Chimeric virus-like particle vaccine against rotavirus

The cVLP vaccine addresses the limitations of current rotavirus vaccines by using HBc and extended VP8* domains for enhanced immunogenicity and stability, achieving robust immune responses and broader strain coverage.

WO2025191546A2PCT designated stage Publication Date: 2025-09-18SHOJA ZABIHOLLAH +7
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/IB2025/054774
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-10
Filing Date
2025-05-07
Publication Date
2025-09-18

AI Technical Summary

Technical Problem

Current rotavirus vaccines face challenges such as genetic instability, safety concerns, reduced efficacy in developing countries, and limited strain coverage due to insufficient representation of the VP8* domain, which is critical for viral entry and neutralization.

Method used

A recombinant chimeric virus-like particle (cVLP) vaccine composition using hepatitis B core protein (HBc) as an adjuvant and an extended VP8* domain from rotavirus as an antigen, expressed in a prokaryotic system, to enhance immunogenicity and structural stability, facilitating multivalent antigen display.

Benefits of technology

The cVLP vaccine induces stronger and broader immune responses, including neutralizing antibodies, with improved strain coverage and reduced risk of adverse events, suitable for scalable production in resource-limited settings.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IB2025054774_18092025_PF_FP_ABST
    Figure IB2025054774_18092025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure relates to a recombinant chimeric virus-like particle (cVLP) vaccine composition against rotavirus infection. The vaccine comprises a virus-like particle fragment including a hepatitis B core (HBc) protein functioning as an adjuvant, into which a heterologous immunogenic domain derived from the rotavirus VPS* protein is inserted within the major immunodominant region (MIR) of HBc. The construct is encoded by SEQ ID NO. 1, and expressed in a prokaryotic system. The cVLPVPS* vaccine composition of the present disclosure offers a non-replicating, protein-based alternative to live attenuated vaccines, and the platform may help address challenges related to safety, strain specificity, and antigen delivery.
Need to check novelty before this filing date? Find Prior Art

Description

DescriptionTitle of Invention: Chimeric Virus-like Particle Vaccine Against RotavirusTechnical Field

[0001] The present invention relates to the field of immunology and vaccine development, specifically to a recombinant chimeric virus-like particle (cVLP) vaccine composition for inducing an immune response against rotavirus. The vaccine composition includes a hepatitis B core protein (HBc) and a heterologous immunogenic domain derived from rotavirus VP8* protein.Background Art

[0002] Rotavirus is a major cause of acute viral gastroenteritis in children under five, with over half a million deaths annually before vaccine introduction. In 2006, two live attenuated oral vaccines, RotaTeq and Rotarix, were introduced and later recommended by the WHO for global immunization. However, concerns persist regarding their reduced efficacy and safety in developing countries, including genetic instability and risk of adverse events. These challenges have prompted interest in alternative strategies such as non-replicating vaccine platforms.

[0003] One promising approach for developing non-replicating rotavirus vaccines involves the use of the VP8* protein. VP8* is a domain derived from the spike protein VP4, which is cleaved by host proteases into VP5* and VP8* fragments. VP8* functioning as the viral ligand responsible for cell receptor binding and viral entry. Multiple studies have demonstrated that the VP8* protein can induce potent neutralizing antibodies against rotavirus. Additionally, VP8 contains both linear and conformational neutralizing epitopes, which are recognized by antibodies capable of blocking viral attachment in-vitro and contributing to protective immunity in animal challenge studies.

[0004] The core antigen of hepatitis B virus (HBc) has been shown to self-assemble efficiently into virus-like particles (VLPs) in prokaryotic expression systems. HBc- based VLPs are capable of inducing strong humoral and T-cell immune responses and can serve as an intrinsic adjuvant for fused heterologous antigens.

[0005] US20220313813A1 (2020) discloses an RNA-based rotavirus vaccine. The RNA construct includes at least one coding region encoding at least one antigenic peptide or protein of rotavirus, particularly VP8*, or an immunogenic fragment or variant thereof. The invention further relates to formulations and vaccines comprising the RNA sequence in association with a delivery vehicle such as a polymer carrier, polycationic peptide or protein, or a lipid nanoparticle (LNP). It also describes kits containing the RNA, the formulation, or the vaccine for use in therapeutic and prophylactic applications.

[0006] CN 103319604A (2013) discloses a recombinant rotavirus subunit vaccine based on a Delta VP8* protein, which incorporates a P2 helper T-cell epitope from tetanus toxin. This fusion enhances the immunogenicity of the VP8* domain, promoting the generation of high-titer neutralizing antibodies, particularly against genotype P[4], The approach aims to improve immune protection while potentially reducing the risk of intussusception associated with live attenuated oral vaccines.

[0007] Although HBc-based virus-like particle platforms have been employed for the display of epitopes from various viral pathogens including hepatitis B and C viruses, HIV, influenza virus, hantavirus, papillomavirus, dengue virus, and foot-and-mouth disease virus, these applications have primarily focused on short epitope insertions. To date, no known reference has disclosed the application of HBc VLPs for displaying extended antigenic domains derived from rotavirus VP8*.Summary of Invention

[0008] This summary is intended to provide an overview of the subject matter of the exemplary embodiments of the present disclosure, and is not intended to identify essential elements or key elements of the subject matter, nor is it intended to be used to determine the scope of the claimed implementations. The proper scope of the exemplary embodiments of the present disclosure may be ascertained from the claims set forth below in view of the detailed description below and the drawings.

