Compositions and methods for detecting pneumocystis jirovecii pneumonia

Abstract

Disclosed herein are methods for determining whether a patient is suffering from or is at risk for Pneumocystis jirovecii pneumonia (PIP) infection. The methods of the present technology are based on detecting expression levels of the P. jirovecii mitochondrial genes Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, axxA Nadl in biological samples such as blood samples or oral swabs. Kits for use in practicing the methods are also provided.

Description

COMPOSITIONS AND METHODS FOR DETECTING PNEUMOCYSTIS JIROVECIIPNEUMONIACROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 564,066, filed March 12, 2024, the contents of which are incorporated herein by reference in their entireties.TECHNICAL FIELD

[0002] The present disclosure provides methods for determining whether a patient is suffering from or is at risk for Pneumocystis jirovecii pneumonia (PJP) infection. These methods are based on detecting expression levels of the P. jirovecii mitochondrial genes Orf 195. Coxl. Alp6. Cox3, Atp9, Nad5, Nadf Nad2, Cox2, and Nadi in biological samples such as blood samples or oral swabs. Kits for use in practicing the methods are also provided.GOVERNMENT SUPPORT

[0003] This invention was made with government support under Grant Nos. AI120033 awarded by the National Institutes of Health. The government has certain rights in the invention.BACKGROUND

[0004] The following description of the background of the present technology is provided simply as an aid in understanding the present technology and is not admitted to describe or constitute prior art to the present technology.

[0005] Pneumocystis is the leading cause of fungal pneumonia in the world. However, due to the inability to culture the organism, and the lack of genomic information prior to 2013, it has been woefully difficult to diagnose. Current diagnosis relies on an invasive bronchoscopy followed by histological examination, or performing PCR molecular detection on bronchoalveolar lavage fluid (BALF). Pneumocytes is a member of the ascomycetes fungal family. Accordingly, there is an environmental form called the ascus, and an infectious form known as the troph that attaches to the lung epithelium. The troph is released from the asci and initiates infection after colonizing the lung tissue. Currently, there are no diagnostics to discriminate between these two forms of the Pneumocytes. Accordingly, there is an urgent need for non-invasive, accurate and sensitive methods for diagnosing PJP.SUMMARY OF THE PRESENT TECHNOLOGY

[0006] In one aspect, the present disclosure provides a method for detecting the presence of pathogenic Pneumocystis jirovecii in a subject comprising: (a) extracting ribonucleic acids from a biological sample obtained from the subject; (b) reverse transcribing the extracted ribonucleic acids to generate a plurality of cDNA:RNA hybridization complexes; (c) contacting the cDNA:RNA hybridization complexes with at least one primer pair that amplifies target nucleic acids in one or more P. jirovecii mitochondrial genes to produce a reach on- sample mixture; (d) subjecting the reaction-sample mixture to real-time PCR conditions under which each of the target nucleic acids present in the biological sample is amplified to produce a fluorescent signal; (e) detecting the fluorescent signal generated by each of the amplified target nucleic acids produced in step (d); and (f) detecting the presence of pathogenic P. jirovecii in the biological sample when the fluorescent signal is detected for the amplified target nucleic acids. In certain embodiments, the one or more / < jirovecii mitochondrial genes are selected from the group consisting of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi.

[0007] Additionally or alternatively, in some embodiments, the at least one primer pair is capable of specifically amplifying a P. jirovecii nucleic acid comprising a sequence that is at least 85-95% identical to any one of SEQ ID NOs: 15-24. In some embodiments, the at least one primer pair consists of: (i) a forward primer comprising the sequence of SEQ ID NO: 9 and a reverse primer comprising the sequence of SEQ ID NO: 10, or (ii) a forward primer comprising the sequence of SEQ ID NO: 12 and a reverse primer comprising the sequence of SEQ ID NO: 13, or (iii) a forward primer comprising the sequence of SEQ ID NO: 5 and a reverse primer comprising the sequence of SEQ ID NO: 6.

[0008] In any of the preceding embodiments of the methods disclosed herein, the reaction- sample mixture further comprises one or more nucleic acid probes that specifically hybridize to a region of one or more of the genes selected from the group consisting of Orfl95, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi, wherein the one or more nucleic acid probes are detectably labeled. In some embodiments, the reach on- sample mixture comprises a single nucleic acid probe that specifically hybridizes to a region of a single gene selected from the group consisting of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi. In certain embodiments, the reaction-sample mixture comprises multiple nucleic acid probes that specifically hybridize to one or more regions of a single gene selected from the group consisting of Orfl95,Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi. In other embodiments, the reaction- sample mixture comprises multiple nucleic acid probes comprising a single nucleic acid probe that specifically hybridizes to a region of a single gene for each of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi. In some embodiments, the reach on- sample mixture comprises multiple nucleic acid probes comprising more than one nucleic acid probe that hybridizes to one or more regions for each of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi. Additionally or alternatively, in some embodiments, the reaction-sample mixture further comprises at least one nucleic acid probe that is capable of specifically hybridizing to a segment of the nucleic acid sequence of any one of SEQ ID NOs: 15-24 or a complement thereof. In certain embodiments, the at least one nucleic acid probe comprises the sequence of SEQ ID NO: 11 or SEQ ID NO: 14.

[0009] In another aspect, the present disclosure provides a method for detecting the presence of pathogenic Pneumocystis jirovecii in a subject comprising: (a) extracting ribonucleic acids from a biological sample obtained from the subject; (b) reverse transcribing the extracted ribonucleic acids to generate a plurality of cDNA:RNA hybridization complexes; (c) amplifying the cDNA:RNA hybridization complexes with at least one primer pair that amplifies target nucleic acids in one or more P. jirovecii mitochondrial genes to produce a plurality of amplicons; (d) contacting the plurality of amplicons with a mixture comprising (i) a CRISPR enzyme, (ii) single- stranded nucleic acid probes comprising a donor fluorophore and a quencher moiety, and (iii) at least one sgRNA that is capable of specifically hybridizing to at least one amplicon in the plurality of amplicons to form a reaction mixture; (e) subjecting the reaction mixture to conditions under which a plurality of CRISPR: sgRNA complexes are formed and the single-stranded nucleic acid probes are cleaved by the plurality of CRISPR: sgRNA complexes to produce a fluorescent signal, wherein each CRISPR: sgRNA complex comprises the CRISPR enzyme and at least one sgRNA hybridized to at least one amplicon; (f) detecting the fluorescent signal generated by each single- stranded nucleic acid probe cleaved by the plurality of CRISPR: sgRNA complexes produced in step (e); and (g) detecting the presence of pathogenic P. jirovecii in the biological sample when the fluorescent signal is detected for the cleaved single-stranded nucleic acid probe. Additionally or alternatively, in certain embodiments, the cDNA:RNA hybridization complexes are amplified using polymerase chain reaction (PCR) amplification or isothermal amplification. The one or more P. jirovecii mitochondrial genes may be selected from the group consisting of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi.

[0010] Additionally or alternatively, in some embodiments, steps (c)-(e) are performed in a single reaction chamber. In further embodiments, steps (c)-(e) are performed are performed sequentially or simultaneously. In other embodiments, step (c) and steps (d)-(e) are performed in separate reaction chambers.

[0011] In some embodiments, the CRISPR enzyme is Cas12a or Cas12b and the single-stranded nucleic acid probe is a single-stranded DNA probe. In certain embodiments, the CRISPR enzyme is Cast 3 and the single-stranded nucleic acid probe is a single-stranded RNA probe. Additionally or alternatively, in some embodiments, the single-stranded nucleic acid probe is about 15 to about 35 nucleotides in length. In certain embodiments, the single-stranded nucleic acid probe is about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, or about 35 nucleotides in length.

[0012] Additionally or alternatively, in some embodiments, the at least one primer pair is capable of specifically amplifying aP.jirovecii nucleic acid comprising a sequence that is at least 85-95% identical to any one of SEQ ID NOs: 15-24. In some embodiments, the at least one primer pair consists of: (i) a forward primer comprising the sequence of SEQ ID NO: 9 and a reverse primer comprising the sequence of SEQ ID NO: 10, or (ii) a forward primer comprising the sequence of SEQ ID NO: 12 and a reverse primer comprising the sequence of SEQ ID NO: 13, or (iii) a forward primer comprising the sequence of SEQ ID NO: 5 and a reverse primer comprising the sequence of SEQ ID NO: 6.

[0013] In any and all embodiments of the methods disclosed herein, the biological sample is whole blood, serum, plasma, bronchioalveolar lavage fluid, a throat swab, or a nasopharyngeal (NP) aspirate or wash. In any of the preceding embodiments of the methods disclosed herein, the subject is a pediatric patient, a geriatric patient, an adult patient, or an immunocompromised patient.

[0014] In any and all embodiments of the methods disclosed herein, the methods of the present technology further comprise administering to the subject an effective amount of an anti-fungal agent. Examples of anti-fungal agents include, but are not limited to, one or more of trimethoprim, sulfamethoxazole, pentamidine, dapsone, pyrimethamine, atovaquone, clindamycin, or primaquine.

[0015] Also disclosed herein are kits for detecting the presence of pathogenic Pneumocystis jirovecii in a biological sample.BRIEF DESCRIPTION OF THE DRAWINGS

[0016] FIG. 1 shows study Participants from Cape Town, South Africa. RT-PCR CRISPR was evaluated by blind analysis of BAL and serum from a cohort of 27 HIV-positive adults from South Africa with and without PCP confirmed by Pneumocystis jirovecii immunofluorescence. Study participants were enrolled with dyspnea and hypoxemia (sO2≤ 94% or PaO2≤ 10kPa) and an abnormal chest X-ray. BAL and serum were obtained from patients at baseline before treatment initiation, and diagnosis was achieved from collected BAL specimens using the P.jirovecii immunofluorescence assay.

[0017] FIGs. 2A-2C show an overview of the RT-PCR CRISPR assay workflow for P.jirovecii diagnosis. FIG. 2A: RNA isolates from oropharyngeal swab or serum specimens are subjected to RT-PCR to amplify a target mRNA differentially expressed in the fungal trophic form required for active infection. These amplicons are recognized by a Cas12a / gRNA complex that cleaves and derepresses a quenched fluorescent probe in proportion to amplicon abundance. FIG. 2B: DNA and mRNA phenotypes expected in children with P.jirovecii colonization and infection events and (FIG. 2C) characteristics of conventional qPCR and proposed RT-PCR CRISPR assays for P.jirovecii infection.

[0018] FIGs. 3A-3G: show Sp and Gscl assay performance in serial BAL and serum from P. murina-infected mice. FIG. 3A: Scheme showing mouse infection and sampling time course with analysis of P. murina ascus- and trophic-life form transcripts Sp and GscP Sp and Gscl assay signal in mouse (FIGs. 3B and 3C) lung RNA, (FIGs. 3D and 3E) BAL and (FIGs. 3F and 3G) serum at two-, four-, and six-weeks post-inoculation with P. murina. Graphs indicate mean ± SD values of triplicate samples. *p < 0.05, **p < 0.01, ***p < 0.001, by two-sample Welch’s t-test corrected for multiple comparisons by the Holm-Sidak method (WT vs. Rag2- / -or performed without correction (4 vs. 6 weeks post-infection).

[0019] FIGs. 4A-4J: show characterization of Nad4 and Gscl assay performance in spiked samples. FIG. 4A: Ranked list of the most abundant and differentially detected P.jirovecii RNAs identified by sequencing of BAL samples of two P.jirovecii positive patients after subtractive hybridization to remove host-derived RNA transcripts. FIG. 4B: Genomic organization of enriched P.jirovecii mitochondrial genes and alignment of the P.jirovecii Nad4 primer and gRNAsequences with corresponding sequence regions of other Pneumocystis species (red text denotes sequence mismatches). LoD analyses for the (FIG. 4C) Nad4 and (FIG. 4D) Gscl CRISPR assays and (FIG. 4E) a matching Nad4 RT-qPCR assay, and the linear detection range data for the (FIG. 4F) Nad4 and (FIG. 4G) Gscl CRISPR assays and for RT-qPCR Nad4 (FIG. 4H). Species specificity of the P.jirovecii (FIG. 41) Nad4 and (FIG. 4J) Gscl assays when analyzing samples spiked with corresponding sequences from other respiratory pathogens. NTC = no template control. Graphs indicate mean ±SD values of triplicate analyses. Standard curve graphs indicate the linear regression line of the data, its 95% CI, and Pearson coefficient.

[0020] FIGs. 5A-5G: show characterization of Nad4 assay performance with infant oropharyngeal swab and adult BAL samples. FIG. 5A: Heatmap of CRISPR and RT-qPCR assay positive (red) and negative (blue) results for Nad4 and Gscl in infant oropharyngeal swab and adult BAL samples from P.jzroveczz-infected and -non-infected patients. Nad4 levels detected in (FIG. 5B) infant oropharyngeal swab and (FIG. 5C) adult BAL samples from North America, where positive signal was defined as signal that exceeded a threshold of the mean plus three times the SD of triplicate NTC samples (vertical dashed lines). FIG. 5D and 5E: Heatmap of CRISPR and RT-qPCR assay positive (red) and negative (blue) results for Nad4 and Gscl in adult BAL and serum samples from PCP-positive and -negative cases determined by immunofluorescence assay (IF A). Nad4 levels detected in (FIG. 5F) adult BAL and (FIG. 5G) adult serum samples from patients in South Africa, where positive signal was defined as signal that exceeded a threshold of the mean plus three times the SD of triplicate NTC samples (vertical dashed lines).

[0021] FIGs. 6A-6F: show optimization of RT-PCR-CRISPR assays for P. murina RNA targets. Signal-to-noise ratios of Sp and Gscl RT-PCR CRISPR assays performed with DNA isolated from healthy serum spiked with Sp or Gscl PCR amplicons at (FIG. 6A and 6B) the indicated annealing temperatures, with (FIG. 6C and 6D) the listed probe concentration, and (FIG. 6E and 6F) with the indicated Cas12a / gRNA complex concentrations. Signal-to-noise calculated as the ratio of fluorescent intensity for a sample well versus the mean fluorescent intensity in its matching no template control (NTC) wells.

[0022] FIGs. 7A-7H show characterization of Sp and Gscl assay performance in spiked serum. Sp and Gscl assay (FIG. 7A and 7B) limit of detection analysis, (FIG. 7C and 7D) standard curve linear range data, and (FIG. 7E and 7F) specificity results when analyzing serial dilutions of DNA isolated from healthy mouse serum spiked with Sp or Gscl PCR amplicons. Standard curve graphs indicate linear regression line, 95% CI, and Pearson coefficient. Sensitivityand Specificity graphs indicate mean ± SD values of triplicate samples. FIGs. 7G-7H: In vivo validation of CRISPR-murina detection of Sp and Gscl in mouse BAL (FIG. 7G) and serum (FIG. 7H) samples and qPCR targeting mtSSU using the same samples is shown. Quantitative fluorescent intensity provided for CRISPR targets is compared to PCR mtSSU diagnostic results. After infection with Pneumocystis murina. BAL and blood samples were harvested 4 weeks later. NTC: no template control.

[0023] FIGs. 8A-8F: show optimization of RT-PCR-CRISPR assays for P. jirovecii RNA targets. Signal-to-noise ratios of Nad4 and Gscl RT-PCR CRISPR assays performed with DNA isolated from healthy serum spiked with Nad4 or Gscl PCR amplicons at (FIG. 8A and 8B) the indicated annealing temperatures, with (FIG. 8C and 8D) the listed probe concentrations, and (FIG. 8E and 8F) with the indicated Cas12a / gRNA complex concentrations. Signal-to-noise calculated as the ratio of fluorescent intensity for a sample well versus the mean fluorescent intensity in its matching no template control (NTC) wells. Cas12a-gRNA graphs indicate mean ± SD values of triplicate samples.

[0024] FIGs. 9A-9B: show Gscl levels from infant swabs and adult BAL samples. Gscl levels detected in (FIG. 9A) infant oropharyngeal swab and (FIG. 9B) adult BAL samples from North America, where positive signal was defined as signal that exceeded a threshold of the mean plus three times the SD of triplicate NTC samples (vertical dashed lines).

[0025] FIGs. 10A-10B: show ROC curves for infant swab and North American BAL cohorts. Receiver operating characteristic curve results for the ability of CRISPR Nad4 and Gscl, and RT- qPCR Nad4 to distinguish (FIG. 10A) P. jzroveczz-infected and -non-infected cases from pediatric oropharyngeal swabs, and (FIG. 10B) PCP -positive and PCP-negative cases from North American adult BAL samples.

[0026] FIGs. 11A-11B: show Gscl levels from patients in South Africa cohort. Gscl levels detected in adult (FIG. 11 A) BAL and (FIG. 11B) serum samples from patients in South Africa. Positive signal was defined as signal that exceeded a threshold of the mean plus three times the SD of triplicate NTC samples (vertical dashed lines).

[0027] FIGs. 12A-12B: ROC curves for South African cohort. Receiver operating characteristic curve results for the ability of CRISPR Nad4 and Gscl to distinguish PCP-positive and PCP-negative adults from (FIG. 12A) BAL and (FIG. 12B) serum samples from South Africa.

[0028] FIGs. 13A-13D: Show CRISPR and RT-qPCR assay diagnostic performance tables for the indicated samples and patient populations.

[0029] FIG. 14: Shows clinical and demographic information for Perch infants with oropharyngeal swabs.

[0030] FIG. 15: Shows clinical information for adult PCP suspects from North America with BAL samples.

[0031] FIG. 16: shows primers, gRNA, and probe sequences used in the experiments disclosed herein (SEQ ID NOs: 1-10, 32, 33, 31, 34, 35, and 11).

[0032] FIG. 17: shows NAD4-specific primer and probe nucleic acid sequences for Pneumocystis jirovecii real time PCR assays (SEQ ID NOs: 9-14, in order of appearance from top to bottom).DETAILED DESCRIPTION

[0033] It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present methods are described below in various levels of detail in order to provide a substantial understanding of the present technology.

[0034] In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, immunology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel el al. eds. (2007) Current Protocols in Molecular Biology, the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach,' Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual,' Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis,' U.S. Patent No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization,' Anderson (1999) Nucleic Acid Hybridization,' Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir ’sHandbook of Experimental Immunology. Methods to detect and measure levels of polypeptide gene expression products (i.e., gene translation level) are well-known in the art and include the use of polypeptide detection methods such as antibody detection and quantification techniques. (See also, Strachan & Read, Human Molecular Genetics, Second Edition. (John Wiley and Sons, Inc., NY, 1999)).

[0035] Pneumocystis jirovecii is a lung pathogen that can lead to severe symptoms and death, and recent molecular epidemiology indicates it is the leading cause of fungal pneumonia in HIV- negative infants under 2 years old. Additionally, Pneumocystis jirovecii pneumonia (PJP) risk is clinically relevant in subjects with immune-deficiency or immune-suppressive medical regimens in both adults and children. Despite the clinical need for rapid PJP identification to guide effective therapeutic intervention, current diagnostic tests are invasive and have long turnaround times, due to the requirement of bronchoalveolar lavage (BAL) sampling. Historically, the gold standard PJP test is silver staining (GMS), immunofluorescent staining of patient BAL samples, which are costly, or time consuming. Other conventional test involve detecting Pneumocystis jirovecii genomic DNA or rRNA copy number via PCR. However, the sensitivity of genomic DNA / rRNA copy number detection assays may be negatively impacted by difficulties associated with recovery of fungal nucleic acid material (Rodriguez et al., Scientific Reports volume 9: 18037 (2019)), low sensitivities associated with sample type or assay type (Nanay akkara et al. Open Forum Infectious Diseases, Volume 8, Issue Supplement 1 : S583 (2021 ); Kapatia et al., Cytojournal. 2023; 20: 2), and the inability to discriminate between active infection versus colonization states, or live vs. dead pathogenic Pneumocystis pathogens. Steele et al., J Exp Med. 2003; 198(11): 1677-1688.

[0036] As disclosed in the Examples herein, several mitochondrial transcripts were upregulated in the trophs present in Pneumocystis infected mice including NADPH isoforms demonstrating that the troph is more metabolically active. In contrast, the ascus expressed the GSC 1 enzyme that synthesizes beta 1,3 glucan. Studies of throat swabs from the PERCH cohort of clinical PJP cases also validated these targets in active infection.

