Therapeutic agent for cancer in non-human mammals

A therapeutic agent containing JPH203 effectively treats cancers in non-human mammals by targeting LAT1, addressing the ineffectiveness of existing treatments and providing a predictive method for canine cancer therapy based on LAT1 expression.

WO2025197131A1PCT designated stage Publication Date: 2025-09-25CODEC CHEMICAL CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2024/021675
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-18
Filing Date
2024-06-14
Publication Date
2025-09-25

AI Technical Summary

Technical Problem

Existing cancer treatments, such as JPH203, are ineffective in non-human mammals, particularly dogs and cats, and there is a lack of effective methods to predict the efficacy of such treatments in these species.

Method used

Development of a therapeutic agent containing O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine (JPH203) or its pharmaceutically acceptable salts, specifically designed for non-human mammals, and a method to predict efficacy by measuring LAT1 protein and mRNA levels in canine-derived samples.

Benefits of technology

JPH203 effectively treats solid cancers like lung cancer, hepatocellular carcinoma, and particularly bladder cancer in dogs, demonstrating significant tumor growth inhibition and apoptosis induction in vivo, with the method accurately predicting treatment efficacy based on LAT1 expression levels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JP2024021675_25092025_PF_FP_ABST
    Figure JP2024021675_25092025_PF_FP_ABST
Patent Text Reader

Abstract

[Problem] To provide a therapeutic agent for cancer in non-human mammals. [Solution] A therapeutic agent for cancer in non-human mammals (in particular, a therapeutic agent for canine bladder cancer) which comprises, as an active ingredient, O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine or a pharmaceutically acceptable salt thereof, and a method which is for predicting drug efficacy, against canine cancer, of O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine or a pharmaceutically acceptable salt thereof, and which comprises the step for measuring either one or both of the amounts of LAT1 protein and LAT1 mRNA that are contained in canine urine.
Need to check novelty before this filing date? Find Prior Art

Description

Cancer treatment agents for non-human mammals

[0001] The present invention relates to a therapeutic agent for cancer in non-human mammals.

[0002] International Publication WO 2015 / 173970 describes an anti-cancer composition containing an LAT1 inhibitor. International Publication WO 2019 / 130637 describes a cancer therapeutic agent containing O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine (JPH203) or a pharmaceutically acceptable salt thereof as an active ingredient. JPH203 has not been shown to be effective in treating cancer in animals other than humans.

[0003] International Publication No. WO2015 / 173970 Pamphlet International Publication No. WO2019 / 130637 Pamphlet

[0004] The present invention aims to provide a therapeutic agent for cancer in mammals other than humans, and a method for analyzing whether administration of JPH203 is effective for cancer treatment in a subject.

[0005] This invention is based on the discovery that JPH203 is also effective in treating cancer in mammals other than humans, and in particular, that JPH203 is effective in treating solid cancers (particularly bladder cancer) in dogs.

[0006] The first invention relates to a therapeutic agent for cancer in a non-human mammal, which comprises O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine (JPH203) or a pharmaceutically acceptable salt thereof as an active ingredient.

[0007] Examples of non-human mammals include dogs and cats. Examples of "cancer" in the cancer therapeutic agent include lung cancer, hepatocellular carcinoma, kidney cancer, bladder cancer, breast tumor, melanoma, and angiosarcoma. Among these, the agent is particularly effective in treating lung cancer, hepatocellular carcinoma, and bladder cancer, and among these, the agent is particularly effective in treating bladder cancer.

[0008] The second invention relates to a method for predicting the efficacy of O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine or a pharmaceutically acceptable salt thereof against canine cancer, which method comprises measuring either or both of the amount of LAT1 protein and the amount of LAT1 mRNA contained in a canine-derived measurement object (e.g., excised canine cancer tissue, blood, or urine, particularly canine urine).

[0009] The examples demonstrate that JPH203 is also effective in treating cancer in mammals other than humans. This means that the present invention can provide a therapeutic agent for cancer in mammals other than humans. The present invention also provides a method for analyzing whether administration of JPH203 is effective in treating cancer in a subject.