[0009] In one general aspect, the present disclosure discloses a recombinant chimeric virus-like particle (cVLP) vaccine composition against rotavirus, which the vaccine composition includes a virus-like particle fragment comprising hepatitis B core protein (HBc) as an adjuvant and a heterologous immunogenic domain derived from rotavirus VP8* protein as an antigen. The heterologous immunogenic domainderived from rotavirus VP8* including 200 or more amino acids inserted in to the major immunodominant region (MIR) of the HBc.

[0010] In one aspect of the present disclosure, the recombinant cVLP vaccine composition comprises a nucleotide sequence that presented in SEQ ID NO. 1.

[0011] In another aspect of the present disclosure, the recombinant cVLP vaccine composition is expressed in a prokaryotic expression system includes Escherichia coli and configured to induce an immune response against rotavirus.

[0012] In another aspect of the present disclosure, the recombinant cVLP vaccine composition configured to induce a neutralizing antibody response against rotavirus.Technical Problem

[0013] Rotavirus is a leading cause of acute viral gastroenteritis in infants and young children, often resulting in severe diarrhea and dehydration. The absence of a specific antiviral treatment has made vaccination the primary preventive strategy against this infection.

[0014] Despite advancements in vaccine development, currently formulated rotavirus vaccines present several technical limitations. Existing vaccines are predominantly based on live attenuated virus strains, which, due to their replicative nature, pose inherent risks. These include the potential for genetic reassortment between vaccine strains and circulating wild-type rotaviruses, raising concerns about the emergence of virulent strains. Furthermore, the live viral nature of these vaccines increases the risk of adverse events such as intussusception, a rare but serious gastrointestinal complication.

[0015] Another key challenge is the suboptimal efficacy of live oral vaccines in low- and middle-income regions. While these vaccines show high protective efficacy in developed countries, their performance is significantly reduced in developing settings. Although the exact mechanisms are not fully understood, multiple host, viral, and environmental factors have been implicated. These may affect vaccine virus replication in the gut, mucosal immunity, or antigen presentation, all of which can diminish vaccine- induced protection.

[0016] Additionally, the current vaccines are designed based on G-type antigens (specifically the VP7 protein), and less emphasis has been placed on P-type (VP4 / VP8*) genotyping. However, accumulating evidence suggests that the VP8* domain plays a critical role in viral entry and neutralization. As such, insufficient representation or immunogenic exposure of VP8* in existing formulations may contribute to limited strain coverage and reduced cross-protection.

[0017] Protein-based subunit vaccines, particularly those targeting VP8*, have been explored as safer alternatives to live attenuated vaccines. Nonetheless, these approaches have faced their own technical challenges, including weak immunogenicity when administered alone and difficulties in maintaining native protein conformation, especially when expressed recombinantly. Many VP8*- based candidates have required strong adjuvants or carrier systems to enhance immune recognition and efficacy.

[0018] Moreover, viral-like particle (VLP) platforms, while promising for antigen display, have shown limited success in past efforts when incorporating longer heterologous sequences. In many prior designs, only short peptide epitopes were successfully inserted into VLP scaffolds without compromising structural stability or selfassembly properties. These limitations have hindered the development of more robust, broadly protective non-replicating rotavirus vaccines.Solution to Problem

[0019] To overcome the limitations of current live attenuated rotavirus vaccines, nonreplicating platforms have been investigated as safer alternatives. Among them, VP8*-based subunit vaccines have gained interest due to the key role of this domain in viral entry. However, these approaches have often shown limited immunogenicity on their own and have faced challenges in preserving native protein conformation when expressed recombinantly.

[0020] One strategy to enhance immunogenicity and structural presentation involves the use of virus-like particle (VLP) platforms. The hepatitis B virus core (HBc) antigen naturally self-assembles into VLPs and supports strong immune activation. Insertion of heterologous antigens such as VP8* into the immunodominant region of the HBc allows multivalent display while retaining the scaffold’s structural properties.

[0021] Incorporating an extended VP8* fragment into the HBc platform enables the presentation of both linear and conformational neutralizing epitopes in a highly ordered and immunologically accessible format. This design enhances the quality and magnitude of immune responses compared to monomeric VP8* and offering improved potential for broad neutralization across rotavirus strains.

[0022] In contrast to previous VLP-based systems limited to short peptide insertions, this approach supports stable integration of larger antigenic domains without compromising VLP assembly. This technical advance addresses earlier obstacles in developing robust non-replicating rotavirus vaccines that elicit effective humoral immunity.Advantageous Effects of Invention

[0023] The recombinant chimeric virus-like particle vaccine composition offers several advantages based on its structural design and immunological function. By incorporating an extended VP8* domain into the immunodominant region of the hepatitis B core (HBc) virus-like particle (VLP) platform, the construct facilitates multivalent antigen display in a particulate format. This configuration may enhance immune recognition and engagement, resulting in stronger and broader immune responses compared to VP8* antigen alone. It promotes both systemic and mucosal immunity, stimulates relevant antibody subclasses, and supports a more balanced and potentially effective protective profile.