[0037] The present disclosure provides both real time RT-PCR assays as well as CRISPR assays for detecting select mitochondrial transcripts in both BAL and throat swab samples in PJP infected patients. The CRISPR-based assay consists of RNA isolation, PCR amplification, and CRISPR- based signal amplification for quantification of ascus and troph transcripts to distinguish active infection and colonization. CRISPR diagnostics display enhanced sensitivity compared to PCR-only methods allowing for CRISPRto diagnose Pneumocystis in minimally invasive sample types including throat swab, reducing the requirement for invasive BALF.Definitions

[0038] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. As used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise. For example, reference to “a cell” includes a combination of two or more cells, and the like. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical chemistry and nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art.

[0039] As used herein, the term “about” in reference to a number is generally taken to include numbers that fall within a range of 1%, 5%, or 10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).

[0040] As used herein, the “administration” of an agent or drug to a subject includes any route of introducing or delivering to a subject a compound to perform its intended function. Administration can be carried out by any suitable route, including but not limited to, orally, intranasally, intrathecally, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), rectally, intrathecally, intraocularly, intradermally, transmucosally, iontophoretically, or topically. Administration includes self-administration and the administration by another.

[0041] As used herein, the terms “amplify” or “amplification” with respect to nucleic acid sequences, refer to methods that increase the representation of a population of nucleic acid sequences in a sample. Copies of a particular target nucleic acid sequence generated in vitro in an amplification reaction are called “amplicons” or “amplification products”. Amplification may be exponential or linear. A target nucleic acid may be DNA (such as, for example, genomic DNA and cDNA) or RNA. While the exemplary methods described hereinafter relate to amplification using polymerase chain reaction (PCR), numerous other methods such as isothermal methods, rolling circle methods, etc., are well known to the skilled artisan. The skilled artisan will understand that these other methods may be used either in place of, or together with, PCR methods.See, e.g., Saiki, “ Amplification of Genomic DNA” in PCR Protocols, Innis el al., Eds., Academic Press, San Diego, CA 1990, pp 13-20; Wharam, et al., Nucleic Acids Res. 29(11):E54-E54 (2001).

[0042] An "amplification master mix" comprises an amplification mixture and primers for amplifying one or more target nucleic acids, but does not contain the sample to be amplified.

[0043] The terms “complementary” or “complementarity” as used herein with reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) refer to the base-pairing rules. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3’ end of the other, is in “antiparallel association.” For example, the sequence “5'-A-G-T-3”’ is complementary to the sequence “3’-T-C-A-5.” Certain bases not commonly found in naturally-occurring nucleic acids may be included in the nucleic acids described herein. These include, for example, inosine, 7-deazaguanine, Locked Nucleic Acids (LNA), and Peptide Nucleic Acids (PNA). Complementarity need not be perfect; stable duplexes may contain mismatched base pairs, degenerative, or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. A complement sequence can also be an RNA sequence complementary to the DNA sequence or its complement sequence, and can also be a cDNA.

[0044] The term “substantially complementary” as used herein means that two sequences hybridize under stringent hybridization conditions. The skilled artisan will understand that substantially complementary sequences need not hybridize along their entire length. In particular, substantially complementary sequences may comprise a contiguous sequence of bases that do not hybridize to a target sequence, positioned 3' or 5' to a contiguous sequence of bases that hybridize under stringent hybridization conditions to a target sequence.

[0045] As used herein, a "control" is an alternative sample used in an experiment for comparison purpose. A control can be "positive" or "negative."

[0046] As used herein, a "cycle threshold" (Ct) for an analyte is the PCR cycle at which the fluorescence signal crosses a specified fluorescence threshold. The Ct depends on the amplification reaction efficiency which includes starting template copy number, organism lysis, PCR amplification, hybridization or cleavage of a fluorogenic probe and sensitivity of detection.The Ct provides a relative measure of the concentration of the target nucleic acid in the PCR reaction. Many factors other than the concentration of the target nucleic acid can impact the absolute value of Ct. However, artifacts from the reaction mix or instrument that change the fluorescence measurements associated with the Ct calculation will result in template-independent changes to the Ct value.

[0047] “Detecting” as used herein refers to determining the presence of a nucleic acid of interest in a sample. Detection does not require the method to provide 100% sensitivity. Analysis of nucleic acid markers can be performed using techniques known in the art including, but not limited to, sequence analysis, and electrophoretic analysis. Non-limiting examples of sequence analysis include Maxam-Gilbert sequencing, Sanger sequencing, capillary array DNA sequencing, thermal cycle sequencing (Sears et aL, Biotechniques, 13:626-633 (1992)), solid-phase sequencing (Zimmerman et al. , Methods Mol. Cell Biol, 3:39-42 (1992)), sequencing with mass spectrometry such as matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI- TOF / MS; Fu et al., Nat. Biotechnol, 16:381-384 (1998)), and sequencing by hybridization. Chee et al., Science, 274:610-614 (1996); Drmanac et al., Science, 260: 1649-1652 (1993); Drmanac et al., Nat. Biotechnol, 16:54-58 (1998). Non-limiting examples of electrophoretic analysis include slab gel electrophoresis such as agarose or polyacrylamide gel electrophoresis, capillary electrophoresis, and denaturing gradient gel electrophoresis. Additionally, next generation sequencing methods can be performed using commercially available kits and instruments from companies such as the Life Technologies / Ion Torrent PGM or Proton, the Illumina HiSEQ or MiSEQ, and the Roche / 454 next generation sequencing system.

[0048] “Detectable label” as used herein refers to a molecule or a compound or a group of molecules or a group of compounds used to identify a nucleic acid or protein of interest. In some embodiments, the detectable label may be detected directly. In other embodiments, the detectable label may be a part of a binding pair, which can then be subsequently detected. Signals from the detectable label may be detected by various means and will depend on the nature of the detectable label. Detectable labels may be isotopes, fluorescent moieties, colored substances, and the like. Examples of means to detect detectable labels include but are not limited to spectroscopic, photochemical, biochemical, immunochemical, electromagnetic, radiochemical, or chemical means, such as fluorescence, chemifluorescence, or chemiluminescence, or any other appropriate means.

[0049] As used herein, the term “effective amount” refers to a quantity sufficient to achieve a desired therapeutic and / or prophylactic effect, e.g., an amount which results in the prevention of, or a decrease in a disease or condition described herein or one or more signs or symptoms associated with a disease or condition described herein. In the context of therapeutic or prophylactic applications, the amount of a composition administered to the subject will vary depending on the composition, the degree, type, and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. The compositions can also be administered in combination with one or more additional therapeutic compounds. In the methods described herein, the therapeutic compositions may be administered to a subject having one or more signs or symptoms of a disease or condition described herein. As used herein, a "therapeutically effective amount" of a composition refers to composition levels in which the physiological effects of a disease or condition are ameliorated or eliminated. A therapeutically effective amount can be given in one or more administrations.

[0050] As used herein, “expression” includes one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and / or other modifications of the translation product, if required for proper expression and function.

[0051] The term “fluorophore” as used herein refers to a molecule that absorbs light at a particular wavelength (excitation frequency) and subsequently emits light of a longer wavelength (emission frequency). The term “donor fluorophore” as used herein means a fluorophore that, when in close proximity to a quencher moiety, donates or transfers emission energy to the quencher. As a result of donating energy to the quencher moiety, the donor fluorophore will itself emit less light at a particular emission frequency that it would have in the absence of a closely positioned quencher moiety.

[0052] As used herein, the term “gene” means a segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that control expression.

[0053] The term “hybridize” as used herein refers to a process where two substantially complementary nucleic acid strands (at least about 65% complementary over a stretch of at least14 to 25 nucleotides, at least about 75%, or at least about 90% complementary) anneal to each other under appropriately stringent conditions to form a duplex or heteroduplex through formation of hydrogen bonds between complementary base pairs. Hybridizations are typically and preferably conducted with probe-length nucleic acid molecules, preferably 15-100 nucleotides in length, more preferably 18-50 nucleotides in length. Nucleic acid hybridization techniques are well known in the art. See, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementarity between the nucleic acids, stringency of the conditions involved, and the thermal melting point (Tm) of the formed hybrid. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences having at least a desired level of complementarity will stably hybridize, while those having lower complementarity will not. For examples of hybridization conditions and parameters, see, e.g., Sambrook, etal., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y.; Ausubel, F. M. et al. 1994, Current Protocols in Molecular Biology, John Wiley & Sons, Secaucus, N.J. In some embodiments, specific hybridization occurs under stringent hybridization conditions. An oligonucleotide or polynucleotide (e.g., a probe or a primer) that is specific for a target nucleic acid will “hybridize” to the target nucleic acid under suitable conditions.

[0054] As used herein, “oligonucleotide” refers to a molecule that has a sequence of nucleic acid bases on a backbone comprised mainly of identical monomer units at defined intervals. The bases are arranged on the backbone in such a way that they can bind with a nucleic acid having a sequence of bases that are complementary to the bases of the oligonucleotide. The most common oligonucleotides have a backbone of sugar phosphate units. A distinction may be made between oligodeoxyribonucleotides that do not have a hydroxyl group at the 2' position and oligoribonucleotides that have a hydroxyl group at the 2' position. Oligonucleotides may also include derivatives, in which the hydrogen of the hydroxyl group is replaced with organic groups, e.g., an allyl group. Oligonucleotides of the method which function as primers or probes are generally at least about 10-15 nucleotides long and more preferably at least about 15 to 25 nucleotides long, although shorter or longer oligonucleotides may be used in the method. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including, for example,chemical synthesis, DNA replication, restriction endonuclease digestion of plasmids or phage DNA, reverse transcription, PCR, or a combination thereof. The oligonucleotide may be modified e.g., by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides.

[0055] As used herein, the term “primer” refers to an oligonucleotide, which is capable of acting as a point of initiation of nucleic acid sequence synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a target nucleic acid strand is induced, z.e., in the presence of different nucleotide triphosphates and a polymerase in an appropriate buffer (“buffer” includes pH, ionic strength, cofactors etc.) and at a suitable temperature. One or more of the nucleotides of the primer can be modified for instance by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides. A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. The term primer as used herein includes all forms of primers that may be synthesized including peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate modified primers, labeled primers, and the like. The term “forward primer” as used herein means a primer that anneals to the anti-sense strand of dsDNA. A “reverse primer” anneals to the sense-strand of dsDNA.

[0056] Primers are typically at least 10, 15, 18, or 30 nucleotides in length or up to about 100, 110, 125, or 200 nucleotides in length. In some embodiments, primers are preferably between about 15 to about 60 nucleotides in length, and most preferably between about 25 to about 40 nucleotides in length. In some embodiments, primers are 15 to 35 nucleotides in length. There is no standard length for optimal hybridization or polymerase chain reaction amplification. An optimal length for a particular primer application may be readily determined in the manner described in H. Erlich, PCR Technology, Principles and Application for DNA Amplification, (1989).

[0057] As used herein, “primer pair” refers to a forward and reverse primer pair (z.e., a left and right primer pair) that can be used together to amplify a given region of a nucleic acid of interest.

[0058] “Probe” as used herein refers to nucleic acid that interacts with a target nucleic acid via hybridization. A probe may be fully complementary to a target nucleic acid sequence or partially complementary. The level of complementarity will depend on many factors based, in general, onthe function of the probe. A probe or probes can be used, for example to detect the presence or absence of a mutation in a nucleic acid sequence by virtue of the sequence characteristics of the target. Probes can be labeled or unlabeled, or modified in any of a number of ways well known in the art. A probe may specifically hybridize to a target nucleic acid. Probes may be DNA, RNA or a RNA / DNA hybrid. Probes may be oligonucleotides, artificial chromosomes, fragmented artificial chromosome, genomic nucleic acid, fragmented genomic nucleic acid, RNA, recombinant nucleic acid, fragmented recombinant nucleic acid, peptide nucleic acid (PNA), locked nucleic acid, oligomer of cyclic heterocycles, or conjugates of nucleic acid. Probes may comprise modified nucleobases, modified sugar moieties, and modified internucleotide linkages. A probe may be used to detect the presence or absence of a target nucleic acid. Probes are typically at least about 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 100 nucleotides or more in length.

[0059] A "probe element" as used herein refers to a stretch of nucleotides that (a) is associated with a primer in that it is connected to or located adjacent to the primer nucleic acid sequence, and (b) specifically hybridizes under stringent conditions to a target nucleic acid sequence to be detected.

[0060] As used herein, the term "primer-probe detection system" refers to a method for real-time PCR. This method utilizes a bi-functional molecule (referred to herein as a primer-probe), which contains a PCR primer element covalently linked by a polymerase-blocking group to a probe element. Additionally, each primer-probe molecule contains a fluorophore that interacts with a quencher to reduce the background fluorescence. Primer-probes, as used herein, may comprise a 3' primer with a 5' extended probe tail comprising a hairpin structure which possesses a fluor ophore / quencher pair. During PCR, the polymerase is blocked from extending into the probe tail by the inclusion of hexethylene glycol (HEG). During the first round of amplification the 3' target-specific primer anneals to the target nucleic acid and is extended such that the primer-probe is now incorporated into the newly synthesized strand, which possesses a newly synthesized target region for the 5' probe. During the next round of denaturation and annealing, the probe region of the primer-probe hairpin loop will hybridize to the target, thus separating the fluorophore and quencher and creating a measurable signal. Such primer-probes are described in Whitcombe et al., Nature Biotech 17: 804-807 (1999). SCORPION primers are exemplary primer-probes.

[0061] The term “quencher moiety” as used herein means a molecule that, in close proximity to a donor fluorophore, takes up emission energy generated by the donor and either dissipates the energy as heat or emits light of a longer wavelength than the emission wavelength of the donor.In the latter case, the quencher is considered to be an acceptor fluorophore. The quenching moiety can act via proximal (z.e., collisional) quenching or by Forster or fluorescence resonance energy transfer (“FRET”). Quenching by FRET is generally used in TaqMan® probes while proximal quenching is used in molecular beacon and Scorpion™ type probes.

[0062] A "reaction-sample mixture" as used herein refers to a mixture containing amplification master mix and a sample.

[0063] As used herein, a “sample” or “biological sample” refers to a body fluid or a tissue sample isolated from a subject. In some cases, a biological sample may consist of or comprise whole blood, platelets, red blood cells, white blood cells, plasma, sera, urine, feces, epidermal sample, throat swabs, bronchioalveolar lavage (BAL), vaginal sample, skin sample, cheek swab, sperm, amniotic fluid, cultured cells, bone marrow sample, biopsies, aspirate and / or chorionic villi, cultured cells, endothelial cells, synovial fluid, lymphatic fluid, ascites fluid, interstitial or extracellular fluid and the like. The term "sample" may also encompass the fluid in spaces between cells, including gingival crevicular fluid, bone marrow, cerebrospinal fluid (CSF), saliva, mucus, sputum, semen, sweat, urine, or any other bodily fluids. Samples can be obtained from a subject by any means including, but not limited to, venipuncture, excretion, ejaculation, massage, biopsy, needle aspirate, lavage, scraping, surgical incision, or intervention or other means known in the art. A blood sample can be whole blood or any fraction thereof, including blood cells (red blood cells, white blood cells or leukocytes, and platelets), serum and plasma.

[0064] The term “sensitivity,” as used herein in reference to the methods of the present technology, is a measure of the ability of a method to detect a preselected sequence variant in a heterogeneous population of sequences. A method has a sensitivity of S % for variants of F % if, given a sample in which the preselected sequence variant is present as at least F % of the sequences in the sample, the method can detect the preselected sequence at a preselected confidence of C %, S % of the time. By way of example, a method has a sensitivity of 90% for variants of 5% if, given a sample in which the preselected variant sequence is present as at least 5% of the sequences in the sample, the method can detect the preselected sequence at a preselected confidence of 99%, 9 out of 10 times (F=5%; C=99%; S=90%).

[0065] The term “specific” as used herein in reference to an oligonucleotide primer means that the nucleotide sequence of the primer has at least 12 bases of sequence identity with a portion of the nucleic acid to be amplified when the oligonucleotide and the nucleic acid are aligned. Anoligonucleotide primer that is specific for a nucleic acid is one that, under the stringent hybridization or washing conditions, is capable of hybridizing to the target of interest and not substantially hybridizing to nucleic acids which are not of interest. Higher levels of sequence identity are preferred and include at least 75%, at least 80%, at least 85%, at least 90%, at least 95% and more preferably at least 98% sequence identity.

[0066] “Specificity,” as used herein, is a measure of the ability of a method to distinguish a truly occurring preselected sequence variant from sequencing artifacts or other closely related sequences. It is the ability to avoid false positive detections. False positive detections can arise from errors introduced into the sequence of interest during sample preparation, sequencing error, or inadvertent sequencing of closely related sequences like pseudo-genes or members of a gene family. A method has a specificity of X % if, when applied to a sample set of Niotai sequences, in which XTrue sequences are truly variant and Xxottrue are not truly variant, the method selects at least X % of the not truly variant as not variant. E.g., a method has a specificity of 90% if, when applied to a sample set of 1,000 sequences, in which 500 sequences are truly variant and 500 are not truly variant, the method selects 90% of the 500 not truly variant sequences as not variant. Exemplary specificities include 90, 95, 98, and 99%.

[0067] The term “stringent hybridization conditions” as used herein refers to hybridization conditions at least as stringent as the following: hybridization in 50% formamide, 5xSSC, 50 mM NaH2PO4, pH 6.8, 0.5% SDS, 0.1 mg / mL sonicated salmon sperm DNA, and 5x Denhart's solution at 42° C. overnight; washing with 2x SSC, 0.1% SDS at 45° C; and washing with 0.2x SSC, 0.1% SDS at 45° C. In another example, stringent hybridization conditions should not allow for hybridization of two nucleic acids which differ over a stretch of 20 contiguous nucleotides by more than two bases.

[0068] As used herein "TaqMan® PCR detection system" refers to a method for real-time PCR. In this method, a TaqMan® probe which hybridizes to the amplified nucleic acid segment is included in the amplification master mix. The TaqMan® probe comprises a donor and a quencher fluorophore on either end of the probe and in close enough proximity to each other so that the fluorescence of the donor is taken up by the quencher. However, when the probe hybridizes to the amplified segment, the 5'-exonuclease activity of the Taq polymerase cleaves the probe thereby allowing the donor fluorophore to emit fluorescence which can be detected.

[0069] The terms “target nucleic acid” or “target sequence” as used herein refer to a nucleic acid sequence of interest to be detected and / or quantified in the sample to be analyzed. Target nucleic acid may be composed of segments of a chromosome, a complete gene with or without intergenic sequence, segments or portions of a gene with or without intergenic sequence, or sequence of nucleic acids which probes or primers are designed. Target nucleic acids may include a wild-type sequence(s), a mutation, deletion, insertion or duplication, tandem repeat elements, a gene of interest, a region of a gene of interest or any upstream or downstream region thereof. Target nucleic acids may represent alternative sequences or alleles of a particular gene. Target nucleic acids may be derived from genomic DNA, cDNA, or RNA.

[0070] As used herein, the terms “subject”, “patient”, or “individual” can be an individual organism, a vertebrate, a mammal, or a human. In some embodiments, the subject, patient or individual is a human.

[0071] “Treating” or “treatment” as used herein covers the treatment of a disease or condition described herein, in a subject, such as a human, and includes: (i) inhibiting a disease or condition, z.e., arresting its development; (ii) relieving a disease or condition, z.e., causing regression of the condition; (iii) slowing progression of the disease or condition; and / or (iv) inhibiting, relieving, or slowing progression of one or more symptoms of the disease or condition. In some embodiments, treatment means that the symptoms associated with the disease are, e.g., alleviated, reduced, cured, or placed in a state of remission.

[0072] It is also to be appreciated that the various modes of treatment of diseases or conditions as described herein are intended to mean “substantial,” which includes total but also less than total treatment, and wherein some biologically or medically relevant result is achieved. The treatment may be a continuous prolonged treatment for a chronic disease or a single, or few time administrations for the treatment of an acute condition.Nucleic Acid Amplification and / or Detection

[0073] Polynucleotides associated with active PJP infection can be detected by the use of nucleic acid amplification techniques that are well known in the art. The starting material may be genomic DNA, cDNA, RNA or mRNA. Nucleic acid amplification can be linear or exponential. Specific variants or mutations may be detected by the use of amplification methods with the aid of oligonucleotide primers or probes designed to interact with or hybridize to a particular target sequence in a specific manner, thus amplifying only the target variant.

[0074] Non-limiting examples of nucleic acid amplification techniques include polymerase chain reaction (PCR), real-time quantitative PCR (qPCR), digital PCR (dPCR), reverse transcriptase polymerase chain reaction (RT-PCR), nested PCR, ligase chain reaction (see Abravaya, K. et al., Nucleic Acids Res. (1995), 23:675-682), branched DNA signal amplification (see Urdea, M. S. et al., AIDS (1993), 7(suppl 2):S11- S14), amplifiable RNA reporters, Q-beta replication, transcription-based amplification, boomerang DNA amplification, strand displacement activation, cycling probe technology, isothermal nucleic acid sequence based amplification (NASBA) (see Kievits, T. et al., J Virological Methods (1991), 35:273-286), Invader Technology, next-generation sequencing technology or other sequence replication assays or signal amplification assays.

