cso, Cs4), endohedral metallofullerenes (EMI’s), which contain additional atoms, ions, or clusters inside their fullerene cage), trimetallic nitride templated endohedral metallofullerenes (TNT EMEs, high-symmetry four-atom molecular cluster endohedrals, which are formed in a trimetallic nitride template within the carbon cage), single-walled and multi-walled carbon nanotubes, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled and multi-walled boron / nitrate nanotubes, carbon nanotube peapods (nanotubes with internal metallo-fullerenes and / or other internal chemical structures), carbon nanohorns, carbon nanohorn peapods, lipid particles liposomes, lipoplex, polymeric nanoparticles, polyplex, nanoshells, dendrimers, quantum dots, superparamagnetic nanoparticles, nanorods, and cellulose nanoparticles. Other exemplary nanoparticles include glass and polymer micro- and nano-spheres, biodegradable PLGA micro- and nano-spheres, gold, silver, platinum, carbon, and iron nanoparticles.

[0244] In some embodiments, the nanoparticle is a modified micelle. In these embodiments, the modified micelle includes polyol polymers modified to contain a hydrophobic polymer block. The term “hydrophobic polymer block” as used in the present disclosure indicates a segment of the polymer that on its own would be hydrophobic. The term “micelle” as used herein refers to an aggregate of molecules dispersed in a liquid. A typical micelle in aqueous solution forms an aggregate with the hydrophilic “head” regions in contact with surrounding solvent, sequestering the hydrophobic single tail regions in the micelle center. In some embodiments the head region may be, for example, a surface region of the polyol polymer while the tail region may be, for example, the hydrophobic polymer block region of the polyol polymer.

[0245] The disclosure further encompasses use of particles on the micrometer scale in addition to the nanometer scale. Where microparticles are used, it is preferred that they are relatively small, on the order of 1 -50 micrometers. For ease of discussion, the use herein of “nanoparticles” encompasses true nanoparticles (sizes of from 1 nm to 1000 nm), microparticles (e.g., from 1 micrometer to 50 micrometers), or both.

[0246] Examples of nanoparticles include, by way of example and without limitation, paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers, dendrimers with covalently attached metal chelates, nanofibers, nanohorns, nano-onions, nanorods, nanoropes, and quantum dots. In some embodiments, a nanoparticle is a metal nanoparticle (for example, a nanoparticle of gold, palladium, platinum, silver, copper, nickel, cobalt, iridium, or an alloy of two or more thereof). Nanoparticles can include a core or a core and a shell, as in core-shell nanoparticles. Hybrid particles that consist of several classes of materials can also be used.

[0247] Cytokine construct-containing compositions including at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor each loaded into, attached to the surface of, and / or enclosed within a delivery vehicle, are disclosed. The nanoparticulate compositions offer a number of advantages over delivering the active agent or agents to the target cells in solution. For example, the nanoparticulate compositions present a localized concentration of the one or more active agents on or in a nanoparticle leading to increased avidity when the nanoparticle encounters the target cells. The nanoparticulate compositions can also serve as a depot of active agent with tunable release kinetics that can extend over several days to prolong effective systemic half-life and efficacy of the agent or agents.

[0248] Typically, two or more active agents (including at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor) are loaded into, attached to the surface of, and / or enclosed within a delivery vehicle. The relative concentrations of each of the two or more active agents and their location on or within the delivery vehicle can be manipulated during manufacture of the compositions to adapt a preferred dosage and presentation that will be received by the target cell. Loading of two or more active agents into or onto the same delivery vehicle allows the two or more active agents to be presented to the target cell or same tumor microenvironment simultaneously or in an otherwise predetermined order to the target cell.

[0249] The delivery vehicles can be, for example, nanolipogels, polymeric particles, silica particles, liposomes, or multilamellar vesicles. In the certain embodiments, the particulate delivery vehicles are nanoscale compositions, for example, 10 nm up to, but not including, 1 micron. However, it will be appreciated that in some embodiments, and for some uses, the particles can be smaller, or larger (e.g., microparticles, etc.). Although example cytokine constructs disclosed herein may be referred to nanoparticulate compositions, it will be appreciated that in some embodiments and for some uses the particulate compositions can be somewhat larger than nanoparticles. For example, particulate compositions can also be between 1 micron to 1000 microns. Such compositions can be referred to as microparticulate compositions.

[0250] In embodiments for treating cancer, it is desirable that the particle be of a size suitable to access the tumor microenvironment. In particular embodiments, the particle is of a size suitable to access the tumor microenvironment and / or the tumor cells by enhanced permeability and retention (EPR) effect. EPR refers to the property by which certain sizes of molecules (e.g., the particulate compositions discussed herein) tend to accumulate in tumor tissue much more than they do in normaltissues. Therefore, in compositions for treatment of cancer, the delivery vehicle is preferably in the range of 25 nm to 500 nm inclusive, more preferably in the range of 30 nm to 300 nm inclusive.

[0251] Nanolipogels. Nanolipogels are core-shell nano-particulates that combine the advantages of both liposomes and polymer-based particles for sustained delivery of active agents. In some of these embodiments and applications nanolipogels can exhibit, increased loading efficiency, increased sustained release, and improved therapeutic efficacy for combinations of macromolecules and molecules compared to conventional nanoparticle compositions.

[0252] Typically, the outer shell of the nanolipogel protects cargo and provides biocompatibility as well as a surface for functionalization with targeting molecule(s). The outer shell encapsulates components, so they are not exposed until desired, for example, in response to environmental conditions or stimuli, creating monodisperse, reproducible particle populations, and mediating internalization into desired cell types. The inner core, which can be a dendrimer or other polymer, has separate and additive functionalities to the outer shell. For example, the inner shell allows for secondary deposition of drug, vaccine, or imaging agent; increases loading of components with different physiochemical properties into the particle; allows for tunable release of contents from particles; increases cytosolic availability of DNA / RNA, drug, and / or protein by disrupting endosomes, all leading to enhanced drug effects, antigen presentation, and transfection / silencing.

[0253] Nanolipogels have a polymer matrix core containing one or more host molecules. The polymeric matrix is preferably a hydrogel, such as a crosslinked block copolymer containing one or more poly(alkylene oxide) segments, such as polyethylene glycol, and one or more aliphatic polyester segments, such as polylactic acid. One or more cargo molecules are dispersed within or covalently bound to the polymeric matrix. The hydrogel core is surrounded by a liposomal shell.

[0254] Nanolipogels can be constructed to incorporate a variety of active agents that can subsequently be released in a controlled fashion. Active agents can be dispersed within the hydrogel matrix, dispersed within the liposomal shell, covalently attached to the liposomal shell, and combinations thereof. Active agents can be selectively incorporated at each of these locales within the nanolipogel. Furthermore, the release rate of active agents from each of these locales can be independently tuned. Because each of these locales possesses distinct properties, including size and hydrophobicity / hydrophilicity, the chemical entities independently incorporated at each of these locales can differ dramatically with respect to size and composition. For example, nanolipogels can be loaded with one or more compounds dispersed within the polymeric matrix as well as at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor. Nanolipogels can be loaded provide simultaneous sustained release of agents that differ widely in chemical composition and molecular weight.

[0255] Nanolipogels are typically spherical in shape, with average particle sizes ranging between 50 nm and 1000 nm, more preferably between 75 nm and 300 nm, most preferably between 90 nm and 200 nm. In certain embodiments, the nanolipogels possess an average particle size between 100 nm and 140 nm. Particles may be non-spherical.

[0256] Depending upon the nature of the lipids present in the liposomal shell of the nanolipogels, nanolipogels having a positive, negative, or near neutral surface charge may be prepared. In certain embodiments, the nanolipogels possess a near neutral surface charge. In certain embodiments, the nanolipogels possess a ^-potential of between 10 mV and -10 mV, more preferably between 5 mV and -5 mV, more preferably between 3 mV and -3 mV, most preferably between 2 mV and -2 mV.

[0257] Hydrophobic active agents, such as proteins, may be covalently connected to the surface of the nanolipogel, whereas hydrophilic active agents may be covalently connected to the surface of the nanolipogel or dispersed within the liposomal shell. In certain embodiments, the liposomal shell includes one or more PEGylated lipids. In these cases, one or more active agents may be conjugated to the terminus of one or more PEG chains present on the surface of the liposomal shell.

[0258] In another embodiment, the lipid is modified to include an avidin moiety, enabling a biotinylated targeting moiety, detectable label, or other active agent to be coupled thereto, if so desired.

[0259] In particular embodiments, one or more active agents are covalently connected to the surface of the nanolipogel via a linking group that is cleaved in response to an external chemical or physical stimulus, such as a change in ambient pH, so as to trigger release of the active agent at a desired physiological locale.

[0260] Core. The nanolipogel core is formed from a polymeric matrix. The matrix can include one or more host molecules as discussed in more detail below. The nanolipogel core may further include one or more active agents. The active agents may be complexed to a host molecule, dispersed with polymeric matrix, or combinations thereof.

[0261] The polymeric matrix of the nanolipogels may be formed from one or more polymers or copolymers. By varying the composition and morphology of the polymeric matrix, one can achieve a variety of controlled release characteristics, permitting the delivery of moderate constant doses of one or more active agents over prolonged periods of time.

[0262] The polymeric matrix may be formed from non-biodegradable or biodegradable polymers; however, preferably, the polymeric matrix is biodegradable. The polymeric matrix can be selected to degrade over a time period ranging from one day to one year, more preferably from seven days to 26 weeks, more preferably from seven days to 20 weeks, most preferably from seven days to 16 weeks. Biodegradable cross-linkers may be used to increase molecular weight of polymers, which are clearable from the body as small fragments after degradation of the cross-linkers.

[0263] In general, synthetic polymers are preferred, although natural polymers may be used. Representative polymers include poly(hydroxy acids) such as poly(lactic acid), poly(glycolic acid), poly(lactic acid-co-glycolic acids), polyhydroxyalkanoates such as poly3-hydroxybutyrate or poly4- hydroxybutyrate; polycaprolactones; poly (orthoesters); polyanhydrides; poly(phosphazenes); poly(lactide-co-caprolactones); poly(glycolide-co-caprolactones); polycarbonates such as tyrosine polycarbonates; polyamides (including synthetic and natural polyamides), polypeptides, and poly(amino acids); polyesteramides; other biocompatible polyesters; poly(dioxanones); poly(alkylene alkylates); hydrophilic polyethers; polyurethanes; polyetheresters; polyacetals; polycyanoacrylates; polysiloxanes; poly(oxyethylene) / poly(oxypropylene) copolymers; polyketals; polyphosphates;polyhydroxyvalerates; polyalkylene oxalates; polyalkylene succinates; poly(maleic acids), polyvinyl alcohols, polyvinylpyrrolidone; poly(alkylene oxides) such as polyethylene glycol (PEG); derivativized celluloses such as alkyl celluloses e.g., methyl cellulose), hydroxyalkyl celluloses (e.g., hydroxypropyl cellulose), cellulose ethers, cellulose esters, nitrocelluloses, polymers of acrylic acid, methacrylic acid or copolymers or derivatives thereof including esters, poly(methyl methacrylate), poly(ethyl methacrylate), poly(butylmethacrylate), poly(isobutyl methacrylate), poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate) (jointly referred to herein as “polyacrylic acids”), as well as derivatives, copolymers, and blends thereof.

[0264] As used herein, “derivatives” include polymers having substitutions, additions of chemical groups and other modifications to the polymeric backbones described above routinely made by those skilled in the art. Natural polymers, including proteins such as albumin, collagen, gelatin, prolamines, such as zein, and polysaccharides such as alginate and pectin, may also be incorporated into the polymeric matrix. While a variety of polymers may be used to form the polymeric matrix, generally, the resulting polymeric matrix will be a hydrogel. In certain cases, when the polymeric matrix contains a natural polymer, the natural polymer is a biopolymer which degrades by hydrolysis, such as a polyhydroxyalkanoate.

[0265] The polymeric matrix may optionally contain one or more crosslinkable polymers. Preferably, the crosslinkable polymers contain one or more photo-polymerizable groups, allowing for the crosslinking of the polymeric matrix following nanolipogel formation. Examples of suitable photo- polymerizable groups include vinyl groups, acrylate groups, methacrylate groups, and acrylamide groups. Photo-polymerizable groups, when present, may be incorporated within the backbone of the crosslinkable polymers, within one or more of the sidechains of the crosslinkable polymers, at one or more of the ends of the crosslinkable polymers, or combinations thereof.

[0266] The polymeric matrix may be formed from polymers having a variety of molecular weights, so as to form nanolipogels having properties, including drug release rates, optimal for specific applications. Generally, the polymers which make up the polymeric matrix possess average molecular weights ranging between 500 Da and 50 kDa. In cases where the polymeric matrix is formed from non-crosslinkable polymers, the polymers typically possess average molecular weights ranging between 1 kDa and 50 kDa, more preferably between 1 kDa and 70 kDa, most preferably between 5 kDa and 50 kDa. In cases where the polymeric matrix is formed from crosslinkable polymers, the polymers typically possess lower average molecular weights ranging between 500 Da and 25 kDa, more preferably between 1 kDa and 10 kDa, most preferably between 3 kDa and 6 kDa. In particular embodiments the polymeric matrix is formed from a crosslinkable polymer having an average molecular weight of 5 kDa.

[0267] In some embodiments, the polymeric matrix is formed from a poly(alkylene oxide) polymer or a block copolymer containing one or more poly(alkylene oxide) segments. The poly(alkylene oxide) polymer or poly(alkylene oxide) polymer segments may contain between 8 and 500 repeat units, morepreferably between 40 and 300 repeat units, most preferably between 50 and 150 repeat units. Suitable poly(alkylene oxides) include: polyethylene glycol (also referred to as polyethylene oxide or PEG), polypropylene 1 ,2-glycol, polypropylene oxide), polypropylene 1 ,3-glycol, and copolymers thereof.

[0268] In some embodiments, the polymeric matrix is formed from an aliphatic polyester or a block copolymer containing one or more aliphatic polyester segments. Preferably the polyester or polyester segments are poly(lactic acid) (PLA), poly(glycolic acid) PGA, or poly(lactide-co-glycolide) (PLGA).

[0269] In some embodiments, the polymeric matrix is formed from a block copolymer containing one or more poly(alkylene oxide) segments, one or more aliphatic polyester segments, and optionally one or more photo-polymerizable groups. In these cases, the one or more poly(alkylene oxide) segments imbue the polymer with the necessary hydrophilicity, such that the resultant polymer matrix forms a suitable hydrogel, while the polyester segments provide a polymeric matrix with tunable hydrophobicity / hydrophi licity and / or the desired in vivo degradation characteristics.

[0270] The degradation rate of the polyester segments, and often the corresponding drug release rate, can be varied from days (in the case of pure PGA) to months (in the case of pure PLA), and may be readily manipulated by varying the ratio of PLA to PGA in the polyester segments. In addition, the poly(alkylene oxides), such as PEG, and aliphatic polyesters, such as PGA, PLA, and PLGA have been established as safe for use in humans; these materials have been used in human clinical applications, including drug delivery systems, for more than 30 years.