[0024] The ability of the CVLPVP8* formulation to stimulate cross-reactive neutralizing antibodies against heterotypic rotavirus strains further highlights its potential for broader strain coverage, which is an important limitation in many current vaccines.

[0025] Additionally, the composition is compatible with prokaryotic expression systems such as E. coli, which simplify production and allow for efficient and scalable manufacturing without the complexity of eukaryotic hosts.

[0026] The self-assembling nature of the HBc scaffold ensures the structural integrity of the chimeric particles even when incorporating large heterologous inserts like VP8*. These features collectively position the CVLPVP8* platform as a promising candidate for developing safe, effective, and technically robust non-replicating vaccines against rotavirus.Brief Description of Drawings

[0027] The drawing figures depict one or more implementations in accord with the present teachings, by way of example only, not by way of limitation. In the figures, like reference numerals refer to the same or similar elements.

[0028] [FIG. 1] shows a schematic of the chimeric virus-like particle (cVLP) vaccine composition construct.

[0029] [FIG. 2] shows a schematic of the cVLP vaccine composition construct with the flanking enzyme sites thereof.

[0030] [FIG. 3] shows the expression of CVLPVP8* protein detected by western blot using anti-His taq antibody.

[0031] [FIG. 4] shows the expression of CVLPVP8* protein detected by western blot using human anti-rotavirus serum.

[0032] [FIG. 5] shows the expression of VP8* protein detected by western blot using anti-His taq antibody.

[0033] [FIG. 6] shows the expression of VP8* protein detected by western blot using human anti-rotavirus serum.

[0034] [FIG. 7] shows the SDS-PAGE analysis of refolded and purified CVLPVP8* and VP8* proteins under denaturing conditions.

[0035] [FIG. 8] shows the formation of virus-like particles (VLPs) by CVLPVP8* protein as visualized by transmission electron microscopy.

[0036] [FIG. 9A] shows the vaccination timeline and sampling point in immunized mice.

[0037] [FIG. 9B] shows the levels of VP8*-specific IgG antibodies in immunized mice as measured by ELISA.

[0038] [FIG. 9C] shows the levels of VP8*-specific IgA antibodies in immunized mice across different vaccine groups.

[0039] [FIG. 10] shows the IgG titration curve for VP8*-specific antibodies across serial serum dilutions.

[0040] [FIG. 11 A] shows the IgG subclass (lgG1 and lgG2a) distribution in mice immunized with different formulations.

[0041] [FIG. 11 B] shows the lgG1 / lgG2a ratio indicating the polarization of the immune response.

[0042] [FIG. 12] shows a comparative analysis of the neutralizing antibody titers against the rotavirus SA11 strain which induced by immunization with CVLPVP8*- Adj and VP8*-Adj.Description of Embodiments

[0043] The following detailed description is presented to enable a person skilled in the art to make and use the methods and devices disclosed in exemplary embodiments of the present disclosure. For purposes of explanation, specific nomenclature is set forth to provide a thorough understanding of the present disclosure. However, it will be apparent to one skilled in the art that these specific details are not required to practice the disclosed exemplary embodiments. Descriptions of specific exemplary embodiments are provided only as representative examples. Various modifications to the exemplary implementations will be readily apparent to one skilled in the art, and the general principles defined herein may be applied to other implementations and applications without departing from the scope of the present disclosure. The present disclosure is not intended to be limited to the implementations shown but is to be accorded the widest possible scope consistent with the principles and features disclosed herein.

[0044] In one general embodiment of the present disclosure, a recombinant chimeric virus-like particle (cVLP) vaccine composition may comprise an adjuvant, an antigen, and a nucleotide sequence of SEQ ID NO. 1 against rotavirus in a subject. The adjuvant may comprise a virus-like particle fragment, which includes a hepatitis B core protein (HBc). The antigen may comprise a heterologous immunogenic domain derived from rotavirus VP8* protein, which may be inserted into the major immunodominant region (MIR) of the adjuvant.

[0045] In one embodiment of the present disclosure, the recombinant chimeric viruslike particle (cVLP) vaccine composition may comprise a nucleotide sequence of SEQ ID NO. 1 , which is represented below:

[0046] SEQ ID NO. 1 :GGATCCGATATCGATCCGTATAAAGAATTTGGCGCCACCGTTGAACTGCTGA GCTTTCTGCCGAGCGATTTTTTTCCGAGCGTTCGTGATCTGCTGGATACCGCCAGCGCACTGTATCGTGAAGCACTGGAAAGCCCGGAACATTGTAGTCCGCA TCATACAGCACTGCGCCAGGCCATTCTGTGTTGGGGTGAACTGATGACCCT GGCCACCTGGGTTGGTAATAATCTGGAAGATGAGCTCGGCTCTGGTTCAGA AAAAACACAAAATGTTACAGTTAATCCAGGTCCTTTTGCACAAACTCGTTATG CTCCTGTTAATTGGGGTCATGGTGAAATTAATGATTCTACTACTGTTGAACCA ATTTTAGATGGTCCTTATCAACCTACTACATTTACACCACCAACAGATTATTG GATTCTTATTACTTCTAATACTAATGGAGTTGTTTATGAAAGTACAAATAATAG TGATTTTTGGACTGCAGTTATTGCAGTTGAACCACATGTTAATCCAGTTGATC GACAATATAATGTTTTTGGAGAAAATAAACAATTTAATGTTCGTAATGATAGT GATAAATGGAAATTTCTTGAAATGTTTCGAGGAAGTAGTCAAAATGATTTTTA TAATCGTCGAACTTTGACATCAGATACACGACTTGTTGGTATTCTTAAATATGGTGGACGAGTTTGGACATTTCATGGAGAAACACCTAGAGCAACAACTGATAG TAGTAATACAGCTAATCTTGATGGTATTAGTATTACTATTCATAGTGAATTTTA TATTATTCCTCGAAGTCAAGAATCTAAATGTAATGAATATATTAATAATGGTCT TCCACCTATTCAAAATACTCGTAATGGCTCTTCCGAGCTCCCTGCATCTCGT GATCTGGTTGTTAATTATGTTAATACCAACATGGGTCTGAAAATTCGTCAGCT GCTGTGGTTTCATATTAGTTGTCTGACCTTTGGTCGTGAGACCGTTCTGGAA TATCTGGTTAGCTTTGGTGTTTGGATCAGAACCCCGCCTGCATATCGTCCTC CGAATGCACCGATTCTGAGCACCCTGCCGGAAACCACTGTTGTTGGAGGTG GAGGCTCTCTCGAGCACCACCACCACCACCACTGA

[0047] The SEQ ID NO. 1 may represent the entire or part of the sequence of the recombinant cVLP vaccine composition according to the present disclosure. However, the recombinant cVLP vaccine composition is not limited to the SEQ ID NO. 1.

[0048] FIG.1 illustrates a schematic of the recombinant cVLP vaccine composition according to one and more embodiments of the present disclosure. The schematic in FIG. 1 can be considered a representative embodiment of the disclosed recombinant cVLP construct and is intended to facilitate the understanding of the overall design and structure of the recombinant cVLP. However, this schematic should not be construed as limiting, and it will be understood and implemented by those skilled in the art that other configurations, arrangements, or structural variants may also fall within the scope of the present disclosure. The depicted structure is presented for illustrative purposes only, and modifications, additions,or alternative designs may be applied without departing from the essential features or inventive concept described herein.

[0049] According to one embodiment of the present disclosure illustrated in FIG. 1 , the recombinant cVLP vaccine composition construct may comprise distinct regions representing a chimeric assembly of structural and immunogenic domains. The numeric labels beneath each section can indicate amino acid positions that are included for illustrative clarity. FIG. 1 intended to highlight how the VP8* domain derived from rotavirus can be inserted into a virus-like particle scaffold that may include HBc, without disrupting the intrinsic self-assembling behavior typically associated with virus-like particle formation. The resulting architecture is designed to facilitate antigen presentation in a particulate format, potentially enhancing its immunogenic properties while maintaining structural stability.

[0050] In one embodiment, the recombinant cVLP vaccine composition is expressed in a prokaryotic expression system, which may include, but is not limited to Escherichia coli.

[0051] In one embodiment, the recombinant chimeric virus-like particle (cVLP) vaccine composition may be designed for efficient expression in prokaryotic systems. The configuration of the nucleotide sequence and chimeric protein may be compatible with bacterial hosts, enabling production without the need for complex eukaryotic machinery. This prokaryotic compatibility may facilitate scalable manufacturing and simplify upstream processing for the vaccine antigen.

[0052] In one exemplary embodiment of the present disclosure, the recombinant cVLP vaccine composition described herein may be configured to induce an immune response against rotavirus in a subject, wherein the immune response may include a VP8*-specific antibodies against rotavirus in the subject.

[0053] The previous embodiment may include one or more the following features: The recombinant cVLP vaccine composition may potentially lead to the generation of antibodies specific for the rotavirus VP8* antigen. The VP8*-specific antibodies may comprise neutralizing, IgG, and IgA antibodies. In other embodiment, the IgG antibody may comprise one or both of the lgG1 and lgG2a subclasses, indicative of a balanced Th1 / Th2 immune response with a predominant Th2 bias.

[0054] In one embodiment, the vaccine composition disclosed in the present disclosure may comprise a non-replicating immunogen in the form of a recombinant chimeric protein, which refers to a fusion construct composed of structural and immunogenic domains derived from distinct viral origins. The recombinant chimeric protein may comprise a virus-like fragment, such as hepatitis B core protein (HBc), and a heterologous immunogenic domain derived from rotavirus VP8* protein. The recombinant chimeric protein may be encoded by a nucleotide sequence comprising a nucleotide sequence that is identical or substantially identical to SEQ ID NO. 1.

[0055] In one embodiment, an amino acid sequence corresponding to the heterologous immunogenic domain derived from rotavirus VP8* (VP8* domain) within the encoded chimeric protein (cVLP vaccine composition) can exhibit sequence identity to known VP8* or VP4 protein sequences from rotavirus strains, consistent with its viral origin. In another embodiment, this sequence identity may range from approximately 83% to 92% when compared to the outer capsid VP4 protein sequence from various Rotavirus A isolates. The VP8* domain functions as an antigen inducing immune responses in a subject.