[0010] Figure 1A is a graph in place of a drawing showing LAT1 mRNA expression in various canine cancers evaluated by real-time PCR. Figure 1B is a graph in place of a drawing showing LAT1 mRNA expression in cBC organoids evaluated by real-time PCR. Figure 1C is a photograph and graph of Western blotting gel electrophoresis in place of a drawing showing protein expression by Western blotting. Figure 1D is a fluorescent micrograph in place of a drawing showing protein expression by immunofluorescence staining. Figure 2A is a fluorescent micrograph, optical micrograph, and graph showing the ratio of amino acid uptake cells in place of a drawing showing amino acid uptake in cells. Figure 2B is a graph in place of a drawing showing cell viability in bladder cancer organoids 72 hours after JPH203 treatment. Figure 3A is a photograph in place of a drawing showing Western blotting showing the effect of JPH203 on the mTOR signaling pathway over time in cBC1 organoids. Figure 3B is a graph showing Western blotting indicating the effect of JPH203 on the mTOR signaling pathway in cBC1 organoids. Figure 3C is a schematic diagram of the PI3K / Akt / mTOR signaling pathway and the mechanism of JPH203 treatment. Figure 4A is a graph showing the results of tumor size measurements, indicating the tumor growth inhibitory effect of JPH203 on immunodeficient mice bearing canine bladder tumors. Figure 4B is a graph showing the results of average tumor weight measurements, indicating the tumor growth inhibitory effect of JPH203 on immunodeficient mice bearing canine bladder tumors. Figure 4C is a photograph showing tumors evaluated from mice sacrificed on day 19 after JPH203 treatment. Figure 4D is a photograph and graph showing Western blotting gel electrophoresis confirming LAT1 expression in tumor tissues collected from mice sacrificed on day 19 after JPH203 treatment. Figure 4E is a photograph in place of a drawing showing immunohistochemical staining confirming LAT1 expression in tumor tissue collected from mice sacrificed on day 19 after JPH203 treatment. Figure 5A is a photograph and graph in place of a drawing showing immunohistochemical staining (IHC) of mTOR and phospho-mTOR in tumor tissue collected from mice sacrificed on day 19 after JPH203 treatment.Figure 5B is a TUNEL staining photograph (in place of a drawing) of tumor tissue collected from mice sacrificed on day 19 after JPH203 treatment. Figure 6 is a graph (in place of a drawing) showing the expression of the LAT1 gene in five types of cancer organoids. Figure 7 is a graph (in place of a drawing) showing tumor cell viability in canine liver cancer and lung cancer. Figure 8 is a graph (in place of a drawing) showing tumor cell viability in feline mammary tumors, canine melanoma, and canine hemangiosarcoma, and the table in the figure is a table (in place of a drawing) showing the cancer cell viability of each individual animal.

[0011] The following describes embodiments of the present invention with reference to the drawings. The present invention is not limited to the embodiments described below, but also includes appropriate modifications of the embodiments that are obvious to those skilled in the art.

[0012] The first invention relates to a therapeutic agent for cancer in a non-human mammal. The therapeutic agent for cancer in a non-human mammal contains an effective amount of O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine (JPH203) or a pharmaceutically acceptable salt thereof as an active ingredient. O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine is known as an LAT1 inhibitor and is a known compound known as JPH203 or nanvuranlat. JPH203 is commercially available and can be obtained by purchasing it.

[0013] A pharmaceutically acceptable salt thereof is a salt of O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine. Examples of salts include inorganic acid salts, organic acid salts, inorganic base salts, organic base salts, and acidic or basic amino acid salts. Examples of inorganic acid salts include hydrochloride, hydrobromide, sulfate, nitrate, and phosphate. Examples of organic acid salts include acetate, succinate, fumarate, maleate, tartrate, citrate, lactate, stearate, benzoate, methanesulfonate, and p-toluenesulfonate. Examples of inorganic base salts include alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as calcium salt and magnesium salt, aluminum salt, and ammonium salt. Examples of organic base salts include diethylamine salt, diethanolamine salt, meglumine salt, and N,N'-dibenzylethylenediamine salt. Examples of acidic amino acid salts are aspartate and glutamate, and examples of basic amino acid salts are arginine, lysine, and ornithine salts.