[0075] Primers'. Oligonucleotide primers for use in amplification methods can be designed according to general guidance well known in the art as described herein, as well as with specific requirements as described herein for each step of the particular methods described. In some embodiments, oligonucleotide primers for cDNA synthesis and PCR are 10 to 100 nucleotides in length, preferably between about 15 and about 60 nucleotides in length, more preferably 25 and about 50 nucleotides in length, and most preferably between about 25 and about 40 nucleotides in length.

[0076] Tmof a polynucleotide affects its hybridization to another polynucleotide (e.g., the annealing of an oligonucleotide primer to a template polynucleotide). In certain embodiments of the disclosed methods, the oligonucleotide primer used in various steps selectively hybridizes to a target template or polynucleotides derived from the target template (i.e., first and second strand cDNAs and amplified products). Typically, selective hybridization occurs when two polynucleotide sequences are substantially complementary (at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, preferably at least about 75%, more preferably at least about 90% complementary). See Kanehisa, M., Polynucleotides Res. (1984), 12:203, incorporated herein by reference. As a result, it is expected that a certain degree of mismatch at the priming site is tolerated. Such mismatch may be small, such as a mono-, di- or tri-nucleotide. In certain embodiments, 100% complementarity exists.

[0077] Probes'. Probes are capable of hybridizing to at least a portion of the nucleic acid of interest or a reference nucleic acid (i.e., wild-type sequence). Probes may be an oligonucleotide, artificial chromosome, fragmented artificial chromosome, genomic nucleic acid, fragmented genomic nucleic acid, RNA, recombinant nucleic acid, fragmented recombinant nucleic acid,peptide nucleic acid (PNA), locked nucleic acid, oligomer of cyclic heterocycles, or conjugates of nucleic acid. Probes may be used for detecting and / or capturing / purifying a nucleic acid of interest.

[0078] Typically, probes can be about 10 nucleotides, about 20 nucleotides, about 25 nucleotides, about 30 nucleotides, about 35 nucleotides, about 40 nucleotides, about 50 nucleotides, about 60 nucleotides, about 75 nucleotides, or about 100 nucleotides long. However, longer probes are possible. Longer probes can be about 200 nucleotides, about 300 nucleotides, about 400 nucleotides, about 500 nucleotides, about 750 nucleotides, about 1,000 nucleotides, about 1,500 nucleotides, about 2,000 nucleotides, about 2,500 nucleotides, about 3,000 nucleotides, about 3,500 nucleotides, about 4,000 nucleotides, about 5,000 nucleotides, about 7,500 nucleotides, or about 10,000 nucleotides long.

[0079] Probes may also include a detectable label or a plurality of detectable labels. The detectable label associated with the probe can generate a detectable signal directly. Additionally, the detectable label associated with the probe can be detected indirectly using a reagent, wherein the reagent includes a detectable label, and binds to the label associated with the probe.

[0080] In some embodiments, detectably labeled probes can be used in hybridization assays including, but not limited to Northern blots, Southern blots, microarray, dot or slot blots, and in situ hybridization assays such as fluorescent in situ hybridization (FISH) to detect a target nucleic acid sequence within a biological sample. Certain embodiments may employ hybridization methods for measuring expression of a polynucleotide gene product, such as mRNA. Methods for conducting polynucleotide hybridization assays have been well developed in the art. Hybridization assay procedures and conditions will vary depending on the application and are selected in accordance with the general binding methods known including those referred to in: Maniatis el al. Molecular Cloning: A Laboratory Manual (2nd Ed. Cold Spring Harbor, N. Y., 1989); Berger and Kimmel Methods in Enzymology, Vol. 152, Guide to Molecular Cloning Techniques (Academic Press, Inc., San Diego, Calif, 1987); Young and Davis, PNAS. 80: 1194 (1983).

[0081] Detectably labeled probes can also be used to monitor the amplification of a target nucleic acid sequence. In some embodiments, detectably labeled probes present in an amplification reaction are suitable for monitoring the amount of amplicon(s) produced as a function of time. Examples of such probes include, but are not limited to, the 5'- exonucleaseassay (TAQMAN® probes described herein (see also U.S. Pat. No. 5,538,848) various stem-loop molecular beacons (see for example, U.S. Pat. Nos. 6,103,476 and 5,925,517 and Tyagi and Kramer, 1996, Nature Biotechnology 14:303- 308), stemless or linear beacons (see, e.g., WO 99 / 21881), PNA Molecular Beacons™ (see, e.g., U.S. Pat. Nos. 6,355,421 and 6,593,091), linear PNA beacons (see, for example, Kubista et al., 2001, SPIE 4264:53-58), non-FRET probes (see, for example, U.S. Pat. No. 6,150,097), Sunrise® / Amplifluor™ probes (U.S. Pat. No. 6,548,250), stem-loop and duplex Scorpion probes (Solinas et al., 2001, Nucleic Acids Research 29:E96 and U.S. Pat. No. 6,589,743), bulge loop probes (U.S. Pat. No. 6,590,091), pseudo knot probes (U.S. Pat. No. 6,589,250), cyclicons (U.S. Pat. No. 6,383,752), MGB Eclipse™ probe (Epoch Biosciences), hairpin probes (U.S. Pat. No. 6,596,490), peptide nucleic acid (PNA) light-up probes, self-assembled nanoparticle probes, and ferrocene-modified probes described, for example, in U.S. Pat. No. 6,485,901 ; Mhlanga et al., 2001, Methods 25:463-471 ; Whitcombe et al., 1999, Nature Biotechnology. 17:804-807; Isacsson et al., 2000, Molecular Cell Probes. 14:321-328; Svanvik et al., 2000, Anal Biochem. 281 :26-35; Wolffs et al., 2001, Biotechniques 766:769-771 ; Tsourkas et al., 2002, Nucleic Acids Research. 30:4208-4215; Riccelli et al., 2002, Nucleic Acids Research 30:4088-4093; Zhang et al., 2002 Shanghai. 34:329-332; Maxwell et al., 2002, J. Am. Chem. Soc. 124:9606-9612; Broude et al., 2002, Trends Biotechnol. 20:249-56; Huang et al, 2002, Chem. Res. Toxicol. 15: 118- 126; and Yu et al., 2001, J. Am. Chem. Soc 14: 11155-11161.

[0082] In some embodiments, the detectable label is a fluorophore. Suitable fluorescent moieties include but are not limited to the following fluorophores working individually or in combination: 4-acetamido-4'-isothiocyanatostilbene- 2,2'disulfonic acid; acridine and derivatives: acridine, acridine isothiocyanate; Alexa Fluors: Alexa Fluor® 350, Alexa Fluor® 488, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 647 (Molecular Probes); 5-(2- aminoethyl)aminonaphthalene-l -sulfonic acid (EDANS); 4-amino-N- [3- vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate (Lucifer Yellow VS); N-(4-anilino-l- naphthyl)maleimide; anthranilamide; Black Hole Quencher™ (BHQ™) dyes (biosearch Technologies); BODIPY dyes: BODIPY® R-6G, BOPIPY® 530 / 550, BODIPY® FL; Brilliant Yellow; coumarin and derivatives: coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120),7-amino-4-trifluoromethylcouluarin (Coumarin 151); Cy2®, Cy3®, Cy3.5®, Cy5®, Cy5.5®; cyanosine; 4',6-diaminidino-2-phenylindole (DAPI); 5', 5"-dibromopyrogallol- sulfonephthalein (Bromopyrogallol Red); 7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin; diethylenetriamine pentaacetate; 4,4'-diisothiocyanatodihydro-stilbene-2,2'- disulfonic acid; 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid; 5- [dimethylamino]naphthalene-l -sulfonyl chloride (DNS, dansyl chloride); 4-(4'- dimethylaminophenylazo)benzoic acid (DABCYL); 4-dimethylaminophenylazophenyl-4'- isothiocyanate (DABITC); Eclipse™ (Epoch Biosciences Inc.); eosin and derivatives: eosin, eosin isothiocyanate; erythrosin and derivatives: erythrosin B, erythrosin isothiocyanate; ethidium; fluorescein and derivatives: 5-carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2- yl)amino fluorescein (DTAF), 2',7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), hexachloro-6-carboxyfluorescein (HEX), QFITC (XRITC), tetrachlorofluorescem (TET); fiuorescamine; IR144; IR1446; lanthamide phosphors; Malachite Green isothiocyanate; 4-methylumbelliferone; ortho cresolphthalein; nitrotyrosine; pararosaniline; Phenol Red; B -phycoerythrin, R-phycoerythrin; allophycocyanin; o-phthaldialdehyde; Oregon Green®; propidium iodide; pyrene and derivatives: pyrene, pyrene butyrate, succinimidyl 1 - pyrene butyrate; QSY® 7; QSY® 9; QSY® 21; QSY® 35 (Molecular Probes); Reactive Red 4 (Cibacron®Brilliant Red 3B-A); rhodamine and derivatives: 6-carboxy-X-rhodamine (ROX), 6- carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine green, rhodamine X isothiocyanate, riboflavin, rosolic acid, sulforhodamine B, sulforhodamine 101, sulfonyl chloride derivative of sulforhodamine 101 (Texas Red); terbium chelate derivatives; N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl rhodamine; tetramethyl rhodamine isothiocyanate (TRITC); and VIC®. Detector probes can also comprise sulfonate derivatives of fluorescenin dyes with S03 instead of the carboxylate group, phosphoramidite forms of fluorescein, phosphoramidite forms of CY 5 (commercially available for example from Amersham).

[0083] Detectably labeled probes can also include quenchers, including without limitation black hole quenchers (Biosearch), Iowa Black (IDT) quenchers, QSY quencher (Molecular Probes), and Dabsyl and Dabcel sulfonate / carboxylate Quenchers (Epoch).

[0084] Detectably labeled probes can also include two probes, wherein for example a fluorophore is on one probe, and a quencher is on the other probe, wherein hybridization of the two probes together on a target quenches the signal, or wherein hybridization on the target alters the signal signature via a change in fluorescence.

[0085] In some embodiments, interchelating labels such as ethidium bromide, SYBR® GreenI (Molecular Probes), and PicoGreen® (Molecular Probes) are used, thereby allowingvisualization in real-time, or at the end point, of an amplification product in the absence of a detector probe. In some embodiments, real-time visualization may involve the use of both an intercalating detector probe and a sequence-based detector probe. In some embodiments, the detector probe is at least partially quenched when not hybridized to a complementary sequence in the amplification reaction, and is at least partially unquenched when hybridized to a complementary sequence in the amplification reaction.

[0086] In some embodiments, the amount of probe that gives a fluorescent signal in response to an excited light typically relates to the amount of nucleic acid produced in the amplification reaction. Thus, in some embodiments, the amount of fluorescent signal is related to the amount of product created in the amplification reaction. In such embodiments, one can therefore measure the amount of amplification product by measuring the intensity of the fluorescent signal from the fluorescent indicator.

[0087] Primers or probes may be designed to selectively hybridize to any portion of a Pneumocystis jirovecii nucleic acid sequence encoding Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, ox Nadi polypeptide. See GenBank: JX499143.1 for complete genome of the Pneumocystis jirovecii mitochondrion.

[0088] Exemplary nucleic acid sequences of the Pneumocystis jirovecii mitochondrial genes are provided below:

[0089] Orfl95 >1X499143.1 : 15394-15939 Pneumocystis jirovecii mitochondrion, complete genome (SEQ ID NO: 15)GT GAAAGT T TAT CAAT T T CAAAAT AAAAAT T T AAT T AAGT AT T C CACT T T GAAT T T AAAAGAAAGT AAAC ATTTAACTTCTTTTTTAAATGTCTTCTTCTATCCCTTCGGTTATATTAGTAATCCTCATATTGCTTTGAC TAATTATTGAATGTGAATTACTTTCTTCTACTATTTAATTAAACCTTTCCCCTTTTCAATCAGATTGTTG TTGGAAACTTCTCTCTCTAAAGTTTATGGAAAATGTGTTGTTGTAGAAGCAATGCCTCTGAAATATCCTT TCTTGAATAGTGCAATTTATTCTCAGTATATTGCTAATTCCCAATTTAATGATTTAGAATTGTTGCAACA TTCTTCTTCTACACATTTTATAGGTCAGTTGTTAGGTATTACTGTATGAATTGCTGGTTGATTGTTGAAA ACATGAGCTTCTGTTTCAGAGTTCTCTGTAGGTTCCGTTTCCTCTTTTAAAGATTCTTATCTGTTTGATT TTAAAGATAAAAATGGAGTGAAATCTGTTTCTGTTACTCTTTATTCTTCTTCTTAG

[0090] Coxl >1X499143.1 : 16256-17836 Pneumocystis jirovecii mitochondrion, complete genome (SEQ ID NO: 16)ATGACATGATGGTTGTTTTCAACAAATGCTAAGGATATCGGAGTCTTGTACTTGATCTTTGCACTTTTTT CTGGAATGTTGGGTACAGCATATTCAGTATTATTGAGAATGGAATTAACTTCCCCAGGTGTTCAGTATTT ACAGGGTGATAATCAATTGTATAATGTAATTTTAACGAGTCATGCGTTGTTAATGATATTCTTTATGGTT ATGCCCGGAATGGTAGGAGGTTTTGGTAATTGGTTGGTTCCAGTAATGATTGGAGCACCAGATATGGCCT TTCCAAGATTAAATAATATCTCCTTCTGGTTGTTACCGCCTTCTCTGATTCTGTTAATTGCTTCTTCTCT TCTAGAAGGTGGAAGTGGTACAGGTTGGACTTTTTATCCACCTTTGTCCAGTTTACAAAGTCATTCCTCAGGTGCTGTCGATTTGTCTATCTTTAGTCTACATTTAGCAGGTATTAGTTCTATGTTGGGAGCTATTAATTTTATTACTACTGTTCTTAATACTTGAGCTCCCGGTATGACTATGCATAAAATTCCATTGTTTGTATGGTCTATCTTTGTTACTGCTATACTGTTGTTATTGTCCTTGCCAGTCTTAGCAGGAGGTATTACTATGCTCTTGACGGATTGAAATTTTAATACTTCCTTCTATGATGTCGCAGGAGGAGGGGATCCTATCCTTTATCAACATCTCTTCTGGTTCTTCGGACATCCAGAAGTTTATATTCTGATTATTCCAGGATTTGGTATCATTAGTCATATTATTTCCACTTTCTCTGGAAAACCAGTATTCGGTTATTTAGGTATGGTTTATGCTATGTTGTCAATTGGTGTCTTAGGATTTATTGTCTGGAGTCATCATATGTATTCAGTGGGTTTAGATGTTGATACATGAGCTTATTTTACTGCTGCTACTATGATTATTGGTGTACCTACTGGTATTAAAATCTTCTCTTGGATTGCTACTATGTATGGTGGTGTGATTCGATTTAATACACCTATGCTCTTTGCTATCGGATTCCTTTTCCTTTTTACTGTGGGAGGATTAACGGGTATTGTCTTGTCTAATGCTTCTTTAGATGTGGCTTTACATGATACTTATTATGTTGTAGCTCATTTCCATTATGTTTTATCCATGGGTGCAGTCTTTGCTCTCTTAGCAGCTTGGTATTTCTGGTCTCCAAAAATTTTAGGATTGTTCTTTGATGAAAAATTAGGGCATTTGCATTTCTGGACTCTTTTTATTGGAGTGAATTTAACTTTTATGCCTATGCATTTCTTGGGATTACAGGGTATGCCCAGATGAATTCCTGATTATCCTGATGCTTTTGCTCAGTGGAATCATATCTCAAGTTTAGGTAGTTTGATTTCTGTTGTTGCTACTGTTGTTTTTATTTATTCTATTTTTGATCAATTGATCTCTAAATGATTGGTACCGATGAATCCTTGGTATTCTCCTGAT TTCTTTGTTAGTCATACGAATTTAGAGGATTCCAAAGCTTGTTCCTTAGAATGGGCATTGATTTCACCAC CAGCTTTCCATGCTTATACTAGTTTACCTAAACAAGCTTAA

[0091] Atp6 >1X499143.1 : 18022-18789 Pneumocystis jirovecii mitochondrion, complete genome (SEQ ID NO: 17)ATGTATTCTATCTCTCTCTTTAGCCCGTTAGAACAGTTCGAAATTTATCCTTTGTTGAGTTTGGATCTGCCTCTGTTCGGTTATTGTGAATTCGCTATCACGAATATTGCTGTCTATTTCTCTATTGCTGTTCTGACTATCGTGGGACTTTCTGTTTTGACTACTAATAATTTTAAATTAATTTCTAATGGGTGGAATTTGTCTACGGAATCGCTTTATCATACTGTTCTGAATGTTGTCGAAAATCAAATCGGTCGAAAAGGTTATATCTATTTCCCTCTGATTTATTCGTTGTTTGTTTTTGTTCTGGTTGCTAATTTTATTGGTATGATACCTTATTCTTTTGCTGTCACTTCACATCTGGTCTTTACTGTCGCTTTAAGTCTGACTATTCTTTTGGGGGTCACTTTCTTAGGTTTGTTTCTACATGGTCTGAAATTCTTCTCCTTCTTTGTTCCTTCAGGTGTACCTATGGTTCTGATTCCTTTCTTGACTGCTATCGAATTGATTCTTTATCTTTCATGAGGTCTCTCTCTGGGTATCCGATTGGGTGCTAATGTTATGGCTGGACATATGCTTATGAAAATTTTAGCTGGATTTATTTTTAATATTATGGTCTCGGGTATTCTGCTTTTTGTTCTGGGACTTCTTCCTCTGGCTATTCTTATTGCTATTGCTGGATTAGAATTGGCTATCGCTTTTATTCAAGCTTATGTCTTTGTTGTTCTGACTTCTAGTTATATTAAAGATTCTATCTATTTACATTAA

[0092] Cox3 >1X499143.1 : 19380-20177 Pneumocystis jirovecii mitochondrion, complete genome (SEQ ID NO: 18)ATGAATAAAGAACAATTTGTTGCACTTCATCCTTATCATTTGGTAAATTCTAGTCCATGGCCTTTAGTTTGTTCTTTTTCTTTGTTGTCCTTAGCTTTGTCTTCTGTATTATTATTTCAAGGGTCTACTGGAATCTGGTTTGTCTTGAGTTTATTGTCTGTTGTGGGTTCTGTTGTCTTCTGGTTTAGAGATGTTATAGCTGAAGGTTCGTATGAAGGTTCACATACTTCCTCTGTACAAACAGGGTTGAATATTGGTGTTATTTTATTTATTATTAGTGAAGTTTTCTTCTTTGTTTCTATCTTCTGGGCTTTCTTCCATTGTGCCTTGTCACCTGCTGTAGAATTAGGTATGCAATGGCCACCTAAAGGTCTTCAGGCTGTGAATCCTTGGGAATTACCTCTTCTTAATACTGTAATTCTGTTATCTTCAGGAGGTACTGTCACTTATGCTCATCATTCTCTTCTTCAGGGTCAATGATCGAATGCATTAATTGGTTTGTCTTTAACTCTTTTACTAGCTCTAGCTTTTACTCTTTTACAGGGTGTGGAATATTATCTTTCTTCTTTCACTATCTCTGATGGTGTCTTTGGTTCCTGTTTCTATTTTTCTACTGGTTTTCATGGTTTACATGTTTTAGTGGGTGCTATCTTTTTATCTGTAGGACTTTGGAGAATTTGGAATTATCACTTCAATGATAAACATCATTTGGGATTAGAATCAGCTATTTTATATTGGCATTTTGTTGATATTGTTTGGTTGTTCTTATT TATTTCCATCTATTGGTGGGGAAGTTAA

[0093] Atp9 >1X499143.1 :20225-20449 Pneumocystis jirovecii mitochondrion, complete genome (SEQ ID NO: 19)ATGTTACAAGCAGCTAAAGTTATTGGTTCAGGGTTAGCTACAATTGGATTAGCAGGGGCTGGTATCGGTATCGGTTTAGTTTTCGGTAATTTATTAGTAGCGACAAGTCGAAATCCTTCATTGAAAGGACAACTCTTCTCTTATGCTATCTTGGGATTTGCTCTAGCAGAAGCTACTGGTCTTTTCTGTTTGATGATGGCTTTCCTTCTGCTATATGCAGCTTAA