[0056] In one embodiment, the VP8* domain may include both linear and conformational neutralizing epitopes, which may contribute to its immunogenic potential when displayed on the surface of the cVLP vaccine composition.

[0057] The previous embodiments may include the following features: The inserted VP8* domain may comprise at least 200 amino acids, a relatively extended sequence length that may contribute to preserving the antigen’s immunogenic potency and structural compatibility within the self-assembling HBc-based VLP platform. This feature may further address technical challenges commonly associated with incorporating large antigenic inserts into the VLP platforms by maintaining efficient self-assembly and stable virus-like particle formation. This immunogenic domain is configured to act as an antigen capable of eliciting an immune response in a subject.

[0058] In one embodiment, the chimeric virus-like particle vaccine composition may comprise a virus-like particle fragment, such as hepatitis B core protein (HBc), and an antigen, which can be inserted into the major immunodominant region (MIR) ofthe virus-like particle fragment or the HBc protein. The antigen may comprise a heterologous immunogenic domain derived from rotavirus VP8* protein, which serves as the target for the immune response. The disclosed cVLP vaccine composition comprising both the HBc fragment and the inserted VP8* domain may possess intrinsic self-assembly properties that result in the formation of virus-like particles. In one embodiment, insertion of the VP8* domain into the MIR of the HBc protein does not alter the structural integrity or self-assembling behavior of the virus-like particles. Furthermore, the HBc fragment in the vaccine composition may function as an intrinsic adjuvant, contributing to the self-assembly, structural stability, and the immunogenic properties of the cVLP vaccine composition.

[0059] In one embodiment of the present disclosure, the disclosed recombinant chimeric virus-like particle (cVLP) vaccine composition is a protein-based formulation that may not require any nucleic acid delivery system or carrier for antigen expression. The disclosed composition may comprise a structural scaffold derived from the hepatitis B core (HBc) protein, which may inherently function as a self-assembling domain and simultaneously provides adjuvant-like activity, and may enhance the immunogenicity of the inserted antigen. The disclosed composition, comprising both the HBc carrier domain and the heterologous immunogenic domain derived from the rotavirus VP8* protein, may be encoded by the nucleotide sequence of SEQ ID NO. 1. This sequence may be recombinantly expressed in a prokaryotic system and may follow by protein purification and in- vitro assembly into virus-like particles. Therefore, unlike mRNA-based vaccines, the disclosed composition is protein-based, free of RNA components, and independent of any in-vivo transcription or translation mechanisms.

[0060] In one embodiment of the present disclosure, presentation of the VP8* antigenic domain on the cVLP vaccine composition may result in an enhanced immune response against rotavirus, potentially characterized by a greater magnitude of specific antibodies, including neutralizing antibodies, as well as IgG and IgA isotypes compared to the immune response elicited by the VP8* antigen alone or in a non-VLP format under comparable conditions. The level of enhancement observed with the disclosed cVLP vaccine composition relative to VP8* alone or its non-VLP formulation may range from approximately 2 to 4-fold.The numerical data supporting this unexpected immunological improvement are described in detail in the “Examples” section.

[0061] In one embodiment, the disclosed recombinant cVLP vaccine composition may be capable of inducing systemic and potentially mucosal immune responses, including but not limited to circulating antibodies such as IgG, IgA, and their respective subclasses. Additional immune responses, including cellular immunity and components of the innate immune system, may also be stimulated depending on the formulation, route of administration, and host immunological status.

[0062] In one exemplary embodiment, the cVLP vaccine composition may exhibit an enhanced ability to induce stronger antigen-specific immune responses compared to the VP8* antigen alone. This enhancement may include elevated levels of total IgG, IgA, and IgG subclasses such as lgG1 and lgG2a. In another embodiment, the lgG1-to-lgG2a ratio may suggest a Th2-skewed immune polarization. Additionally, the composition may result in a greater magnitude of neutralizing antibody responses against VP8* of rotavirus compared to formulations in which VP8* is delivered either individually or in conjunction with an adjuvant. Such immunological enhancements may be supported by data described in the “Examples” section.

[0063] In one embodiment, the recombinant chimeric virus-like particle (cVLP) vaccine composition may be structurally configured to address specific technical challenges associated with existing rotavirus vaccines. The composition may be based on a non-replicating design, which could help mitigate risks linked to genetic reassortment between live vaccine strains and circulating wild-type rotaviruses, a potential consequence of the segmented RNA genome. Additionally, as the formulation may be delivered via parenteral routes and lacks replicative capacity, it may reduce the likelihood of replication-associated adverse events such as intussusception. The antigenic component may include a VP8* domain derived from the rotavirus VP4 protein, which is known to mediate viral attachment and entry into host cells. Its inclusion within the HBc scaffold may facilitate the structural presentation of neutralizing epitopes that are less emphasized in VP7 (G-type) focused vaccines, potentially addressing the challenge of narrow strain coverage and limited cross-protective immunity observed with current formulations.