[0014] Examples of non-human mammals include dogs, cats, and horses. Of these, dogs are preferred. Examples of "cancer" in the cancer therapeutic agent include brain cancer, head and neck cancer, esophageal cancer, thyroid cancer, small cell carcinoma, non-small cell carcinoma, breast cancer, stomach cancer, gallbladder and bile duct cancer, liver cancer, pancreatic cancer, colon cancer, rectal cancer, ovarian cancer, choriothelial carcinoma, uterine cancer, cervical cancer, renal pelvis and ureter cancer, bladder cancer, prostate cancer, penile cancer, testicular cancer, embryonal carcinoma, Wilms' carcinoma, skin cancer, malignant melanoma, neuroblastoma, osteosarcoma, Ewing's tumor, and soft tissue sarcoma. Examples of cancer include lung cancer, hepatocellular carcinoma, kidney cancer, bladder cancer, breast tumor, melanoma, and angiosarcoma. Among these, as demonstrated in the examples, JPH203 can be preferably used for lung cancer, hepatocellular carcinoma, and bladder cancer, and is particularly preferably used for bladder cancer. The agents of certain embodiments disclosed in this specification can be administered orally or parenterally. Examples of parenteral administration include pulmonary dosage forms (e.g., using a nebulizer), nasal dosage forms, transdermal dosage forms (e.g., ointments, creams), and injection dosage forms. Injection dosage forms can be administered systemically or locally by, for example, intravenous injection such as drip infusion, intramuscular injection, intraperitoneal injection, subcutaneous injection, etc.

[0015] The agent of the present invention may contain a known active ingredient (for example, an active ingredient for treating cancer) in addition to JPH203.

[0016] The method of administration of the agent of the present invention is appropriately selected depending on the age, body weight, and symptoms of the target organism. The dose of JPH203 per kg of body weight may be 10 μg to 100 mg, 0.1 mg to 100 mg, 10 mg to 100 mg, or 0.1 mg to 10 mg per kg of body weight. However, the dose of the therapeutic agent is not limited to these doses. The frequency of administration may also be adjusted appropriately.

[0017] The agent of the present invention can be formulated according to conventional methods and may contain pharmaceutically acceptable carriers and additives. Examples of such carriers and additives include water, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, carboxyvinyl polymers, sodium carboxymethylcellulose, sodium polyacrylate, sodium alginate, water-soluble dextran, sodium carboxymethyl starch, pectin, methylcellulose, ethylcellulose, xanthan gum, gum arabic, casein, agar, polyethylene glycol, diglycerin, glycerin, propylene glycol, petrolatum, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sorbitol, lactose, and surfactants acceptable as pharmaceutical additives. The additives may be selected individually or in appropriate combinations depending on the dosage form of the therapeutic agent of the present invention. For example, when used as an injectable formulation, the active ingredient may be dissolved in a solvent (e.g., physiological saline, buffer solution, glucose solution, etc.) and then Tween 80, Tween 20, gelatin, human serum albumin, etc. may be added to the solution.

[0018] The second invention relates to a method for predicting the efficacy of O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine or a pharmaceutically acceptable salt thereof against canine cancer, which method comprises measuring either or both of the amount of LAT1 protein and the amount of LAT1 mRNA contained in a canine-derived measurement object (e.g., excised canine cancer tissue, blood, or urine, particularly canine urine).

[0019] For example, urine is collected from a dog suffering from a cancer for which efficacy in dogs has been established. Then, the amount (concentration) of LAT1 protein and / or the amount (concentration) of LAT1 mRNA contained in the urine are measured. Substances that bind to LAT1 protein and substances that bind to LAT1 mRNA are known. For example, the amounts of LAT1 protein and LAT1 mRNA in urine can be measured using markers attached to LAT1 protein or LAT1 mRNA. If the amounts of LAT1 protein and LAT1 mRNA are equal to or greater than a threshold, JPH203 can be determined to be effective as a cancer therapeutic agent.

[0020] L-type amino acid transporter 1 (LAT1), which regulates the uptake of neutral amino acids across the cell membrane, has been found to be frequently overexpressed in various human cancers. LAT1 overexpression is associated with increased tumor proliferation and shortened patient survival, and it has been used as a prognostic biomarker in some tumors. Previous studies have shown that selective inhibition of LAT1 by the small molecule compound JPH203 demonstrated potent anticancer effects in human leukemia cells and colon tumors. In this example, we confirmed increased LAT1 expression in canine bladder cancer (cBC) and found that JPH203 effectively suppressed tumor growth in vitro and in vivo. Bladder cancer (BC) cells were surgically harvested from dogs with spontaneous tumors at a veterinary clinic in Japan, and a 2.5D cancer organoid culture system was generated according to previous reports. Increased LAT1 expression was observed in two cBC organoid lines compared with other canine cancers and normal bladder cells by real-time PCR, immunofluorescence staining, and Western blot analysis. JPH203 treatment demonstrated dose-dependent cytotoxicity in LAT1-overexpressing BC organoids, with an IC50 of 11.9 μM. Furthermore, treatment inhibited amino acid uptake by more than 90%. In vivo, intraperitoneal administration of JPH203 significantly reduced the growth and weight of mouse cBC organoid-derived xenografts, along with the induction of apoptosis and reduced LAT1 expression, compared with vehicle-treated mice. Therefore, in this example, we first demonstrated that JPH203 is a promising therapeutic agent for cBC through downregulation of overexpressed LAT1.

