Method for inducing apomixis in plants

Abstract

The present invention belongs to the fields of plant breeding and biotechnology. Disclosed is a method for inducing apomixis in plants. Specifically, the present invention relates to the use of the WUS gene in the induction of apomixis. It is found in the research of the present inventors that the MOC3 gene (renamed OsWUS) in rice can be used for constructing apomictic lines. In these lines, the seed-setting rate and the induction rate of clonal seeds show different degrees of changes. In particular, some lines maintain a normal seed-setting rate, and achieve a clonal seed efficiency of up to 22%. Therefore, the present invention has relatively good application values.

Description

A method for inducing plant apomixis Technical Field

[0001] The present invention belongs to the field of plant breeding and biotechnology, and particularly relates to a method for inducing plant apomixis, and particularly relates to the application of the WUS gene in inducing apomixis. Background Art

[0002] Hybrid vigor, the phenomenon in which hybrid offspring surpass their parents in vitality, stress resistance, and yield, has been widely utilized in agricultural production. Hybrid varieties currently cover approximately 50% of rice cultivation area in my country, making a significant contribution to national food security. However, hybrid vigor is difficult to pass on to future generations due to genetic recombination and segregation, requiring significant manpower and material resources to produce hybrid seeds annually. This cumbersome process not only increases risk and cost but also limits the further application of hybrids. Therefore, achieving self-retention of hybrid seeds is considered the ultimate goal of hybrid breeding. Apomixis is an asexual reproduction method that reproduces clonally through seeds, producing offspring that are identical to the maternal genotype. Introducing apomixis into hybrids can maintain a stable heterozygous genotype in hybrid offspring, preventing trait segregation and thus stabilizing heterosis. This will greatly simplify breeding procedures, reduce risks and costs, and expand the application of hybrid vigor. In recent decades, with the elucidation of the molecular mechanisms of reproductive development and the development of gene editing technologies, significant breakthroughs have been made in the technology of artificially creating apomixis. Multiple research teams have successfully created clonal seeds in model plants such as Arabidopsis and rice through the MiMe strategy (producing clonal gametes with completely identical maternal genotypes) and haploid induction strategy. Mercier's team pioneered hybridization of MiMe (Atspo11-1-Atrec8-Atosd1) with a cenh3 chromosome elimination line in Arabidopsis thaliana, obtaining approximately 40% clonal seeds (Marimuthu MP, Jolivet S, Ravi M, Pereira L, Davda JN, Cromer L, Wang L, Nogué F, Chan SW, Siddiqi I, Mercier R. Synthetic clonal reproduction through seeds. Science. 2011 Feb 18;331(6019):876. doi:10.1126 / science.1199682.). It is noteworthy that although CENH3 function is highly conserved across multiple species, no CENH3-based apomixis system has been reported in systems other than Arabidopsis thaliana. In 2019, Venkatesan Sundaresan's team combined the MiMe gene (pair1-rec8-osd1) with the BBM1 expression element driven by the egg cell-specific promoter pDD45, establishing an apomixis system in the conventional rice variety Kitaake for the first time and obtaining cloned seeds of Kitaake. Although the seed set rate was low, the cloning efficiency reached a maximum of 29% (Khanday I, Skinner D, Yang B, Mercier R, Sundaresan VA. Male-expressed rice embryogenic trigger redirected for asexual propagation through seeds. Nature. 2019 Jan;565(7737):91-95. doi:10.1038 / s41586-018-0785-8.).In the same year, Wang Kejian's team used CRISPR / Cas9 technology to obtain a Fix strain with simultaneous mutations in the MiMe (pair1-rec8-osd1) and mtl genes in the indica-japonica hybrid rice Chunyou 84 (CY84), successfully producing clonal seeds of hybrid rice for the first time. The fruit set rate ranged from 3.7% to 5.2%, and clonal seeds accounted for 4.7% to 9.5% of all fertile seeds (Wang C, Liu Q, Shen Y, Hua Y, Wang J, Lin J, Wu M, Sun T, Cheng Z, Mercier R, Wang K. Clonal seeds from hybrid rice by simultaneous genome engineering of meiosis and fertilization genes. Nat Biotechnol. 2019 Mar; 37(3): 283-286. doi: 10.1038 / s41587-018-0003-0.). Unlike the CENH3 strategy, these two methods do not require a hybridization process and can obtain apomixis clone seeds through self-pollination, opening up new research directions for the fixed utilization of crop hybrid vigor. In 2022, the team of Emmanuel Guiderdoni and Raphael Mercier integrated BBM1 and MiMe into the same vector in the hybrid rice BRS-CIRAD 302 variety, creating an apomixis system with a clonal seed ratio of more than 90%, although the fruit set rate of this system under greenhouse conditions was only about 30% (Vernet A, Meynard D, Lian Q, Mieulet D, Gibert O, Bissah M, Rivallan R, Autran D, Leblanc O, Meunier AC, Frouin J, Taillebois J, Shankle K, Khanday I, Mercier R, Sundaresan V, Guiderdoni E. High-frequency synthetic apomixis in hybrid rice. Nat Commun. 2022 Dec 27; 13(1): 7963. doi: 10.1038 / s41467-022-35679-3.).In 2023, Wang Kejian's team further explored the application potential of BBM1's homologous gene BBM4 in the apomixis system. They successfully obtained the Fix2 strain capable of apomixis in the indica-japonica hybrid rice Chunyou 84 (CY84). These cloned plants are very similar to wild-type hybrid rice in appearance and maintain a high fruit set rate of 80.9 to 82.0%, although in this study, the highest proportion of cloned seeds was only 2.3% (Wei X, Liu C, Chen X, Lu H, Wang J, Yang S, Wang K. Synthetic apomixis with normal hybrid rice seed production. Mol Plant. 2023 Mar 6; 16(3): 489-492. doi: 10.1016 / j.molp.2023.01.005.). Recent research has shown that by combining parthenogenesis induced by the dandelion PAR gene with the MiMe (pair1-rec8-osd1) strategy, apomixis can be achieved in hybrid rice, maintaining normal fruit set while achieving a clonal seed efficiency of up to 67.7% (Song M, Wang W, Ji C, Li S, Liu W, Hu X, Feng A, Ruan S, Du S, Wang H, Dai K, Guo L, Qian Q, Si H, Hu X. Simultaneous production of high-frequency synthetic apomixis with high fertility and improved agronomic traits in hybrid rice. Mol Plant. 2024 Jan 1;17(1):4-7.doi:10.1016 / j.molp.2023.11.007.). These findings not only provide a new research path for fixing heterosis in crops, but also have far-reaching scientific significance and application value for ensuring global food security.