[0271] In certain embodiments, the polymeric matrix is formed from a tri-block copolymer containing a central poly(alkylene oxide) segment, adjoining aliphatic polyester segments attached to either end of the central poly(alkylene oxide) segment, and one or more photo-polymerizable groups. Preferably, the central poly(alkylene oxide) segment is PEG, and aliphatic polyesters segments are PGA, PLA, or PLGA.

[0272] Generally, the average molecular weight of the central poly(alkylene oxide) segment is greater than the average molecular weight of the adjoining polyester segments. In certain embodiments, the average molecular weight of the central poly(alkylene oxide) segment is at least three times greater than the average molecular weight of one of the adjoining polyester segments, more preferably at least five times greater than the average molecular weight of one of the adjoining polyester segments, most preferably at least ten times greater than the average molecular weight of one of the adjoining polyester segments.

[0273] In some cases, the central poly(alkylene oxide) segment possesses an average molecular weight ranging between 500 Da and 10,000 Da, more preferably between 1 ,000 Da and 7,000 Da, most preferably between 2,500 Da and 5,000 Da. In particular embodiments, average molecular weight of the central poly(alkylene oxide) segment is 4,000 Da. Typically, each adjoining polyester segment possesses an average molecular weight ranging between 100 Da and 3,500 Da, more preferably between 100 Da and 1 ,000 Da, most preferably between 100 Da and 500 Da.

[0274] Examples of natural polymers include proteins such as albumin, collagen, gelatin and prolamines, for example, zein, and polysaccharides such as alginate, cellulose derivatives andpolyhydroxyalkanoates, for example, polyhydroxybutyrate. The in vivo stability of the microparticles can be adjusted during the production by using polymers such as poly(lactide-co-glycolide) copolymerized with polyethylene glycol (PEG). If PEG is exposed on the external surface, it may increase the time these materials circulate due to the hydrophilicity of PEG.

[0275] Examples of non-biodegradable polymers include ethylene vinyl acetate, poly(meth)acrylic acid, polyamides, copolymers, and mixtures thereof.

[0276] The matrix can also be made of gel-type polymers, such as alginate, produced through traditional ionic gelation techniques. The polymers are first dissolved in an aqueous solution, mixed with barium sulfate or some bioactive agent, and then extruded through a microdroplet forming device, which in some instances employs a flow of nitrogen gas to break off the droplet. A slowly stirred (approximately 100-170 PPM) ionic hardening bath is positioned below the extruding device to catch the forming microdroplets. The microparticles are left to incubate in the bath for twenty to thirty minutes in order to allow sufficient time for gelation to occur. Microparticle size is controlled by using various size extruders or varying either the nitrogen gas or polymer solution flow rates. Chitosan microparticles can be prepared by dissolving the polymer in acidic solution and crosslinking it with tripolyphosphate. Carboxymethyl cellulose (CMC) microparticles can be prepared by dissolving the polymer in acid solution and precipitating the microparticle with lead ions. In the case of negatively charged polymers (e.g., alginate, CMC), positively charged ligands (e.g., polylysine, polyethylenimine) of different molecular weights can be ionically attached.

[0277] Perhaps the most widely used are the aliphatic polyesters, specifically the hydrophobic poly(lactic acid) (PLA), more hydrophilic poly(glycolic acid) PGA and their copolymers, poly(lactide- co-glycolide) (PLGA). The degradation rate of these polymers, and often the corresponding drug release rate, can vary from days (PGA) to months (PLA) and is easily manipulated by varying the ratio of PLA to PGA. Second, the physiologic compatibility of PLGA and its homopolymers PGA and PLA have been established for safe use in humans; these materials have a history of over 30 years in various human clinical applications including drug delivery systems. PLGA nanoparticles can be formulated in a variety of ways that improve drug pharmacokinetics and biodistribution to target tissue by either passive or active targeting. The microparticles are designed to release molecules to be encapsulated or attached over a period of days to weeks. Factors that affect the duration of release include pH of the surrounding medium (higher rate of release at pH 5 and below due to acid catalyzed hydrolysis of PLGA) and polymer composition. Aliphatic polyesters differ in hydrophobicity and that in turn affects the degradation rate. Specifically, the hydrophobic poly(lactic acid) (PLA), more hydrophilic poly (glycolic acid) PGA and their copolymers, poly(lactide-co-glycolide) (PLGA) have various release rates. The degradation rate of these polymers, and often the corresponding drug release rate, can vary from days (PGA) to months (PLA) and is easily manipulated by varying the ratio of PLA to PGA.

[0278] Shell Components. Nanolipogels include a liposomal shell composed of one or more concentric lipid monolayers or lipid bilayers. The shell can further include one or more active agents, targeting molecules, or combinations thereof.

[0279] Nanolipogels include a liposomal shell composed of one or more concentric lipid monolayers or lipid bilayers. The composition of the liposomal shell may be varied to influence the release rate of one or more active agents in vivo. The lipids may also be covalently crosslinked, if desired, to alter in v / vo drug release.

[0280] The lipid shell can be formed from a single lipid bilayer (unilamellar) or several concentric lipid bilayers (multilamellar). The lipid shell may be formed from a single lipid; however, in preferred embodiments, the lipid shell is formed from a combination of more than one lipid. The lipids can be neutral, anionic, or cationic at physiologic pH.

[0281] Suitable neutral and anionic lipids include sterols and lipids such as cholesterol, phospholipids, lysolipids, lysophospholipids, and sphingolipids. Neutral and anionic lipids include, but are not limited to, phosphatidylcholine (PC) (such as egg PC, soy PC), including 1 ,2-diacyl-glycero-3- phosphocholines; phosphatidylserine (PS), phosphatidylglycerol, phosphatidylinositol (PI); glycolipids; sphingophospholipids, such as sphingomyelin; sphingoglycolipids (also known as 1 - ceramidyl glucosides), such as ceramide galactopyranoside, gangliosides and cerebrosides; fatty acids, sterols containing a carboxylic acid group such as cholesterol or derivatives thereof; and 1 ,2- diacyl-sn-glycero-3-phosphoethanolamines, including 1 ,2-dioleoyl-sn-Glycero-3- phosphoethanolamine or 1 ,2-dioleolylglyceryl phosphatidylethanolamine (DOPE), 1 ,2- dihexadecylphosphoethanolamine (DHPE), 1 ,2-distearoylphosphatidylcholine (DSPC), 1 ,2- dipalmitoylphosphatidylcholine (DPPC), and 1 ,2-dimyristoylphosphatidylcholine (DMPC). Also suitable are natural (e.g., tissue derived L-. alpha. -phosphatidyl: egg yolk, heart, brain, liver, soybean) and / or synthetic (e.g., saturated and unsaturated 1 ,2-diacyl-sn-glycero-3-phosphocholines, 1 -acyl-2- acyl-sn-glycero-3-phosphocholines, 1 ,2-diheptanoyl-SN-glycero-3-phosphocholine) derivatives of these lipids.

[0282] Suitable cationic lipids include N-[1 -(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl ammonium salts, also referred to as TAP lipids, for example as a methylsulfate salt. Suitable TAP lipids include, but are not limited to, DOTAP (dioleoyl-), DMTAP (dimyristoyl-), DPTAP (dipalmitoyl-), and DSTAP (distearoyl-). Other suitable cationic lipids include dimethyldioctadecyl ammonium bromide (DDAB), 1 ,2-diacyloxy-3-trimethylammonium propanes, N-[1 -(2,3-dioloyloxy)propyl]-N,N-dimethyl amine (DODAP), 1 ,2-diacyloxy-3-dimethylammonium propanes, N-[1 -(2,3-dioleyloxy)propyl]-N,N,N- trimethylammonium chloride (DOTMA), 1 ,2-dialkyloxy-3-dimethylammonium propanes, dioctadecylamidoglycylspermine (DOGS), 3-[N-(N',N'-dimethylamino-ethane)carbamoyl]cholesterol (DC-Chol); 2,3-dioleoyloxy-N-(2-(sperminecarboxamido)-ethyl)-N,N-dimethyl-1 -propanam- inium trifluoro-acetate (DOSPA), .beta. -alanyl cholesterol, cetyltrimethylammonium bromide (CTAB), diCu- amidine, N-tert-butyl-N'-tetradecyl-3-tetradecylamino-propionamidine, N-(alpha- trimethylammonioacetyl)didodecyl-D-glutamate chloride (TMAG), ditetradecanoyl-N- (trimethylammonio-acetyl)diethanolamine chloride, 1 ,3-dioleoyloxy-2-(6-carboxy-spermyl)- propylamide (DOSPER), and N,N,N',N'-tetramethyl-, N'-bis(2-hydroxylethyl)-2,3-dioleoyloxy-1 ,4- butanediammonium iodide, 1 -[2-(acyloxy)ethyl]2-alkyl(alkenyl)-3-(2-hydroxyethyl)-imidazolinium chloride derivatives, such as 1 -[2-(9(Z)-octadecenoyloxy)ethyl]-2-(8(Z)-heptadecenyl-3-(2-hydroxyethyl)- imidazolinium chloride (DOTIM) and 1 -[2-(hexadecanoyloxy)ethyl]-2-pentadecyl-3-(2- hydroxyethyl)imidazoliniiim chloride (DPTIM), and 2,3-dialkyloxypropyl quaternary ammonium derivatives containing a hydroxyalkyl moiety on the quaternary amine, for example, 1 ,2-dioleoyl-3- dimethyl-hydroxyethyl ammonium bromide (DORI), 1 ,2-dioleyloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide (DORIE), 1 ,2-dioleyloxypropyl-3-dimethyl-hydroxypropyl ammonium bromide (DORIE-HP), 1 ,2-dioleyl-oxy-propyl-3-dimethyl-hydroxybutyl ammonium bromide (DORIE-HB), 1 ,2- dioleyloxypropyl-3-dimethyl-hydroxypentyl ammonium bromide (DORIE-Hpe), 1 ,2- dimyristyloxypropyl-3-dimethyl-hydroxylethyl ammonium bromide (DMRIE), 1 ,2-dipalmityloxypropyl- 3-dimethyl-hydroxyethyl ammonium bromide (DPRIE), and 1 ,2-disteryloxypropyl-3-dimethyl- hydroxyethyl ammonium bromide (DSRIE).

[0283] Other suitable lipids include PEGylated derivatives of the neutral, anionic, and cationic lipids described above. Incorporation of one or more PEGylated lipid derivatives into the lipid shell can result in a nanolipogel which displays polyethylene glycol chains on its surface. The resulting nanolipogels may possess increased stability and circulation time in vivo as compared to nanolipogels lacking PEG chains on their surfaces. Examples of suitable PEGylated lipids include distearoylphosphatidylethanlamine-polyethylene glycol (DSPE-PEG), including DSPE PEG (2000 MW) and DSPE PEG (5000 MW), dipalmitoyl-glycero-succinate polyethylene glycol (DPGS-PEG), stearyl-polyethylene glycol and cholesteryl-polyethylene glycol.

[0284] In certain embodiments, the lipid shell is formed from a combination of more than one lipid. In certain embodiments the lipid shell is formed from a mixture of at least three lipids. In particular embodiments, the lipid shell is formed from a mixture of phosphatidyl choline (PC), 1 ,2-distearoyl-sn- glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000] (DSPE-PEG), and cholesterol.

[0285] In some embodiments, the lipid shell is formed from a mixture of one or more PEGylated phospholipids and one or more additional lipids or sterols. In certain instances, the molar ratio of the one or more PEGylated lipids to the one or more additional lipids or sterols ranges from 1 :1 to 1 :6, more preferably from 1 :2 to 1 :6, most preferably from 1 :3 to 1 :5. In particular embodiments, the molar ratio of the one or more PEGylated lipids to the one or more additional lipids or sterols is 1 :4.

[0286] In some embodiments, the lipid shell is formed from a mixture of one or more phospholipids and one or more additional lipids or sterols. In certain instances, the molar ratio of the one or more phospholipids to the one or more additional lipids or sterols ranges from 1 :1 to 6:1 , more preferably from 2:1 to 6:1 , most preferably from 3:1 to 5:1 . In particular embodiments, the molar ratio of the one or more phospholipids to the one or more additional lipids or sterols is 4:1 .

[0287] In preferred embodiments, the lipid shell is formed from a mixture of a phospholipid, such as phosphatidyl choline (PC), a PEGylated phospholipid, such as 1 ,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[amino(polyethylene glycol)-2000] (DSPE-PEG), and cholesterol. In particular embodiments, the lipid shell is formed from a mixture of phosphatidyl choline, 1 ,2-distearoyl- sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000] (DSPE-PEG), and cholesterol in a 3:1 :1 molar ratio.

[0288] Polymeric Particles. The delivery vehicle can also be a polymeric particle, for example a micro- or a nanoparticle. The particles can be biodegradable or non-biodegradable. Exemplary polymers that can be used to manufacture polymeric particles are discussed above with respect to the polymeric matrix component of nanolipogels.

[0289] Examples of preferred biodegradable polymers include polymers of hydroxy acids such as lactic acid and glycolic acid, and copolymers with PEG, polyanhydrides, poly(ortho)esters, polyurethanes, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), blends and copolymers thereof. In preferred embodiments, the particles are composed of one or more polyesters.

[0290] For example, particles can contain one more of the following polyesters: homopolymers including glycolic acid units, referred to herein as “PGA”, and lactic acid units, such as poly-L-lactic acid, poly-D-lactic acid, poly-D,L-lactic acid, poly-L-lactide, poly-D-lactide, and poly-D,L-lactide, collectively referred to herein as “PLA”, and caprolactone units, such as poly(. epsilon. -caprolactone), collectively referred to herein as “PCL”; and copolymers including lactic acid and glycolic acid units, such as various forms of poly (lactic acid-co-glycolic acid) and poly(lactide-co-glycolide) characterized by the ratio of lactic acid:glycolic acid, collectively referred to herein as “PLGA”; and polyacrylates, and derivatives thereof. Exemplary polymers also include copolymers of polyethylene glycol (PEG) and the aforementioned polyesters, such as various forms of PLGA-PEG or PLA-PEG copolymers, collectively referred to herein as “PEGylated polymers”. In certain embodiments, the PEG region can be covalently associated with polymer to yield “PEGylated polymers” by a cleavable linker. Alginate polymers may also be used.

[0291] In some embodiments, the particles are composed of PLGA. PLGA is a safe, FDA approved polymer. PLGA particles are advantageous because they can protect the active agent ( / .e., the encapsulant), promote prolonged release, and are amenable to the addition of targeting moieties.

[0292] The particles can contain one or more polymer conjugates containing end-to-end linkages between the polymer and a targeting moiety, detectable label, or other active agent. For example, a modified polymer can be a PLGA-PEG-phosphonate. In another example, the particle is modified to include an avidin moiety and a biotinylated targeting moiety, detectable label, or other active agent can be coupled thereto.

[0293] Examples of preferred natural polymers include proteins such as albumin, collagen, gelatin and prolamines, for example, zein, and polysaccharides such as alginate, cellulose derivatives and polyhydroxyalkanoates, for example, polyhydroxybutyrate. The in vivo stability of the particles can be adjusted during the production by using polymers such as poly(lactide-co-glycolide) copolymerized with polyethylene glycol (PEG). If PEG is exposed on the external surface, it may increase the time these materials circulate due to the hydrophilicity of PEG.