[0021] JPH203, an L-amino acid transporter 1 (LAT1) inhibitor, was provided by Codec Chemical Co., Ltd. (Tokyo, Japan). TMCell viability reagent was purchased from Thermo Fisher Scientific Inc. (Massachusetts, USA), and amino acid uptake assay kit was purchased from Dojindo Laboratories Co., Ltd. (Kumamoto, Japan). Tween® 20 was purchased from Sigma-Aldrich Chemical (St. Louis, MO, USA), and dimethyl sulfoxide (DMSO) was purchased from Wako Pure Chemical Corporation (Osaka, Japan). For cell culture, the components of the medium were as follows:

[0022] Advanced Dulbecco's Modified Eagle's Medium (DMEM) / F12 (Termo Fisher Scientific Inc.) was supplemented with 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; WAKO Pure Chemical Corporation), 1% GlutaMax (Termo Fisher Scientific Inc.), 10 mM nicotinamide (Sigma-Aldrich Chemical), 1 mM N-acetyl-L-cysteine ​​(Sigma-Aldrich), and 1% HCl (Sigma-Aldrich). Chemical), 0.5 μM A83-01 (Adooq Bioscience, Irvine, CA, USA), 1% penicillin-streptomycin (PS; WAKO Pure Chemical Corporation), and 5% fetal bovine serum (FBS; Termo Fisher Scientific Inc.) were added.

[0023] SLC7A5 (LAT1) antibody (catalog no. orb158412) was purchased from Biorbyt Ltd. (Cambridge, UK). mTOR antibody (catalog no. 2972), Phospho-mTOR (Ser2481) antibody (catalog no. 2974), Akt antibody (catalog no. 9272), Phospho-Akt (Ser473) antibody (catalog no. 4060), 4E-BP1 (53H11) rabbit antibody (catalog no. 9644), Phospho-4E-BP1 (Thr37 / 46) (236B4) rabbit antibody (catalog no. 2855), S6 ribosomal protein (54D2) mouse antibody (catalog no. 2317), and Phospho-S6 ribosomal protein (Ser235 / 236) (D57.2.2E) rabbit antibody (catalog no. 4858) were purchased from Cell Signaling. VCP antibody (catalog no. GTX113030) was purchased from GeneTex Inc. (Irvine, CA, USA).

[0024] The secondary antibodies were goat anti-rabbit IgG H&L (Alexa Fluor® 488) (catalog no. ab150077, Abcam, Cambridge, UK), horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (catalog no. 10004301, Cayman), and Dako Envision+dual Link System-HRP (catalog no. K4061, Agilent Technologies Inc., Santa Clara, CA, USA). Polymerase chain reaction (PCR) primers were purchased from FASMAC Co. Ltd. (Kanagawa, Japan). Hoechst 33258 solution (catalog no. 19173-41, Nacalai Tesque Inc., Kyoto, Japan) was used for nuclear staining.

[0025] Canine tumor tissues or urine were collected from veterinary clinics in Japan between 2019 and 2022. Written informed consent was obtained from all dog owners, and the study was conducted under the approval of the Tokyo University of Agriculture and Technology Animal Care and Use Committee. Samples were transported in chilled transport media. Two-and-a-half-dimensional (2.5D) tumor or normal organoids were generated, passaged, and processed according to the methods described in a previous study.