[0064] In one preferred embodiment, the present disclosure discloses a recombinant chimeric virus-like particle vaccine composition having a nucleotide sequence of SEQ ID NO. 1 , which the vaccine composition consists of two main fragments: a hepatitis B core protein (HBc) serving as an adjuvant and VLP structure, and a heterologous immunogenic domain derived from rotavirus VP8* protein (VP8* domain), functioning as an antigen. The VP8* domain is inserted into the major immunodominant region (MIR) of the HBc.

[0065] In a preferred embodiment, the disclosed construct of the recombinant cVLP vaccine composition is designed to induce the production of VP8*-specific antibodies, including neutralizing antibodies, IgG, and IgA against the VP8* antigen of rotavirus when administered via oral or parenteral routes. The subject may include humans, mammals, or other animal species susceptible to rotavirus infection. In a preferred embodiment, the subject is a human infant or child.

[0066] In one embodiment, the recombinant cVLP vaccine composition disclosed herein is not limited to a specific rotavirus strain or genotype. While the heterologous immunogenic domain may be derived from the VP8* region of a particular rotavirus genotype, such as P[8], the design of the platform may support incorporation of VP8* sequences from various rotavirus genotypes or subtypes. This flexibility may enable broader application of the disclosed vaccine composition across different rotavirus strains, including both homotypic and heterotypic variants. The disclosed vaccine composition may therefore be adapted for use against a range of circulating strains, depending on epidemiological relevance or targeted population needs.

[0067] In one embodiment, the recombinant chimeric virus-like particle (cVLP) construct disclosed herein may additionally be applicable in non-vaccine contexts, including but not limited to, targeted drug delivery, molecular imaging, immunotherapeutic strategies, or formulated or packaged as part of a kit. Such applications may leverage the structural integrity, biocompatibility, and surface modification capacity of the HBc-based VLP platform.

[0068] In one exemplary embodiment of the present disclosure, the disclosed recombinant cVLP vaccine composition may exhibit a particle size typically in a range of approximately 30 nm to 50 nm.

[0069] The structural details, methods of construction, recombinant expression, purification, and functional evaluation of the disclosed chimeric virus-like particle vaccine composition, including the immunogenic assessment in animal models, are provided in the “Examples” section of the present disclosure. These examples are intended to illustrate preferred embodiments and should not be construed as limiting the scope of the invention.Examples

[0070] Example 1 : Design and Cloning Strategy of the Recombinant cVLP_VP8* Construct

[0071] The schematic structure of the recombinant cVLP vaccine composition as illustrated in FIG. 1 indicates that the design of the cVLP composition according to the present disclosure, and consists of a fusion construct in which the VP8* antigen, including amino acid residues 26 to 233, is inserted into the major immunodominant region (MIR) of the hepatitis B core (HBc) protein. As shown in FIG. 1 , MIR is located between the N-terminal domain of HBc consisting amino acid residues 1 to 78, and the C-terminal domain consisting amino acid residues 79 to 149. Elements 110 and 120 in FIG. 1 represents the two junction linkers, which correspond respectively to Glycine-Serine (GS) and Glycine-Serine-Serine (GSS). This layout allows the resulting fusion protein to self-assemble into chimeric virus-like particles (cVLPs) while displaying the VP8* antigen on the particle surface in an immunologically accessible configuration.

[0072] To construct the recombinant CVLPVP8* plasmid, the VP8* gene segment (derived from a rotavirus sample of genotype G1 P[8]) was amplified by PCR using gene-specific primers and a high-accuracy PFU DNA polymerase. The PCR product and the recombinant pET-28a(+) vector containing the hepatitis B core (HBc) gene were subjected to single digestion with Sacl restriction enzyme. The digested fragments were ligated at 4 °C and the ligation mixture was transformed into E. coli DH5a competent cells. Positive colonies were screened using colony PCR and confirmed by restriction digestion and Sanger sequencing.

[0073] In a separate cloning strategy, the VP8* fragment was inserted into the HBc- containing pET-28a(+) vector using double digestion with BamHI and Xhol enzymes. Ligation was performed at 4 °C, and recombinant plasmids weretransformed into E. coli DH5a cells. The resulting colonies were similarly screened and verified through PCR, enzymatic digestion, and sequence analysis.

[0074] FIG. 2 presents the same structural design of the recombinant chimeric construct illustrated in FIG. 1 , but It specifically shows the flanking restriction enzyme sites used during the cloning process. According to FIG. 2, elements 210 and 211 represent the junction linkers, corresponding respectively to Glycine- Serine (GS) and Glycine-Serine-Serine (GSS). Additionally, according to one embodiment of the present disclosure, elements 213 and 214 indicate the flanking restriction enzyme sites used during cloning, namely BamHI and Xhol, respectively. The schematic outlines the arrangement of the HBc and VP8* domains and their amino acid positions, indicating the insertion of the VP8* domain into the major immunodominant region (MIR) of the HBc platform.

[0075] Example 2: Expression and Purification of Recombinant CVLPVP8 and VP8 Proteins in E. coli

[0076] Recombinant plasmids encoding the CVLPVP8* and VP8* constructs were transformed into competent expression strains of Escherichia coli. Transformed cells were cultured on LB agar plates supplemented with kanamycin and chloramphenicol for selection. Individual colonies were picked and inoculated into LB broth for protein expression.