[0003] While rice apomixis technology has made significant progress, it still faces key challenges. On the one hand, while apomictic plants can maintain normal seed set, the efficiency of their clonal seed production is quite low. On the other hand, as the efficiency of clonal seed production approaches 100%, the seed set rate of apomictic plants decreases significantly. This indicates that a comprehensive apomictic technology system that can both guarantee 100% cloning efficiency and maintain normal seed set in cloned plants has not yet been developed, limiting the practical application of hybrid rice apomictic technology. Therefore, there is an urgent need to explore and identify more genes related to apomixis in order to further optimize and improve existing technology systems. Summary of the Invention

[0004] The present invention aims to prepare an apomictic plant strain. Through research, it was found that the WUS gene in plants such as rice can be used to construct an apomictic plant strain, thereby completing the present invention.

[0005] The present invention first provides an application of the WUS gene in preparing an apomictic plant strain. Preferably, the plant is a monocotyledonous plant or a dicotyledonous plant; preferably, the plant is a grass, leguminous, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed.

[0006] Furthermore, a binary expression vector for inducing an apomictic plant line is provided, comprising a WUS gene driven by a promoter specifically expressed by an egg cell; preferably, the WUS gene is derived from a monocot or dicot plant; preferably, the WUS gene is derived from a grass, legume, or crucifer plant; preferably, the WUS gene is derived from rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed;

[0007] The WUS gene is a full-length genomic sequence gene or a full-length coding region sequence gene.