[0094] Nad5 >1X499143.1 :20819-22753 Pneumocystis jirovecii mitochondrion, complete genome (SEQ ID NO: 20)ATGTATTCTACACTTTTAATGTTGCCCTTCTTAAGTGGTTCAGTTGTAGGTTTGTTAGGACATAAAATCG GTGTAAAAGGGTGTTTCTTTATTTCTATTTTATCTATACTTCTTACTACTCTCTTGGGTTATTGCTGTTT TTATGAAGTTGTTCTCTGTAATGCACCAGTCTCTCTTAATTGGGGGTATTGGTTGGATTTGGATTCCTTC TCCCTTTCTTGGAAATTCCTTTTTGATGAATTAACTGTCTCAATGCTTCTTCCTGTGTTGACTATTTCCT GTTTAGTTCAAATCTATTCTATGAGTTATATGAGTCATGATCCTCATGTACCCAGATTCTTCTGTTATCT TTCCTTCTTCACTTTCTTTATGCTGCTTCTGGTTTCAGGAGATAATTTTCTTATTCTCTTTATCGGTTGG GAAGGTGTGGGTATTATGTCTTTCTTGTTAATTAGTTTCTGGTTTACTTGAGTTCAAGCTAATAAAAGTG CTCTGAGTGCTGTACTCTTTAATTGAGTTGGTGATCTTTTCTTGATTGTTGCTTTAGTTCTTTTAATTTG GAATGTCGGATCTTTAGATTTTTCTATTGTGTTCTCTTTAGCTCCTTATATTAATAAAACTCTGATTCTA CTTATTGGTATCTGTTTTGTTCTAGCTGCAACTGGAAAATCAGCTCAGTTAGGTTTGCATTTGTGGTTGC CTCAAGCTATGGAAGGACCTACACCTGTATCCGCATTGATTCATGCAGCTACTATGGTTACAGCGGGTGT CTATCTACTTATATGATCCTCACCTCTTCTAGAATGGAATTCTCTTCTTTCTTCTCTTATCTGTGGGTTA GGTGCGGCTACTGCTTTATTTGCTTCCTTAACTGGATTATTCCAAAATGATTTGAAATGAATTATTGCTT ATTCCACTTGTTCTCAGTTGGGTATGATGTTTGTTGCTATTGGTTTGTCTCAATATTCTTTGGCTTTGTT CCATCTAGTTAATCATGCTTTCTTTAAAGCTCTGCTTTTCTTAAGTGCGGGTGTTGTGATTCATGCATTC CAAGATGAACAAGATATTAGAAAAATGGGTGGTCTTCTATGGGGTATGCCTTTGACTTATACTTTTATTC TTATTGGTTCCTTGAGTCTTATGGCTTTCCCTTTCTTAACTGGTTTCTATTCTAAAGATCTTATTATTGA AATGTCTTTTAAATCTTCTGTTTTCTTTGGTTTGTTAACTGTTGTTGCAGTATTCACTTCATTATACTCT TTTAAATTAATTTATTTTACTTTCTTGTCTAAACCTTCTGCTAGTTTCTCTTCTTATCGATCTTTACATG ATGTACCTCTAAGTATGATTTTACCTTTGTGGGTTTTATCTTTATTAAGTCTCTTCTGGGGTTATTTAAC TAAAGATTTGTTTATTGGTATCGGTTCTTCTGCTTTAGGTAATTCTATTTTTTCTTTCTCTTTTTCTGAT ATTTTGGATGTGGAATTTGGTGTATTGACTGTGTTTAAAATTTTACCTTTTATTTTAAGTTCTGTTGCTA TTCTTTGTTTCTTTATTGTTTTACATTATTTTTCTTATCTTCTTTATTATTTTAAATTCTCTGCTTTAGG TTGATCTATTTATTCTTTCTTTAATCAACGATTTGGATTGGATCTGTTATATACTAAATTCTTTGTTCAT AATGCATTGAAGTTGGGTTATTGGACTTCACGTCTGTTGGATAAAGGTTGTTTAGAAGTTTTGGGACCTA CAGGAGTGTCTAATGGATTGAAACATCTCTATTCTATTCTTTCGACATTCGATTCAGGTGTTCTAAGACA TTATGCTATTTCTATTTGTTTAGCCTTCTTATTGATTCTTGTGTTAGGTTTTTCTGGTTTAGATGTTCAA ATTCTTTGGGTTATTCTGTTAACTACTGTTTTAGTTCTAACTTAA

[0095] Nad4 >1X499143.1 :22758-24167 Pneumocystis jirovecii mitochondrion, complete genome (SEQ ID NO: 21)ATGTTGTCTACATTGGTATTGTGCCCTCTTTTAGGGGTGGGTGTGGTGTTGTGTAATAGTAATTCTTCTG CTAATCTTTTAGGTTTGTGTTTCTCCTTTGTATCTCTTTTGATTTCTTTGGTAGTTTGGGCAGTTAGTCA TCCAGATGTACAATGGATTGAGTCTTTGTTTAATTTTCAATTGGTTGTGGATGGTCTTTCTATTCCTTTT ATTCTTCTTACTACTTTTATTTTTCCTTTTGCTTTGTTATCTAATTGGAGTAATTTGGATTTTAAAAGAT TTTCTAGTAAATATTTTGTTGTTCTTATGCTTCTGGTGGAGTTCTTTTTACTCCTGGTATTTACTGTGTC AGATTTAATTCTATTTTATATTTTCTTTGAAAGTATTTTACCACCTCTTTTTATTTTAATTGGATTGTAT GGTTCTATTCAACGTATTTGAGCCTCTTTCCATCTCTTTCTGTATACTTTTTTAGGATCTGTTTGGATGT TACTTGCTTTTATTACTATTTATTTTGTTACAGGTACTACTAATTGGATTCTGTTGTGAGATATCTCTCT CGATTTAGATCTTCAAAAGGTTTTATGGATTGCTATTTTCTTTGCTTTGGCTGTGAAAACACCTTTGGTG CCCTTGCATCTTTGGTTGCCTTTGGCACATGCAGAAAGTCCTTTGGGAGGTAGTGTTGTTCTTGCGGGTA TTGTTTTGAAATTGTCGTTATATGGTGTTCTGTGAATTCTGTTACCTATCTTGCCAGAAGCTTCGATTTA TTTCACTCCTTTGGTCTATACTGTCTGTGTTATAACTATTATTTATTCTAGCTTGACCACTCTTAGACAA TTCGATCTAAAAGTTATTATTGCTTATTCTTCTATTGGACATATGGCTTTGGCTCTAATGGGGGCTTTCT CTAATACTTTTCTGGGGTTGTCTGGTGCTGTGCTTTTAGCTGTGGCTCATGGTTTAGTTAGTCCTGCTTT GTTTATTTGTGTTGGTGGTATTCTTTATGATTGAACACATACTCGTATTCTGAATTATTATTGAGGTTTA GCTTCATATATGCCTGTCTTTTCTGTTTTCTTTCTCTTTTTCTCTCTCTGTAATATAGCTGTTCCTCTGT CTGCCAATTTTCTTGGGGAATTCTTAGTTCTGTCGGGGGCTTTCCAATGATTGCCTCTCTTGACCGCTGG GGCTTGTTTAAGTATTCTTCTTGCTGCGGCTTATGGTGTCTGGTTGTATATTCGTATTGTTGCAGGGTCTTATTCGCCTTATCTAGATGTTCTTAAGGATATCTCCCAATGAGAATTCTCTCTGCTGTTGCCTCTAGTGG GATTAACTGTTCTGTTGGGTCTTAAACCTGGATGGATTCTTTGTGGTTTGTATACTTGTCTGACTGCTCT TCTGTATTAA

[0096] Nad2 >1X499143.1 :25915-27309 Pneumocystis jirovecii mitochondrion, complete genome (SEQ ID NO: 22)ATGTTAGTTATTGGTATACTTTCTCAATTGATTGTTACATGTTTGAAACCTGGAAGTTGGAATTCTGTAT TATTAAGTTGAATGGGTATGATGTGTTTAATTTATTCTGCTGTTCTGACTTATAATACTTATTATCCTGA TCTGTTGAATTCAGGATTGGGTTTGTATAATGGATTTTATAAAGTGACTACTGTGACTCAATGGATGGAT ATTTTAGTTTGTCTGTTGGGTATGTTGATTCTGGGATTAACTGGTTTTTGTTGTTCTAAAACTGATAATC TTGTTCAAAAACATTATCTGGAATATCCAGCTATCGGTTCGTTTGCTATTGTGGGTATTCAATTGTTAAT GGGTTCTCTTCATATGATCTCCCTCTTCCTAGCTGTCGAATTGCAAAGTTTCTCTCTCTATATTCTTTCC TCTCTGTATTCTTCAAAATTTGGATTAAAGTATTTTTTATTAGGTGCTTTGTCGTCTTGTTTTATTTTGT TGGGTATAGCTTTATTGTATTCTTATACTGGTATTCTGTCTTTAGATTCTCTTTATGTTTTCTATAATCAATGTCCTAATTCTCTTTATTTAGATGTTGCTATATTGATTTTATTATCTGGATTCTTATTTAAAATTGCT GTGTTTCCTTTTCATCAATGGGCTGTAGATATTTATGATGGAGTTCCAACTCTGATTACTACTTGGTTAT CCACTTTAACTAAAATTTCTATTCTGTGGGTTATATTTGATTTTGTTAGTCATTGTTGGGGTAGTTGGAC ATCGATTTTAGTTTTATTATCCTTTTTATCTATTGTTTTTGGTTCTATCTTAGGTTTAGCTCAAGTTTGA TTGAAATGATTATTTGTTTATAGTATGATTTGTCATGTCGGATTTTTACTTCTGGCTTTGTCTTTGAATACTTTTTGGTCTGTT^TGCTTTTGTTTTCTATCTTGTTC^TATAGTTTGACTAATTTAAATCTCTTTTTTATTCTTATTGCTATGGGATATTATTTGAAATCTCCTGATTCTAAAGATTCTTCTGTTGTTTTTATTAGT TCTTTAAAAGGATTCTTTAAGATTAATCCATGGTTAGCTGTCTGTTTTGCTGTCTCCTTGCTGTCTTTGG GTGGTATCCCACCTTTTATTGGTTTCTTTGCTAAATTCTATGTTCTTCATGCTGCTTTGGTGGAAGGTTA TTTATTTGTGGTAGTAGGAGCTTTAATTTGTAGTGTTGTTAGTCTTTGTTATTATCTAAAGATTATTAAA TCGGTTTTCTTTGATTCTTCCGATTTCTATTCTTTGGGTTCTGTGAAATTATCTGGTTATTCTATTTCTG TTATTTCTTTTTTAACGTGTGTAATTTCTTTATTTATTCTTTATCCTAATTCTTTATTTCTTTAA

[0097] Cox2 >1X499143.1 :27781-28533 Pneumocystis jirovecii mitochondrion, complete genome (SEQ ID NO: 23)ATGTCAGTGTTCTGTTTTATTTTTAATCATCCTATTTGTTGTGATGCTCCAAGTCCTTGGGGAGTGTATT TCCAAGATGGTGCCAGTCCTGTTTTTGATGGTATTGTAGAATTACATGATCAAGTTCTTTTCTATTTAGT TATTATTCTTGTTGGTGTTTTCTGGATTTTATTCTCGACTATCTGGAGATTTAAATCTTCTTCTTTTGTT CATAAATATTATAATCATAGTACGGCTATTGAATTGATTTGGACGATGAGTCCAGCTCTTATTCTAGTTG CTATTGCTTTCCCAAGTTTTAAATTATTATATTTAATGGATGAAGTTATTGATCCTGCTATTACTGTTAA AGCTATTGGACATCAATGGTTCTGGTCCTATGAATATTCAGATTTTGAGGATTCGATCGGACATGCGATC GAAT T T GAT T C C T AT AT GAT AC C T AC AGAG GAT T T AGAAAT AG GAC AAT T GAGAC AAT T AGAAGT T GAT AATTGAGTTCTTCTGCCTGTAAATACTCATGTGAGATTTATTGTTACTTCTGCAGATGTTATTCATGATCT TGCTGTTCCAGCTTTAGGTCTTAAAGTGGATGCCAATCCTGGTTGATTAAATCAAACTTCCACTCTGATT CTTTGAGAAGGAGTTTATTATGGACAATGTAGTGAATTGTGTGGTGTTCTCCATAGTAGTATGCCTATTG TTATTGAAGCTGTGTCTGTTGATAAATTCTTGGATTGGTTGGATTGTCAGTAG

[0098] Nadi >1X499143.1 :29671-30672 Pneumocystis jirovecii mitochondrion, complete genome (SEQ ID NO: 24)ATGTTAAATTGTATTCAAGTGGGTATTGTTTTATTACCTGTTTTGTTAAGTGTAGCTTTTGTGACATTAG CTGAACGTAAAGTTATGGGATCGATTCAACGACGTGTGGGTCCTAATGTTGTGGGTTATTATGGTTTGTT ACAACCTGTAGCTGATGCTTTAAAATTATTATTAAAAGAAACTATTATTCCTATCCATTCGAATAAAGTG TTGTTCTTCTTAGGACCTTCTATTGCATTAGTCTTTGCTTTAATGGGTTGGGGTATTATTCCATGGAATT CAGGTATAACACTTTGGGATTTTGATTTAGGTATTTTATTTAGTTTAGCTATTTCTTCTTTAGGTGTGTA TGGTATTTTAATTGGGGGTTGGGCTTCTAATTCCAAATATGCTTTATTAGGTTCCTTGTGAAGTACTGCT CAATTAATTAGTTATGAATTAGTTTTAACTTCGATTGTTTTTGTTGTTGTTCTTTTATCTGGTTCTTTTAATTTTACTCACATTATTGAAGAACAAAAAGCTATTTGGTTTGTTTTGCCTTTATTTCCTCTGTTTATTTT GTTCTTTATTGGTGCTTTAGCAGAAACGAATTGAGCTCCTTTTGATTTGCCAGAAGCTGAATCCGAATTA GTTGCTGGGTTTATGACTGAGTATTCTGCTGCGATCTTTGTTTTCTTCTTCCTAGCTGAATATGCTAATA TTATTCTTATCTCTACTCTAGCTGCTATTTTCTTCTTAGGAGGTTATTTATTACCTTTCGAGTTGCATTT CTTGCCTAATGGTTTAGATGTTCTCGTTCAGGGATTACTTTCTGGTTTGATTTTAGGTTTGAAAGTTGCT GGGATTATTTTCCTCTTTGTTTGGGTTTGATCTAGCTTCCCTAGAATTTGATATGATCAATTGTTAGTTC TATGTTGGACTGTTCTGTTACCTTTGCTTTTTGCTTGGATTTTTCTGGTTTTAGCTATTCTTTTTTCTTT TAATTCTTTTATTCATTTCTAG

[0099] Real-time PCR. For real-time detection, primers and / or probes may be detectably labeled to allow differences in fluorescence when the primers become incorporated or when the probes are hybridized, for example, and amplified in an instrument capable of monitoring the change in fluorescence during the reaction. Real-time detection methods for nucleic acid amplification are well known and include, for example, the TaqMan® system, Scorpion™ primer system and use of intercalating dyes for double-stranded nucleic acid.

[0100] In real-time quantitative PCR, the accumulation of amplification product is measured continuously in both standard dilutions of target DNA and samples containing unknown amounts of target DNA. A standard curve is constructed by correlating initial template concentration in the standard samples with the number of PCR™ cycles (Ct) necessary to produce a specific threshold concentration of product. In the test samples, target PCR™ product accumulation is measured after the same Ct, which allows interpolation of target DNA concentration from the standard curve.

[0101] In some embodiments, amplified nucleic acids are detected by hybridization with a specific probe. Probe oligonucleotides, complementary to a portion of the amplified target sequence may be used to detect amplified fragments. In some embodiments, hybridization may be detected in real time. In an alternate embodiment, hybridization is not detected in real time. Amplified nucleic acids for each of the target sequences may be detected simultaneously (z.e., in the same reaction vessel such as multiplex PCR) or individually (z.e., in separate reaction vessels). In certain embodiments, multiple target nucleic acids are detected simultaneously, using two or more distinguishably-labeled (e.g., via different detectable moieties such as color), gene-specific oligonucleotide probes, one which hybridizes to the first target sequence and the other which hybridizes to the second target sequence.

[0102] In some embodiments, the different primer pairs are labeled with different distinguishable detectable moieties. Thus, for example, HEX and FAM fluorescent dyes may be present on different primer pairs in the multiplex PCR and associated with the resulting amplicons. In other embodiments, the forward primer is labeled with one detectable moiety, while the reverse primer is labeled with a different detectable moiety, e.g. FAM dye for a forward primer and HEXdye for a reverse primer. Use of different detectable moieties is useful for discriminating between amplified products which are of the same length or are very similar in length.

[0103] For sequence-modified nucleic acids, the target may be independently selected from the top strand or the bottom strand. Thus, all targets to be detected may comprise top strand, bottom strand, or a combination of top strand and bottom strand targets.

[0104] One general method for real-time PCR uses fluorescent probes such as the TaqMan® probes, molecular beacons, and Scorpion primer-probes. Real-time PCR quantifies the initial amount of the template with more specificity, sensitivity and reproducibility, than other forms of quantitative PCR, which detect the amount of final amplified product. Real-time PCR does not detect the size of the amplicon. The probes employed in Scorpion™ and TaqMan® technologies are based on the principle of fluorescence quenching and involve a donor fluorophore and a quenching moiety.

[0105] Real-time PCR is performed using any suitable instrument capable of detecting the accumulation of the PCR amplification product. Most commonly, the instrument is capable of detecting fluorescence from one or more fluorescent labels. For example, real-time detection on the instrument (e.g., an ABI Real-Time PCR System 7500® sequence detector) monitors fluorescence and calculates the measure of reporter signal, or Rn value, during each PCR cycle. The threshold cycle, or Ct value, is the cycle at which fluorescence intersects the threshold value. The threshold value can be determined by the sequence detection system software or manually.

[0106] In some embodiments, the probes employed are detectably labeled and the detecting is accomplished by detecting the probe label for each amplification product. A quencher may further be associated with the detectable label which prevents detection of the label prior to amplification of the probe's target. TaqMan® probes are examples of such probes.

[0107] TaqMan® probes (Heid et al., Genome Res. 6: 986-994, 1996) use the fhiorogenic 5' exonuclease activity of Taq polymerase to measure the amount of target sequences in DNA samples. TaqMan® probes are oligonucleotides that contain a donor fluorophore usually at or near the 5' base, and a quenching moiety typically at or near the 3' base. The quencher moiety may be a dye such as TAMRA or may be a non- fluorescent molecule such as 4-(4 - dimethylaminophenylazo) benzoic acid (DABCYL). See Tyagi et al., 16 Nature Biotechnology 49-53 (1998). When irradiated, the excited fluorescent donor transfers energy to the nearbyquenching moiety by FRET rather than fluorescing. Thus, the close proximity of the donor and quencher prevents emission of donor fluorescence while the probe is intact.

[0108] TaqMan® probes are designed to anneal to an internal region of a PCR product. When the polymerase replicates a template on which a TaqMan® probe is bound, its 5' exonuclease activity cleaves the probe. This terminates the activity of the quencher (no FRET) and the donor fluorophore starts to emit fluorescence which increases in each cycle proportional to the rate of probe cleavage. Accumulation of PCR product is detected by monitoring the increase in fluorescence of the reporter dye. If the quencher is an acceptor fluorophore, then accumulation of PCR product can be detected by monitoring the decrease in fluorescence of the acceptor fluorophore.

[0109] In certain embodiments, real-time PCR is performed using a bifunctional primer-probe detection system (e.g., Scorpion™ primers). With Scorpion primers, sequence-specific priming and PCR product detection is achieved using a single molecule. The Scorpion primer maintains a stem-loop configuration in the unhybridized state. The fluorophore is attached to the 5' end and is quenched by a moiety coupled to the 3' end, although in certain embodiments, this arrangement may be switched. The 3' portion of the stem and / or loop also contains sequence that is complementary to the extension product of the primer and is linked to the 5' end of a specific primer via a non-amplifiable monomer. After extension of the primer moiety, the specific probe sequence is able to bind to its complement within the extended amplicon, thus opening up the hairpin loop. This prevents the fluorescence from being quenched and a signal is observed. A specific target is amplified by the reverse primer and the primer portion of the Scorpion™ primer, resulting in an extension product. A fluorescent signal is generated due to the separation of the fluorophore from the quencher resulting from the binding of the probe element of the Scorpion™ primer to the extension product.