[0026] Quantitative Real-Time Reverse-Phase Polymerase Chain Reaction Assay. Total RNA (tRNA) was extracted from 2.5D organoids using the FavorPrep Tissue Total RNA Mini Kit (FAVORGEN, Pingtung, Taiwan) according to the manufacturer's guidelines. The extracted tRNA was reverse-transcribed to generate complementary DNA (cDNA) using the ReverTra Ace™ qPCR RT Master Mix (TOYOBO co., LTD., Osaka, Japan). Quantitative real-time PCR was performed using the QuantiTect SYBR I Kit (QIAGEN N.V., Venlo, The Netherlands) and StepOne. TM The data were analyzed using a real-time PCR system (Applied Biosystems, Waltham, MA, USA). ΔΔC was used to quantify the data using GAPDH as an endogenous control. q The specific canine LAT1 primers used in this example are as follows: Forward: GCTGTGGACTTTGGGACCTA (SEQ ID NO: 1) Reversed: CTGGAGAAGGCGTAAAGCAG (SEQ ID NO: 2)

[0027] Immunofluorescence staining of cBC 2.5D organoids was performed according to the previously described method. Briefly, 2.5D cBC organoids (2 × 10 5Cells (1000 x g / well) were seeded onto a 6-well plate with a cover glass. After reaching 70% confluence, the cells were fixed with 4% paraformaldehyde (PFA) solution at room temperature for 30 minutes. After washing with PBS, the cells were blocked with 1.5% normal goat serum at room temperature for 30 minutes. The cells were then treated with SLC7A5 (LAT1) antibody for 120 minutes at room temperature. This was followed by a PBS wash and subsequent treatment with the secondary antibody goat anti-rabbit IgG H&L and the nuclear stain Hoechst 33258. After 1 hour of incubation at room temperature, the expression was observed under a microscope (BX52-DP72, Olympus, Tokyo, Japan) in the dark.

[0028] Expression and phosphorylation levels of LAT1 and related signaling pathway proteins were analyzed by Western blot analysis according to standard guidelines. Proteins from each cell line were extracted using CelLytic™ M (Sigma-Aldrich, Missouri, USA). Equal amounts of protein (5-10 μg) were loaded and separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; Mini-PROTEAN TGX Gels, BIO-RAD Laboratories, Inc., USA), and then transferred to a PVDF membrane (Clear Blot P+ membrane, ATTO Corporation, Tokyo, Japan). After protein blocking with skim milk, the membranes were incubated with primary antibodies (SLC7A5, mTOR, p-mTOR, Akt, p-Akt, 4E-BP1, p-4E-BP1, S6 Rib, p-S6 Rib, and VCP) overnight at 4°C. After washing, the membranes were treated with secondary antibodies (HRP-conjugated anti-rabbit IgG) at room temperature for 1 hour. Images were acquired using an LAS-3000 image analyzer (Fujifilm, Tokyo, Japan), and quantified using Image J software with VCP as a protein control.

[0029] The amino acid transport activity of cBC organoids was quantified using an amino acid uptake assay according to the manufacturer's guidelines. Briefly, cBC organoids were plated in 24-well plates at 3 × 10 4The cells were seeded at a density of 100 μg / mL and incubated overnight. The cells were washed three times with 0.1% glucose / PBS solution and then treated with JPH203 or DMSO (control group) for 5 minutes at 37°C. After removing the solution, the organoids were refrigerated with a boronophenylalanine (BPA) solution containing JPH203 or DMSO and incubated for another 5 minutes at 37°C. After washing three times with 0.1% glucose / PBS solution, the fluorescent probe solution was added. Images were taken with a fluorescence microscope (BZ-9000; KEYENCE, Tokyo, Japan) and quantified using Image J software.

[0030] The experiment followed the recommendations of the "Guide for the Care and Use of Laboratory Animals" and was approved by the Ethics Committee of Tokyo University of Agriculture and Technology. Male SCID (C.B-17 / IcrHsd-Prkdcscid, Japan SLC, Shizuoka, Japan) mice were obtained from Japan SLC Inc. (Shizuoka, Japan). A mouse xenograft model of 2.5D cBC organoids was performed according to previously described methods. Briefly, 1 × 10 6 The organoids were subcutaneously injected into the right flank of the mice. After transplantation, the longest and shortest diameters of the tumor were measured using a Vernier scale, and the tumor volume was calculated as V = 1 / 2 (L × W). 2 ) where L is the longest diameter (length) and W is the shortest diameter (width). 3 After reaching 10 days (day 1), mice were divided into two groups (n = 10) and administered JPH203 intraperitoneally at a dose of 50 mg / kg five times a week. Tumor volume and body weight were measured twice a week. After the third cycle of JPH203 treatment, mice were anesthetized with isoflurane and tumors were dissected. Tumor weight was measured, and then tumor tissues were embedded in 4% PFA overnight for paraffin embedding. Alternatively, tumor tissues were stored at -20°C for protein extraction. Paraffin-embedded tissues were further prepared for H&E staining and immunohistochemistry.