[0008] Furthermore, the vector also carries elements that can produce MiMe. Preferably, MiMe includes simultaneous mutations of PAIR1, REC8 and OSD1, and the elements that can produce MiMe include: a DNA sequence encoding PARI1 sgRNA driven by a U3 promoter, a DNA sequence encoding REC8 sgRNA driven by a U3 promoter, and a DNA sequence encoding OSD1 sgRNA driven by a U3 promoter.

[0009] For example, rice is a diploid plant. The introduction of the MiMe element can produce tetraploid offspring, while the WUS expression element can induce haploid production. Combining the MiMe and WUS expression elements can halve tetraploids to produce diploids, generating clonal seeds. Therefore, only when the MiMe and WUS expression elements are on the same vector can apomictic lines be induced.

[0010] Specifically, the starting vector is pCAMBIA 1300; pCAMBIA series vectors other than pCAMBIA1300, pGreen series vectors, pBIN series vectors, pBI series vectors, and pHELLSGATE series vectors; the promoter is an egg cell-specific promoter, preferably, selected from AtDD45 (At2g21740), AtEC1.1 (At1g76750), AtEC1.3 (At2g21750), AtEC1.4 (At4g39340), AtEC1.5 (At5g64720), OsECA1 (LOC_Os03g18530), OsECA2 (LOC_Os11g06730), and OsECA3 (LOC_Os12g06970).

[0011] Preferably, the rice OsWUS gene is a full-length OsWUS genomic sequence gene or a full-length OsWUS coding region sequence gene.

[0012] The present invention also provides a method for inducing plant apomixis, which comprises the following steps: transferring a binary expression vector comprising an element capable of producing MiMe and a WUS ectopic expression element driven by an egg cell-specific promoter into corresponding plants, and screening transgenic plants for lines expressing MiMe and WUS ectopically, thereby obtaining an apomictic line.

[0013] Specifically, the plant is a monocotyledonous plant or a dicotyledonous plant; preferably, the plant is a grass, leguminous, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed.

[0014] In a specific embodiment, the introduction is achieved by using a gene gun method or an Agrobacterium-mediated method.

[0015] Optionally, the method further comprises the step of screening out apomictic plants with normal fruit setting rate and high seed cloning efficiency.

[0016] Taking rice as an example, since it is a diploid plant, the introduction of MiMe-producing elements into rice can produce tetraploid offspring, while ectopic expression of the WUS gene can induce haploid production. Therefore, when the MiMe element and the WUS ectopic expression element are combined, the tetraploid population can be halved to a diploid, thereby producing clonal seeds. Only by co-expressing the MiMe element and the WUS ectopic expression element (for example, integrating them into a single expression vector) can apomictic lines be successfully induced.

[0017] For some plants, such as maize and millet, the elements capable of producing MiMes have not yet been constructed. However, with the maturation of gene editing systems and genetic transformation technologies in maize and millet, MiMes in maize and millet may become available. Combined with haploid induction of the WUS gene in maize and millet, it is possible to create apomictic lines of maize and millet based on the WUS gene.

[0018] The WUSCHEL (WUS) gene is considered an important plant stem cell regulatory gene and plays a key role in the maintenance of the apical meristem. In crops such as Arabidopsis thaliana and maize, studies have shown that overexpression of the WUS gene can promote somatic embryogenesis and shoot organ regeneration in tissue culture (Lowe K, Wu E, Wang N, Hoerster G, Hastings C, Cho MJ, Scelonge C, Lenderts B, Chamberlin M, Cushatt J, Wang L, Ryan L, Khan T, Chow-Yiu J, Hua W, Yu M, Banh J, Bao Z, Brink K, Igo E, Rudrappa B, Shamseer PM, Bruce W, Newman L, Shen B, Zheng P, Bidney D, Falco C, Register J, Zhao ZY, Xu D, Jones T, Gordon-Kamm W. Morphogenic Regulators Baby Boom and Wuschel Improve Monocot Transformation. Plant Cell. 2016). Sep;28(9):1998-2015.doi:10.1105 / tpc.16.00124.). Specifically, the WUS gene in Arabidopsis thaliana has a homologous gene in rice called MOC3, which encodes a member of the WOX protein family and is involved in the formation and development of rice tiller buds. When this gene function is lost, the formation of tiller buds is blocked, causing the plant to exhibit a phenotype of reduced tiller number (Tanaka W, Ohmori Y, Ushijima T, Matsusaka H, ​​Matsushita T, Kumamaru T, Kawano S, Hirano HY. Axillary Meristem Formation in Rice Requires the WUSCHEL Ortholog TILLERS ABSENT1. Plant Cell. 2015 Apr;27(4):1173-84.doi:10.1105 / tpc.15.00074.). However, the inventors' research found that the MOC3 gene (renamed OsWUS) in rice can be used to construct apomictic lines. In these lines, the fruit set rate and the induction rate of cloned seeds showed varying degrees of variation. In particular, the fruit set rate of some lines remained normal, and the efficiency of cloned seeds could reach as high as 22%.