[0294] Examples of non-biodegradable polymers include ethylene vinyl acetate, poly(meth)acrylic acid, polyamides, copolymers, and mixtures thereof.

[0295] Nanolipogels. A nanolipogel is a nanoparticle that combines the advantages of both liposomes and polymer-based particles for sustained delivery of nucleic acids, proteins and / or small molecules. The nanolipogel can be in the form of spheres, discs, rods, or other geometries with different aspectratios. The nanosphere can be larger, microparticles. The nanolipogel is typically formed of synthetic or natural polymers capable of encapsulating agents by remote loading and tunable in properties so as to facilitate different rates of release. Release rates are modulated by varying the polymer to lipid ratio from 0.05 to 5.0, more preferably from 0.5 to 1 .5.

[0296] Nanolipogels are designed to be loaded with agents either prior to, during or after formation and subsequently function as controlled-release vehicles for the agents. The nanolipogel can be loaded with more than one agent such that controlled release of the multiplicity of agents is subsequently achieved.

[0297] The nanolipogel is loaded with at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor during formation and / or following formation by the process of rehydration of the nanolipogel in the presence of the agents. For example, the nanolipogel is loaded with a molecule that serves as a mitotic kinase inhibitor and the nanolipogel thereafter incorporates one or more immune checkpoint inhibitor after formation (or vice versa), for the co-delivery and release of both inhibitors together.Polymeric Nanoparticles

[0298] Emulsion Method. In some embodiments, the polymeric nanoparticle is prepared using an emulsion solvent evaporation method. For example, a polymeric material is dissolved in a water immiscible organic solvent and mixed with a drug solution or a combination of drug solutions. The water immiscible organic solvent can be, but is not limited to, one or more of the following: chloroform, dichloromethane, and acyl acetate. The drug can be dissolved in, but is not limited to, one or more of the following: acetone, ethanol, methanol, isopropyl alcohol, acetonitrile and dimethyl sulfoxide (DMSO). An aqueous solution is then added into the resulting mixture solution to yield emulsion solution by emulsification. The emulsification technique can be, but is not limited to, probe sonication or homogenization through a homogenizer. The peptides or fluorophores or drugs may be associated with the surface of, encapsulated within, surrounded by, and / or distributed throughout, the polymeric matrix of the particle.

[0299] Nanoprecipitation Method. In another embodiment, the polymeric nanoparticles are prepared using nanoprecipitation methods or microfluidic devices. A polymeric material is mixed with a drug or drug combinations in a water miscible organic solvent. The resulting mixture solution is then added to an aqueous solution to yield a nanoparticle solution.

[0300] Exemplary Methods of Preparation. Particles can be fabricated from different polymers using a variety of methods that and can be selected based on criteria including the polymeric composition of the particle, the agent(s) being loaded into or associated with the particle according to method that are known in the art. Exemplary methods are provided below.

[0301] Solvent Evaporation. In this method the polymer is dissolved in a volatile organic solvent, such as methylene chloride. The drug (either soluble or dispersed as fine particles) is added to the solution, and the mixture is suspended in an aqueous solution that contains a surface-active agent such as poly(vinyl alcohol). The resulting emulsion is stirred until most of the organic solvent evaporated,leaving solid particles. The resulting particles are washed with water and dried overnight in a lyophilizer. Particles with different sizes (0.5-1000 microns) and morphologies can be obtained by this method. This method is useful for relatively stable polymers like polyesters and polystyrene.

[0302] However, labile polymers, such as polyanhydrides, may degrade during the fabrication process due to the presence of water. For these polymers, the following two methods, which are performed in completely anhydrous organic solvents, are more useful.

[0303] Hot Melt Microencapsulation. In this method, the polymer is first melted and then mixed with the solid particles. The mixture is suspended in a non-miscible solvent (like silicon oil), and, with continuous stirring, heated to 5sC. above the melting point of the polymer. Once the emulsion is stabilized, it is cooled until the polymer particles solidify. The resulting particles are washed by decantation with petroleum ether to give a free-flowing powder. Particles with sizes between 0.5 to 1000 microns are obtained with this method. The external surfaces of spheres prepared with this technique are usually smooth and dense. This procedure is used to prepare particles made of polyesters and polyanhydrides. However, this method is limited to polymers with molecular weights between 1 ,000-50,000.

[0304] Solvent Removal. This technique is primarily designed for polyanhydrides. In this method, the drug is dispersed or dissolved in a solution of the selected polymer in a volatile organic solvent like methylene chloride. This mixture is suspended by stirring in an organic oil (such as silicon oil) to form an emulsion. Unlike solvent evaporation, this method can be used to make particles from polymers with high melting points and different molecular weights. Particles that range between 1 -300 microns can be obtained by this procedure. The external morphology of spheres produced with this technique is highly dependent on the type of polymer used.

[0305] Spray-Drying. In this method, the polymer is dissolved in organic solvent. A known amount of the active drug is suspended (insoluble drugs) or co-dissolved (soluble drugs) in the polymer solution. The solution or the dispersion is then spray-dried. Typical process parameters for a mini-spray drier (Buchi) are as follows: polymer concentrations.04 g / mL, inlet temperature=-24aC., outlet temperature=13-15sC., aspirator setting=15, pump setting=10 mL / minute, spray flow=600 Nl / hr, and nozzle diameters.5 mm. Microparticles ranging between 1 -10 microns are obtained with a morphology which depends on the type of polymer used.

[0306] Hydrogel Particles. Particles made of gel-type polymers, such as alginate, are produced through traditional ionic gelation techniques. The polymers are first dissolved in an aqueous solution, mixed with barium sulfate or some bioactive agent, and then extruded through a microdroplet forming device, which in some instances employs a flow of nitrogen gas to break off the droplet. A slowly stirred (approximately 100-170 RPM) ionic hardening bath is positioned below the extruding device to catch the forming microdroplets. The particles are left to incubate in the bath for twenty to thirty minutes in order to allow sufficient time for gelation to occur. Particle size is controlled by using various size extruders or varying either the nitrogen gas or polymer solution flow rates. Chitosan particles can be prepared by dissolving the polymer in acidic solution and crosslinking it with tripolyphosphate. Carboxymethyl cellulose (CMC) particles can be prepared by dissolving the polymer in acid solutionand precipitating the particle with lead ions. In the case of negatively charged polymers (e.g., alginate, CMC), positively charged ligands (e.g., polylysine, polyethylenimine) of different molecular weights can be ionically attached.Other Delivery Vehicles

[0307] In some embodiments, the delivery vehicles are liposomes or lipid nanoparticles. Liposomes are typically spherical vesicles composed of a lamellar phase lipid bilayer. The liposomes can be, for example, multilamellar vesicles (MLV), small unilamellar liposome vesicles (SUV), large unilamellar vesicles (LUV), or cochleate vesicles. Liposomes, micelles, and other lipid-based delivery vehicles useful for preparation of the disclosed nanoparticulate compositions are known in the art. See, for example, Torchilin et al., 2006. It is anticipated that a wide variety of liposomes and exosomes may be used with the present disclosure. Liposomes may include N-[1 -(2,3-Dioleoyloxy)propyl]-N,N,N- trimethylammonium methyl-sulfate (DOTAP) or Lipofectamine™. In some embodiments, a delivery system involving chitosan may be used as described, e.g., in Lu et al. (Cancer Cell, 18:185-197, 2010). In some embodiments, a nanovector may be used to deliver a miRNA to a subject; nanovectors are described, e.g., in Pramanik et al, 2011 ).

[0308] The delivery vehicle can also be silica particles. Suitable silica particles useful for preparation of the disclosed nanoparticulate compositions are also known in the art. See, for example, Barbe et al., 2004, Ngamcherdtrakul et al., 2015. and Argyo etal., 2014. For example, in some embodiments, a silicone nanoparticle (e.g., as described in Bharali et al., 2005 may be used to deliver at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor to a cell. Solubility of silica or silicon in the body provides the ability for time-release of the agents that the particles carry. In addition, biodegradable polymers or bioreducible crosslinking agents can be used to modify the silica or silicon particles to provide the time-release ability.(VIII) Antibodies

[0309] At least some of the agents herein (such as agents used to induce immune checkpoint blockade) are antibodies. An antibody is a type of binding agent, which is a molecule that can bind a target ligand, for instance on the surface of a cell or in a biological sample. The term antibody includes both whole antibodies and functional (that is, maintaining significant and specific target binding) fragments thereof. The terms “antibody” and “immunoglobulin” are used interchangeably herein and are well understood by those in the field. Those terms refer to a protein including one or more polypeptides that specifically binds an antigen. One form of antibody includes the basic structural unit of an antibody. This form is a tetramer and includes two pairs of antibody chains, each pair having one light and one heavy chain. In each pair, the light and heavy chain variable regions are together responsible for binding to the antigen recognized by that antibody, and the constant regions are responsible for the antibody effector functions.

[0310] The recognized immunoglobulin polypeptides include the kappa and lambda light chains and the alpha, gamma (lgG1 , lgG2, lgG3, lgG4), delta, epsilon and mu heavy chains or equivalents inother species. Full-length immunoglobulin “light chains” (of 25 kDa or 214 amino acids) include a variable region of 1 10 amino acids at the NH2-terminus and a kappa or lambda constant region at the COOH-terminus. Full-length immunoglobulin “heavy chains” (of 50 kDa or 446 amino acids), similarly include a variable region (of 116 amino acids) and one of the aforementioned heavy chain constant regions, e.g., gamma (of 330 amino acids).

[0311] Particular embodiments of antibodies and immunoglobulins include antibodies or immunoglobulins of any isotype, fragments of antibodies which retain specific binding to antigen, including, Fab, Fv, scFv, and Fd fragments, chimeric antibodies, humanized antibodies, single-chain antibodies, and fusion proteins including an antigen-binding portion of an antibody and a non-antibody protein. The antibodies may be detectably labeled, e.g., with a radioisotope, an enzyme which generates a detectable product, a fluorescent protein, a fluorescent molecule, or a stable elemental isotope and the like. The antibodies may be further conjugated to other moieties, such as members of specific binding pairs, e.g., biotin (member of a biotin-avidin specific binding pair), and the like. Also encompassed by the term are Fab', Fv, F(ab')2, and other antibody fragments that retain specific binding to their cognate antigen, and monoclonal antibodies.

[0312] Antibodies may exist in a variety of other forms including, for example, bi-functional ( / .e. bispecific) hybrid antibodies {e.g., Lanzavecchia et al., 1987) and in single chains {e.g., Huston et al., 1988; and Bird et al., 1988). See, generally, Hood et al., 1984 and Hunkapiller & Hood, 1986.

[0313] An immunoglobulin light or heavy chain variable region consists of a “framework” region (FR) interrupted by three hypervariable regions, also called “complementarity determining regions” or “CDRs”. The extent of the framework region and CDRs has been precisely defined (see, “Sequences of Proteins of Immunological Interest” in Kabat etal., 1991 ). In particular embodiments, the numbering of an antibody amino acid sequence can conform to the Kabat system. The sequences of the framework regions of different light or heavy chains are relatively conserved within a species. The framework region of an antibody, that is the combined framework regions of the constituent light and heavy chains, serves to position and align the CDRs. The CDRs are primarily responsible for binding to an epitope of an antigen.

[0314] Chimeric antibodies are antibodies whose light and heavy chain genes have been constructed, typically by genetic engineering, from antibody variable and constant region genes belonging to different species. For example, the variable segments of the genes from a rabbit monoclonal antibody may be joined to human constant segments, such as y1 and y3.

[0315] Antibodies can target different antigens, including STAT3, Axl, PI3K, IDO-6, PD-L1 , PD-1 , LAG-3, TIM-3, B7-H3, VISTA, A2AR, FOXP3, CTLA-4, STAT5, IL-2Ra, TGFBR, IKZF4, TGF-p, CD47, NOX1 -5, HSP47, XBP1 , BCL2, BCL-XL, AKT1 , AKT2, AKT3, MYC, HER2, HER3, AR, Survivin, GRB7, EPS8L1 , RRM2, PKN3, EGFR, IRE1 -alpha, VEGF-R1 , RTP801 , proNGF, Keratin K6A, LMP2, LMP7, MECL1 , HIF1 a, Furin, KSP, eiF-4E, p53, p-catenin, ApoB, PCSK9, SNALP, CD39, CD73, MIF, VEGF, PIGF, CXCR4, CCR2, PLK1 , MTDH, Twist, Lcn2, IL-6, IL-10, p65, and mitotic kinases {e.g., PLK1 , PLK2, PLK3, PLK4, CDK1 , CDK2, CHK1 , CHK2, BUB1 , BUBR1 , MPS1 , NEK2, HASPIN, Aurora A). Examples of inflammation-related targets for antibodies include TNF,TNF-a, IL-1 A, IL-1 B, IL-12 / 23, IL-4, IL-5, IL-6, IL-8, IL-13, IL-17, NF-KB1 , NF-KB2, C0X2, PTGS2, TLR4, MAPK, STAT3, CCL2, CXCL10, IFN-y, and MMP9. Of note, some antibodies can function as immune checkpoint inhibitors. In certain cases, antibodies can serve as homing targets to immune cells or diseased cells; e.g., antibodies against CD3, CD4, CD8, PD-1 , PD-L1 , CTLA-4, LFA-1 , CD25, CD122, CD19, CD20, CSF1 R, CD30, CD33, CD47, SIRPa, CD30, HER2, EGFR, DEC-205, CD40, DC-SIGN, CLEC9, MARCO, CCR2; e.g., rituximab, ofatumumba, obinutuzumab, inebilizumab, tafasitamab, AFM13, AFM24; e.g., antibodies targeting T cells (e.g., antibodies against CD3, CD8, CD4, PD-1 , CTLA-4, LFA-1 ), antibodies targeting B cells e.g., antibodies against CD19, CD20; rituximab, ofatumumba, obinutuzumab, inebilizumab, tafasitamab), antibodies targeting myeloid cells (e.g., CSF1 R, CD33, CD47, SIRPa), antibodies targeting NK cells (e.g., antibodies against KIR, NKG2A, CD16; e.g., monalizumab), antibodies targeting cancer cells (e.g., antibodies against CD19, CD30, HER2, EGFR, BCMA; e.g., AFM13, AFM24, trastuzumab, cetuximan, panitumumab), antibodies targeting DC (e.g., antibodies against DEC-205, CD40, DC-SIGN, CLEC9), antibodies targeting macrophages (e.g., antibodies against CSF1 R, CD47, MARCO, CCR2). The known or knowable cognate ligands or cognate receptors to all these listed targets can also be targeted. Antibodies can be present on the cytokine construct at 0.01 wt.% to 20 wt.% (e.g., 0.01 to 0.5 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, 0.5 to 1 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, 10 to 20 wt.%, 1 to 10 wt.%, 1 to 20 wt.%).(IX) Pharmaceutical Compositions and Administration Formulations

[0316] Provided herein are compositions for use in treating cancer, precancer, and other proliferative disease. The compositions include at least two active components / agents, one of which is a therapeutically active agent that inhibits at least one mitotic kinase inhibitor; and another of which is an immune checkpoint inhibitor. As described herein, the active agents may be delivered in / associated with a delivery vehicle (a construct, an engineered construct), such as a liposome, an organic or inorganic (nano- or micro-) particle, and so forth. As described herein, the active agents may be co-delivered with a chemical linker connecting the agents (e.g., an antibody-drug conjugate, an antibody-oligonucleotide conjugate, a small molecule -oligonucleotide conjugate, or a small molecule-small molecule conjugate).