[0077] Protein expression of the CVLPVP8* construct was induced using 0.5 mM isopropyl p-D-1 -thiogalactopyranoside (IPTG). SDS-PAGE analysis revealed that the highest level of recombinant protein expression was achieved approximately three hours after IPTG induction. This optimal induction time was selected for harvesting the bacterial pellet for subsequent purification.

[0078] FIG. 3 shows the western blot analysis of the CVLPVP8* protein using an anti- His tag HRP-conjugated antibody, where a distinct band around 43 kDa confirms the expression of the chimeric protein. FIG. 4 shows the same CVLPVP8* protein detected with human anti- rotavirus serum, again verifying its successful expression.Similarly, FIG. 5 presents the western blot result for the VP8* protein using the anti- His tag HRP-conjugated antibody, showing a band around 28 kDa, while FIG. 6illustrates detection of the VP8* protein using human anti-rotavirus serum, confirming its proper expression.

[0079] Following the successful expression of recombinant proteins, the CVLPVP8* and VP8* proteins were purified using Ni-NTA affinity chromatography under denaturing conditions due to their insolubility. FIG. 7 shows the SDS-PAGE analysis of the refolded and purified proteins, confirming their integrity after the purification process.

[0080] Example 3: Confirmation of VLP Formation by TEM

[0081] The formation of virus-like structures by the purified CVLPVP8* protein was evaluated using transmission electron microscopy (TEM). The results confirmed that the recombinant HBc-based construct successfully assembled into virus-like particles (VLPs) displaying the rotavirus VP8* protein. This concept is shown in FIG. 8.

[0082] Example 4: Assessment of Antibody Responses and Cross-Neutralization Induced by CVLPVP8* Vaccine Constructs

[0083] FIG. 9A shows the immunization schedule used to assess the antibody responses generated by different recombinant protein formulations. In this study, groups of BALB / c mice were immunized subcutaneously with either the recombinant chimeric CVLPVP8* or VP8* protein, with or without an adjuvant. Injections were administered on days 0, 14, and 35, and blood samples were collected on day 42. Each group included five mice (n = 5).

[0084] For ELISA, 96-well plates were coated with 10 pg / mL of purified VP8* antigen diluted in sterile PBS and incubated overnight at 4°C (16-20 h). Optimization studies demonstrated that 10 pg / mL produced the strongest antibody response compared to 1 and 5 pg / mL concentrations. The following day, plates were washed five times with PBS containing 0.05% Tween-20 and blocked with 300 pL of blocking buffer (PBS + 0.05% Tween-20 + 3% skimmed milk) for 90 minutes at 37°C.

[0085] Serum samples were diluted 1 :250 in PBS and added to the wells. For IgG titration, sera were further diluted serially up to 1 :32,000. After incubation at 37°C for 1 hour and subsequent washes, HRP-conjugated secondary antibodies were applied. IgG detection used 1 :2500 dilution of anti-mouse IgG-HRP, while IgA,lgG1 , and lgG2a subclasses used 1 :5000 dilutions. The enzymatic reaction was stopped after 15 minutes and absorbance was measured at 450 nm.

[0086] FIG. 9B shows the VP8*-specific IgG antibody responses among different immunization groups. As illustrated in this figure, the cVLPVP8*-Adj group exhibited the highest levels of VP8*-specific IgG antibodies, significantly surpassing both the VP8*-Adj group and the PBS control group (p < 0.05). Additionally, no statistically significant difference was observed between the groups that were immunized without an adjuvant (p > 0.05).

[0087] FIG. 9C demonstrates the IgA antibody responses among different groups. The cVLPVP8*-Adj group showed the highest mucosal antibody levels compared to other formulations (p < 0.01), while no significant increase in IgA was observed in non-adjuvanted groups (p > 0.05).

[0088] FIG. 10 illustrates the serum IgG titration curves against the VP8* antigen in immunized mice, evaluated by ELISA following the immunization protocol described above. Serial dilutions of sera up to 1 :32,000 were analyzed to quantify VP8*-specific IgG antibodies. Three immunization groups are shown: the cVLPVP8*-Adj group (red circles), VP8*-Adj group (green squares), and a non- adjuvanted group (blue triangles). Sera were collected on day 42 postimmunization and processed using HRP-conjugated anti-mouse IgG secondary antibodies. The absorbance at OD450 reflects antigen-specific antibody binding across dilution ranges. The red curve shows significantly higher antibody titers in the cVLPVP8*-Adj group compared to the others, confirming enhanced immunogenicity of the chimeric construct in the presence of adjuvant.

[0089] FIG. 11A presents data on IgG subclasses, demonstrating a statistically significant increase in both lgG1 and lgG2a levels in the cVLPVP8*-Adj group compared to all other groups (P < 0.05). As shown in FIG. 11 B, the lgG1 / lgG2a ratio indicates a Th2-biased immune response in the cVLPVP8*-Adj group. All statistical analyses were conducted using GraphPad Prism v8 software, utilizing one-way and two-way ANOVA and appropriate non-parametric tests.

[0090] For viral neutralization and TCID50-ELISA assays, MA104 cells were cultured in DMEM containing 100 pg / mL penicillin-streptomycin and 10% fetal bovine serum at 37°C under 5% CO2. When 85-90% confluency was reached, cells wereharvested using trypsin and cryopreserved in freezing media (20% FBS + 10% DMSO) and stored in liquid nitrogen for long-term use.