[0019] In rice-related research, reports have shown that apomictic plants based on BBM1 can achieve a clonal seed induction efficiency close to 100%, but their maximum seed set rate in a greenhouse environment is only about 40%; while apomictic plants based on BBM4 maintain a normal seed set rate, their maximum clonal seed induction rate is only 2.3%. In contrast, the apomictic lines based on OsWUS in the present invention not only maintain a normal seed set rate, but also achieve a maximum clonal seed efficiency of 22%, which is approximately ten times that of BBM4. In addition, although apomictic plants based on ToPAR achieve a normal seed set rate and a maximum clonal seed efficiency of 67.7%, the fact that ToPAR is a dandelion-derived gene, rather than an endogenous gene of rice, may limit its practical application in rice apomictic applications. Therefore, our invention, the apomictic system based on OsWUS, exhibits significant advantages. This not only includes significantly improving the induction efficiency of cloned seeds while maintaining the fruit set rate, but also because OsWUS is an endogenous gene of rice, it is more suitable for the application and promotion of rice apomixis technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1. Schematic diagram of the binary vector for combined ectopic expression of MiMe and OsWUS.

[0021] Figure 2. Transgenic positive identification results.

[0022] Figure 3. Genotypes of homozygous mutations in the PAIR1, REC8, and OSD1 genes.

[0023] Figure 4. Phenotypic analysis of wild-type Chunyou 84 (CY84) and T225#6 strains.

[0024] Fig. 5. Phenotypic comparison between ZmWUS haploid plants and Zheng 58 diploid plants.

[0025] Fig. 6. Phenotypic comparison of SiWUS haploid plants and foxtail millet Ci846 diploid plants. DETAILED DESCRIPTION

[0026] The present invention is further described below with reference to specific examples, which however do not constitute limitations of the present invention.

[0027] In the current study, the artificial creation of apomixis mainly involves the fusion of the MiMe strategy and the haploid induction strategy. First, the genomic sequence of the rice OsWUS gene, including its exons and introns, was successfully cloned and labeled gOsWUS. Subsequently, knockout elements for the three genes PAIR1, REC8, and OSD1, as well as the gOsWUS expression element driven by the Arabidopsis egg cell-specific expression promoter pAtDD45, were integrated into the pCAMBIA1300 binary vector, completing the construction of the vector T225 (sgMiMe_pAtDD45: gOsWUS). Through Agrobacterium-mediated genetic transformation, the T225 vector was introduced into the indica-japonica hybrid rice variety Chunyou 84 (CY84) to create apomictic lines. The goal of this invention is to screen for apomictic plants with normal fruit set and high seed cloning efficiency.

[0028] Example 1: Creation of rice apomictic lines

[0029] 1. Cloning and sequence analysis of the OsWUS gene in rice

[0030] The leaf DNA of Chunyou 84 was extracted by CTAB method and amplified using primers 56780-cds-F1 and 56780-cds-R1 to obtain the genomic sequence of the OsWUS gene, which included its three exons and two introns and was labeled as gOsWUS.

[0031] 56780-cds-F1: ATGGATCACATGCAGCAGCAGCAGCGGCAGCAGGTG

[0032] 56780-cds-R1:TCACATGGACCCTGCAGGGTAAGGTGAGCATGAG

[0033] The following is the sequence of gOsWUS (SEQ ID No: 1, which contains 2 intron sequences):

[0034] It contains two introns:

[0035] Intron 1 is (SEQ ID No: 2): GTACGTTGCTGCGTCATGGCTAATTCCGATCGCTGCTTCCCTGCTAAGCTGTAATGCGCGAGCCGGCGCCGAGCCGCCGATCGATGCTTCTGCGTGTGCAG.