[0317] The compositions can be provided to the cells either directly, such as by contacting it with the cell, or indirectly, such as through the action of any biological process. For example, the compositions can be formulated in a physiologically acceptable carrier or vehicle, and injected into a tissue or fluid surrounding the cell. The compositions can cross the cell membrane by simple diffusion, endocytosis, or by any active or passive transport mechanism.

[0318] When formulated in a pharmaceutical composition, a therapeutic compound (such as delivery system coupled with at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor) can be admixed with a pharmaceutically acceptable carrier or excipient. As used herein, the phrase “pharmaceutically acceptable” refers to molecular entities and compositions that are generallybelieved to be physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human or veterinary subject.

[0319] The term “pharmaceutically acceptable derivative” as used herein means any pharmaceutically acceptable salt, solvate or prodrug, e.g. ester, of the desired active agent, which upon administration to the recipient is capable of providing (directly or indirectly) the desired active agent, or an active metabolite or residue thereof. Such derivatives are recognizable to those skilled in the art, without undue experimentation. Nevertheless, reference is made to the teaching of Burger's Medicinal Chemistry and Drug Discovery, 5th Edition, Vol 1 : Principles and Practice. Pharmaceutically acceptable derivatives include salts, solvates, esters, carbamates, and phosphate esters.

[0320] While it is possible to use a composition for therapy as is, it may be preferable to administer it in a pharmaceutical formulation, e.g., in admixture with a suitable pharmaceutical excipient, diluent or carrier selected with regard to the intended route of administration and standard pharmaceutical practice. Accordingly, in one aspect, pharmaceutical composition or formulation includes at least one active composition, or a pharmaceutically acceptable derivative thereof, in association with a pharmaceutically acceptable excipient, diluent and / or carrier. The excipient, diluent and / or carrier is “acceptable” in the sense of being compatible with the other ingredient(s) of the formulation and not significantly deleterious to the recipient thereof.

[0321] Any composition formulation disclosed herein can advantageously include any other pharmaceutically acceptable carriers which include those that do not produce significantly adverse, allergic, or other untoward reactions that outweigh the benefit of administration, whether for research, prophylactic and / or therapeutic treatments. Exemplary pharmaceutically acceptable excipients, diluents, and carriers for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington: The Science and Practice of Pharmacy. Lippincott Williams & Wilkins (A.R., Gennaro edit. 2005), and in Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990. Moreover, formulations can be prepared to meet sterility, pyrogenicity, general safety and purity standards as required by United States FDA Office of Biological Standards and / or other relevant foreign regulatory agencies. The pharmaceutical excipient(s), diluent(s), and carrier(s) can be selected with regard to the intended route of administration and standard pharmaceutical practice.

[0322] Such pharmaceutical formulations may be presented for use in a conventional manner with the aid of one or more suitable excipients, diluents, and carriers. Pharmaceutically acceptable excipients assist or make possible the formation of a dosage form for a bioactive material and include diluents, binding agents, lubricants, glidants, disintegrants, coloring agents, and other ingredients. Preservatives, stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, ascorbic acid and esters of p- hydroxybenzoic acid. Antioxidants and suspending agents may be also used. An excipient is pharmaceutically acceptable if, in addition to performing its desired function, it is non-toxic, well tolerated upon ingestion, and does not interfere with absorption of bioactive materials.

[0323] Exemplary generally used pharmaceutically acceptable carriers include any and all bulking agents or fillers, solvents or co-solvents, dispersion media, coatings, surfactants, antioxidants (e.g., ascorbic acid, methionine, vitamin E), preservatives, isotonic agents, absorption delaying agents, salts, stabilizers, buffering agents, chelating agents (e.g., EDTA), gels, binders, disintegration agents, and / or lubricants.

[0324] Exemplary buffering agents include citrate buffers, succinate buffers, tartrate buffers, fumarate buffers, gluconate buffers, oxalate buffers, lactate buffers, acetate buffers, phosphate buffers, histidine buffers and / or trimethylamine salts.

[0325] Exemplary preservatives include phenol, benzyl alcohol, meta-cresol, methyl paraben, propyl paraben, octadecyldimethylbenzyl ammonium chloride, benzalkonium halides, hexamethonium chloride, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol and 3- pentanol.

[0326] Exemplary isotonic agents include polyhydric sugar alcohols including trihydric or higher sugar alcohols, such as glycerin, erythritol, arabitol, xylitol, sorbitol, or mannitol.

[0327] Exemplary stabilizers include organic sugars, polyhydric sugar alcohols, polyethylene glycol; sulfur-containing reducing agents, amino acids, low molecular weight polypeptides, proteins, immunoglobulins, hydrophilic polymers, or polysaccharides.

[0328] A “therapeutically effective amount” or “therapeutically effective dose” means the amount of a compound that, when administered to a subject for treating a state, disorder or condition, is sufficient to impact such state, disorder, or condition. The “therapeutically effective amount” will vary depending on the compound, the disease and its severity and the age, weight, physical condition, and responsiveness of the mammal to be treated. The exact dose and formulation will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1 -3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Remington: The Science and Practice of Pharmacy, 20th Edition, Gennaro, Editor (2003), and Pickar, Dosage Calculations (1999)). In certain cases, “therapeutically effective amount” is used to mean an amount or dose sufficient to modulate, e.g., increase or decrease a desired activity e.g., by 10%, by 50%, or by 90%. Generally, a therapeutically effective amount is sufficient to cause an improvement in a clinically significant condition in the host following a therapeutic regimen involving one or more therapeutic agents. The concentration or amount of the active ingredient depends on the desired dosage and administration regimen, as discussed herein.

[0329] The actual dose amount administered to a particular subject can be determined by a physician, veterinarian, or researcher taking into account parameters such as physical, physiological and psychological factors including target, body weight, stage of cancer, the type of cancer, previous or concurrent therapeutic interventions, idiopathy of the subject, and route of administration.

[0330] Amounts effective for this use will depend on the severity of the disease and its location, particularly when a metastatic site is implicated, and the weight and general state of the patient being treated. Generally, dosages range from 0.01 mg / kg to 100 mg / kg host body weight of cytokineconstruct per day, with dosages of from 0.1 mg / kg to 10 mg / kg per day being more commonly used, and for instance dosages of 3-7 mg / kg. Maintenance dosages over a prolonged period of time may be adjusted as necessary. The dosages, however, may be varied depending upon the requirements of the patient, the severity of the condition being treated, and the compound being employed. For example, dosages can be empirically determined considering the type and stage of cancer diagnosed in a particular patient. The dose administered to a patient, in the context of the present disclosure should be sufficient to affect a beneficial therapeutic response in the patient over time. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration of a particular vector, or transduced cell type in a particular patient. Determination of the proper dosage for a particular situation is within the skill of the practitioner. Generally, treatment is initiated with smaller dosages which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under circumstances is reached. For convenience, the total daily dosage may be divided and administered in portions during the day, if desired.

[0331] The selected dosage may be influenced by the desired therapeutic effect, the route of administration, the duration of the treatment desired, and the specific therapeutic complex being employed. Generally, cytokine construct can be administered in a range of 0.001 mg / kg to 100 mg / kg per administration (e.g., daily; or 2, 3, 4, 5 or more times weekly; or 2, 3, 4, 5 or more times a month, etc., as discussed in more detail below). The route of administration can be a consideration in determining dosage as well. For example, in a particular embodiment, a cytokine construct is administered in a range of 0.01 mg / kg to 100 mg / kg (e.g., daily; or 2, 3, 4, 5 or more times weekly; or 2, 3, 4, 5 or more times a month, etc.) by intravenous or interpretational routes, or in a range of 0.0001 mg / kg to 1 mg / kg (e.g., daily; or 2, 3, 4, 5 or more times weekly; or 2, 3, 4, 5 or more times a month, etc.) for a subcutaneous route (e.g., local injection into or adjacent to a tumor or into the TME). More exemplary dosages are discussed below.

[0332] Suitable dosages may range from 0.01 mg / kg to 100 mg / kg of body weight per day, week, or month. Exemplary doses can include 0.05 mg / kg to 10.0 mg / kg of the active compounds (cytokine constructs) disclosed herein. The total daily dose can be 0.05 mg / kg to 30.0 mg / kg of an agent administered to a subject one to three times a day, including administration of total daily doses of 0.05-3.0, 0.1 -3.0, 0.5-3.0, 1.0-3.0, 1 .5-3.0, 2.0-3.0, 2.5-3.0, and 0.5-3.0 mg / kg / day of administration forms of a drug using 60-minute oral, intravenous or other dosing. In one particular example, doses can be administered QD or BID to a subject with, e.g., total daily doses of 1 .5 mg / kg, 3.0 mg / kg, 4.0 mg / kg, 5.0 mg / kg, or 7.5 mg / kg of a composition with up to 92-98% wt / v of the compounds disclosed herein.

[0333] Additional useful doses can often range from 0.1 to 5 pg / kg or from 0.5 to 1 pg / kg. In other examples, a dose can include 1 pg / kg, 10 pg / kg, 20 pg / kg, 40 pg / kg, 80 pg / kg, 200 pg / kg, 0.1 to 5 mg / kg or from 0.5 to 1 mg / kg. In other examples, a dose can include 1 mg / kg, 10 mg / kg, 20 mg / kg, 40 mg / kg, 80 mg / kg, 200 mg / kg, 400 mg / kg, 450 mg / kg, or more.

[0334] Therapeutic materials of the present disclosure may be employed in serious disease states, that is, life-threatening or potentially life-threatening situations. In such cases, it is possible and may be felt desirable by the treating physician to administer substantial excesses of these compositions.

[0335] As will be appreciated by those of skill in the art, specific dosages will be influenced by the pharmacokinetics of the active compound. For administration, therapeutically effective amounts (also referred to herein as doses) can be initially estimated based on results from in vitro assays and / or animal model studies. Such information can be used to determine useful doses more accurately in subjects of interest. Useful pre-clinical tests include pharmacodynamic analyses, toxicity analyses, and so forth.

[0336] Therapeutically effective amounts can be achieved by administering single or multiple doses during the course of a treatment regimen (e.g., hourly, every 2 hours, every 3 hours, every 4 hours, every 6 hours, every 9 hours, every 12 hours, every 18 hours, daily, every other day, every 3 days, every 4 days, every 5 days, every 6 days, weekly, every 2 weeks, every 3 weeks, or monthly).

[0337] The effective amounts of compounds containing active agents include doses that partially or completely achieve the desired therapeutic, prophylactic, and / or biological effect. The actual amount effective for a particular application depends on the condition being treated and the route of administration. The effective amount for use in humans can be determined from animal models. For example, a dose for humans can be formulated to achieve local (e.g., intratumoral) or circulating levels that have been found to be effective in animals.

[0338] Compositions can be administered with one or more anesthetics including ethanol, bupivacaine, chloroprocaine, levobupivacaine, lidocaine, mepivacaine, procaine, ropivacaine, tetracaine, desflurane, isoflurane, ketamine, propofol, sevoflurane, codeine, fentanyl, hydromorphone, marcaine, meperidine, methadone, morphine, oxycodone, remifentanil, sufentanil, butorphanol, nalbuphine, tramadol, benzocaine, dibucaine, ethyl chloride, xylocaine, and / or phenazopyridine.

[0339] In particular embodiments that include treating or preventing a cancer (including for instance a cancer metastasis), the compositions disclosed herein can be used in conjunction with other cancer treatments, such as chemotherapy, targeted therapy, radiation therapy, and / or immunotherapy. The compositions described herein can be administered simultaneously with or sequentially with another treatment within a selected time window, such as within 10 minutes, 1 hour, 3 hour, 10 hour, 15 hour, 24 hour, or 48 hour time windows or when the complementary treatment is within a clinically-relevant therapeutic window.

[0340] Pharmaceutical compositions can be for administration by parenteral (intramuscular, intraperitoneal, intravenous (IV) or subcutaneous injection), by instillation, or in a depo, formulated in dosage forms appropriate for each route of administration.

[0341] In some embodiments, the compositions are administered systemically, for example, by intravenous or intraperitoneal administration, in an amount effective for delivery of the compositions to targeted cells. Other routes include instillation or mucosal.

[0342] In certain embodiments, the compositions are administered locally, for example, by injection directly into a site to be treated. In some embodiments, the compositions are injected or otherwise administered directly to one or more tumors or diseased tissues. Typically, local injection causes an increased localized concentration of the compositions which is greater than that which can be achieved by systemic administration. In some embodiments, the compositions are delivered locally to the appropriate cells by using a catheter or syringe. Other means of delivering such compositions locally to cells include using infusion pumps or incorporating the compositions into polymeric implants which can affect a sustained release of the compositions to the immediate area of the implant.

[0343] By way of example, in certain embodiments the cytokine constructs are given locally, for instance to readily accessible tumors such as melanoma, head and neck cancer, breast cancer, and lymphoma; or systemically for other cancers such as lung cancer, liver cancer, pancreatic cancer, prostate cancer, and metastatic cancers.

[0344] Thus, the therapeutic compositions described herein can be administered (on their own or as part of a combination therapy) by a variety of routes, including any convenient way for use in human or veterinary medicine. A therapeutically effective amount of the desired active agent(s) can be formulated in a pharmaceutical composition to be introduced parenterally, transmucosally (e.g., orally, nasally, or rectally), or transdermally. In some embodiments, administration is parenteral, for instance, via intravenous injection, or intra-arteriole, intramuscular, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial administration. The administered may be as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerobrospinal, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, topical, or inhalation routes. In certain embodiments, for instance those involved in treatment of inflammatory conditions that impact joints, the pharmaceutical composition may be administered directly to the synovium, synovial fluid, or joint capsule by injection preferably with a syringe. Administration may be local or systemic; the choice may be influenced by the condition being treated, as well as the active agent(s) and compositions being administered.

[0345] For injection, compositions can be made as aqueous solutions, such as in buffers such as Hanks' solution, Flinger's solution, or physiological saline. The solutions can contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Alternatively, the composition can be in lyophilized and / or powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

[0346] Compositions including a cytokine construct may be administered in an aqueous solution, by parenteral injection. The injectable formulation can be in the form of a suspension or emulsion, and optionally includes pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants and / or carriers. Such injectable compositions can include diluents such as sterile water, buffered saline of various buffer content (e.g., Tris-HCI, acetate, phosphate), pH and ionic strength; and optionally, additives such as detergents and solubilizing agents (e.g., TWEEN™ 20, TWEEN™ 80 also referred to as polysorbate 20 or 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), and preservatives (e.g., Thimerosal, benzyl alcohol). Examples of non-aqueous solvents or vehicles are propylene glycol, polyethylene glycol, vegetable oils, such as olive oil and corn oil, gelatin, andinjectable organic esters such as ethyl oleate. The formulations for injection may be lyophilized and resuspended, for instance immediately before use. The injectable formulation may be sterilized by, for example, filtration through a bacterium retaining filter, by incorporating sterilizing agents into the compositions, by irradiating the compositions, or by heating the compositions.