[0091] The rotavirus strain SA11 (genotype G3P[2]) was propagated in MA104 cells. Following PBS washes, the virus was added in serum-free media with 10 pg / mL trypsin and incubated for 1 hour at 37°C. Virus propagation continued until complete cytopathic effect (CPE) was observed, typically between 24 and 48 hours. Virus stocks were harvested, treated with trypsin, and stored at -80°C.

[0092] For TCID50 determination by ELISA, MA104 cells were seeded at 105cells / mL (100 pL per well) in 96-well plates and incubated for 24 hours. The next day, wells were washed and inoculated with 100 pL of 10-fold serial virus dilutions (from 10A- 1 to 10A-12) in quadruplicate, with four wells as cell-only controls. After 1 hour, virus was removed and replaced with serum-free DMEM containing 0.5 pg / mL trypsin. One plate was fixed after 24 hours for ELISA, while another was maintained for CPE observation.

[0093] For ELISA, the wells were fixed with 80% cold acetone in PBS for 10 minutes, air-dried, and washed three times with PBS-Tween. Anti-rotavirus capsid monoclonal antibody (clone 2B4) was applied at 1 :2000 dilution for 1 hour at 37°C. Following additional washes, HRP-conjugated anti-mouse IgG (1 :2000) was added. Plates were washed again, substrate was added, and absorbance was measured at 450 nm. Samples exceeding mean ± 3 standard deviations (SD) of controls were considered positive. All tests were performed in duplicate, and CPE data were used to confirm TCID50 values.

[0094] For neutralization assays, MA104 cells were seeded and incubated as described. 100 pL of virus (1000 TCID50) was incubated with 100 pL of diluted immune sera (1 :40 to 1 :320) at 37°C for 1 hour. The virus-serum mix was added to cells and incubated for 1 hour before being replaced with DMEM containing 0.5 pg / mL trypsin. After 24-72 hours, CPE was evaluated under an inverted microscope.

[0095] The table shown in FIG. 12 presents a comparative analysis of the neutralizing antibody titers against the rotavirus SA11 strain which induced by immunization with cVLP_VP8*-Adj and VP8*-Adj formulations. As presented in FIG. 12, the cVLPVP8*-Adj group produced heterotypic neutralizing antibodies against SA11with a GMT of 1 :140, whereas the VP8*-Adj group exhibited a lower GMT of 1 :50. These results suggest that the CVLPVP8* platform can induce cross- reactive neutralizing antibody responses, which may reflect the potential for a stronger homologous response against the VP8*-derived P[8] strain.Industrial Applicability

[0096] The disclosed recombinant chimeric virus-like particle (cVLP) vaccine composition is industrially applicable as a scalable, protein-based injectable vaccine for preventing rotavirus infections. Its compatibility with prokaryotic expression systems allows cost-effective production, making it suitable for widespread immunization programs, especially in resource-limited settings. The disclosed vaccine composition efficiently immunizes at-risk populations, breaks the transmission chain of rotavirus, and thereby prevents the spread and mortality associated with the infection.

Claims

Claims

1. A recombinant chimeric virus-like particle (cVLP) vaccine composition against rotavirus in a subject, wherein the recombinant cVLP vaccine composition comprises:(a) a virus-like particle fragment comprising a hepatitis B core protein (HBc) as an adjuvant;(b) a VP8* domain comprising a heterologous immunogenic domain derived from rotavirus VP8* protein and at least 200 amino acids, wherein the VP8* domain is inserted into the major immunodominant region (MIR) of the HBc protein; and(c) a nucleotide sequence encoding the chimeric cVLP, wherein the nucleotide sequence comprises SEQ ID NO. 1 ; wherein the recombinant cVLP vaccine composition is expressed in a prokaryotic expression system and is configured to induce production of VP8*- specific antibodies in the subject.

2. The recombinant cVLP vaccine composition of claim 1 , wherein the prokaryotic expression system comprises Escherichia coli.

3. The recombinant cVLP vaccine composition of claim 1 , wherein the VP8*-specific antibodies comprise neutralizing antibodies, IgA, and IgG specific to the VP8* domain.

4. A recombinant chimeric virus-like particle (cVLP) vaccine composition against rotavirus in a subject, wherein the recombinant cVLP vaccine composition comprises:(a) an adjuvant;(b) an antigen, wherein the antigen inserted into the major immunodominant region (MIR) of the adjuvant; and(c) a nucleotide sequence of SEQ ID NO. 1 ; wherein the adjuvant comprises a virus-like particle fragment comprising a hepatitis B core protein (HBc), and the antigen is characterized by a VP8*domain comprising a heterologous immunogenic domain derived from rotavirus VP8* protein, and at least 200 amino acids; wherein the cVLP vaccine composition is expressed in a prokaryotic expression system and is configured to induce production of VP8*-specific antibodies in the subject.

5. The recombinant cVLP vaccine composition of claim 4, wherein the prokaryotic expression system comprises Escherichia coli.

6. The recombinant cVLP vaccine composition of claim 4, wherein the VP8*- specific antibodies comprise neutralizing antibodies, IgA, and IgG specific to the VP8* domain.