[0036] Intron 2 is (SEQ ID No: 3): GTATGATCACACGTACTACTACCTCCTCCAGGTGTGTGAATTCACCATGCAAGAGCAAGCTAATGTGCAATGCTGCAG.

[0037] 2. Construction of sgMiMe vector

[0038] The main steps are as follows (the specific operations can also refer to the method described in the paper Wang C, Shen L, Fu Y, Yan C, Wang KA Simple CRISPR / Cas9 System for Multiplex Genome Editing in Rice. J Genet Genomics. 2015 Dec 20; 42(12): 703-6. doi: 10.1016 / j.jgg.2015.09.011, with slight modifications):

[0039] 1) Construction of sgMiMe intermediate vector

[0040] The target sequences of PAIR1, REC8, and OSD1 genes were referenced from the target sites reported in the paper (Wang C, Liu Q, Shen Y, Hua Y, Wang J, Lin J, Wu M, Sun T, Cheng Z, Mercier R, Wang K. Clonal seeds from hybrid rice by simultaneous genome engineering of meiosis and fertilization genes. Nat Biotechnol. 2019 Mar; 37(3): 283-286. doi: 10.1038 / s41587-018-0003-0.) (the underlined marks are PAM sequences), specifically:

[0041] PAIR1 target site: AAGCAACCCAGTGCACCGCTGG

[0042] REC8 target site: CGGAGAGCCTTAGTGCCATGGG

[0043] Target site of OSD1: CTGCCGCCGACGAGCAACAAG.

[0044] Two complementary DNA sequences, PAIR1, REC8, and OSD1, were designed respectively. Adding GGCA before the forward target sequence constituted the forward primer of the target, and adding AAAC before the reverse complementary target sequence constituted the reverse primer of the target.

[0045] There are two AarI restriction sites on the SK-gRNA intermediate vector. After AarI enzyme digestion, a vector with sticky ends is formed; the target forward and reverse primers are mixed and denatured and annealed to form fragments with sticky ends; the vector and fragments are connected using T4 ligase to form an intermediate vector of the sgMiMe single target gene, which are marked as SK-gPAIR1, SK-gREC8, and SK-gOSD1 respectively.

[0046] 2) Construction of sgMiMe vector

[0047] The pCAMBIA1300 binary vector was digested with KpnI and BamHI to obtain the KpnI-BamHI linearized pCAMBIA1300 vector; SK-gPAIR1, SK-gREC8, and SK-gOSD1 were digested with KpnI+SalI, XhoI+NheI, and XbaI+BglII, respectively, and the SK-gPAIR1 / KpnI+SalI, SK-gREC8 / XhoI+NheI, and SK-gOSD1 / XbaI+BglII exogenous fragments were recovered; the KpnI-BamHI linearized pCAMBIA1300 vector was ligated with the SK-gPAIR1 / KpnI+SalI, SK-gREC8 / XhoI+NheI, and SK-gOSD1 / XbaI+BglII exogenous fragments using T4 ligase to obtain the sgMiMe vector.

[0048] 3. Construction of T225 (sgMiMe_pAtDD45: gOsWUS) vector

[0049] The Arabidopsis egg cell-specific expression promoter pAtDD45, the genomic sequence of OsWUS gOsWUS, and the OCS terminator fragment were amplified using the primer combinations ool-PmeI-F+pAtDD45-overlap-R, pAtDD45-56780-F+56780-overlap-R, and OCS-F+OCS-PmeI-R, respectively. The sgMiMe vector was digested with PmeI, and the PmeI-linearized sgMiMe vector was recovered. Using homologous recombination, pAtDD45, gOsWUS, the OCS terminator fragment, and the PmeI-linearized sgMiMe vector were ligated to complete the construction of vector T225 (sgMiMe_pAtDD45:gOsWUS) (Figure 1). Specific primer information is as follows:

[0050] ool-PmeI-F:ctgtcaaacactgatagtttAAATGTTCCTCGCTGACGTAAGAAG;

[0051] pAtDD45-overlap-R: TATTCTTTCTTTTTGGGGTTTTTG;

[0052] pAtDD45-56780-F: AACCCCAAAAAGAAAGAATAATGGATCACATGCAGCAG;

[0053] 56780-overlap-R:cctgcaggtcgactctagaggatccTCACATGGACCCTGCAGGGTAAGGTG;

[0054] OCS-F: CTCTAGAGTCGACCTGCAGGCATGC;

[0055] OCS-PmeI-R:TCGTTTCCCGCCTTCAGTTTTCCCAGTCACGACGTTTGTAAAACG.

[0056] 4. Creation of apomictic rice lines

[0057] 1) Obtaining T225 transgenic plants

[0058] The expression vector T225 (sgMiMe_pAtDD45: gOsWUS) was transformed into the Agrobacterium tumefaciens strain EHA105 by electroporation, and then the binary expression vector was transformed into the callus of indica-japonica hybrid rice Chunyou 84 using Agrobacterium-mediated genetic transformation. The specific transformation method is to sterilize the embryos of hybrid rice Chunyou 84 seeds and inoculate them into an induction medium; after culturing for one week, select embryonic calli with vigorous growth, light yellow color and relatively looseness to serve as the transformation recipient; infect the rice calli with the EHA105 strain containing the T225 (sgMiMe_pAtDD45:gOsWUS) plasmid, culture them in a dark incubator at 25°C for three days, select resistant calli on a screening medium containing 50 mg / L hygromycin, transfer the resistant calli to a differentiation medium, and culture them under light at a temperature of 26°C; select transgenic plants that grow normally on the differentiation medium and perform rooting culture for two weeks, and a total of 29 T225 transgenic plants are obtained.

[0059] 2) Identification of the genotype of T225 transgenic plants

[0060] Genomic DNA from these 29 strains was extracted using the CTAB method. The DD45-PCR-F and 56780-PCR-R primer combinations were used to identify the 29 transgenic lines. Twenty-seven of the lines were found to contain the pAtDD45:gOsWUS expression element (Figure 2). The primers used are as follows:

[0061] DD45-PCR-F:AGGAGCGCTACTGATTCAACATGCC;

[0062] 56780-PCR-R: TTCTGGAACCAGTAGAAGACGTTC.

[0063] Next, the editing status of the three genes PAIR1, REC8, and OSD1 was detected. The DNA fragments of the target site regions of the three genes PAIR1, REC8, and OSD1 were amplified using the primer combinations PAIR1-HF1+PAIR1-HB1, REC8-HF1+REC8-HB1, and OSD1-HF2+OSD1-HB2, respectively. The genotype of the amplified DNA fragments was detected using Hi-TOM technology (Liu Q, Wang C, Jiao X, Zhang H, Song L, Li Y, Gao C, Wang K. Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR / Cas systems. Sci China Life Sci. 2019 Jan; 62(1): 1-7. doi: 10.1007 / s11427-018-9402-9). The primer information used is as follows:

[0064] PAIR1-HF1:GGAGTGAGTACGGTGTGCCTTCTTGCGCGCGAGAAGAGTCTC;

[0065] PAIR1-HB1:GAGTTGGATGCTGAGTGGGAGATGTAGTGCGTGGGTCTTG;

[0066] REC8-HF1:GGAGTGAGTACGGTGTGCTTGGGTTAGTGAGGAGAT;

[0067] REC8-HB1:GAGTTGGATGCTGAGTGGTGCGATCGGAACTATGGAGAC;

[0068] OSD1-HF2:GGAGTGAGTACGGTGTGCTATCAGGAGGACGACGTCGCCG;

[0069] OSD1-HB2:GAGTTGGATGCTGAGTGGCTCCTCCTCTTGGGTGTAGC.

[0070] A total of five strains (T225#1, T225#6, T225#7, T225#10, and T225#28) were identified with mutations in the PAIR1, REC8, and OSD1 genes (Figure 3). Combined with the results of positive transgenic identification, it was further confirmed that these five strains all contained the pAtDD45:gOsWUS expression element, thus confirming that they were OsWUS-based apomictic strains.