[0347] In other embodiments, cytokine construct-including compositions are applied topically or by instillation. Topical administration can include application to the lungs, nasal, oral (sublingual, buccal), vaginal, or rectal mucosa. These methods of administration can be made effective by formulating the shell or coating of the delivery vehicle with mucosal transport element(s). Compositions can be delivered to the lungs while inhaling and traverse across the lung epithelial lining to the blood stream when delivered either as an aerosol or spray dried particles having an aerodynamic diameter of less than 5 microns.

[0348] A wide range of mechanical devices designed for pulmonary delivery of therapeutic products can be used, including but not limited to nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art.

[0349] Formulations for administration to the mucosa will typically be spray dried drug particles, which may be incorporated into a tablet, gel, capsule, suspension, or emulsion. Standard pharmaceutical excipients are available from any formulator.

[0350] Transdermal formulations may also be prepared. These will typically be ointments, lotions, sprays, or patches, all of which can be prepared using standard technology. T ransdermal formulations can include penetration enhancers. Chemical enhancers and physical methods including electroporation and microneedles can work in conjunction with this method.

[0351] A microneedle (MN) is a micron-sized needle with a height of 10-2000 pm and a width of 10- 50 pm, which can penetrate through the epidermis layer to dermal tissue directly with minimal or no pain (Hao et al., 2017). Several types of microneedles can be used. In some embodiments, metalbased or plastic microneedle rollers can be used to physically disrupt skin surface to enhance penetration of the applied topical agents (cytokine construct in this case). In some embodiments, degradable and dissolvable microneedles can contain cytokine constructs. Upon administration to skin, microneedles can dissolve and release the construct deep in layers of skin. In some embodiments, non-degradable microneedles may be coated with cytokine constructs, such that they deliver the coated construct deep in skin layers. Microneedles can be fabricated from many classes of materials, including but not limited to, polymer, saccharides, polysaccharides, peptide, protein, metals, inorganic compound, and so forth (Ye et al., 2018). All materials and fabrication methods known in the art for microneedle technology is applicable to enhance delivery of this cytokine construct.

[0352] Any device that facilitates systemic or localized delivery of therapeutics is also applicable to the herein provided cytokine constructs. For example, hepatic arterial infusion (HAI) pump, which is an implanted chemotherapy device that delivers high concentrations of cytotoxic agents directly to liver metastases with minimal systemic toxicities (Cohen et al., 2003), can also be utilized to deliver the herein described cytokine constructs. In some embodiments, convection enhanced delivery(CED), which involves the placement of a small diameter infusion catheter to deliver therapeutics to brain tumors (Mehta et al., 2017), can also be utilized to deliver the herein described cytokine constructs.(X) Exemplary Methods of Use:

[0353] With the provision herein of cytokine constructs that include at least one anti-cancer agent (e.g., a mitotic kinase inhibitor) and at least one immune checkpoint inhibitor, there are now enabled methods of treating and / or preventing hyperproliferative diseases, disorders, or conditions, including cancer, symptoms of cancer, cancer progression (including from precancer to cancer), and cancer metastasis. Specific examples of hyperproliferative diseases, disorders, or conditions include cancer. In some embodiments, the cancer may suppress the immune system of the subject or individual with the cancer. In some embodiments, the cytokine constructs as provided herein can suppress or reverse cancer-mediated immune suppression and allow for immune recognition and clearance of the malignancy.

[0354] As used herein, the term “treatment” or “treating” refers to any improvement of the cancer that occurs in a treated subject compared to an untreated subject. Such an improvement can be a prevention of a worsening or progression of the cancer (e.g., improved progression-free survival). Moreover, such an improvement may also be a reduction or cure of the cancer or its accompanying symptoms (e.g., reduction in tumor volume, partial remission, complete remission (e.g., for 6 months, 1 year, 2 years, 3 years, 4 years, or 5 years or more), prevention of cancer recurrence or relapse, reduction of metastasis, or reduction of number of tumors or lesions). It will be understood that a treatment may not be successful for 100% of the subjects to be treated. The term, however, requires that the treatment is successful as determined by people skilled in the art (e.g., oncologists, physicians). As used herein, the term “preventing” refers to avoiding the onset of cancer as used herein or its accompanying syndromes. It will be understood that prevention refers to avoiding the onset of cancer within a certain time window in the future. Said time window shall, preferably, start upon administration of a compound in the sense of the disclosure and lasts for at least 1 month, at least 6 months, at least 9 months, at least 1 year, at least 2 years, at least 5 years, at least 10 years or even for the remaining physiological life span of a subject. It will be understood that a prevention may not be successful for 100% of the subjects to be treated. The term, however, requires that the prevention is successful as determined by one skilled in the art (e.g., oncologists, physicians). Prevention may also be in the context of a recurrence of cancer after remission, e.g., as measured by a reduction in probability for recurrence in a population.

[0355] The disclosed compositions can be used to treat benign or malignant cancers, and tumors thereof. The treatment can directly target and kill cancer cells, indirectly target the cancer cells by increasing an immune response against the cancer cells; or a combination thereof.

[0356] In a mature animal, a balance usually is maintained between cell renewal and cell death in most organs and tissues. The various types of mature cells in the body have a given life span; as these cells die, new cells are generated by the proliferation and differentiation of various types of stemcells. Under normal circumstances, the production of new cells is so regulated that the numbers of any particular type of cell remain constant. Occasionally, though, cells arise that are no longer responsive to normal growth-control mechanisms. These cells give rise to clones of cells that can expand to a considerable size, producing a tumor or neoplasm. A tumor that is not capable of indefinite growth and does not invade the healthy surrounding tissue extensively is benign. A tumor that continues to grow and becomes progressively invasive is malignant. The term cancer refers specifically to a malignant tumor. In addition to uncontrolled growth, malignant tumors exhibit metastasis. In this process, small clusters of cancerous cells dislodge from a tumor, invade the blood or lymphatic vessels, and are carried to other tissues, where they continue to proliferate. In this way a primary tumor at one site can give rise to a secondary tumor at another site.

[0357] The disclosed compositions can delay or inhibit the growth of a tumor in a subject, reduce the growth or size of the tumor or eliminate it altogether, inhibit or reduce metastasis of the tumor, and / or inhibit or reduce symptoms associated with tumor development or growth. For example, in some embodiments, the compositions reduce tumor burden in the subject or slow or prevent tumor growth over time.

[0358] Malignant tumors may be classified according to the embryonic origin of the tissue from which the tumor is derived. Carcinomas are tumors arising from endodermal or ectodermal tissues such as skin or the epithelial lining of internal organs and glands. Sarcomas, which arise less frequently, are derived from mesodermal connective tissues such as bone, fat, and cartilage. The leukemias and lymphomas are malignant tumors of hematopoietic cells of the bone marrow. Leukemias proliferate as single cells, whereas lymphomas tend to grow as tumor masses. Malignant tumors may show up at numerous organs or tissues of the body to establish a cancer.

[0359] The types of cancer that can be treated with the provided compositions and methods include, but are not limited to, vascular cancers such as multiple myeloma, as well as solid cancers, including adenocarcinomas and sarcomas, of bone, bladder, brain, breast, cervix, colon, rectum, esophagus, kidney, liver, lung, nasopharynx, pancreas, prostate, skin, stomach, and uterus. In some embodiments, the disclosed compositions are used to treat multiple cancer types concurrently. The compositions can also be used to treat metastases or tumors at multiple locations.

[0360] Administration is not limited to the treatment of an existing tumor but can also be used to prevent or lower the risk of developing such diseases in an individual, i.e., for prophylactic use and to reduce spread of cancer, for instance through metastasis. Potential candidates for prophylactic vaccination include individuals with a high risk of developing cancer, i.e., with a personal or familial history of certain types of cancer.

[0361] As used herein, the term “cancer” refers to all types of cancer, neoplasm or malignant tumors found in mammals, including leukemia, lymphoma, carcinomas and sarcomas. Exemplary cancers that may be treated with a compound, pharmaceutical composition, or method provided herein include lymphoma, sarcoma, bladder cancer, bone cancer, brain tumor, cervical cancer, colon cancer, esophageal cancer, gastric cancer, head and neck cancer, kidney cancer, myeloma, thyroid cancer, leukemia, prostate cancer, breast cancer (e.g. triple negative, ER positive, ER negative,chemotherapy resistant, Herceptin® resistant, HER2 positive, doxorubicin resistant, tamoxifen resistant, ductal carcinoma, lobular carcinoma, primary, metastatic), ovarian cancer, pancreatic cancer, liver cancer (e.g. hepatocellular carcinoma), lung cancer (e.g. non-small cell lung carcinoma, squamous cell lung carcinoma, adenocarcinoma, large cell lung carcinoma, small cell lung carcinoma, carcinoid, sarcoma), glioblastoma multiforme, glioma, melanoma, prostate cancer, castrationresistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g. head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma. Additional examples include, cancer of the thyroid, endocrine system, brain, breast, cervix, colon, head & neck, esophagus, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus or Medulloblastoma, Hodgkin's Disease, Non-Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, cancer, malignant pancreatic insulinoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenal cortical cancer, neoplasms of the endocrine or exocrine pancreas, medullary thyroid cancer, medullary thyroid carcinoma, melanoma, colorectal cancer, papillary thyroid cancer, hepatocellular carcinoma, Paget's Disease of the Nipple, Phyllodes Tumors, Lobular Carcinoma, Ductal Carcinoma, cancer of the pancreatic stellate cells, cancer of the hepatic stellate cells, or prostate cancer. The term “precancer”, as used herein, refers to a condition or growth that precedes or develops into a cancer. The term “cancer metastasis”, as used herein, refers to the spread of cancer cells or a tumor from one organ or part of the body to another organ or part of the body.

[0362] The term “leukemia” refers broadly to progressive, malignant diseases of the blood-forming organs and is generally characterized by a distorted proliferation and development of leukocytes and their precursors in the blood and bone marrow. Leukemia is generally clinically classified on the basis of (1 ) the duration and character of the disease-acute or chronic; (2) the type of cell involved; myeloid (myelogenous), lymphoid (lymphogenous), or monocytic; and (3) the increase or non-increase in the number abnormal cells in the blood-leukemic or aleukemic (subleukemic). Exemplary leukemias that may be treated with a compound, pharmaceutical composition, or method provided herein include, for example, acute nonlymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute promyelocytic leukemia, adult T-cell leukemia, aleukemic leukemia, a leukocythemic leukemia, basophilic leukemia, blast cell leukemia, bovine leukemia, chronic myelocytic leukemia, leukemia cutis, embryonal leukemia, eosinophilic leukemia, Gross' leukemia, hairy-cell leukemia, hemoblastic leukemia, hemocytoblastic leukemia, histiocytic leukemia, stem cell leukemia, acute monocytic leukemia, leukopenic leukemia, lymphatic leukemia, lymphoblastic leukemia, lymphocytic leukemia, lymphogenous leukemia, lymphoid leukemia, lymphosarcoma cell leukemia, mast cell leukemia, megakaryocytic leukemia, micromyeloblastic leukemia, monocytic leukemia, myeloblastic leukemia, myelocytic leukemia, myeloid granulocyticleukemia, myelomonocytic leukemia, Naegel! leukemia, plasma cell leukemia, multiple myeloma, plasmacytic leukemia, promyelocytic leukemia, Rieder cell leukemia, Schilling's leukemia, stem cell leukemia, subleukemic leukemia, or undifferentiated cell leukemia.

[0363] The term “sarcoma” generally refers to a tumor which is made up of a substance like the embryonic connective tissue and is generally composed of closely packed cells embedded in a fibrillar or homogeneous substance. Sarcomas that may be treated with a compound, pharmaceutical composition, or method provided herein include a chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abernethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, chorio carcinoma, embryonal sarcoma, Wilms' tumor sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, fibroblastic sarcoma, giant cell sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented hemorrhagic sarcoma, immunoblastic sarcoma of B cells, lymphoma, immunoblastic sarcoma of T-cells, Jensen's sarcoma, Kaposi's sarcoma, Kupffer cell sarcoma, angiosarcoma, leukosarcoma, malignant mesenchymoma sarcoma, parosteal sarcoma, reticulocytic sarcoma, Rous sarcoma, serocystic sarcoma, synovial sarcoma, or telangiectaltic sarcoma.

[0364] The term “melanoma” is taken to mean a tumor arising from the melanocytic system of the skin and other organs. Melanomas that may be treated with a compound, pharmaceutical composition, or method provided herein include, for example, acral-lentiginous melanoma, amelanotic melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma, juvenile melanoma, lentigo maligna melanoma, malignant melanoma, nodular melanoma, subungal melanoma, or superficial spreading melanoma.

[0365] The term “carcinoma” refers to a malignant new growth made up of epithelial cells tending to infiltrate the surrounding tissues and give rise to metastases. Exemplary carcinomas that may be treated with a compound, pharmaceutical composition, or method provided herein include, for example, medullary thyroid carcinoma, familial medullary thyroid carcinoma, acinar carcinoma, acinous carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, carcinoma adenomatosum, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, carcinoma basocellulare, basaloid carcinoma, basosquamous cell carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma, chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, ductal carcinoma, carcinoma durum, embryonal carcinoma, encephaloid carcinoma, epiermoid carcinoma, carcinoma epitheliale adenoides, exophytic carcinoma, carcinoma ex ulcere, carcinoma fibrosum, gelatiniforni carcinoma, gelatinous carcinoma, giant cell carcinoma, carcinoma gigantocellulare, glandular carcinoma, granulosa cell carcinoma, hair-matrix carcinoma, hematoid carcinoma, hepatocellular carcinoma, Hurthle cell carcinoma, hyaline carcinoma, hypernephroid carcinoma, infantile embryonal carcinoma, carcinoma in situ, intraepidermal carcinoma, intraepithelial carcinoma, Krompecher's carcinoma, Kulchitzky-cellcarcinoma, large-cell carcinoma, lenticular carcinoma, carcinoma lenticulare, lipomatous carcinoma, lobular carcinoma, lymphoepithelial carcinoma, carcinoma medullare, medullary carcinoma, melanotic carcinoma, carcinoma molle, mucinous carcinoma, carcinoma muciparum, carcinoma mucocellulare, mucoepidermoid carcinoma, carcinoma mucosum, mucous carcinoma, carcinoma myxomatodes, nasopharyngeal carcinoma, oat cell carcinoma, carcinoma ossificans, osteoid carcinoma, papillary carcinoma, periportal carcinoma, preinvasive carcinoma, prickle cell carcinoma, pultaceous carcinoma, renal cell carcinoma of kidney, reserve cell carcinoma, carcinoma sarcomatodes, Schneiderian carcinoma, scirrhous carcinoma, carcinoma scroti, signet-ring cell carcinoma, carcinoma simplex, small-cell carcinoma, solanoid carcinoma, spheroidal cell carcinoma, spindle cell carcinoma, carcinoma spongiosum, squamous carcinoma, squamous cell carcinoma, string carcinoma, carcinoma telangiectaticum, carcinoma telangiectodes, transitional cell carcinoma, carcinoma tuberosum, tubular carcinoma, tuberous carcinoma, verrucous carcinoma, or carcinoma villosum.