[0110] In some embodiments, the probes employed in the disclosed methods comprise or consist of short fluorescently labeled DNA sequences designed to detect sections of DNA sequence with a genetic variation such as those disclosed in French et al., Mol Cell Probes, 5(6):363-74 (2001), incorporated by reference herein in its entirety. HyBeacons® are an example of this type of probe.

[0111] In some embodiments of the method, at least one primer of each primer pair or at least one probe in the amplification reaction comprises a detectable moiety. Alternatively, thedetectable moiety may be on a probe that is attached to the primer, such as with a primer-probe. In some embodiments, the detectable moiety or label is a fluorophore. Suitable fluorescent moieties include, but are not limited to the following fluorophores: 4-acetamido-4'- isothiocyanatostilbene-2,2'disulfonic acid, acridine and derivatives (acridine, acridine isothiocyanate), Alexa Fluors (Alexa Fluor® 350, Alexa Fluor® 488, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 647 (Molecular Probes)), 5-(2'- aminoethyl)aminonaphthalene-l -sulfonic acid (EDANS), 4-amino-N-[3- vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate (Lucifer Yellow VS), N-(4-anilino-l- naphthyl)maleimide, anthranilamide, BODIPY® R-6G, BOPIPY® 530 / 550, BODIPY® FL, Brilliant Yellow, Cal Fluor Red 610® (CFR610), coumarin and derivatives (coumarin, 7-amino- 4-methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcouluarin (Coumarin 151)), Cy2®, Cy3®, Cy3.5®, Cy5®, Cy5.5®, cyanosine, 4',6-diaminidino-2-phenylindole (DAPI), 5', 5"-dibromopyrogallol-sulfonephthalein (Bromopyrogallol Red), 7-diethylamino-3-(4'- isothiocyanatophenyl)-4-methylcoumarin, diethylenetriamine pentaacetate, 4,4'- diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid, 4,4'-diisothiocyanatostilbene-2,2'- disulfonic acid, 5-[dimethylamino]naphthalene-l-sulfonyl chloride (DNS, dansyl chloride), 4-(4'- dimethylaminophenylazo)benzoic acid (DABCYL), 4-dimethylaminophenylazophenyl-4'- isothiocyanate (DABITC), EclipseTM (Epoch Biosciences Inc.), eosin and derivatives (eosin, eosin isothiocyanate), erythrosin and derivatives (erythrosin B, erythrosin isothiocyanate), ethidium, fluorescein and derivatives (5-carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2- yl)aminofluorescein (DTAF), 2',7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), hexachloro-6-carboxyfluorescein (HEX), QFITC (XRITC), tetrachlorofluorescein (TET), fluorescamine, IR144, IR1446, lanthamide phosphors, Malachite Green isothiocyanate, 4-methylumbelliferone, ortho cresolphthalein, nitrotyrosine, pararosaniline, Phenol Red, B -phycoerythrin, R-phycoerythrin, allophycocyanin, o- phthaldialdehyde, Oregon Green®, propidium iodide, pyrene and derivatives (pyrene, pyrene butyrate, succinimidyl 1-pyrene butyrate), QSY® 7, QSY® 9, QSY® 21, QSY® 35 (Molecular Probes), Reactive Red 4 (Cibacron® Brilliant Red 3B-A), rhodamine and derivatives (6-carboxy- X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine green, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101, sulfonyl chloride derivative of sulforhodamine 101 (Texas Red), N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), tetramethyl rhodamine,tetramethyl rhodamine isothiocyanate (TRITC), riboflavin, rosolic acid, terbium chelate derivatives, Quasar 670®, and VIC®.

[0112] Suitable quenchers are selected based on the fluorescence spectrum of the particular fluorophore. Useful quenchers include, for example, the Black Hole™ quenchers BHQ-1, BHQ 2, and BHQ-3 (Biosearch Technologies, Inc.), and the ATTO-series of quenchers (ATTO 540Q, ATTO 580Q, and ATTO 612Q; Atto-Tec GmbH).

[0113] Alternate Methods of Detecting Target Nucleic Acids. In some embodiments, detection can occur through any of a variety of mobility dependent analytical techniques based on the differential rates of migration between different nucleic acid sequences. Exemplary mobility- dependent analysis techniques include electrophoresis, chromatography, mass spectroscopy, sedimentation, gradient centrifugation, field-flow fractionation, multi-stage extraction techniques, and the like. In some embodiments, mobility probes can be hybridized to amplification products, and the identity of the target nucleic acid sequence determined via a mobility dependent analysis technique of the eluted mobility probes, as described in Published PCT Applications WO04 / 46344 and WOO 1 / 92579. In some embodiments, detection can be achieved by various microarrays and related software such as the Applied Biosystems Array System with the Applied Biosystems 1700 Chemiluminescent Microarray Analyzer and other commercially available array systems available from Affymetrix, Agilent, Illumina, and Amersham Biosciences, among others (see also Gerry et al., J. Mol. Biol. 292:251-62, 1999; De Bellis et al., Minerva Biotec 14:247-52, 2002; and Stears et al., Nat. Med. 9: 14045, including supplements, 2003).

[0114] It is also understood that detection can comprise reporter groups that are incorporated into the reaction products, either as part of labeled primers or due to the incorporation of labeled dNTPs during an amplification, or attached to reaction products, for example but not limited to, via hybridization tag complements comprising reporter groups or via linker arms that are integral or attached to reaction products. In some embodiments, unlabeled reaction products may be detected using mass spectrometry. sgRNAs of the Present Technology

[0115] The present disclosure also provides a synthetic guide RNA (sgRNA) comprising a nucleic acid sequence that is complementary to and specifically hybridizes with a portion of any one of SEQ ID NOs: 15-24. An sgRNA oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. Guide RNAs for use in CRISPR-Cas systems aretypically generated as a single guide RNA comprising a crRNA segment and a tracrRNA segment. The crRNA segment and a tracrRNA segment can also be generated as separate RNA molecules. The crRNA segment comprises the targeting sequence that binds to a portion of any one of SEQ ID NOs: 15-24, and a stem portion that hybridizes to a tracrRNA. The tracrRNA segment comprises a nucleotide sequence that is partially or completely complementary to the stem sequence of the crRNA and a nucleotide sequence that binds to the CRISPR enzyme. In some embodiments, the crRNA segment and the tracrRNA segment are provided as a single guide RNA. In some embodiments, the crRNA segment and the tracrRNA segment are provided as separate RNAs. The combination of the CRISPR enzyme with the crRNA and tracrRNA make up a functional CRISPR-Cas system. Exemplary CRISPR-Cas systems for targeting nucleic acids, are described, for example, in WO2015 / 089465.

[0116] In some embodiments, a synthetic guide RNA is a single RNA represented as comprising the following elements:5'-Xl-X2-Y-Z-3' where XI and X2 represent the crRNA segment, where XI is the targeting sequence that binds to a portion of any one of SEQ ID NOs: 15-24, X2 is a stem sequence the hybridizes to a tracrRNA, Z represents a tracrRNA segment comprising a nucleotide sequence that is partially or completely complementary to X2, and Y represents a linker sequence. In some embodiments, the linker sequence comprises two or more nucleotides and links the crRNA and tracrRNA segments. In some embodiments, the linker sequence comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides. In some embodiments, the linker is the loop of the hairpin structure formed when the stem sequence hybridized with the tracrRNA.

[0117] In some embodiments, a synthetic guide RNA is provided as two separate RNAs where one RNA represents a crRNA segment: 5'-Xl-X2-3' where XI is the targeting sequence that binds to a portion of any one of SEQ ID NOs: 15-24, X2 is a stem sequence the hybridizes to a tracrRNA, and one RNA represents a tracrRNA segment, Z, that is a separate RNA from the crRNA segment and comprises a nucleotide sequence that is partially or completely complementary to X2 of the crRNA.

[0118] Exemplary crRNA stem sequences and tracrRNA sequences are provided, for example, in WO / 2015 / 089465, which is incorporated by reference herein. In general, a stem sequence includes any sequence that has sufficient complementarity with a complementary sequence in the tracrRNA to promote formation of a CRISPR complex at a target sequence, wherein the CRISPRcomplex comprises the stem sequence hybridized to the tracrRNA. In general, degree of complementarity is with reference to the optimal alignment of the stem and complementary sequence in the tracrRNA, along the length of the shorter of the two sequences. Optimal alignment may be determined by any suitable alignment algorithm, and may further account for secondary structures, such as self-complementarity within either the stem sequence or the complementary sequence in the tracrRNA. In some embodiments, the degree of complementarity between the stem sequence and the complementary sequence in the tracrRNA along the length of the shorter of the two when optimally aligned is about or more than about 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher. In some embodiments, the stem sequence is about or more than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, or more nucleotides in length. In some embodiments, the stem sequence and complementary sequence in the tracrRNA are contained within a single RNA, such that hybridization between the two produces a transcript having a secondary structure, such as a hairpin. In some embodiments, the tracrRNA has additional complementary sequences that form hairpins. In some embodiments, the tracrRNA has at least two or more hairpins. In some embodiments, the tracrRNA has two, three, four or five hairpins. In some embodiments, the tracrRNA has at most five hairpins.

[0119] In a hairpin structure, the portion of the sequence 5' of the final “N” and upstream of the loop corresponds to the crRNA stem sequence, and the portion of the sequence 3' of the loop corresponds to the tracrRNA sequence. Further non-limiting examples of single polynucleotides comprising a guide sequence, a stem sequence, and a tracr sequence are as follows (listed 5' to 3'), where “N” represents a base of a guide sequence (e.g. a modified oligonucleotide provided herein), the first block of lower case letters represent stem sequence, and the second block of lower case letters represent the tracrRNA sequence, and the final poly-T sequence represents the transcription terminator: (a)NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaagatttaGAAAtaaatcttgcagaagctacaaagataa ggcttcatgccgaaatcaacaccctgtcattttatggcagggtgttttcgttatttaaTTTTTT (SEQ ID NO: 25); (b) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagctacaaagataaggcttcatgccg aaatcaacaccctgtcattttatggcagggtgttttcgttatttaaTTTTTT (SEQ ID NO: 26); (c)NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagctacaaagataaggcttcatgccg aaatcaacaccctgtcattttatggcagggtgtTTTTTT (SEQ ID NO: 27); (d)NNNNNNNNNNNNNNNNNNNNgttttagagctaGAAAtagcaagttaaaataaggctagtccgttatcaactt gaaaaagtggcaccgagtcggtgcTTTTTT (SEQ ID NO: 28); (e)NNNNNNNNNNNNNNNNNNNNgttttagagctaGAAATAGcaagttaaaataaggctagtccgttatcaac ttgaaaaagtgTTTTTTT (SEQ ID NO: 29); and (f)NNNNNNNNNNNNNNNNNNNNgttttagagctagAAATAGcaagttaaaataaggctagtccgttatcaTT TTTTTT (SEQ ID NO: 30)

[0120] Selection of suitable oligonucleotides for use in as a targeting sequence in a CRISPR Cas system depends on several factors including the particular CRISPR enzyme to be used and the presence of corresponding proto-spacer adjacent motifs (PAMs) downstream of the target sequence in the target nucleic acid. The PAM sequences direct the cleavage of the target nucleic acid by the CRISPR enzyme. For example, a suitable PAM is 5'- TTTV -3’ (where V is A, C, or G) for Cas12a enzymes (or derived enzymes), respectively. Generally the PAM sequences should be present between about 18-23 bases nucleotides of the target sequence to generate efficient cleavage of the target nucleic acid. Thus, when the guide RNA forms a complex with the CRISPR enzyme, the complex locates the target and PAM sequence, unwinds the DNA duplex, and the guide RNA anneals to the complementary sequence on the opposite strand. This enables the Cas12 nuclease to create a double-strand break. In some embodiments, the sgRNA comprises the nucleic acid sequence of UAAUUUCUACUAAGUGUAGAUUCUAAUACUUUUCUGGGGUUG (SEQ ID NO: 31).

[0121] A variety of CRISPR enzymes are available for use in conjunction with the disclosed guide RNAs of the present disclosure. In some embodiments, the CRISPR enzyme is a Type II CRISPR enzyme. In some embodiments, the CRISPR enzyme catalyzes DN A cleavage. In some embodiments, the CRISPR enzyme catalyzes RNA cleavage. In some embodiments, the CRISPR enzyme is any Cas12 protein, for instance any naturally-occurring bacterial Cas12 as weH as any chimeras, mutants, homologs or orthologs. Non-limiting examples of Cas proteins include Cas12a, Cas12b, Casl3, Cast, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, CasS, Cas9 (also known as Csn1 and Csx12), Cas 10, Csy 1, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl , Cmr3, Cmr4, Cmr5, Cmr6, Csbl , Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologues thereof, or modified variants thereof. In some embodiments, the CRISPR enzyme cleaves both strands of the target nucleic acid at the Protospacer Adjacent Motif (PAM) site. In some embodiments, the CRISPR enzyme is a nickase, which cleaves only one strand of die target nucleic acid.Diagnostic Methods of the Present Technology

[0122] In one aspect, the present disclosure provides a method for detecting the presence of pathogenic Pneumocystis jirovecii in a subject comprising: (a) extracting ribonucleic acids from a biological sample obtained from the subject; (b) reverse transcribing the extracted ribonucleic acids to generate a plurality of cDNA:RNA hybridization complexes; (c) contacting the cDNA:RNA hybridization complexes with at least one primer pair that amplifies target nucleic acids in one or more P. jirovecii mitochondrial genes to produce a reach on- sample mixture; (d) subjecting the reaction-sample mixture to real-time PCR conditions under which each of the target nucleic acids present in the biological sample is amplified to produce a fluorescent signal; (e) detecting the fluorescent signal generated by each of the amplified target nucleic acids produced in step (d); and (f) detecting the presence of pathogenic P. jirovecii in the biological sample when the fluorescent signal is detected for the amplified target nucleic acids. In certain embodiments, the one or more / < jirovecii mitochondrial genes are selected from the group consisting of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi.

[0123] Additionally or alternatively, in some embodiments, the at least one primer pair is capable of specifically amplifying a P. jirovecii nucleic acid comprising a sequence that is at least 85-95% identical to any one of SEQ ID NOs: 15-24. In some embodiments, the at least one primer pair consists of: (i) a forward primer comprising the sequence of SEQ ID NO: 9 and a reverse primer comprising the sequence of SEQ ID NO: 10, or (ii) a forward primer comprising the sequence of SEQ ID NO: 12 and a reverse primer comprising the sequence of SEQ ID NO: 13, or (iii) a forward primer comprising the sequence of SEQ ID NO: 5 and a reverse primer comprising the sequence of SEQ ID NO: 6.

[0124] In any of the preceding embodiments of the methods disclosed herein, the reaction- sample mixture further comprises one or more nucleic acid probes that specifically hybridize to a region of one or more of the genes selected from the group consisting of Orfl95, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi, wherein the one or more nucleic acid probes are detectably labeled. In some embodiments, the reach on- sample mixture comprises a single nucleic acid probe that specifically hybridizes to a region of a single gene selected from the group consisting of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi. In certain embodiments, the reaction-sample mixture comprises multiple nucleic acid probes that specifically hybridize to one or more regions of a single gene selected from the group consisting of Orfl95, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi. In other embodiments, the reaction-sample mixture comprises multiple nucleic acid probes comprising a single nucleic acid probe that specifically hybridizes to a region of a single gene for each of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi. In some embodiments, the reach on- sample mixture comprises multiple nucleic acid probes comprising more than one nucleic acid probe that hybridizes to one or more regions for each of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi. Additionally or alternatively, in some embodiments, the reaction-sample mixture further comprises at least one nucleic acid probe that is capable of specifically hybridizing to a segment of the nucleic acid sequence of any one of SEQ ID NOs: 15-24 or a complement thereof. In certain embodiments, the at least one nucleic acid probe comprises the sequence of SEQ ID NO: 11 or SEQ ID NO: 14.

[0125] In another aspect, the present disclosure provides a method for detecting the presence of pathogenic Pneumocystis jirovecii in a subject comprising: (a) extracting ribonucleic acids from a biological sample obtained from the subject; (b) reverse transcribing the extracted ribonucleic acids to generate a plurality of cDNA:RNA hybridization complexes; (c) amplifying the cDNA:RNA hybridization complexes with at least one primer pair that amplifies target nucleic acids in one or more P. jirovecii mitochondrial genes to produce a plurality of amplicons; (d) contacting the plurality of amplicons with a mixture comprising (i) a CRISPR enzyme, (ii) single- stranded nucleic acid probes comprising a donor fluorophore and a quencher moiety, and (iii) at least one sgRNA that is capable of specifically hybridizing to at least one amplicon in the plurality of amplicons to form a reaction mixture; (e) subjecting the reaction mixture to conditions under which a plurality of CRISPR: sgRNA complexes are formed and the single-stranded nucleic acid probes are cleaved by the plurality of CRISPR: sgRNA complexes to produce a fluorescent signal, wherein each CRISPR: sgRNA complex comprises the CRISPR enzyme and at least one sgRNA hybridized to at least one amplicon; (f) detecting the fluorescent signal generated by each single- stranded nucleic acid probe cleaved by the plurality of CRISPR: sgRNA complexes produced in step (e); and (g) detecting the presence of pathogenic P. jirovecii in the biological sample when the fluorescent signal is detected for the cleaved single-stranded nucleic acid probe. Additionally or alternatively, in certain embodiments, the cDNA:RNA hybridization complexes are amplified using polymerase chain reaction (PCR) amplification or isothermal amplification. The one or more P. jirovecii mitochondrial genes may be selected from the group consisting of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi.

[0126] Additionally or alternatively, in some embodiments, steps (c)-(e) are performed in a single reaction chamber. In further embodiments, steps (c)-(e) are performed are performed sequentially or simultaneously. In other embodiments, step (c) and steps (d)-(e) are performed in separate reaction chambers.

[0127] In some embodiments, the CRISPR enzyme is Cas12a or Cas12b and the single-stranded nucleic acid probe is a single-stranded DNA probe. In certain embodiments, the CRISPR enzyme is Cast 3 and the single-stranded nucleic acid probe is a single-stranded RNA probe. Additionally or alternatively, in some embodiments, the single-stranded nucleic acid probe is about 15 to about 35 nucleotides in length. In certain embodiments, the single-stranded nucleic acid probe is about 15, about 16, about 17, about 18, about 19, abou120, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, or about 35 nucleotides in length.

[0128] Additionally or alternatively, in some embodiments, the at least one primer pair is capable of specifically amplifying aP.jirovecii nucleic acid comprising a sequence that is at least 85-95% identical to any one of SEQ ID NOs: 15-24. In some embodiments, the at least one primer pair consists of: (i) a forward primer comprising the sequence of SEQ ID NO: 9 and a reverse primer comprising the sequence of SEQ ID NO: 10, or (ii) a forward primer comprising the sequence of SEQ ID NO: 12 and a reverse primer comprising the sequence of SEQ ID NO: 13, or (iii) a forward primer comprising the sequence of SEQ ID NO: 5 and a reverse primer comprising the sequence of SEQ ID NO: 6.

[0129] In any and all embodiments of the methods disclosed herein, the biological sample is whole blood, serum, plasma, bronchioalveolar lavage fluid, a throat swab, or a nasopharyngeal (NP) aspirate or wash. In any of the preceding embodiments of the methods disclosed herein, the subject is a pediatric patient, a geriatric patient, an adult patient, or an immunocompromised patient.

[0130] In any and all embodiments of the methods disclosed herein, the methods of the present technology further comprise administering to the subject an effective amount of an anti-fungal agent. Examples of anti-fungal agents include, but are not limited to, one or more of trimethoprim, sulfamethoxazole, pentamidine, dapsone, pyrimethamine, atovaquone, clindamycin, or primaquine.Kits of the Present Technology

[0131] The present disclosure also provides kits for detecting target nucleic acid sequences corresponding to pathogenic PJP species in a biological sample obtained from a subject. The biological sample may comprise whole blood, serum, plasma, bronchioalveolar lavage fluid, a throat swab, or a nasopharyngeal (NP) aspirate or wash.

[0132] Kits of the present technology comprise at least two oligonucleotides which may serve as primers or probes for amplifying one or more P. jirovecii mitochondrial genes selected from among Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi to determine the presence of active PJP infection.

[0133] In some embodiments, the kits of the present technology comprise a single primer pair that specifically amplifies a target nucleic acid sequence of a P. jirovecii mitochondrial gene selected from among Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi. In other embodiments, the kits of the present technology comprise multiple primer pairs comprising primer pairs that specifically amplify target nucleic acids for at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or 10 P. jirovecii mitochondrial genes selected from among Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi.