[0071] 3) Phenotypic identification of the T225 apomictic line

[0072] During the vegetative growth period, these five apomictic lines exhibited normal morphology. Surprisingly, at maturity, all five apomictic lines exhibited a high seed set rate of 72.0% to 83.3%, comparable to the wild-type Chunyou 84 seed set rate (80.2 ± 2.3%) (Figure 4). To verify whether these five apomictic lines with high seed set rates were capable of producing clonal seeds, flow cytometry was used to characterize the ploidy levels of their T1 generations. It was found that four lines, T225#1, T225#6, T225#7, and T225#28, produced 0.5% to 21.7% diploid progeny, while the remaining line, T225#10, produced only tetraploids. Notably, line T225#6 not only maintained a normal seed set rate but also achieved a clonal seed efficiency of 21.7% (Table 1).

[0073] Table 1. Statistical analysis of the seed setting rate and cloning efficiency of apomictic lines of OsWUS

[0074] Example 2: Creation of ZmWUS haploid induced strain

[0075] 1. Cloning and sequencing of the maize WUS gene

[0076] Zheng 58 was amplified using primers ZmWUS-F1 and ZmWUS-R1 according to the method of Example 1 to obtain the genomic sequence of the ZmWUS gene (NP_001105961), which was labeled as gZmWUS.

[0077] ZmWUS-F1:ATGGCGGCCAAATGCGGGCGGCGGTGG;

[0078] ZmWUS-R1:TCACATGCTCCCTGCAGCAGGGTAAG.

[0079] 2. Construction of ZmWUS ectopic expression vector

[0080] The Arabidopsis egg cell-specific expression promoter pAtDD45 and the genomic sequence of ZmWUS, gZmWUS, were amplified using the primer combinations KpnI-F+pAtDD45-overlap-R and pAtDD45-ZmWUS-F+ZmWUS-overlap-R, respectively. The pCAMBIA1300 vector was double-digested with KpnI+BamHI, and the KpnI-BamHI-linearized vector was recovered. Using homologous recombination, the pAtDD45, gZmWUS fragment, and the KpnI-BamHI-linearized vector were ligated to complete the construction of the ZmWUS ectopic expression vector (pAtDD45:gZmWUS). The specific primer information is as follows:

[0081] KpnI-F: tacgaattcgagctcggtacAAATGTTCCTCGCTGACGTAAGAAG;

[0082] pAtDD45-overlap-R: TATTCTTTCTTTTTGGGGTTTTTG;

[0083] pAtDD45-ZmWUS-F:aaccccaaaaagaaagaataATGGCGGCCAAATGCGGGCGGCGGTGG;

[0084] ZmWUS-overlap-R: caggtcgactctagaggatcTCACATGCTCCCTGCAGCAGGG.

[0085] 3. Creation of haploid induced maize lines

[0086] The ZmWUS ectopic expression vector (pAtDD45:gZmWUS) was transformed into Zheng 58 using the same method as in Example 1. A total of nine ZmWUS ectopic expression plants were obtained. To verify whether the ZmWUS ectopic expression plants could produce haploids, flow cytometry was used to assess the ploidy level of their T1 progeny. The ZmWUS ectopic expression lines produced 0.5% to 1.2% haploids. The phenotypes of the ZmWUS haploid plants and the Zheng 58 diploid plants are shown in Figure 5.

[0087] Example 3: Creation of Haploid Induced Millet Lines

[0088] 1. Cloning and sequencing of the foxtail millet WUS gene

[0089] Referring to the method of Example 1, the SiWUS-F1 and SiWUS-R1 primers were used to amplify the millet variety Ci846 to obtain the genomic sequence of the millet SiWUS gene (XP_022680535), which was labeled as gSiWUS.

[0090] SiWUS-F1:ATGGCGGCCAATGTGGGCGGAAAG

[0091] SiWUS-R1:TCACATGGTCCCTGCAGGGTAAGG.