[0366] Also contemplated are uses of the provided cytokine constructs for treatment of diseases other than cancers or hyperproliferative diseases. Any disease or condition that is mediated or influenced by a cytokine may benefit from use of a cytokine construct as provided herein. By way of example, use to treat infectious diseases, autoimmune diseases, and inflammatory diseases are particularly contemplated.

[0367] The phrase “infectious disease,” and its equivalents, refers to a disorder caused by an infectious agent (e.g., bacteria, viruses, fungi, parasites, prions, or a combination thereof). Examples of the infectious disease include coronavirus-based infections, such as middle east respiratory syndrome (MERS), severe acute respiratory syndrome (SARS), and coronavirus disease 19 (COVID- 19); Corynebacterium-based infections, such as diphtheria; ebolavirus-based infections, such as Ebola; Orthomyxoviridae virus-based infections, such as influenza A, B, or C; hepatovirus A, B, C, D, or E-based infections, such as hepatitis; Haemophilus-based infections, such as hib disease; human immunodeficiency virus (HlV)-based infections, such as acquired immunodeficiency syndrome (AIDS); human papillomavirus (HPV)-based infections; sexually transmitted infections, such as chlamydia, gonorrhea, syphilis, and trichomoniasis; Morbillivirus-based infections, such as measles; Mycobacterium-based infections, such as tuberculosis; Neisseria-based infections, such as meningitis; Orthorubulavirus-based infections, such as mumps; norovirus-based infections; Streptococcus-based infections; enterovirus-based infections, such as polio and hand, foot, and mouth Disease; Orthopneumovirus-based infections; rotavirus-based infections; Rubivirus-based infections, such as rubella; herpesvirus-based infections, such as oral herpes, genital herpes, Kaposi’s sarcoma, roseola, infectious mononucleosis (Epstein-Barr virus), cytomegalovirus infection, chickenpox or shingles; Staphylococcus-based infections; Salmonella-based infections; Rhinovirusbased infections, Clostridium-based infections, such as tetanus or botulism; Bordetella-based infections, such as pertussis; Flavivirus-based infections, such as Zika and West Nile fever; other tropical diseases, such as malaria, leishmaniasis, filariasis, Chagas disease, trypanosomiasis, chikungunya, cysticercosis, and dengue; smallpox; Lyme disease; other zoonotic infections, such asQ Fever, tularaemia, brucellosis, leptospirosis, psittacosis, anthrax, and hantavirus pulmonary syndrome (HPS); gastroenteritis-causing infections, such as cholera, shigella, Campylobacter infection, giardiasis, and cryptosporidiosis; dermatophyte-based infections, such as athlete’s foot, ringworm, and jock itch; yeast infections, such as candidiasis and cryptococcosis; dimorphic fungal infections, such as histoplasmosis, Valley fever, and blastomycosis; mold infections, such as aspergillosis and mucormycosis; prion diseases, such as Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), Gerstmann-Straussler-Scheinker syndrome (GSS), and fatal familial insomnia (FFI) and so on. Additional examples of infectious diseases can be found in Spec, Andrej, et al. Comprehensive Review of Infectious Diseases. 1st ed., Elsevier, 2019 and in Torok, Estee, et al. Oxford Handbook of Infectious Diseases and Microbiology. 2nded., Oxford University Press, 2017.

[0368] As used herein, the term “autoimmune disease,” and its equivalents can refer to any disorder, condition, or disease in which the immune system mounts a reaction against self-cells or tissues, due to a breakdown in the ability to distinguish self from non-self or otherwise. Examples of autoimmune disorders include autoimmune skin diseases (such as scleroderma, Crest syndrome, bullous pemphigoid, celiac sprue-dermatitis, cicatricial pemphigoid, pemphigus, vitiligo, alopecia, psoriasis), autoimmune bowel diseases (such as Crohn's disease, ulcerative colitis), autoimmune endocrine diseases (such as Hashimoto's thyroiditis, hypothyroidism, hypoparathyroidism, Grave's disease, type I diabetes, polyglancular syndromes,), autoimmune liver disorders (such as primary biliary cirrhosis and autoimmune hepatitis), autoimmune musculoskeletal disorders (polymyosititis, rheumatoid arthritis, ankylosing spondylitis, dermatomyositis, and mixed connective tissue disease,), autoimmune cardiovascular disorders (such as polymyositis, Takayasu's arteritis, temporal arteritis), autoimmune neurological disorders (such as multiple sclerosis, chronic inflammatory demyelinating polyneuropathy, myasthenia gravis, Guillain Barre), pernicious anemia, cold agglutinin disease, rheumatic fever, Addison's disease, Huntington’s disease, Sjogren's syndrome, antiphospholipid syndrome, lupus erythematosus, idiopathic thrombocytopenia purpura (ITP), Reiter's syndrome, stiffman syndrome, Wegener's granulomatosis, polyarteritis nodosa, autoimmune premature ovarian failure, Churg-Strauss syndrome, hypopituitarism, myocarditis, uveitis, and others. Autoimmune disorders can involve any component of the immune system, and can target any cell or tissue type in the body. Additional examples of autoimmune diseases can be found in Rose and Mackay Textbook of Autoimmune Diseases. Edited by M. Eric Gershwin, George Tsokos, and Betty Diamond, 7thEd., Elsevier Science, 2024.

[0369] The phrase “inflammatory disease,” and its equivalents refers to a disorder characterized by chronic inflammation. Inflammation involves the activation of the immune system in response to harmful stimuli, such as, e.g., a pathogen, infection, irritant, or damage to cells. As a stereotyped response, inflammation is a mechanism of innate immunity, as compared to adaptive immunity, which is specific for each pathogen. Inflammation can be classified as either acute or chronic. Generally speaking, acute inflammation is mediated by granulocytes, while chronic inflammation is mediated by mononuclear cells such as monocytes and lymphocytes.

[0370] Acute inflammation is an initial protective response of the body to remove an injurious stimulus by maintaining tissue integrity and contributing to tissue repair. It a part of the body's natural defense system against injury and disease, and in the absence of acute inflammation, wounds and infections would never heal and progressive destruction of the tissue would compromise the survival of the organism.

[0371] However, severe or prolonged noxious stimulation results in a chronic inflammatory response that leads to a progressive shift in the type of cells present at the site of tissue injury. Chronic inflammation may be characterized as the simultaneous destruction and healing of tissue from the inflammatory process, with the net result of provoking injury rather than mediating repair. As such, chronic inflammation is a disease.

[0372] Examples of inflammatory diseases include allergic conditions (e.g., Hay fever), sarcoidosis, age-related macular degeneration (AMD), glaucoma, Behcet's disease, cardiomyopathy, chronic fatigue syndrome, chronic pancreatitis, chronic renal disease, chronic rhinosinusitis, Degos disease, discoid lupus, essential mixed cryoglobulinemia, fibromyalgia, hives, idiopathic pulmonary fibrosis, type 2 diabetes, Meniere's disease, polychondritis, primary agammaglobulinemia, Raynaud's phenomenon, Reiter's syndrome, uveitis, acne, gastroesophageal reflux disease (GERD), atherosclerosis and vascular occlusive disease, bronchitis, cancer, carditis, cataracts, chronic pain, chronic prostatitis, dementia, dermatitis, dry eye, gingivitis, glomerulonephritis, hepatitis, inflammatory bowel diseases, inflammatory myopathies (such as dermatomyositis and polymyositis), non-alcoholic fatty liver disease, Alzheimer’s disease, Parkinson's disease, pelvic inflammatory disease, pneumonitis (e.g., extrinsic allergic alveolitis), obesity, osteoarthritis, osteopenia, osteoporosis, polymyalgia rheumatica, reactive arthritis, gout, tendonitis, transplant rejection, vaginitis, sinusitis, vasculitis, inflammatory lung diseases (such as chronic obstructive pulmonary disease (COPD) and interstitial lung disease (ILD)), or an autoimmune disorder. Additional examples of inflammatory diseases can be found in Compendium of Inflammatory Diseases. Edited by Michael J. Parnham, 1sted., Springer, 2016.(XI) Kits

[0373] Active component(s), including particularly at least one described cytokine construct (including a delivery vehicle containing or associated with at least one mitotic kinase inhibitor and at least one immune checkpoint inhibitor), can be provided as kits. Kits can include one or more containers including (containing) one or more or more compounds or complexes {e.g., anti-cancer agents) as described herein, optionally along with one or more additional agents for use in therapy. For instance, some kits will include an amount of at least one additional anti-cancer composition, or an amount of at least one additional anti-inflammatory agent, or both.

[0374] Any active component in a kit may be provided in premeasured dosages, though this is not required; and it is anticipated that certain kits will include more than one dose.

[0375] Kits can also include a notice in the form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals or biological products, which notice reflects approval bythe agency of manufacture, use, or sale for human administration. The notice may state that the provided active ingredients can be administered to a subject. The kits can include further instructions for using the kit, for example, instructions regarding administration; proper disposal of related waste; and the like. The instructions can be in the form of printed instructions provided within the kit or the instructions can be printed on a portion of the kit itself. Instructions may be in the form of a sheet, pamphlet, brochure, CD-ROM, or computer-readable device, or can provide directions to instructions at a remote location, such as a website. In particular embodiments, kits can also include some or all of the necessary medical supplies needed to use the kit effectively, such as applicators, ampules, sponges, sterile adhesive strips, Chloraprep, gloves, and the like. Variations in contents of any of the kits described herein can be made. The instructions of the kit will direct use of the active i ngredient(s) included in that kit to effectuate a clinical and / or therapeutic use described herein.

[0376] Suitable methods, materials, and examples used in the practice and / or testing of embodiments of the disclosed disclosure are described herein. Such methods and materials are illustrative only and are not intended to be limiting. Other methods, materials, and examples similar or equivalent to those described herein can be used.

[0377] The Exemplary Embodiments and Examples below are included to demonstrate particular embodiments of the disclosure. Those of ordinary skill in the art should recognize in light of the present disclosure that many changes can be made to the specific embodiments disclosed herein and still obtain a like or similar result without departing from the spirit and scope of the disclosure.(XII) Exemplary Embodiments.First Set of Exemplary Embodiments.

[0378] 1 . A nanoparticle construct including: a delivery vehicle, including: a mesoporous silica nanoparticle (MSNP) coated with an uncross-linked polymer coat including: at least 18% (by MSNP weight) polyethylenimine (PEI); and polyethylene glycol (PEG); and IL-2 attached to the PEI and / or PEG of the polymer coat on the delivery vehicle.

[0379] 2. The nanoparticle construct of embodiment 1 , which nanoparticle construct includes at least 1700 molecules of IL-2 attached to the PEI and / or PEG of the polymer coat on the delivery vehicle

[0380] 3. A construct including: (1 ) a delivery vehicle, including: a core coated with a polymer coat including: at least 18% (by core weight) polyethylenimine (PEI); and polyethylene glycol (PEG); and at least one cytokine attached to the PEI and / or PEG of the polymer coat on the delivery vehicle; or (2) a delivery vehicle, including: a core coated with a polymer coat including: polyethylenimine (PEI); and polyethylene glycol (PEG); and at least one decoy receptor attached to the PEI and / or PEG of the polymer coat on the delivery vehicle; or (3) a delivery vehicle, including: a mesoporous silica nanoparticle (MSNP) coated with an uncross-linked polymer coat including: polyethylenimine (PEI); and polyethylene glycol (PEG); and at least one STING agonists attached to the PEI and / or PEG of the polymer coat on the delivery vehicle.

[0381] 4. The construct of embodiment 3, or any other construct embodiment, wherein the delivery vehicle includes a liposome, a lipid-based particle, a polymeric particle, an inorganic nanoparticle, an organic nanoparticle, an inorganic microparticle, an organic microparticle, or a hybrid thereof.

[0382] 5. The construct of embodiment 4, or any other construct embodiment, wherein the delivery vehicle includes one or more of fullerenes, endohedral metallofullerenes, trimetallic nitride templated endohedral metallofullerenes, single-walled and multi-walled carbon nanotubes, calcium phosphate particles, aluminum salt particles, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled and multi-walled boron / nitrate nanotubes, carbon nanotube peapods, carbon nanohorns, carbon nanohorn peapods, liposomes, nanoshells, dendrimers, microparticles, quantum dots, superparamagnetic nanoparticles, nanorods, cellulose nanoparticles, silicon, silica nanoparticles, silica and polymer micro- and nano-spheres, si lica-shells, biodegradable PLGA micro- and nano-spheres, gold nanoparticles, cerium oxide particles, zinc oxide particles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, and / or modified micelles.

[0383] 6. The construct of embodiment 3, or any other construct embodiment, wherein the delivery vehicle includes a mesoporous silica nanoparticle (MSNP).

[0384] 7. The construct of embodiment 6, or any other construct embodiment, wherein the mesoporous silica nanoparticle has a mean particle size of 5-200 nm or 50 nm.

[0385] 8. The construct of embodiment 3, or any other construct embodiment, wherein the at least one cytokine includes IL-2, IL-8, IL-15, IL-12, IL-15, GM-CSF, EGF, TNF-a, or TGF-p.

[0386] 9. The construct of 8, or any other construct embodiment, wherein the at least one cytokine is IL-2.

[0387] 10. The construct of embodiment 3, or any other construct embodiment, wherein the decoy receptor is IL-18BP decoy receptor, IL-22BP decoy receptor, DcR1 decoy receptor, DcR2 decoy receptor, DcR3 decoy receptor, IL-13R2 decoy receptor, IL-1 RII decoy receptor, or TGF-p decoy receptor.

[0388] 1 1 . The construct of embodiment 3, or any other construct embodiment, including TGF-p.

[0389] 12. The construct of embodiment 3, or any other construct embodiment, including at least one cytokine and at least one decoy receptor.

[0390] 13. The construct of embodiment 12, or any other construct embodiment, wherein the cytokine is IL-2 and the decoy receptor is TGF-p decoy receptor.

[0391] 14. The construct of embodiment 3, or any other construct embodiment, wherein the cytokine or decoy receptor is present at 0.01 wt.% to 50 wt.% of the delivery vehicle.

[0392] 15. The construct of embodiment 14, or any other construct embodiment, wherein the cytokine or decoy receptor is present at 0.01 to 0.02 wt.%, 0.01 to 0.1 wt.%, 0.01 to 0.5 wt.%, 0.02 to 0.4 wt.%, 0.02 to 0.3 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, or 0.5 to 1 wt.% of the delivery vehicle.

[0393] 16. The construct of embodiment 14, or any other construct embodiment, wherein the cytokine or decoy receptor is present at 0.5 to 1 wt.%, 0.6 to 1 .6 wt.%, 0.6 to 2 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, 10 to 20 wt.%, 5 to 20 wt.%, 5 to 15 wt.%, or 10 to 50 wt.% of the delivery vehicle.