[0134] In some embodiments, the kits of the present technology comprise a primer pair that is capable of specifically amplifying an Orf 195 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 15, or a complement thereof. Additionally or alternatively, the kits comprise a primer pair that is capable of specifically amplifying a Coxl nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 16, or a complement thereof. Additionally or alternatively, the kits comprise a primer pair that is capable of specifically amplifying an Atp6 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 17, or a complement thereof. Additionally or alternatively, the kits comprise a primer pair that is capable of specifically amplifying a Cox3 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 18, or a complement thereof. Additionally or alternatively, the kits comprise a primer pair that is capable of specifically amplifying an Atp9 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 19, or a complement thereof. Additionally or alternatively, the kits comprise a primer pair that is capable of specifically amplifying aNad5 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 20, or a complement thereof. Additionally or alternatively, the kits comprise a primer pair that is capable of specifically amplifying aNad4 nucleic acid comprising a sequence that is at least85-95% identical to SEQ ID NO: 21, or a complement thereof. Additionally or alternatively, the kits comprise a primer pair that is capable of specifically amplifying a Nad2 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 22, or a complement thereof. Additionally or alternatively, the kits comprise a primer pair that is capable of specifically amplifying a Cox2 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 23, or a complement thereof. Additionally or alternatively, the kits comprise a primer pair that is capable of specifically amplifying a. Nadi nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 24, or a complement thereof. In some embodiments, the kits comprise one or more primers selected from among SEQ ID NOs: 5-6, 9-10, or 12-13.

[0135] Additionally or alternatively, in some embodiments, the kits provide a single nucleic acid probe that specifically hybridizes to a target nucleic acid present in a P. jirovecii mitochondrial gene selected from among Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi. In other embodiments, the kits of the present technology comprise multiple nucleic acid probes comprising probes that specifically hybridize to target nucleic acids present in at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or 10 P. jirovecii mitochondrial genes selected from among Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi. In any of the preceding embodiments, the target-specific nucleic acid probes are detectably labeled with a fluorophore. In some embodiments, the kits comprise one or more nucleic acid probes selected from among SEQ ID NO: 11 or SEQ ID NO: 14.

[0136] Also disclosed herein are kits for detecting the presence of pathogenic Pneumocystis jirovecii in a biological sample comprising (i) a CRISPR enzyme, (ii) a single-stranded nucleic acid probe comprising a donor fluorophore and a quencher moiety, and (iii) at least one of: (a) a primer pair that amplifies a P. jirovecii Orf 195 target nucleic acid to generate Orf 195 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Orf 195 amplicons; (b) a primer pair that amplifies a P. jirovecii Coxl target nucleic acid to generate Coxl amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Coxl amplicons; (c) a primer pair that amplifies a P. jirovecii Atp6 target nucleic acid to generate Atp6 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Atp6 amplicons; (d) a primer pair that amplifies a P. jirovecii Cox3 target nucleic acid to generate Cox3 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Cox3 amplicons; (e) a primer pair that amplifies a P. jirovecii Atp9 target nucleic acid to generate Atp9 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Atp9 amplicons; (f) a primer pair thatamplifies an P. jirovecii Nad5 target nucleic acid to generate Nad5 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Nad5 amplicons; (g) a primer pair that amplifies a P. jirovecii Nad4 target nucleic acid to generate Nad4 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Nad4 amplicons; (h) a primer pair that amplifies a P. jirovecii Nad2 target nucleic acid to generate Nad2 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Nad2 amplicons; (i) a primer pair that amplifies a P. jirovecii Cox2 target nucleic acid to generate Cox2 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Cox2 amplicons; and / or (j) a primer pair that amplifies a P. jirovecii Nadi target nucleic acid to generate Nadi amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Nadi amplicons.

[0137] Additionally or alternatively, in some embodiments, the CRISPR enzyme is selected from the group consisting of Cas12a, Cas12b, Casl3, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csfl, Csf2, Csf3, and Csf4. The one or more CRISPR enzymes may be coupled to the sgRNA. In some embodiments, the CRISPR enzyme is configured to form complexes with sgRNAs that are hybridized to the amplicons and activate non-specific cleavage of the single-stranded nucleic acid probe comprising the donor fluorophore and the quencher moiety.

[0138] Additionally or alternatively, in some embodiments, the single-stranded nucleic acid probe is about 15 to about 35 nucleotides in length. In certain embodiments, the single-stranded nucleic acid probe is about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, or about 35 nucleotides in length. In some embodiments, the donor fluorophore of the single-stranded nucleic acid probe comprises 4-acetamido-4'- isothiocyanatostilbene-2,2'disulfonic acid, acridine and derivatives (acridine, acridine isothiocyanate), Alexa Fluors (Alexa Fluor® 350, Alexa Fluor® 488, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 647 (Molecular Probes)), 5-(2'- aminoethyl)aminonaphthalene-l -sulfonic acid (EDANS), 4-amino-N-[3- vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate (Lucifer Yellow VS), N-(4-anilino-l- naphthyl)maleimide, anthranilamide, BODIPY® R-6G, BOPIPY® 530 / 550, BODIPY® FL, Brilliant Yellow, Cal Fluor Red 610® (CFR610), coumarin and derivatives (coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcouluarin (Coumarin 151)), Cy2®, Cy3®, Cy3.5®, Cy5®, Cy5.5®, cyanosine, 4',6-diaminidino-2-phenylindole (DAPI), 5', 5"-dibromopyrogallol-sulfonephthalein (Bromopyrogallol Red), 7-diethylamino-3-(4'- isothiocyanatophenyl)-4-methylcoumarin, diethylenetriamine pentaacetate, 4,4'- diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid, 4,4'-diisothiocyanatostilbene-2,2'- disulfonic acid, 5-[dimethylamino]naphthalene-l-sulfonyl chloride (DNS, dansyl chloride), 4-(4'- dimethylaminophenylazo)benzoic acid (DABCYL), 4-dimethylaminophenylazophenyl-4'- isothiocyanate (DABITC), EclipseTM (Epoch Biosciences Inc.), eosin and derivatives (eosin, eosin isothiocyanate), erythrosin and derivatives (erythrosin B, erythrosin isothiocyanate), ethidium, fluorescein and derivatives (5-carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2- yl)aminofluorescein (DTAF), 2',7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), hexachloro-6-carboxyfluorescein (HEX), QFITC (XRITC), tetrachlorofluorescein (TET), fluorescamine, IR144, IR1446, lanthamide phosphors, Malachite Green isothiocyanate, 4-methylumbelliferone, ortho cresolphthalein, nitrotyrosine, pararosaniline, Phenol Red, B -phycoerythrin, R-phycoerythrin, allophycocyanin, o- phthaldialdehyde, Oregon Green®, propidium iodide, pyrene and derivatives (pyrene, pyrene butyrate, succinimidyl 1-pyrene butyrate), QSY® 7, QSY® 9, QSY® 21, QSY® 35 (Molecular Probes), Reactive Red 4 (Cibacron® Brilliant Red 3B-A), rhodamine and derivatives (6-carboxy- X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine green, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101, sulfonyl chloride derivative of sulforhodamine 101 (Texas Red), N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), tetramethyl rhodamine, tetramethyl rhodamine isothiocyanate (TRITC), riboflavin, rosolic acid, terbium chelate derivatives, Quasar 670®, or VIC®. Additionally or alternatively, in certain embodiments, the quencher moiety of the single-stranded nucleic acid probe comprises black hole quenchers (Biosearch), Iowa Black (IDT) quenchers, QSY quencher (Molecular Probes), or Dabsyl and Dabcel sulfonate / carboxylate Quenchers (Epoch).

[0139] In some embodiments, the single-stranded nucleic acid probe is a single-stranded DNA (ssDNA) probe and the CRISPR enzyme is Cas12. In other embodiments, the single-stranded nucleic acid probe is single-stranded RNA (ssRNA) probe and the CRISPR enzyme is Casl3.

[0140] In any and all embodiments of the kits disclosed herein, the kits further comprise buffers, reverse transcriptase enzymes, enzymes having polymerase activity, enzymes having polymeraseactivity and lacking 5'— >3’ exonuclease activity or both 5'— >3’ and 3’^-5' exonuclease activity, enzyme cofactors such as magnesium or manganese, salts, chain extension nucleotides such as deoxynucleoside triphosphates (dNTPs), modified dNTPs, nuclease-resistant dNTPs or labeled dNTPs, necessary to carry out an assay or reaction, such as amplification and / or detection of target nucleic acid sequences corresponding to pathogenic PJP species.

[0141] In one embodiment, the kits of the present technology further comprise a positive control nucleic acid sequence and a negative control nucleic acid sequence to ensure the integrity of the assay during experimental runs. The kit may also comprise instructions for use, software for automated analysis, containers, packages such as packaging intended for commercial sale and the like.

[0142] The kit may further comprise one or more of: wash buffers and / or reagents, hybridization buffers and / or reagents, labeling buffers and / or reagents, and detection means. The buffers and / or reagents are usually optimized for the particular amplification / detection technique for which the kit is intended. Protocols for using these buffers and reagents for performing different steps of the procedure may also be included in the kit.

[0143] The kit additionally may comprise an assay definition scan card and / or instructions such as printed or electronic instructions for using the oligonucleotides in an assay. Reagents included in the kit may be contained in one or more containers, such as a vial.

[0144] Primers, probes, and / or primer-probes specific for amplification and detection of DNA internal control may be included in the amplification master mix as the target primer pairs to monitor potential PCR inhibition. Reagents necessary for amplification and detection of targets and internal control may be formulated as an all-in-one amplification master mix, which may be provided as single reaction aliquots in a kit.EXAMPLES

[0145] The present technology is further illustrated by the following Examples, which should not be construed as limiting in any way.Example 1: Materials and Methods

[0146] Sex as a biological variable: Patient sexes used in this study are specified in FIGs. 14 and 15. Sex was not considered as a biological variable.

[0147] Mice: Female C57BL / 6J wild-type and Rag2- / -(B6(Cg)-Rag2tml. lCgn / J) mice aged 6- to 8-weeks were obtained from The Jackson Laboratory (Bar Harbor, ME) and housed in a pathogen-free environment at the Tulane University Department of Comparative Medicine.

[0148] Mouse P. murina infection procedure: All mice were infected with P. murina by oropharyngeal administration as previously published (28, 29, 63). Mice were lightly anesthetized with 2% isoflurane delivered in a box connected to the delivery machine and then fixed vertically on a surgery board, the tongue was extended with forceps, and a 100 μL inoculum containing 2x105P. murina cysts was administered to the distal part of the oropharynx using a micropipette while gently closing the nose. At 2-, 4-, and 6-weeks post-inoculation, mice were euthanized by carbon dioxide inhalation to collect BAL, sera, and lung tissue specimens.

[0149] RNA isolation: Mouse serum cell-free (cf) RNA was extracted using a Quick- cfDNA / cfRNA Serum & Plasma Kit (Zymo Research, R1072). RNA was extracted from all other samples analyzed using a Quick-RNA Fungal / Bacterial Miniprep Kit (Zymo Research, R2014). All RNA isolates were eluted in 50 μL of DNase / RNase-free water and stored at -80°C until analysis. Positive control and negative control samples were derived from samples from healthy mice or individuals that were then spiked with P. murina or P.jirovecii RNA or water, respectively.

[0150] RT-PCR CRISPR analyses: RT-PCR reactions were generated by adding 5 μL isolated RNA to a mixture containing 10 μL 2x Platinum SuperFi RT-PCR master Mix (Thermo Fisher, 12594025), 0.2 μL SuperScript IV RT Mix (Thermo Fisher, 12594025), 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, and 2.8 μL of nuclease free-water. For RT-PCR-CRISPR experiments, 5 μL isolated P. murina or P.jirovecii RNA was added as template and water was added for the no template controls. RT-PCR reaction was first incubated at 25 °C for 2 minutes and 55 °C for 10 minutes to permit cDNA synthesis, and then denatured at 95°C for 5 minutes, subjected to 38 cycles of PCR amplification [95°C for 10 seconds, 60°C for 10 seconds, and 72°C for 15 seconds], and then incubated at 72°C for 5 minutes to permit complete extension of all amplicons. CRISPR reaction mixtures containing: 25.48 μL nuclease-free water, 0.01 μL 66.7 μM IDT Lb Cas12a (Integrated DNA Technologies, 10007922) , 0.01 μL 100 μM gRNA, 1.5 μL of the 10 μM fluorescent reporter, and 3 μL NEBuffer 2.1 (New England Biolabs, B7202) were supplemented with a 2 μL aliquot the final RT-PCR reaction sample and incubated at 37 °C for 15 minutes in the dark in a 96 well corning half area opaque plate. CRISPR reactions analyzing P. murina and P.jirovecii RT-PCR reaction samples were respectively analyzed using a SpectraMax i3x Multi-Mode Microplate Reader (Molecular Devices) and an Infinite M Plex (Tecan) platereader, using 485 nM excitation and 525 nM emission settings. Thresholds for positive CRISPR signal in spiked samples and clinical samples were defined as the mean plus three times the SD of the signal detected in triplicate no-template control samples.

[0151] Standard curve and limit of detection (LoD) analyses: Serum samples used to generate the standard curves for the P. murina and P.jirovecii RT-PCR CRISPR assays were generated by spiking known concentrations of the appropriate P. murina or P.jirovecii synthetic gBlock target DNA sequence (Sp or Gscl and Nad4 or GscP) into healthy mouse serum or swab RNA isolation solution, respectively. These concentration standards were then subjected to 10- fold serial dilutions in serum or swab diluent to generate concentration standards that contained from 10-1 to 106 copies / μL of these target sequences. These concentration standards were then processed to isolate DNA that was analyzed in RT-PCR CRISPR assays for the appropriate target sequence.

[0152] RT-qPCR: RT-PCR reactions were performed with SuperScript IV First-Strand Synthesis System kits and random hexamers (Thermo Scientific) and the resulting cDNA was isolated using AMPure XP Beads (Beckman Coulter, A63880) and 80% ethanol before use in qPCR reactions employing 10 μL SsoAdvanced Universal Probes Supermix (2x) (Bio-Rad, 172- 5280), 0.9 μL forward primer (20 μM), 0.9 μL reverse primer (20 μM), 0.45 μL probe (20 μM), 5.75 μL nuclease-free water, and 2 μL cDNA template. Reactions were performed by incubating the reactions at 50°C for 2 minutes and 95°C for 10 minutes, and then using 50 cycles of 95°C for 15 seconds and 60 °C for 30 seconds for target amplification. Melt curve were performed from 55 to 95°C with 0.5 °C increments after reaction completion to confirm that the reaction amplified a single product with the expected melting temperature profile. Thresholds for positive RT-qPCR signal in spiked samples were defined as the mean plus three times the SD of the signal detected in triplicate no-template control samples. Thresholds for positive RT-qPCR signal in clinical samples were determined by receiver operating characteristic curve analyses.

[0153] Clinical sample collection procedures: Oropharyngeal swabs analyzed in this study were obtained from 107 children between 1-59 months FIG. 14; 54 Pjzroveczz-infected and 53 P.jzroveczz-non-infected. Pjzroveczz-infected cases enrolled in the PERCH cohort study were judged to be infected with P.jirovecii if their analyzed swab samples yielded greater than 104copies / mL of mtLSU DNA when analyzed using a quantitative multiplex polymerase chain reaction assay (FTD Resp-33 kit; Fast-track Diagnostics, Sliema, Malta). P.jzroveczz-non-infected controls were age-matched with cases and selected from communities near the study sites.Children were deemed HIV-positive if HIV virus was detected in their serum samples or if the child was seropositive for HIV at greater than 12 months of age. Swabs were collected in viral transport medium (universal transport medium [UTM], Copan Diagnostics, Bresica, Italy) and processed to extract nucleic using the NucliSENS easyMAG platform (bioMerieux, Marcyl’Etoile, France) (64). Adult BAL samples collected in Toronto and New Orleans represented residual clinical pathology laboratory samples and were sampled according to clinical guidelines (65). P.jzroveczz-positive and P.jzroveczz-negative BAL specimens were obtained from adult patients with pneumonia or who underwent clinical surveillance following lung transplant or in response to other conditions and whose BAL samples respectively tested positive and negative when analyzed by RealStar Pneumocystis jirovecii PCR kit 1.0 (altona Diagnostics). Adult serum and BAL specimens obtained from South Africa were collected as part of an NIHR funded prospective observational study aimed at describing outcomes and evaluation of non-invasive diagnostic tests for HIV-associated PCP. Consecutive adults with probable (clinical case definition) or definite (immunofluorescent staining on a respiratory sample) HIV-associated PCP were enrolled from a District Hospital in the township of Khayelitsha, Cape Town. Eligible participants underwent bronchoscopy and evaluation for co-infections. Bronchoscopies and BAL sample collections were performed by a respiratory physician using a flexible fiber-optic bronchoscope. Procedures were performed through the oral cavity following local anesthesia (lidocaine 2%) and were supported by cardiopulmonary monitoring (continuous assessment of pulse rate, blood pressure, and oxygen saturation). All BAL samples are obtained from areas of lung infiltration, and if multiple areas were observed the samples were obtained from the area where the infiltration was most severe.

[0154] RNA sequencing: RNA was extracted with the Trizol method from the BAL cells pellets of two patients with Bare Lymphocyte Syndrome who had clinical PCP. Prior to construction of an Illumina total RNA library, DNase treated RNA was quantitated using a Qubit RNA BR assay kit (Thermo Fisher Scientific: Guide MAN0001987 MP10210, Kit #Q10210). Cytoplasmic, mitochondrial, and bacterial rRNA was removed from 2.5 ug of each sample as indicated by the Illumina RiboZero RNA Removal Kit Reference Guide [(Document # 15066012 v02, ScriptSeq Complete Gold (Epidemiology) Kit #BEP1206 (now obsolete)]. Illumina-compatible cDNA libraries were generated according to the instructions of the TruSeq Stranded Total RNA Sample Preparation Guide (Illumina Document #1000000040499v00, Kit #20020596). All libraries were pooled and denatured following the standard normalization method described by the Illumina Denature and Dilute Libraries Guide for the NextSeq System (Illumina Part #15048776), afterwhich denatured libraries were loaded onto an Illumina NextSeq 550. To determine transcript abundance, FASTQ outputs were aligned to the Pneumocystis jirovecii RU7 genome using EdgeR normalization (66).

[0155] Statistics: Statistical analyses were performed using GraphPad Prism 10 software, where p-values of less than 0.05 were used to determine statistically significant differences between groups when analyzed by parametric or non-parametric T-tests according to their data characteristics.

[0156] Study approval: Adult BAL samples analyzed in this study were obtained from residual de-identified clinical diagnostic specimens using an institutional review board (IRB)-approved informed consent process at Ochsner Medical Center - New Orleans (Pro00015109) and University Health Network Toronto (13-7093). Adult BAL and serum specimens from the South African cohort were collected as part of a prospective observational cohort study performed in compliance with a protocol approved by the University of Cape Town Human Research Ethics Committee (HREC 543 / 2022). The Tulane University IRB reviewed the analysis protocol for the de-identified PERCH oropharyngeal swab samples (protocol 2021-1332) and determined it to be non-human-subject research. Mouse model studies were performed in compliance with a protocol approved by the Tulane Institutional Animal Care and Use Committee (protocol 1821). All study participants or parents or guardians of study participants gave written informed consent.Example 2: Study Design for RT-PCR CRISPR clinical validation

[0157] RT-PCR CRISPR assays were developed and used to blindly analyze 107 retrospectively collected oropharyngeal swab samples obtained from the PERCH cohort (1), an international case- control study designed to analyze the incidence of pathogens that cause pneumonia in infants (FIG. 14). This study examined samples collected from children aged 1-59 months who were admitted to the hospital with severe pneumonia and age-matched healthy controls from the same general communities, and used quantitative PCRto detect P.jirovecii gene mtLSU m extracted nucleic acid samples and a threshold of >104 copies / mL as a classifier for active disease. CRISPR and RT- qPCR assay sensitivity and specificity results were calculated against the corresponding PERCH study mtLSU qPCR swab results. RT-PCR CRISPR assays were also employed to blindly evaluate 32 BAL samples from 12 PCP and 20 P.jirovecii non-infected patients, using residual BAL specimens from PCP-positive pneumonia patients (qPCR-positive for P.jirovecii mtLSU DNA) or from PCP-negative patients undergoing clinical surveillance after lung transplant or for other conditions (FIG. 15).