[0031] H&E staining of xenografted tumor fragments was performed according to standard procedures using paraffin-embedded tissue, and images were acquired under a light microscope (BX43; Olympus, Tokyo, Japan). Immunohistochemical staining was performed. After deparaffinization of tumor tissue fragments, antigen retrieval was performed using citrate buffer at 121°C for 5 minutes, and endogenous peroxidase activity was quenched with 1% peroxidase at room temperature for 30 minutes. The fragments were then blocked with 10% normal goat serum for 30 minutes, stained with the primary antibody, and stored overnight at 4°C. After washing, the fragments were treated with Dako Envision+ Dual Link System-HRP according to the manufacturer's instructions. Images were acquired under a light microscope and quantified using ImageJ software.

[0032] Data are presented as mean ± mean error (SEM). Statistical evaluation was performed using one-way analysis of variance (ANOVA) followed by Student's t-test. Statistical analysis was performed using Sigma Plot 14.0 (Systat Software, Inc., Palo Alto, CA, USA). A P value of 0.05 or less was considered significant.

[0033] LAT1 gene expression was evaluated in patient-derived 2.5D canine tumor organoids, including mammary tumor (MT), hepatocellular carcinoma (HCC), renal tumor (KT), melanoma (ML), and bladder cancer (BC), using comparative CT. Significantly higher LAT1 expression was observed in canine BC (cBC) organoids compared with other tumor organoids (Figure 1A). Compared with normal bladder (NB) organoids, cBC also showed significantly higher LAT1 gene and protein expression (Figure 1B, C). Consistently, intracellular expression of LAT1 was detected in cBC organoids by immunofluorescence (Figure 1D). The percentage of LAT1-positive cells was 53.6% in cBC1 organoids and 36.8% in cBC2 organoids.

[0034] Figure 1 is a graph showing LAT1 expression in canine cells. (A) and (B) mRNA expression was assessed by real-time PCR (n = 5 for cBC and NB, n = 3 for others). Relative quantification was normalized by GAPDH. Abbreviations: MT, breast tumor; HCC, hepatocellular carcinoma; KT, renal tumor; ML, melanoma; BC, bladder cancer; NB, normal bladder. Protein expression was assessed by (C) Western blotting and (D) immunofluorescence staining. VCP was used as a protein loading control.

[0035] The effects of JPH203, a LAT1 inhibitor, on amino acid uptake and cell viability were investigated in patient-derived 2.5D cBC organoids. Based on the results of an amino acid uptake assay kit, JPH203 treatment significantly suppressed amino acid uptake in cBC organoids compared with DMSO treatment (Figure 2A). JPH203-induced cell viability inhibition was assessed in cBC1 organoids, which have high LAT1 expression, and cBC2 organoids, which have low LAT1 expression, after 72 hours of treatment. As shown in Figure 2B, both cBC1 and cBC2 showed dose-dependent cell suppression upon JPH203 treatment. Of the two cBC organoid lines, cBC1 was more sensitive to JPH203 treatment. In contrast, cBC2 organoids tended to be resistant to JPH203.

[0036] Figure 2. (A) Inhibition of amino acid transporters in bladder cancer cells was detected by amino acid uptake assay. Fluorescence was detected by incubating BC1 cells with an amino acid analog (boronophenylalanine) and a membrane-permeable fluorescent probe followed by treatment with or without JPH203. Quantification of fluorescence intensity was normalized by the number of cells in each image (n = 3). (B) Cell viability of bladder cancer cells 72 hours after treatment with JPH203 at three different doses (0.3, 3, and 30 μM) and without treatment (0 μM).

[0037] We examined the effects of JPH203 on the mTOR signaling pathway in cBC1 organoids (Figure 3). Phosphorylation of mTOR was decreased at 3 hours after JPH203 treatment, and phosphorylation of ribosomal protein S6 and Akt was decreased at 1 hour and continued for up to 24 hours. Phosphorylation of 4E-BP1 was decreased at 3 hours after JPH203 treatment but recovered to initial levels at 24 hours. There was little change in the overall protein levels of ribosomal protein S6, 4E-BP1, Akt, and mTOR.