[0394] 17. The construct of embodiment 3, or any other construct embodiment, further includes anticancer agents, targeting or homing agents, antigens, or therapeutics for other immune-related diseases, optionally mitotic kinase inhibitors, immune checkpoint inhibitors, targeted therapies, small molecule inhibitors, chemotherapeutic agents, targeting agents, adjuvants, oligonucleotides, or antibodies.

[0395] 18. The construct of embodiment 17, or any other construct embodiment, wherein the cytokine is IL-2, and the antibody targets PD-L1 or PD-1 .

[0396] 19. The construct of embodiment 17, or any other construct embodiment, wherein the adjuvant includes one or more of a STING agonist, CpG oligonucleotide, a DNA TLR agonist containing a CpG sequence, a non-CpG DNA TLR agonist, an RNA TLR agonist, an aluminum salt, an anti-CD40 antibody, a fusion protein, a cytokine, a small molecule TLR agonist, imiquimod, resiquimod, gardiquimod, poly l:C, poly ICLC, dSLIM, EnanDIM, or an oil- or surfactant-based adjuvant, a lipopolysaccharide (LPS), a plant extract, or a derivative thereof.

[0397] 20. The construct of embodiment 19, or any other construct embodiment, wherein the adjuvant is CpG.

[0398] 21 . The construct of embodiment 17, or any other construct embodiment, wherein the adjuvant is present at 0.01 wt.% to 20 wt.% of the delivery vehicle, or at 0.01 to 0.5 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, 0.5 to 1 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, or 10 to 20 wt.% of the delivery vehicle.

[0399] 22. The construct of embodiment 17, or any other construct embodiment, wherein the antibody targets CD3, CD4, CD8, PD-1 , PD-L1 , CTLA-4, LFA-1 , CD25, CD122, CD19, CD20, CSF1 R, CD30, CD33, CD47, SIRPa, CD30, HER2, EGFR, DEC-205, CD40, DC-SIGN, CLEC9, MARCO, and CCR2.

[0400] 23. The construct of embodiment 17, or any other construct embodiment, wherein the antibody is present at 0.01 wt.% to 20 wt.% of the delivery vehicle, or at 0.01 to 0.5 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, 0.5 to 1 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 4 to 6 wt.%, 2.5 to 10 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, 10 to 20 wt.%, 1 to 10 wt.%, or 1 to 20 wt.% of the delivery vehicle.

[0401] 24. The construct of embodiment 17, or any other construct embodiment, wherein the oligonucleotide is siRNA, antisense oligonucleotide (ASO), miRNA, or sgRNA.

[0402] 25. The construct of embodiment 24, or any other construct embodiment, wherein the oligonucleotide inhibits expression or activity of STAT3, Axl, PI3K, IDO-6, PD-L1 , PD-1 , LAG-3, TIM- 3, B7-H3, VISTA, A2AR, FOXP3, CTLA-4, STAT5, IL-2Ra, TGFBR, IKZF4, FOXP3, CTLA-4, TGF-p, CD47, NOX1 -5, HSP47, XBP1 , BCL2, BCL-XL, AKT1 , AKT2, AKT3, MYC, HER2, HER3, AR, Survivin, GRB7, EPS8L1 , RRM2, PKN3, EGFR, IRE1 -alpha, VEGF-R1 , RTP801 , proNGF, Keratin K6A, LMP2, LMP7, MECL1 , HIF1 a, Furin, KSP, eiF-4E, p53, p-catenin, ApoB, PCSK9, SNALP, CD39, CD73, MIF, VEGF, PIGF, CXCR4, CCR2, PLK1 , MTDH, Twist, Lcn2, IL-6, IL-10, p65, mitotic kinases (e.g., PLK1 , PLK2, PLK3, PLK4, CDK1 , CDK2, CHK1 , CHK2, BUB1 , BUBR1 , MPS1 , NEK2, HASPIN, Aurora A), TNF, TNF-a, IL-1 A, IL-1 B, IL-12 / 23, IL-4, IL-5, IL-6, IL-8, IL-13, IL-17, NF-KB1 , NF-KB2, COX2, PTGS2, TLR4, MAPK, CCL2, CXCL10, IFN-y, and MMP9.

[0403] 26. The construct of embodiment 17, or any other construct embodiment, wherein the cytokine is IL-2 and the oligonucleotide targets TGF-p, FOXP3, CTLA-4, STAT3, or STAT5.

[0404] 27. The construct any one of embodiments 17-23, or any other construct embodiment, wherein the oligonucleotide is present at 0.01 wt.% to 20 wt.% of the delivery vehicle, or at 0.01 to 0.5 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, 0.5 to 1 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, 10 to 20 wt.%, 1 wt.%, 2 wt.%, 3 wt.%, 4 wt.%, 5 wt.%, 6 wt.%, 10 wt.%, 15 wt.%, or 20 wt.% of the delivery vehicle.

[0405] 28. The construct of embodiment 3, or any other construct embodiment, which construct has a mean particle size of 90 nm, 100 nm, 120 nm, 130 nm, 150 nm, 160 nm, 175 nm, 200 nm, 300 nm, 500 nm, 1 pm, 5 pm, 5-100 nm, 50-100 nm, 100-500 nm, 100-999 nm, 500-999 nm, 1 -5 pm, or above 1 pm.

[0406] 29. The construct of embodiment 3, or any other construct embodiment, wherein stability of cytokine is enhanced in the construct, when compared to an equivalent free cytokine.

[0407] 30. A composition including the construct of any one of embodiments 1 -29 and a pharmaceutically acceptable carrier, excipient, or diluent.

[0408] 31 . A method of treating cancer or other immune-related disease, including administering to a subject with the disease an effective amount of the construct of any one of embodiments 1 -29, or the composition of embodiment 30.

[0409] 32. The method of embodiment 31 , wherein the subject is a human.

[0410] 33. A method of treating a cell exhibiting symptoms of cancer, including contacting the cell with a therapeutically effective amount of the construct of any one of embodiments 1 -29, or the composition of embodiment 30.

[0411] 34. A method of treating a cell obtained from a subject exhibiting symptoms of cancer or other immune-related disease, including contacting the cell with a therapeutically effective amount of the construct of any one of embodiments 1 -29, or the composition of embodiment 30.

[0412] 35. A method of treating a cell obtained from a healthy subject, including contacting the cell with a therapeutically effective amount of the construct of any one of embodiments 1 -29, or the composition of embodiment 30.

[0413] 36. The method of embodiment 34, or any other method embodiment, wherein the cell is a cancer cell.

[0414] 37. The method of embodiment 34 or 35, or any other method embodiment, wherein the cell is not a cancer cell.

[0415] 38. The method of embodiment 34 or 35, or any other method embodiment, wherein the cell is an immune cell, which immune cell optionally is a DC cell, a NK cell, a B cell, a T cell, a neutrophil, or a macrophage.

[0416] 39. The method of embodiment 34 or 35, or any other method embodiment, wherein the cell is a stem cell, which stem cell optionally is an induced pluripotent stem cell (iPSC).

[0417] 40. The method of any one of embodiments 33-39, or any other method embodiment, further including administering at least one treated cell back to a subject.

[0418] 41. A method of treating a subject diagnosed as having a hyperproliferative disease or condition or other immune-related disease, including administering to the subject an effective amount of the construct of any one of embodiments 1 -29, or the composition of embodiment 30.

[0419] 42. The method of embodiment 41 , or any other method embodiment, wherein the hyperproliferative disease includes one or more of cancer, precancer, or cancer metastasis.

[0420] 43. The method of embodiment 41 , or any other method embodiment, wherein the hyperproliferative disease includes one or more of melanoma, lung cancer, breast cancer, colon cancer, pancreatic cancer, brain cancer, prostate cancer, head and neck cancer, kidney cancer, colorectal cancer, ovarian cancer, lymphoma, leukemia, mesothelioma, sarcoma, liver cancer, or other rare cancers / malignancies.

[0421] 44. The method of any one of embodiments 31 , 40, or 41 , or any other method embodiment, wherein the administering includes one or more of: injection to or at a tumor in the subject; infusion locally to or at a tumor in the subject; microneedle application to the subject systemic injection in the subject; systemic infusion in the subject; inhalation by the subject; oral administration to the subject; or topical application to the subject.

[0422] 45. A method of enhancing an effect of an anti-cancer therapy in a subject in need thereof, including administering to the subject: an effective amount of the construct of any one of embodiments 1 -29, or the composition of embodiment 30, or any other method embodiment; and at least one anticancer agent.

[0423] 46. The method of embodiment 45, or any other method embodiment, wherein the anti-cancer agent is a chemotherapeutic agent, a targeted therapeutic agent, radiation therapy, or an immune checkpoint inhibitor.

[0424] 47. The method of embodiment 45 or 46, or any other method embodiment, wherein the cytokine construct or composition and the anti-cancer therapy are administered sequentially or concurrently.

[0425] 48. A method of enhancing an effect of therapeutic agents in a subject in need thereof, including administering to a subject in need thereof: an effective amount of the construct of any one of embodiments 1 -29, or the composition of embodiment 30; and at least one therapeutic agent.

[0426] 49. The method of embodiment 48, or any other method embodiment, wherein the cytokine construct or composition and the therapeutic agents are administered sequentially or concurrently.

[0427] 50. The method of any one of embodiments 41 -49, or any other method embodiment, wherein the subject is human.

[0428] 51 . The method of any one of embodiments 31 -50, or any other method embodiment, wherein stability of the cytokine is enhanced, when compared to a free equivalent cytokine.

[0429] 52. A method of increasing stability of a cytokine, including loading the cytokine onto or into a nanoparticle construct including a delivery vehicle coated with a polymer coat including polyethylenimine (PEI) and polyethylene glycol (PEG), wherein the cytokine is attached to the PEI and / or PEG of the polymer coat on the vehicle.

[0430] 53. The method of embodiment 52, or any other method embodiment, wherein the increased stability includes increased stability through one or more freeze-thaw cycles, compared to the same cytokines not loaded onto or into the nanoparticle construct.Second Set of Exemplary Embodiments.

[0431] 1 . A cytokine construct including: a delivery vehicle, including a core coated with a polymer coat including polyethylenimine (PEI) and polyethylene glycol (PEG); and at least one cytokine or one decoy receptor attached to the PEI / PEG coat.

[0432] 2. The cytokine construct of embodiment 1 , wherein the delivery vehicle includes a liposome, a lipid-based particle, a polymeric particle, an inorganic nanoparticle, an organic nanoparticle, an inorganic microparticle, an organic microparticle, or a hybrid thereof.

[0433] 3. The cytokine construct of embodiment 2, wherein the delivery vehicle includes one or more of fullerenes, endohedral metallofullerenes, trimetallic nitride templated endohedral metallofullerenes, single-walled and multi-walled carbon nanotubes, calcium phosphate particles, aluminum salt particles, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled and multi-walled boron / nitrate nanotubes, carbon nanotube peapods, carbon nanohorns, carbon nanohorn peapods, liposomes, nanoshells, dendrimers, microparticles, quantum dots, superparamagnetic nanoparticles, nanorods, cellulose nanoparticles, silicon, silica and polymer micro- and nano-spheres, silica-shells, biodegradable PLGA micro- and nano-spheres, gold nanoparticles, cerium oxide particles, zinc oxide particles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, and / or modified micelles.

[0434] 4. The cytokine construct of any one of embodiments 1 -3, wherein the delivery vehicle includes a mesoporous silica nanoparticle (MSNP).

[0435] 5. The cytokine construct of embodiment 4, wherein the mesoporous silica nanoparticle has a mean particle size of 5-200 nm or 50 nm.

[0436] 6. The cytokine construct of any one of embodiments 1 -5, wherein the at least one cytokine includes IL-2, IL-8, IL-12, IL-15, GM-CSF, EGF, TNF-a, or TGF-p.

[0437] 7. The cytokine construct of any one of embodiments 1 -6, wherein the at least one cytokine is IL-2.

[0438] 8. The cytokine construct of any one of embodiments 1 -7, wherein the decoy receptor is IL- 18BP decoy receptor, IL-22BP decoy receptor, DcR1 decoy receptor, DcR2 decoy receptor, DcR3 decoy receptor, IL-13R2 decoy receptor, IL-1 RII decoy receptor, or TGF-p decoy receptor.

[0439] 9. The cytokine construct of embodiment 1 -7, further including TGF-p.

[0440] 10. The cytokine construct of embodiment 1 -8, wherein the cytokine is IL-2 and the decoy receptor is TGF-p decoy receptor.

[0441] 1 1. The cytokine construct of any one of embodiments 1 -10, wherein the cytokine or decoy receptor is present at 0.01 wt.% to 50 wt.% of the delivery vehicle.

[0442] 12. The cytokine construct of embodiment 11 , wherein the cytokine or decoy receptor is present at 0.01 to 0.02 wt.%, 0.01 to 0.1 wt.%, 0.01 to 0.5 wt.%, 0.02 to 0.4 wt.%, 0.02 to 0.3 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, or 0.5 to 1 wt.% of the delivery vehicle.

[0443] 13. The cytokine construct of embodiment 11 , wherein the cytokine or decoy receptor is present at 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, 10 to 20 wt.%, 5 to 20 wt.%, 5 to 15 wt.%, or 10 to 50 wt.% of the delivery vehicle.

[0444] 14. The cytokine construct of any one of embodiments 1 -13, further includes anti-cancer agents, targeting or homing agents, antigens, or therapeutics for other immune-related diseases (e.g., mitotic kinase inhibitors, immune checkpoint inhibitors, targeted therapies, small molecule inhibitors, chemotherapeutic agents, targeting agents, adjuvants, oligonucleotides, or antibody).

[0445] 15. The cytokine construct of embodiment 14, wherein the cytokine is IL-2, and the antibody targets PD-L1 or PD-1 .

[0446] 16. The cytokine construct of embodiment 14, wherein the adjuvant includes one or more of a CpG oligonucleotide, a DNA TLR agonist containing a CpG sequence, a non-CpG DNA TLR agonist, an RNA TLR agonist, an aluminum salt, an anti-CD40 antibody, a fusion protein, a cytokine, a small molecule TLR agonist, imiquimod, resiquimod, gardiquimod, poly l:C, poly ICLC, dSLIM, EnanDIM, or an oil- or surfactant-based adjuvant, a lipopolysaccharide (LPS), a plant extract, or a derivative thereof.

[0447] 17. The cytokine construct of embodiment 16, wherein the adjuvant is CpG.

[0448] 18. The cytokine construct of any one of embodiments 14-17, wherein the adjuvant is present at 0.01 wt.% to 20 wt.% of the delivery vehicle, or at 0.01 to 0.5 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, 0.5 to 1 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, or 10 to 20 wt.% of the delivery vehicle.

[0449] 19. The cytokine construct of embodiment 14, wherein the antibody targets CD3, CD4, CD8, PD-1 , PD-L1 , CTLA-4, LFA-1 , CD25, CD122, CD19, CD20, CSF1 R, CD30, CD33, CD47, SIRPa, CD30, HER2, EGFR, DEC-205, CD40, DC-SIGN, CLEC9, MARCO, and CCR2.