[0092] 2. Construction of SiWUS ectopic expression vector

[0093] The Arabidopsis thaliana egg cell-specific expression promoter pAtDD45 and the SiWUS genomic sequence gSiWUS were amplified using the KpnI-F+pAtDD45-overlap-R and pAtDD45-SiWUS-F+SiWUS-overlap-R primer combinations, respectively. Following the method of Example 2, the pAtDD45 and SiWUS fragments were ligated with the KpnI-BamHI linearized vector to complete the construction of the SiWUS ectopic expression vector (pAtDD45:gSiWUS). The specific primer information is as follows:

[0094] KpnI-F: tacgaattcgagctcggtacAAATGTTCCTCGCTGACGTAAGAAG;

[0095] pAtDD45-overlap-R: TATTCTTTCTTTTTGGGGTTTTTG;

[0096] pAtDD45-SiWUS-F:aaccccaaaaagaaagaataATGGCGGCCAATGTGGGCGGAAAG;

[0097] SiWUS-overlap-R: caggtcgactctagaggatcTCACATGGTCCCTGCAGGGTAAGG.

[0098] 3. Creation of Haploid Induced Millet Lines

[0099] The SiWUS ectopic expression vector (pAtDD45:gSiWUS) was transformed into Ci846 using the same method as in Example 1. Flow cytometry was used to assess the ploidy level of the T1 generation, revealing that the SiWUS ectopic expression lines produced 1.1% to 2.3% haploids. The phenotypes of the SiWUS haploid plants and the Ci846 diploid plants are shown in Figure 6.

Claims

1. A use of a WUS gene in preparing an apomictic plant line, preferably, the plant is a monocotyledonous plant or a dicotyledonous plant; preferably, the plant is a grass, leguminous, or cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed.

2. A binary expression vector for inducing apomictic plant lines, characterized in that: A WUS gene driven by a promoter specifically expressed in egg cells; preferably, the WUS gene is derived from a monocot or dicot plant; preferably, the WUS gene is derived from a grass, leguminous, or cruciferous plant; preferably, the WUS gene is derived from rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed; The WUS gene is a full-length genomic sequence gene or a full-length coding region sequence gene.

3. The binary expression vector according to claim 2, wherein It also carries components that can produce MiMe.

4. The binary expression vector according to claim 3, wherein MiMe elements include simultaneous mutations of PAIR1, REC8, and OSD1. The elements that produce MiMe include: a DNA sequence encoding PARI1 sgRNA driven by a U3 promoter, a DNA sequence encoding REC8 sgRNA driven by a U3 promoter, and a DNA sequence encoding OSD1 sgRNA driven by a U3 promoter.

5. The binary expression vector according to claim 2, wherein The starting vector is pCAMBIA 1300; pCAMBIA series vectors other than pCAMBIA1300, pGreen series vectors, pBIN series vectors, pBI series vectors, and pHELLSGATE series vectors; the promoter is an egg cell-specific promoter, preferably selected from AtDD45 (At2g21740), AtEC1.1 (At1g76750), AtEC1.3 (At2g21750), AtEC1.4 (At4g39340), AtEC1.5 (At5g64720), OsECA1 (LOC_Os03g18530), OsECA2 (LOC_Os11g06730), and OsECA3 (LOC_Os12g06970).

6. The binary expression vector according to claim 2, wherein The rice OsWUS gene is a full-length OsWUS genome sequence gene or a full-length OsWUS coding region sequence gene.

7. A method for inducing plant apomixis, characterized in that: The method comprises the following steps: transferring a binary expression vector comprising an element capable of producing MiMe and a WUS ectopic expression element driven by an egg cell-specific promoter into corresponding plants, screening strains expressing MiMe and WUS ectopically in transgenic plants, and obtaining apomictic strains.

8. The method according to claim 7, wherein The plant is a monocotyledonous plant or a dicotyledonous plant; preferably, the plant is a grass, leguminous plant, or a cruciferous plant; preferably, the plant is rice, corn, millet, wheat, barley, sorghum, soybean, or rapeseed.

9. The method according to claim 7, wherein: The introduction is achieved by using the gene gun method and the Agrobacterium-mediated method.

10. The method according to any one of claims 7 to 9, characterized in that The method also includes the step of screening out apomictic plants with normal fruit setting rate and high seed cloning efficiency.

Images