[0038] Figure 3. (A) and (B) Phosphorylation of proteins involved in amino acid-dependent translation regulation was identified by Western blotting after JPH203 treatment in bladder cancer cells. VCP was used as a protein loading control. (C) Schematic diagram of the PI3K / Akt / mTOR signaling pathway and the mechanism of JPH203 treatment.

[0039] The antitumor activity of JPH203 was investigated in cBC organoids transplanted into immunodeficient mice (n = 10 per group). JPH203 was administered intraperitoneally at a dose of 50 mg / kg five times a week. Tumor growth was suppressed by JPH203 after 12 days of administration, and on day 19, the average tumor size was significantly reduced compared to control mice (Figure 4A). After the third cycle of JPH203 administration, mice were sacrificed, and tumors were collected for further experiments. As shown in Figures 4B and 4C, the average tumor weight was significantly reduced after JPH203 treatment, although some tumors showed reduced response to JPH203 treatment. Compared to control animals, a 10% weight change, considered an indicator of toxicity, was observed in JPH203-treated mice on day 15 after administration, and two mice died on day 18.

[0040] Furthermore, LAT1 expression was also investigated in JPH203-treated xenograft cBC tumors by Western blotting and immunohistochemistry. As shown in Figures 4D and 4E, LAT1 protein expression was significantly reduced after JPH203 treatment compared with the control group, indicating changes in LAT1 expression after LAT1-targeted therapy. Next, we also evaluated the regulation of mTOR phosphorylation in xenograft cBC tumors. Phospho-mTOR protein expression was reduced in JPH203-treated tumor tissues, but no significant changes in mTOR expression were observed (Figure 5A). Furthermore, a TUNEL assay was performed on xenograft tumor tissues to evaluate apoptotic cells after JPH203 treatment. As shown in Figure 5B, a few apoptotic cells were observed in the JPH203-treated tumor tissues, whereas few were observed in the control group.

[0041] Figure 4. Tumor growth suppression by JPH203 in immunodeficient mice bearing canine bladder tumors. (A) Tumor size was measured twice weekly for 19 days. (B) Average tumor weight and (C) photographs of tumors assessed from mice sacrificed on day 19 after JPH203 treatment. LAT1 expression in tumor tissues collected from mice sacrificed on day 19 after JPH203 treatment was investigated by (D) Western blotting and (E) immunohistochemistry. VCP was used as a protein loading control.

[0042] Figure 5. Immunohistochemical staining (IHC) of mTOR and phospho-mTOR in tumor tissues collected from mice sacrificed on day 19 after JPH203 treatment. Quantitation of IHC intensity was normalized by the number of cells in each image (n=5). (B) TUNEL staining in tumor tissues collected from mice sacrificed on day 19 after JPH203 treatment.

[0043] Expression of LAT1 mRNA in 2.5D organoids from various canine cancer tissues <Materials and Methods> 1. Materials The following is the composition of the medium for 2.5D organoids. (The name of the reagent manufacturer is written in parentheses.) Dulbecco's Modified Eagle Medium (DMEM) / F12 (Thermo Fisher Scientific Inc.) , Waltham, MA, USA), 1% GlutaMax (Thermo Fisher Scientific Inc.), 10 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES; WAKO, Osaka, Japan), 1 mM N-acetyl-L-cysteine ​​(Sigma-Aldrich), 10 mM nicotinamide (Sigma-Aldrich, St. Lewis, MO, USA), 0.5 μM A83-01 (Adooq Bioscience, Irvine, CA, USA), 50 ng / ml epidermal growth factor (EGF) (Thermo Fisher Scientific Inc.), 1% penicillin-streptomycin (PS; WAKO), and 5% fetal bovine serum (FBS; Thermo Fisher Scientific).

[0044] 2. 2.5D Organoid Creation Tissue samples surgically removed from cancer-affected dogs, including melanoma, mammary tumor, renal cancer, hepatocellular carcinoma, and lung cancer, were processed as follows to create 2.5D organoids. Each solid tumor tissue was aseptically minced using microsurgical scissors in a 6-cm Petri dish on ice and washed with sterile phosphate-buffered saline (PBS). The minced tissue was placed in prewarmed (37°C) DMEM medium containing 0.125 mg / ml collagenase type I and type II (Liberase TH, Roche Diagnostics, Germany), and the tube was incubated in a shaking water bath at 37°C for 30 minutes. The cells were then treated with trypsin TrypLE Express Solution (Thermo Fisher Scientific Inc.) at 37°C for 5 minutes. They were then filtered through a 70 μM nylon filter. The cell pellet was cultured in 2.5D organoid medium (normal DMEM supplemented with 10% FBS and 1% HCl).