[0450] 20. The cytokine construct of any one of embodiments 14-19, wherein the antibody is present at 0.01 wt.% to 20 wt.% of the delivery vehicle, or at 0.01 to 0.5 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, 0.5 to 1 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, 10 to 20 wt.%, 1 to 10 wt.%, or 1 to 20 wt.% of the delivery vehicle.

[0451] 21 . The cytokine construct of embodiment 14, wherein the oligonucleotide is siRNA, antisense oligonucleotide (ASO), miRNA, or sgRNA.

[0452] 22. The cytokine construct of embodiment 21 , wherein the oligonucleotide inhibits expression or activity of STAT3, Axl, PI3K, IDO-6, PD-L1 , PD-1 , LAG-3, TIM-3, B7-H3, VISTA, A2AR, FOXP3, CTLA-4, STAT5, IL-2Ra, TGFBR, IKZF4, FOXP3, CTLA-4, TGF-p, CD47, NOX1 -5, HSP47, XBP1 , BCL2, BCL-XL, AKT1 , AKT2, AKT3, MYC, HER2, HER3, AR, Survivin, GRB7, EPS8L1 , RRM2, PKN3, EGFR, IRE1 -alpha, VEGF-R1 , RTP801 , proNGF, Keratin K6A, LMP2, LMP7, MECL1 , HIF1 a, Furin, KSP, eiF-4E, p53, p-catenin, ApoB, PCSK9, SNALP, CD39, CD73, MIF, VEGF, PIGF, CXCR4,CCR2, PLK1 , MTDH, Twist, Lcn2, IL-6, IL-10, p65, mitotic kinases (e.g., PLK1 , PLK2, PLK3, PLK4, CDK1 , C...

Claims

LISTING OF CLAIMSWhat is claimed is:1 . A nanoparticle construct comprising: a delivery vehicle, comprising: a mesoporous silica nanoparticle (MSNP) coated with an uncross-linked polymer coat comprising: at least 18% (by MSNP weight) polyethylenimine (PEI); and polyethylene glycol (PEG); andIL-2 attached to the PEI and / or PEG of the polymer coat on the delivery vehicle.

2. The nanoparticle construct of claim 1 , which nanoparticle construct comprises at least 1700 molecules of IL-2 attached to the PEI and / or PEG of the polymer coat on the delivery vehicle3. A construct comprising:(1 ) a delivery vehicle, comprising: a core coated with a polymer coat comprising: at least 18% (by core weight) polyethylenimine (PEI); and polyethylene glycol (PEG); and at least one cytokine attached to the PEI and / or PEG of the polymer coat on the delivery vehicle; or(2) a delivery vehicle, comprising: a core coated with a polymer coat comprising: polyethylenimine (PEI); and polyethylene glycol (PEG); and at least one decoy receptor attached to the PEI and / or PEG of the polymer coat on the delivery vehicle; or(3) a delivery vehicle, comprising: a mesoporous silica nanoparticle (MSNP) coated with an uncross-linked polymer coat comprising: polyethylenimine (PEI); and polyethylene glycol (PEG); and at least one STING agonists attached to the PEI and / or PEG of the polymer coat on the delivery vehicle.

4. The construct of claim 3, wherein the delivery vehicle comprises a liposome, a lipid-based particle, a polymeric particle, an inorganic nanoparticle, an organic nanoparticle, an inorganic microparticle, an organic microparticle, or a hybrid thereof.

5. The construct of claim 4, wherein the delivery vehicle comprises one or more of fullerenes, endohedral metallofullerenes, trimetallic nitride templated endohedral metallofullerenes, single-walled and multi-walled carbon nanotubes, calcium phosphate particles, aluminum salt particles, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled and multi-walled boron / nitrate nanotubes, carbon nanotube peapods, carbon nanohorns, carbon nanohorn peapods, liposomes, nanoshells, dendrimers, microparticles, quantum dots, superparamagnetic nanoparticles,nanorods, cellulose nanoparticles, silicon, silica nanoparticles, silica and polymer micro- and nanospheres, silica-shells, biodegradable PLGA micro- and nano-spheres, gold nanoparticles, cerium oxide particles, zinc oxide particles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, and / or modified micelles.

6. The construct of claim 3, wherein the delivery vehicle comprises a mesoporous silica nanoparticle (MSNP).

7. The construct of claim 6, wherein the mesoporous silica nanoparticle has a mean particle size of 5-200 nm or 50 nm.

8. The construct of claim 3, wherein the at least one cytokine comprises IL-2, IL-8, IL-15, IL-12, IL-15, GM-CSF, EGF, TNF-a, or TGF-p.

9. The construct of 8, wherein the at least one cytokine is IL-2.

10. The construct of claim 3, wherein the decoy receptor is IL-18BP decoy receptor, IL-22BP decoy receptor, DcR1 decoy receptor, DcR2 decoy receptor, DcR3 decoy receptor, IL-13R2 decoy receptor, IL-1 RII decoy receptor, or TGF-p decoy receptor.1 1 . The construct of claim 3, further comprising TGF-p.

12. The construct of claim 3, comprising at least one cytokine and at least one decoy receptor.

13. The construct of claim 12, wherein the cytokine is IL-2 and the decoy receptor is TGF-p decoy receptor.

14. The construct of claim 3, wherein the cytokine or decoy receptor is present at 0.01 wt.% to 50 wt.% of the delivery vehicle.

15. The construct of claim 14, wherein the cytokine or decoy receptor is present at 0.01 to 0.02 wt.%, 0.01 to 0.1 wt.%, 0.01 to 0.5 wt.%, 0.02 to 0.4 wt.%, 0.02 to 0.3 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, or 0.5 to 1 wt.% of the delivery vehicle.

16. The construct of claim 14, wherein the cytokine or decoy receptor is present at 0.5 to 1 wt.%, 0.6 to 1 .6 wt.%, 0.6 to 2 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, 10 to 20 wt.%, 5 to 20 wt.%, 5 to 15 wt.%, or 10 to 50 wt.% of the delivery vehicle.

17. The construct of claim 3, further comprises anti-cancer agents, targeting or homing agents, antigens, or therapeutics for other immune-related diseases, optionally mitotic kinase inhibitors, immune checkpoint inhibitors, targeted therapies, small molecule inhibitors, chemotherapeutic agents, targeting agents, adjuvants, oligonucleotides, or antibodies.

18. The construct of claim 17, wherein the cytokine is IL-2, and the antibody targets PD-L1 or PD- 1 .

19. The construct of claim 17, wherein the adjuvant comprises one or more of a STING agonist, CpG oligonucleotide, a DNA TLR agonist containing a CpG sequence, a non-CpG DNA TLR agonist, an RNA TLR agonist, an aluminum salt, an anti-CD40 antibody, a fusion protein, a cytokine, a small molecule TLR agonist, imiquimod, resiquimod, gardiquimod, poly l:C, poly ICLC, dSLIM, EnanDIM, or an oil- or surfactant-based adjuvant, a lipopolysaccharide (LPS), a plant extract, or a derivative thereof.

20. The construct of claim 19, wherein the adjuvant is CpG.21 . The construct of claim 17, wherein the adjuvant is present at 0.01 wt.% to 20 wt.% of the delivery vehicle, or at 0.01 to 0.5 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, 0.5 to 1 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, or 10 to 20 wt.% of the delivery vehicle.

22. The construct of claim 17, wherein the antibody targets CD3, CD4, CD8, PD-1 , PD-L1 , CTLA- 4, LFA-1 , CD25, CD122, CD19, CD20, CSF1 R, CD30, CD33, CD47, SIRPa, CD30, HER2, EGFR, DEC-205, CD40, DC-SIGN, CLEC9, MARCO, and CCR2.

23. The construct of claim 17, wherein the antibody is present at 0.01 wt.% to 20 wt.% of the delivery vehicle, or at 0.01 to 0.5 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, 0.5 to 1 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 4 to 6 wt.%, 2.5 to 10 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, 10 to 20 wt.%, 1 to 10 wt.%, or 1 to 20 wt.% of the delivery vehicle.

24. The construct of claim 17, wherein the oligonucleotide is siRNA, antisense oligonucleotide (ASO), miRNA, or sgRNA.

25. The construct of claim 24, wherein the oligonucleotide inhibits expression or activity of STAT3, Axl, PI3K, IDO-6, PD-L1 , PD-1 , LAG-3, TIM-3, B7-H3, VISTA, A2AR, FOXP3, CTLA-4, STAT5, IL- 2Ra, TGFBR, IKZF4, FOXP3, CTLA-4, TGF-p, CD47, NOX1 -5, HSP47, XBP1 , BCL2, BCL-XL, AKT1 , AKT2, AKT3, MYC, HER2, HER3, AR, Survivin, GRB7, EPS8L1 , RRM2, PKN3, EGFR, IRE1 -alpha, VEGF-R1 , RTP801 , proNGF, Keratin K6A, LMP2, LMP7, MECL1 , HIF1 a, Furin, KSP, eiF-4E, p53, p- catenin, ApoB, PCSK9, SNALP, CD39, CD73, MIF, VEGF, PIGF, CXCR4, CCR2, PLK1 , MTDH, Twist, Lcn2, IL-6, IL-10, p65, mitotic kinases (e.g., PLK1 , PLK2, PLK3, PLK4, CDK1 , CDK2, CHK1 , CHK2, BUB1 , BUBR1 , MPS1 , NEK2, HASPIN, Aurora A), TNF, TNF-a, IL-1 A, IL-1 B, IL-12 / 23, IL-4, IL-5, IL-6, IL-8, IL-13, IL-17, NF-KB1 , NF-KB2, COX2, PTGS2, TLR4, MAPK, CCL2, CXCL10, IFN-y, and MMP9.

26. The construct of claim 17, wherein the cytokine is IL-2 and the oligonucleotide targets TGF-p, FOXP3, CTLA-4, STAT3, or STAT5.

27. The construct any one of claims 17-23, wherein the oligonucleotide is present at 0.01 wt.% to 20 wt.% of the delivery vehicle, or at 0.01 to 0.5 wt.%, 0.1 to 0.5 wt.%, 0.01 to 1 wt.%, 0.5 to 1 wt.%, 1 to 2 wt.%, 1 to 5 wt.%, 3 to 4 wt.%, 5 to 7 wt.%, 7 to 10 wt.%, 5 to 10 wt.%, 1 to 10 wt.%, 1 to 20 wt.%, 10 to 15 wt.%, 10 to 20 wt.%, 1 wt.%, 2 wt.%, 3 wt.%, 4 wt.%, 5 wt.%, 6 wt.%, 10 wt.%, 15 wt.%, or 20 wt.% of the delivery vehicle.

28. The construct of claim 3, which construct has a mean particle size of 90 nm, 100 nm, 120 nm, 130 nm, 150 nm, 160 nm, 175 nm, 200 nm, 300 nm, 500 nm, 1 pm, 5 pm, 5-100 nm, 50-100 nm, 100- 500 nm, 100-999 nm, 500-999 nm, 1 -5 pm, or above 1 pm.

29. The construct of claim 3, wherein stability of cytokine is enhanced in the construct, when compared to an equivalent free cytokine.

30. A composition comprising the construct of any one of claims 1 -29 and a pharmaceutically acceptable carrier, excipient, or diluent.31 . A method of treating cancer or other immune-related disease, comprising administering to a subject with the disease an effective amount of the construct of any one of claims 1 -29, or the composition of claim 30.

32. The method of claim 31 , wherein the subject is a human.

33. A method of treating a cell exhibiting symptoms of cancer, comprising contacting the cell with a therapeutically effective amount of the construct of any one of claims 1 -29, or the composition of claim 30.

34. A method of treating a cell obtained from a subject exhibiting symptoms of cancer or other immune-related disease, comprising contacting the cell with a therapeutically effective amount of the construct of any one of claims 1 -29, or the composition of claim 30.

35. A method of treating a cell obtained from a healthy subject, comprising contacting the cell with a therapeutically effective amount of the construct of any one of claims 1 -29, or the composition of claim 30.

36. The method of claim 34, wherein the cell is a cancer cell.

37. The method of claim 34 or 35, wherein the cell is not a cancer cell.

38. The method of claim 34 or 35, wherein the cell is an immune cell, which immune cell optionally is a DC cell, a NK cell, a B cell, a T cell, a neutrophil, or a macrophage.

39. The method of claim 34 or 35, wherein the cell is a stem cell, which stem cell optionally is an induced pluripotent stem cell (IPSC).

40. The method of any one of claims 33-39, further comprising administering at least one treated cell back to a subject.41 . A method of treating a subject diagnosed as having a hyperproliferative disease or condition or other immune-related disease, comprising administering to the subject an effective amount of the construct of any one of claims 1 -29, or the composition of claim 30.

42. The method of claim 41 , wherein the hyperproliferative disease comprises one or more of cancer, precancer, or cancer metastasis.

43. The method of claim 41 , wherein the hyperproliferative disease comprises one or more of melanoma, lung cancer, breast cancer, colon cancer, pancreatic cancer, brain cancer, prostate cancer, head and neck cancer, kidney cancer, colorectal cancer, ovarian cancer, lymphoma, leukemia, mesothelioma, sarcoma, liver cancer, or other rare cancers / malignancies.

44. The method of any one of claims 31 , 40, or 41 , wherein the administering comprises one or more of: injection to or at a tumor in the subject; infusion locally to or at a tumor in the subject; microneedle application to the subject systemic injection in the subject; systemic infusion in the subject; inhalation by the subject; oral administration to the subject; ortopical application to the subject.

45. A method of enhancing an effect of an anti-cancer therapy in a subject in need thereof, comprising administering to the subject: an effective amount of the construct of any one of claims 1 -29, or the composition of claim 30; and at least one anti-cancer agent.

46. The method of claim 45, wherein the anti-cancer agent is a chemotherapeutic agent, a targeted therapeutic agent, radiation therapy, or an immune checkpoint inhibitor.

47. The method of claim 45 or 46, wherein the cytokine construct or composition and the anticancer therapy are administered sequentially or concurrently.

48. A method of enhancing an effect of therapeutic agents in a subject in need thereof, comprising administering to a subject in need thereof: an effective amount of the construct of any one of claims 1 -29, or the composition of claim 30; and at least one therapeutic agent.

49. The method of claim 48, wherein the cytokine construct or composition and the therapeutic agents are administered sequentially or concurrently.

50. The method of any one of claims 41 -49, wherein the subject is human.51 . The method of any one of claims 31 -50, wherein stability of the cytokine is enhanced, when compared to a free equivalent cytokine.

52. A method of increasing stability of a cytokine, comprising loading the cytokine onto or into a nanoparticle construct comprising a delivery vehicle coated with a polymer coat comprising polyethylenimine (PEI) and polyethylene glycol (PEG), wherein the cytokine is attached to the PEI and / or PEG of the polymer coat on the vehicle.

53. The method of claim 52, wherein the increased stability comprises increased stability through one or more freeze-thaw cycles, compared to the same cytokines not loaded onto or into the nanoparticle construct.

Images