[0158] To assess the potential for blood-based PCP diagnosis, CRISPR and RT-qPCR assays were used to blindly analyze matched BAL and serum samples from a prospective cohort of 27 adult HIV-positive patients with suspected PCP who were enrolled in an observational cohort study at Khayelitsha District Hospital in Cape Town, South Africa (FIG. 1). Study participants, who had dyspnea and hypoxemia (sCL ≤ 94% or PaCL ≤ 10kPa) with an abnormal chest X-ray, were provided with PCP treatment and underwent BAL collection to confirm PCP using a P.jirovecii immunofluorescence assay (IF A) and had serum collected at the same time.Example 3: Development and optimization of CRISPR-enhanced RT-PCR assays for two P. murina mRNA targets

[0159] Pneumocystis-derived biomarkers that distinguish replicating troph and non-replicating ascus spores could permit development of assays that distinguish Pneumocystis infection fromcolonization to guide treatment decisions (FIGs. 2A-2C). Since we previously reported P. murina serine protease (Sp) and 1,3-beta glucan synthase subunit (Gscl) mRNA transcripts are differentially upregulated in its troph and ascus stages, we hypothesized that RT-PCR CRISPR- Cas12a assays might have the sensitivity necessary to detect them in serum to permit minimally invasive infection diagnosis, and used an in silico approach to identify primer pairs and gRNAs to amplify and detect target sequences within these mRNAs (FIG. 16).

[0160] RT-PCR conditions for these mRNA targets were optimized by analyzing the CRISPR signal produced when their amplicons were generated over a range of annealing temperatures with cDNA generated from lung tissue homogenates of P. murina -infected mice, as previously described (21). CRISPR signal-to-noise ratios defined by the signal generated with and without input template (FIGs. 6A-6B) identified optimum annealing temperatures for Sp and Gscl amplification (57.5°C and 59.9°C) that were used in all further analyses. Subsequent analyses identified the determined reporter concentration (667 μM) that produced the highest signal-to- noise ratio for the least amount of input probe (FIGs. 6C-6D), and the Cas12a / gRNA concentration (67 μM) that yielded optimum signal kinetics for the amount of input Cas12a and gRNA (FIGs. 6E-6F). No substantial signal increases were observed in the absence of input template, consistent with minimal reporter degradation.

[0161] Linearity and limit of detection (LoD) values for these optimized Sp and Gscl RT-PCR CRISPR assays were then determined using serial dilutions of synthetic Sp or Gscl DNA fragments spiked into healthy serum (106 to 10-1copies / μL) (FIGs. 7A-7B). These Sp and Gscl assays detected positive signals in serum concentration standards spiked with 0.3 and 1 copies / μL, respectively, and had strong linear correlations with the spiked-in target amount (R2 values of 0.990 and 0.983) from their LoDs to the highest analyzed target concentration (104copies / μL) (FIGs. 7C-7D). Sp and Gscl assay signal also demonstrated strong species-specificity since positive signal was not detected when these assays were used to analyze genomic RNA or DNA of an array of common viral and microbial respiratory pathogens, including the related human pathogen P.jirovecii (FIGs. 7E-7F). CRISPR-murina was tested in mouse serum and BAL samples taken 28 days post-inoculation using the optimized workflow, and directly compared performance to a conventional PCR approach targeting P. murina mtSSU (FIGs. 7G-7H). In BAL, CRISPR-murina detected Sp in 2 / 2 Rag2‘ ' and 2 / 3 WT.

[0162] These results demonstrate that the non-invasive methods of the present technology are useful for detecting Pneumocystis in biological samples with high specificity and sensitivity.Example 4: Sp and Gscl detection in BAL and serum of P. murina-infected wildtype and Rag2- / - mice

[0163] Sp and Gscl RT-PCR CRISPR assay were then used to analyze lung tissue, BAL, and serum specimens collected from C57BL6 / J wildtype (WT) and immunocompromised ( Rag2- / -) mice sacrificed two-, four-, and six-weeks after inoculation with P. murina (FIG. 3A), as this model reflects critical aspects of human disease (27,28). Lung tissue Sp mRNA expression was higher in Rag2- / -versus WT mice, and Gscl mRNA expression was higher in the lungs of WT versus Rag2- / -mice (FIGs. 3B-3C). Lung tissue Sp and Gscl signal did not vary over time in Rag2- / -mice, but both significantly decreased at six weeks post-inoculation in the WT mice, potentially indicating infection clearance. Sp and Gscl signal was less reliably detected in the BAL and serum samples of these mice (FIGs. 3D-3G), particularly the WT mice. Sp and Gscl signal was consistently detected in Rag2- / -mouse BAL and serum specimens at four weeks post- inoculation, but signal for both targets was more variable in the matching WT mouse samples, and in samples collected at two weeks post-inoculation in both groups. Sp and Gscl signals tended to be greater in Rag2- / -mouse BAL versus serum specimens, and Sp signal tended to be consistently greater than Gscl signal throughout infection, consistent with a reduced ability of the Rag2- / -mice to suppress their P. murina infections as neither difference was detected in the WT mouse samples. Sp-positive Rag2- / -mouse BAL and serum samples also tended to be Gsc1-positive by week two post-inoculation, with double positive results detected in all Rag2- / -mouse BAL and serum samples by week four post-inoculation. By contrast, BAL and serum samples of the WT mice tended to be Sp-negative and Gsc1-negative at week two post-inoculation, sporadically positive for both markers at week four post-inoculation, and mostly negative for both markers at week six post-inoculation consistent with greater containment of their P. murina infections.

[0164] These results demonstrate that the non-invasive methods of the present technology are useful for detecting Pneumocystis in biological samples with high specificity and sensitivity.Example 5: Development and optimization of CRISPR-enhanced RT-PCR assays for P. jirovecii RNA targets

[0165] We next translated this approach to detect troph and ascus targets of P.jirovecii, as this human pathogen is closely related to P. murina. However, while a Pjzroveczz-specific Gscl primer and gRNA set produced strong signal, those generated for the Sp homolog of P.jirovecii did notproduce detectable signal (data not shown), likely due to low confidence in P.jirovecii Sp sequence data or polymorphisms. We therefore instead identified P.jirovecii RNAs that were differentially expressed and abundant detected in a RNAseq dataset of BAL specimens from two immunocompromised patients diagnosed with P.jirovecii infections (29). Similar to previous work indicating that mitochondrial transcripts are enriched in troph-derived P. murina RNA, P.jirovecii mitochondrial RNAs were the most abundant differentially enriched transcripts detected in these samples (FIGs. 4A-4B), consistent with a previous study indicating that the trophic form of P.jirovecii plays a dominant role in pulmonary infections and that troph-derived P. murina RNA is enriched for mitochondrial RNA transcripts (21). NADH-ubiquinone oxidoreductase chain 4 (Nad4) was selected for further analysis since primers to this RNA amplified a region containing a candidate gRNA sequence with a conserved protospacer adjacent motif (PAM) site required for efficient Cas12a target recognition and cleavage activity. These primers and gRNA sequences were designed to avoid known Nad4 SNPs that might affect their binding and detection and lack substantial homology with corresponding Nad4 sequences of other Pneumocystis species.

[0166] CRISPR signal-to-noise ratio analyses determined that annealing temperature (59.9°C) and reporter probe and Cas12a / gRNA complex concentration (67 μM and 67μM) conditions for optimal P.jirovecii Nad4 and Gscl RT-PCR Cas12a reactions were similar to those identified for the P. murina assays (FIGs. 8A-8F). The P.jirovecii Nad4 and Gscl assays had LoD values (0.1 and 1 copies / μL) (FIGs. 4C-4D) that closely matched those of the corresponding P. murina assays, while the LoD value of the equivalent Nad4 RT-PCR assay was 100* greater than the Nad4 RT- PCR CRISPR assay (10 copies / μL) (FIG. 4E). These RT-PCR CRISPR assays and RT-qPCR revealed strong linear correlations between signal and spiked-in target (R2 values of 0.936, 0.927, 0.99) from their individual LoDs to the highest analyzed target concentration (104copies / μL) (FIGs. 4F-4H). Finally, both RT-PCR CRISPR assays demonstrated strong species-specificity since strong positive signal was detected in the P.jirovecii positive control sample, while negative control samples containing corresponding DNA regions from other respiratory pathogens, including P. murina, did not produce signal greater than that detected in the non-template control sample (FIGs. 4I-4J).

[0167] These results demonstrate that the non-invasive methods of the present technology are useful for detecting Pneumocystis jirovecii in biological samples with high specificity and sensitivity.Example 6: P. jirovecii Nad4 and Gscl assay performance with patient BAL and oropharyngeal swab specimens

[0168] For oropharyngeal swab analysis, tested samples were primarily from infants <12 months of age (2 children were >12 months of age). Nad4 and Gscl signal thresholds distinguished infants with and without P.jirovecii infections with 96.3% and 72.2% sensitivity and 100% specificity (FIGs. 5A-5B, 9A, and 13A), while the Nad4 RT-qPCR threshold for positive signal had 66.7% diagnostic sensitivity and 90.6% specificity. Similarly, an analysis of adult BAL specimens (12 PCP and 20 non-PCP cases, including one HIV-positive PCP patient), detected PCP cases with 91.7% and 83.3% clinical sensitivity and 100.0% specificity (FIGs. 5C, 9B, and 13B), while Nad4 RT-qPCR results had 66.7% diagnostic sensitivity and 94.7% specificity. CRISPR. Nad4 and Gscl assay results had better overall classification performance than RT-qPCR Nad4 assay results to distinguish cases and controls in infant swab and adult BAL sample cohorts when these results were evaluated in receiver operating characteristic curve analyses (FIGs. 10A-10B).

[0169] These results demonstrate that the non-invasive methods of the present technology are useful for detecting Pneumocystis jirovecii in biological samples with high specificity and sensitivity.Example 7: P. jirovecii Nad4 and Gscl assay performance with matched patient BAL and serum specimens

[0170] CRISPR Nad4 signal in BAL specimens from South Africa distinguished PCP-positive and PCP-negative patients with 100% sensitivity and 91.7% specificity, exceeding CRISPR Gscl (73.3% sensitivity / 75.0% specificity) and RT-qPCR Nad4 (60.0% sensitivity / 83.3% sensitivity) diagnostic performance (FIGs. 5D, 11 A, and 13C). CRISPR Nad4 and Gscl results for serum identified PCP-positive patients with 93.3% and 60.0% sensitivity, respectively, and 91.7% specificity, which also exceeded the performance (26.7% sensitivity / 91.7% specificity) of the matching RT-qPCR Nad4 results (FIGs. 5E, 11B and 13D). Nad4 levels detected in these samples demonstrated higher mean fluorescent intensity in BAL versus serum specimens (FIGs. 5F-5G). CRISPR Nad4 assay results from adult BAL and serum samples also had better performance to distinguish adult PCP and non-PCP cases than matching Gscl assay results when both were evaluated by receiver operating curve analysis (FIGs. 12A-12B).

[0171] These results demonstrate that the non-invasive methods of the present technology are useful for detecting Pneumocystis jirovecii in biological samples with high specificity and sensitivity.EQUIVALENTS

[0172] The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0173] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0174] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.

[0175] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.REFERENCES1. O’Brien KL, Baggett HC, Brooks WA, Feikin DR, Hammitt LL, Higdon MM, et al. Causes of severe pneumonia requiring hospital admission in children without HIV infection from Africa and Asia: the PERCH multi-country case-control study. The Lancet. 2019;394(10200):757-79.2. Liu Y, Su L, Jiang S-J, and Qu H. Risk factors for mortality from Pneumocystis carinii pneumonia (PCP) in non-HIV patients: a meta-analysis. Oncotarget. 2017;8(35):59729-39.3. Butler-Laporte G, Smyth E, Amar-Zifkin A, Cheng MP, McDonald EG, and Lee TC. Low- Dose TMP-SMX in the Treatment of Pneumocystis jirovecii Pneumonia: A Systematic Review and Meta-analysis. Open Forum Infectious Diseases. 2020;7(5).4. Boskovic T, Stojanovic M, Stanic J, Pena Karan S, Vujasinovic G, Dragisic D, et al. Pneumothorax after transbronchial needle biopsy. J Thorac Dis. 2014;6(Suppl 4):S427-34.5. Carmona EM, and Limper AH. Update on the diagnosis and treatment of Pneumocystis pneumonia. Therapeutic Advances in Respiratory Disease . 2011 ;5(1):41 - 59.6. Bateman M, Oladele R, and Kolls JK. Diagnosing Pneumocystis jirovecii pneumonia: A review of current methods and novel approaches. MedMycol. 2020;58(8): 1015-28.7. Senecal J, Smyth E, Del Corpo O, Hsu JM, Amar-Zifkin A, Bergeron A, et al. Non- invasive diagnosis of Pneumocystis jirovecii pneumonia: a systematic review and meta-analysis. Clin Microbiol Infect. 2022;28(l):23-30.8. White PL, Posso RB, Gorton RL, Price JS, Wey E, and Barnes RA. An evaluation of the performance of the Dynamiker® Fungus (l-3)-P-D-Glucan Assay to assist in the diagnosis of Pneumocystis pneumonia. Medical Mycology . 2018;56(6):778-81.9. Hammarstrbm H, Grankvist A, Broman I, Kondori N, Wenneras C, Gisslen M, et al. Serum-based diagnosis of Pneumocystis pneumonia by detection of Pneumocystis jirovecii DNA and 1,3-P-D-glucan in HIV-infected patients: a retrospective case control study. BMC Infectious Diseases. 2019; 19(1).10. Choe PG, Kang YM, Kim G, Park WB, Park SW, Kim HB, et al. Diagnostic value of direct fluorescence antibody staining for detecting Pneumocystis jirovecii in expectorated sputum from patients with HIV infection. MedMycol. 2014;52(3):326-30.11. Li WJ, Guo YL, Liu TJ, Wang K, and Kong JL. Diagnosis of Pneumocystis pneumonia using serum (l-3)-beta-D-Glucan: a bivariate meta-analysis and systematic review. J Thorac Dis. 2015;7(12):2214-25.12. Racil Z, Kocmanova I, Lengerova M, Weinbergerova B, Buresova L, Toskova M, et al. Difficulties in using 1,3-P-D-glucan as the screening test for the early diagnosis of invasive fungal infections in patients with haematological malignancies - high frequency of false-positive results and their analysis. Journal of Medical Microbiology . 2010;59(9): 1016-22.13. Reid AB, Chen SC, and Worth LJ. Pneumocystis jirovecii pneumonia in non-HIV-infected patients: new risks and diagnostic tools. Curr Opin Infect Dis. 2011;24(6):534-44.14. Miihlethaler K, Bogli-Stuber K, Wasmer S, Von Gamier C, Dumont P, Rauch A, et al. Quantitative PCR to diagnose Pneumocystis pneumonia in immunocompromised non-HIV patients. European Respiratory Journal. 2012;39(4):971-8.15. Fauchier T, Hasseine L, Gari-Toussaint M, Casanova V, Marty PM, and Pomares C. Detection of Pneumocystis jirovecii by Quantitative PCR To Differentiate Colonization and Pneumonia in Immunocompromised HIV-Positive and HIV-Negative Patients. Journal of Clinical Microbiology. 2016;54(6): 1487-95.16. Wang D, Hu Y, Li T, Rong H-M, and Tong Z-H. Diagnosis of Pneumocystis jirovecii pneumonia with serum cell-free DNA in non-HIV-infected immunocompromised patients. Oncotarget. 2017;8(42):71946-53.17. Goterris L, Mancebo Fernandez MA, Aguilar-Company J, Falco V, Ruiz-Camps I, and Martin-Gomez MT. Molecular Diagnosis of <\>Pneumocystis jirovecii<!\> Pneumonia by Use of Oral Wash Samples in Immunocompromised Patients: Usefulness and Importance of the DNA Target. Journal of Clinical Microbiology. 2019;57(12).18. Desoubeaux G, Chesnay A, Mercier V, Bras-Cachinho J, Moshiri P, Eymieux S, et al. Combination of 0-(l, 3)-D-glucan testing in serum and qPCR in nasopharyngeal aspirate for facilitated diagnosis of <\>Pneumocystis jirovecii<!\> pneumonia. Mycoses. 2019;62(l 1): 1015- 22.19. Nyamande K, Lalloo UG, York D, Naidoo M, Irusen EM, and Chetty R. Low sensitivity of a nested polymerase chain reaction in oropharyngeal washings for the diagnosis of Pneumocystis pneumonia in HIV-infected patients. Chest. 2005; 128(1): 167-71.20. Yang SL, Wen YH, Wu YS, Wang MC, Chang PY, Yang S, et al. Diagnosis of Pneumocystis pneumonia by real-time PCR in patients with various underlying diseases. J Microbiol Immunol Infect. 2020;53(5):785-90.21. Eddens T, Elsegeiny W, Ricks D, Goodwin M, Horne WT, Zheng M, et al. Transcriptomic and Proteomic Approaches to Finding Novel Diagnostic and Immunogenic Candidates in <\>Pneumocystis<!\> . mSphere. 2019;4(5).22. Skalski JH, Kottom TJ, and Limper AH. Pathobiology of Pneumocystis pneumonia: life cycle, cell wall and cell signal transduction. FPMS Yeast Res. 2015; 15(6).23. Huang Z, Tian D, Liu Y, Lin Z, Lyon CJ, Lai W, et al. Ultra-sensitive and high-throughput CRISPR-p owered COVID-19 diagnosis. Biosens Bioelectron. 2020; 164: 112316.24. Huang Z, Lacourse SM, Kay AW, Stern J, Escudero JN, Youngquist BM, et al. CRISPR detection of circulating cell-free Mycobacterium tuberculosis DNA in adults and children, including children with HIV: a molecular diagnostics study. The Lancet Microbe. 2022;3(7):e482-e92.25. Chen JS, Ma E, Harrington LB, Da Costa M, Tian X, Palefsky JM, et al. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science. 2018;360(6387):436-9.26. Broughton JP, Deng X, Yu G, Fasching CL, Servellita V, Singh J, et al. CRISPR-Cas12- based detection of SARS-CoV-2. Nature Biotechnology. 2020;38(7):870-4.27. Shellito J, Suzara VV, Blumenfeld W, Beck JM, Steger HJ, and Ermak TH. A new model of Pneumocystis carinii infection in mice selectively depleted of helper T lymphocytes. Journal of Clinical Investigation. 1990;85(5): 1686-93.28. Elsegeiny W, Zheng M, Eddens T, Gallo RL, Dai G, Trevejo-Nunez G, et al. Murine models of Pneumocystis infection recapitulate human primary immune disorders. JCI Insight. 2018;3(12).29. Dai G, Wanek A, Eddens T, Volden P, and Kolls JK. Toward a humanized mouse model of Pneumocystis pneumonia. JCI Insight. 2021;6(2).30. Huang Z, LaCourse SM, Kay AW, Stern J, Escudero JN, Youngquist BM, et al. CRISPR detection of circulating cell-free Mycobacterium tuberculosis DNA in adults and children, including children with HIV: a molecular diagnostics study. Lancet Microbe . 2022;3(7):e482- e92.31. Huang Z, Ning B, Yang HS, Youngquist BM, Niu A, Lyon CJ, et al. Sensitive tracking of circulating viral RNA through all stages of SARS-CoV-2 infection. Journal of Clinical Investigation. 2021; 131(7).32. Ning B, Yu T, Zhang S, Huang Z, Tian D, Lin Z, et al. A smartphone-read ultrasensitive and quantitative saliva test for CO VID- 19. Science Advances . 2021;7(2):eabe3703.33. Zhan Y, Gao X, Li S, Si Y, Li Y, Han X, et al. Development and Evaluation of Rapid and Accurate CRISPR / Cas 13 -Based RNA Diagnostics for Pneumocystis jirovecii Pneumonia. Frontiers in Cellular and Infection Microbiology . 2022; 12.34. Thea DM, Seidenberg P, Park DE, Mwananyanda L, Fu W, Shi Q, et al. Limited Utility of Polymerase Chain Reaction in Induced Sputum Specimens for Determining the Causes of Childhood Pneumonia in Resource-Poor Settings: Findings From the Pneumonia Etiology Research for Child Health (PERCH) Study. Clinical Infectious Diseases. 2017;64(suppl_3):S289-S300.35. Perret T, Kritikos A, Hauser PM, Guiver M, Coste AT, Jaton K, et al. Ability of quantitative PCR to discriminate Pneumocystis jirovecii pneumonia from colonization. Journal of Medical Microbiology . 2020;69(5):705-l 1.36. Maillet M, Maubon D, Brion JP, Francois P, Molina L, Stahl JP, et al. Pneumocystis jirovecii (Pj) quantitative PCR to differentiate Pj pneumonia from Pj colonization in immunocompromised patients. European Journal of Clinical Microbiology & Infectious Diseases. 2014;33(3):331-6.37. Wilson JW, Limper AH, Grys TE, Karre T, Wengenack NL, and Binnicker MJ. Pneumocystis jirovecii testing by real-time polymerase chain reaction and direct examination among immunocompetent and immunosuppressed patient groups and correlation to disease specificity. Diagnostic Microbiology and Infectious Disease. 2011 ;69(2): 145-52.38. Cushion MT, Ashbaugh A, Hendrix K, Linke MJ, Tisdale N, Sayson SG, et al. Gene Expression of Pneumocystis murina after Treatment with Anidulafungin Results in Strong Signals for Sexual Reproduction, Cell Wall Integrity, and Cell Cycle Arrest, Indicating a Requirement for Ascus Formation for Proliferation. Antimicrobial Agents and Chemotherapy. 2018;62(5).39. Van Halsema C, Johnson L, Baxter J, Douthwaite S, Clowes Y, Guiver M, et al. Short Communication: Diagnosis ofPneumocystis jzroveczz Pneumonia by Detection of DNA in Blood and Oropharyngeal Wash, Compared with Sputum. AIDS Research and Human Retroviruses. 2016;32(5):463-6.40. Medrano FJ, Montes-Cano M, Conde M, De La Horra C, Respaldiza N, Gasch A, et al. <\>Pneumocystis jirovecii m General Population. Emerging Infectious Diseases. 2005; 11(2):245-50.41. Djawe K, Daly KR, Vargas SL, Santolaya ME, Ponce CA, Bustamante R, et al. Seroepidemiological study of Pneumocystis jirovecii infection in healthy infants in Chile using recombinant fragments of the P. jirovecii major surface glycoprotein. International Journal of Infectious Diseases. 2010;14(12):el060-e6.42. Morris A, Sciurba FC, Lebedeva IP, Githaiga A, Elliott WM, Hogg JC, et al. Association of chronic obstructive pulmonary disease severity and colonization. Am J ReSp Crit Care. 2004;170(4):408-13.43. Carolina, Gallo M, Bustamante R, and Sergio. Pneumocystis Colonization Is Highly Prevalent in the Autopsied Lungs of the General Population. Clinical Infectious Diseases. 2010;50(3):347-53.44. Morris A, Wei K, Afshar K, and Huang L. Epidemiology and Clinical Significance of Pneumocystis Colonization. The Journal of Infectious Diseases. 2008; 197(1): 10-7.45. Durand-Joly I, Aliouat EM, Recourt CL, Guyot K, FrangOis N, Wauquier ML, et al. <\>Pneumocystis carinii f. sp. hominis Is Not Infectious for SCID mice. Journal of Clinical Microbiology . 2002;40(5) : 1862-5.46. Gigliotti F, Harmsen AG, Haidaris CG, and Haidaris PJ. Pneumocystis carinii is not universally transmissible between mammalian species. Infection and Immunity . 1993;61(7):2886- 90.47. Hauser PM. Genomic Insights into the Fungal Pathogens of the Genus Pneumocystis'. Obligate Biotrophs of Humans and Other Mammals. PLoS Pathogens. 2014; 10(1 l):el004425.48. Demanche C, Berthelemy M, Petit T, Polack B, Wakefield AE, Dei-Cas E, et al. Phylogeny of <\>Pneumocystis carinii from 18 Primate Species Confirms Host Specificity and Suggests Coevolution. Journal of Clinical Microbiology. 2001;39(6):2126-33.49. Walzer PD. The Ecology of <\>Pneumocystis<!\>'. Perspectives, Personal Recollections, and Future Research Opportunities. J Eukaryot Microbiol. 2013;60(6):634-45.50. Zakrzewska M, Roszkowska R, Zakrzewski M, and Maciorkowska E. Pneumocystis pneumonia: still a serious disease in children. Dev PeriodMed. 2019;23(3): 159-62.51. Rojas P, Friaza V, Garcia E, De La Horra C, Vargas SL, Calderon EJ, et al. Early Acquisition of Pneumocystis jirovecii Colonization and Potential Association With Respiratory Distress Syndrome in Preterm Newborn Infants. Clinical Infectious Diseases. 2017;65(6):976- 81.52. Valinetz ED, and Cangelosi GA. A Look Inside: Oral Sampling for Detection of Non- oral Infectious Diseases. Journal of Clinical Microbiology. 2021;59(10).53. Yu W. Species-specific Bacterial Detector for Fast Pathogen Diagnosis of Severe Pneumonia. ClinicalTrialsgov . 2021.54. Yu K. Effect of PCR-CRISPR / Cas12a on the Early Anti -infective Schemes in Patients With Open Air Pneumonia. ClinicalTrialsgov. 2019.55. Zhang W. Evaluation of CRISPR-based Test for the Rapid Identification of TB in Pulmonary Tuberculosis Suspects. ClinicalTrialsgov. 2019.56. Harris JR, Marston B J, SangrujeeN, Duplessis D, and Park B. Cost-Effectiveness Analysis ofDiagnostic Options for Pneumocystis Pneumonia (PCP). PLoS ONE. 201 l;6(8):e23158.57. Craven V, Hausdorff WP, and Everard ML. High levels of inherent variability in microbiological assessment of bronchoalveolar lavage samples from children with persistent bacterial bronchitis and healthy controls. Pediatric Pulmonology . 2020;55(l 1): 3209- 14.58. Yu Y, Liu C, Zhang Z, Shen H, Li Y, Lu L, et al. Bronchoalveolar lavage fluid dilution in ICU patients: what we should know and what we should do. Critical Care . 2019;23(l).59. Murdoch DR, Morpeth SC, Hammitt LL, Driscoll AJ, Watson NL, Baggett HC, et al. Microscopic Analysis and Quality Assessment of Induced Sputum From Children With Pneumonia in the PERCH Study. Clinical Infectious Diseases. 2017;64(suppl_3):S271-S9.60. Uemura N, Makimura K, Onozaki M, Otsuka Y, Shibuya Y, Yazaki H, et al. Development of a loop-mediated isothermal amplification method for diagnosing Pneumocystis pneumonia. J MedMicrobiol. 2008;57(Pt l):50-7.61. Singh P, Singh S, Mirdha BR, Guleria R, Agarwal SK, and Mohan A. Evaluation of Loop- Mediated Isothermal Amplification Assay for the Detection of Pneumocystis jirovecii in Immunocompromised Patients. Molecular Biology International. 2015;2015: 1-6.62. Kawano S, Maeda T, Suzuki T, Abe T, Mikita K, Hamakawa Y, et al. Loop-mediated isothermal amplification with the Procedure for Ultra Rapid Extraction kit for the diagnosis of Pneumocystis pneumonia. J Infect Chemother . 2015;21(3):224-6.63. Noell K, Dai G, Pungan D, Ebacher A, McCombs JE, Landry SJ, et al. Germline IgM predicts T cell immunity to Pneumocystis. JCI Insight. 2022;7(17).64. Driscoll AJ, Karron RA, Morpeth SC, Bhat N, Levine OS, Baggett HC, et al. Standardization of Laboratory Methods for the PERCH Study. Clin Infect Dis. 2017;64(suppl_3):S245-S52.65. Patel PH, Antoine MH, and Ullah S. StatPearls. Treasure Island (FL); 2023.66. Robinson MD, McCarthy DJ, and Smyth GK. <tt>edgeR< / tt>: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics . 2010;26(l):139-40.

Claims

CLAIMS1. A kit for detecting the presence of pathogenic Pneumocystis jirovecii in a biological sample comprising one or more of: a. a primer pair that amplifies a P. jirovecii Orf 195 target nucleic acid, and a nucleic acid probe that is capable of specifically hybridizing to a segment of the Orf 195 nucleic acid of SEQ ID NO: 15 or a complement thereof, wherein the nucleic acid probe is detectably labeled; b. a primer pair that amplifies a P. jirovecii Coxl target nucleic acid, and a nucleic acid probe that is capable of specifically hybridizing to a segment of the Coxl nucleic acid of SEQ ID NO: 16 or a complement thereof, wherein the nucleic acid probe is detectably labeled; c. a primer pair that amplifies a P. jirovecii Atp6 target nucleic acid, and a nucleic acid probe that is capable of specifically hybridizing to a segment of the Atp6 nucleic acid of SEQ ID NO: 17 or a complement thereof, wherein the nucleic acid probe is detectably labeled; d. a primer pair that amplifies a P. jirovecii Cox3 target nucleic acid, and a nucleic acid probe that is capable of specifically hybridizing to a segment of the Cox3 nucleic acid of SEQ ID NO: 18 or a complement thereof, wherein the nucleic acid probe is detectably labeled; e. a primer pair that amplifies a P. jirovecii Atp9 target nucleic acid, and a nucleic acid probe that is capable of specifically hybridizing to a segment of the Atp9 nucleic acid of SEQ ID NO: 19 or a complement thereof, wherein the nucleic acid probe is detectably labeled; f. a primer pair that amplifies an P. jirovecii Nad5 target nucleic acid, and a nucleic acid probe that is capable of specifically hybridizing to a segment of the Nad5 nucleic acid of SEQ ID NO: 20 or a complement thereof, wherein the nucleic acid probe is detectably labeled; g. a primer pair that amplifies a P. jirovecii Nad4 target nucleic acid, and a nucleic acid probe that is capable of specifically hybridizing to a segment of the Nad4 nucleic acidof SEQ ID NO: 21 or a complement thereof, wherein the nucleic acid probe is detectably labeled; h. a primer pair that amplifies a P. jirovecii Nad2 target nucleic acid, and a nucleic acid probe that is capable of specifically hybridizing to a segment of the Nad2 nucleic acid of SEQ ID NO: 22 or a complement thereof, wherein the nucleic acid probe is detectably labeled; i. a primer pair that amplifies a P. jirovecii Cox2 target nucleic acid, and a nucleic acid probe that is capable of specifically hybridizing to a segment of the Cox2 nucleic acid of SEQ ID NO: 23 or a complement thereof, wherein the nucleic acid probe is detectably labeled; and / or j . a primer pair that amplifies a P. jirovecii Nadi target nucleic acid, and a nucleic acid probe that is capable of specifically hybridizing to a segment of the Nadi nucleic acid of SEQ ID NO: 24 or a complement thereof, wherein the nucleic acid probe is detectably labeled.

2. The kit of claim 1, wherein the primer pair is capable of specifically amplifying an Orf 195 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 15, or a complement thereof; or wherein the primer pair is capable of specifically amplifying a Coxl nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 16, or a complement thereof; or wherein the primer pair is capable of specifically amplifying an Atp6 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 17, or a complement thereof; or wherein the primer pair is capable of specifically amplifying a Cox3 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 18, or a complement thereof; or wherein the primer pair is capable of specifically amplifying an Atp9 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 19, or a complement thereof; orwherein the primer pair is capable of specifically amplifying a Nad5 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 20, or a complement thereof; or wherein the primer pair is capable of specifically amplifying a Nad4 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 21, or a complement thereof; or wherein the primer pair is capable of specifically amplifying a Nad2 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 22, or a complement thereof; or wherein the primer pair is capable of specifically amplifying a Cox2 nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 23, or a complement thereof; or wherein the primer pair is capable of specifically amplifying a Nadi nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 24, or a complement thereof.

3. The kit of claim 1 or 2, wherein the primer pair consists of a forward primer comprising the sequence of SEQ ID NO: 9 and a reverse primer comprising the sequence of SEQ ID NO: 10.

4. The kit of claim 3, wherein the nucleic acid probe comprises the sequence of SEQ ID NO: 11.

5. The kit of claim 1 or 2, wherein the primer pair consists of a forward primer comprising the sequence of SEQ ID NO: 12 and a reverse primer comprising the sequence of SEQ ID NO: 13.

6. The kit of claim 5, wherein the nucleic acid probe comprises the sequence of SEQ ID NO: 14.

7. A kit for detecting the presence of pathogenic Pneumocystis jirovecii in a biological sample comprising a CRISPR enzyme, a single-stranded nucleic acid probe comprising a donor fluorophore and a quencher moiety, and at least one of: a. a primer pair that amplifies a P. jirovecii Orf 195 target nucleic acid to generate Orf 195 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Orf 195 amplicons;b. a primer pair that amplifies a P. jirovecii Coxl target nucleic acid to generate Coxl amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Coxl amplicons; c. a primer pair that amplifies a P. jirovecii Atp6 target nucleic acid to generate Atp6 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Atp6 amplicons; d. a primer pair that amplifies a P. jirovecii Cox3 target nucleic acid to generate Cox3 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Cox3 amplicons; e. a primer pair that amplifies a P. jirovecii Atp9 target nucleic acid to generate Atp9 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Atp9 amplicons; f. a primer pair that amplifies an P. jirovecii Nad5 target nucleic acid to generate Nad5 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Nad5 amplicons; g. a primer pair that amplifies a P. jirovecii Nad4 target nucleic acid to generate Nad4 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Nad4 amplicons; h. a primer pair that amplifies a P. jirovecii Nad2 target nucleic acid to generate Nad2 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Nad2 amplicons; i. a primer pair that amplifies a P. jirovecii Cox2 target nucleic acid to generate Cox 2 amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Cox2 amplicons; and / or j . a primer pair that amplifies a P. jirovecii Nadi target nucleic acid to generate Nadi amplicons, and a sgRNA that is capable of specifically hybridizing to a segment of the Nadi amplicons.

8. The kit of claim 7, wherein the CRISPR enzyme is Cas12a or Cas12b and the single- stranded nucleic acid probe is a single-stranded DNA probe.

9. The kit of claim 7 or 8, wherein the single-stranded nucleic acid probe is about 15 to about 35 nucleotides in length.

10. A method for detecting the presence of pathogenic Pneumocystis jirovecii in a subject comprising:(a) extracting ribonucleic acids from a biological sample obtained from the subject;(b) reverse transcribing the extracted ribonucleic acids to generate a plurality of cDNA:RNA hybridization complexes;(c) contacting the cDNA:RNA hybridization complexes with at least one primer pair that amplifies target nucleic acids in one or more P. jirovecii mitochondrial genes to produce a reach on- sample mixture;(d) subjecting the reaction-sample mixture to real-time PCR conditions under which each of the target nucleic acids present in the biological sample is amplified to produce a fluorescent signal;(e) detecting the fluorescent signal generated by each of the amplified target nucleic acids produced in step (d); and(f) detecting the presence of pathogenic P. jirovecii in the biological sample when the fluorescent signal is detected for the amplified target nucleic acids.

11. The method of claim 10, wherein the one or more P. jirovecii mitochondrial genes are selected from the group consisting of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi.

12. The method of claim 10 or 11, wherein the at least one primer pair is capable of specifically amplifying a P. jirovecii nucleic acid comprising a sequence that is at least 85-95% identical to any one of SEQ ID NOs: 15-24.

13. The method of any one of claims 10-12, wherein the at least one primer pair consists of: i. a forward primer comprising the sequence of SEQ ID NO: 9 and a reverse primer comprising the sequence of SEQ ID NO: 10, or ii. a forward primer comprising the sequence of SEQ ID NO: 12 and a reverse primer comprising the sequence of SEQ ID NO: 13, oriii. a forward primer comprising the sequence of SEQ ID NO: 5 and a reverse primer comprising the sequence of SEQ ID NO: 6.

14. The method of any one of claims 10-13, wherein the reach on- sample mixture further comprises one or more nucleic acid probes that specifically hybridize to a region of one or more of the genes selected from the group consisting of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi, wherein the one or more nucleic acid probes are detectably labeled.

15. The method of claim 14, wherein the reach on- sample mixture comprises a single nucleic acid probe that specifically hybridizes to a region of a single gene selected from the group consisting of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi.

16. The method of claim 14, wherein the reaction-sample mixture comprises multiple nucleic acid probes that specifically hybridize to one or more regions of a single gene selected from the group consisting of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi.

17. The method of claim 14, wherein the reaction-sample mixture comprises multiple nucleic acid probes comprising a single nucleic acid probe that specifically hybridizes to a region of a single gene for each of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi.

18. The method of claim 14, wherein the reaction-sample mixture comprises multiple nucleic acid probes comprising more than one nucleic acid probe that hybridizes to one or more regions for each of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi.

19. The method of any one of claims 14-18, wherein the reach on- sample mixture further comprises at least one nucleic acid probe that is capable of specifically hybridizing to a segment of the nucleic acid sequence of any one of SEQ ID NOs: 15-24 or a complement thereof.

20. The method of any one of claims 14-19, wherein the at least one nucleic acid probe comprises the sequence of SEQ ID NO: 11 or SEQ ID NO: 14.

21. A method for detecting the presence of pathogenic Pneumocystis jirovecii in a subject comprising:(a) extracting ribonucleic acids from a biological sample obtained from the subject;(b) reverse transcribing the extracted ribonucleic acids to generate a plurality of cDNA:RNA hybridization complexes;(c) amplifying the cDNA:RNA hybridization complexes with at least one primer pair that amplifies target nucleic acids in one or more P. jirovecii mitochondrial genes to produce a plurality of amplicons;(d) contacting the plurality of amplicons with a mixture comprising (i) a CRISPR enzyme, (ii) single-stranded nucleic acid probes comprising a donor fluorophore and a quencher moiety, and (iii) at least one sgRNA that is capable of specifically hybridizing to at least one amplicon in the plurality of amplicons to form a reaction mixture;(e) subjecting the reaction mixture to conditions under which a plurality of CRISPR: sgRNA complexes are formed and the single-stranded nucleic acid probes are cleaved by the plurality of CRISPR: sgRNA complexes to produce a fluorescent signal, wherein each CRISPR: sgRNA complex comprises the CRISPR enzyme and at least one sgRNA hybridized to at least one amplicon;(f) detecting the fluorescent signal generated by each single-stranded nucleic acid probe cleaved by the plurality of CRISPR: sgRNA complexes produced in step (e); and(g) detecting the presence of pathogenic P. jirovecii in the biological sample when the fluorescent signal is detected for the cleaved single-stranded nucleic acid probe.

22. The method of claim 21, wherein step (c) and steps (d)-(e) are performed in separate reaction chambers.

23. The method of claim 21, wherein steps (c)-(e) are performed in a single reaction chamber.

24. The method of claim 23, wherein steps (c)-(e) are performed are performed sequentially.

25. The method of claim 23, wherein steps (c)-(e) are performed are performed simultaneously.

26. The method of any one of claims 21-25, wherein the cDNA:RNA hybridization complexes are amplified using polymerase chain reaction (PCR) amplification or isothermal amplification.

27. The method of any one of claims 21-26, wherein the CRISPR enzyme is Cas12a or Cas12b and the single-stranded nucleic acid probe is a single-stranded DNA probe.

28. The method of any one of claims 21-26, wherein the CRISPR enzyme is Casl3 and the single-stranded nucleic acid probe is a single-stranded RNA probe.

29. The method of any one of claims 21 -28, wherein the one or more P. jirovecii mitochondrial genes are selected from the group consisting of Orf 195, Coxl, Atp6, Cox3, Atp9, Nad5, Nad4, Nad2, Cox2, and Nadi.

30. The method of any one of claims 21-29, wherein the at least one primer pair is capable of specifically amplifying a P. jirovecii nucleic acid comprising a sequence that is at least 85-95% identical to any one of SEQ ID NOs: 15-24.

31. The method of any one of claims 21-30, wherein the at least one primer pair consists of: i. a forward primer comprising the sequence of SEQ ID NO: 9 and a reverse primer comprising the sequence of SEQ ID NO: 10, or ii. a forward primer comprising the sequence of SEQ ID NO: 12 and a reverse primer comprising the sequence of SEQ ID NO: 13, or iii. a forward primer comprising the sequence of SEQ ID NO: 5 and a reverse primer comprising the sequence of SEQ ID NO: 6.

32. The method of any one of claims 21-31, wherein the single-stranded nucleic acid probe is about 15 to about 35 nucleotides in length.

33. The method of any one of claims 10-32, wherein the biological sample is whole blood, serum, plasma, bronchioalveolar lavage fluid, a throat swab, or a nasopharyngeal (NP) aspirate or wash.

34. The method of any one of claims 10-33, wherein the subject is a pediatric patient, a geriatric patient, an adult patient, or an immunocompromised patient.

35. The method of any one of claims 10-34, further comprising administering to the subject an effective amount of an anti-fungal agent.

36. The method of claim 35, wherein the anti-fungal agent comprises one or more of trimethoprim, sulfamethoxazole, pentamidine, dapsone, pyrimethamine, atovaquone, clindamycin, or primaquine.

Images