[0045] 3. Passaging of 2.5D Organoids After reaching 70-80% confluence, cells were passaged to new dishes. New 6 cm dishes were used at a ratio of 1:3-4. 1 ml of 5 mM ethylenediaminetetraacetic acid (EDTA) / PBS was transferred to the 6 cm dish and placed in a CO2 incubator at 37°C for 10 minutes to detach the cells, after which the solution was collected in a 15 ml tube. Next, 1 ml of TrypLE was added and heated at 37°C for 3-5 minutes to isolate the cells. The collected cell pellet was mixed with 2.5D organoid medium and transferred to a new 6 cm dish for subsequent experiments.

[0046] 4. Quantitative Real-Time Reverse-Phase Polymerase Chain Reaction Assay. Total RNA (tRNA) was extracted from 2.5D organoids using the FavorPrep Tissue Total RNA Mini Kit (FAVORGEN, Pingtung, Taiwan) according to the manufacturer's guidelines. The extracted tRNA was reverse-transcribed to cDNA using the ReverTra Ace™ qPCR RT Master Mix (TOYOBO Co., Ltd., Osaka, Japan). Quantitative PCR was performed using the QuantiTect SYBR I Kit (QIAGEN N.V., Venlo, The Netherlands) and the StepOne™ Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). The ΔΔC_q method was employed to quantify the data using GAPDH as an endogenous control. The specific canine LAT1 primers used in this example are as follows: Forward: GCTGTGGACTTTGGGACCTA (SEQ ID NO: 1) Reversed: CTGGAGAAGGCGTAAAGCAG (SEQ ID NO: 2)

[0047] <Explanation of Results> Figure 6 shows the expression of the LAT1 gene in five types of cancer organoids. Organoids were created using the above method from cancer tissues of two different dogs for melanoma, and from cancer tissues of one dog each for breast cancer, oral cancer, renal cancer, and hepatocellular carcinoma. LAT1 expression was observed in all five cancer types. The vertical axis represents the PCR measurement results for the cancer-specific LAT1 gene, expressed as a ratio of the expression level of glyceralaldehyde-3-phosphate dehydrogenase (GAPDH) found in viable tissue, as a negative control contained in the same sample. Differences between cancer types and individuals were quantified. Measurements confirmed LAT1 expression. In other words, LAT1 expression was found in all canine cancers, similar to human cancers, although there were differences depending on the cancer type and individual differences sampled.

[0048] Effect of JPH203 on Cell Viability in Canine Liver Cancer and Lung Cancer Cells <Creation and Passage of 2.5D Organoids> These methods were the same as those described in Example 1 above, and the experimental method for evaluating sensitivity to JPH203 was the same as that described in the Example demonstrating the efficacy of JPH203 on bladder cancer organoids. <Explanation of Results> Figure 7 is a graph showing cell viability in canine liver cancer and lung cancer cells. Qualitatively similar to the results for bladder cancer organoids, JPH203 demonstrated a concentration-dependent decrease in the viability of each cell after 72 hours (i.e., increased efficacy). The 30 μM group showed a tendency for efficacy to be slightly stronger against hepatocellular carcinoma than against lung cancer.

[0049] The usefulness of JPH203 can be confirmed by demonstrating its efficacy in treating cancers other than those mentioned above in dogs. Furthermore, the therapeutic effect of JPH203 on cancer in non-human mammals other than dogs can be demonstrated using cancer cells from various animal species. Furthermore, its efficacy can be confirmed by administering an agent containing JPH203 to a subject species actually suffering from cancer. Because the mechanisms of action generally differ between humans and animals, its efficacy can be confirmed by conducting actual experiments. As described in Example 4, an attempt was made to expand the range of animal species to which the efficacy of an agent containing JPH203 was administered to cat mammary tumors.

[0050] Effect of JPH203 on the viability of various cancer cells in feline mammary tumors, canine melanoma, and canine hemangiosarcoma <Creation and passage of 2.5D organoids> These methods were the same as those described in Example 1 above, and the experimental method for sensitivity to JPH203 was the same as that used in the example demonstrating the efficacy of JPH203 on bladder cancer organoids. However, the JPH203 concentration was compared between dogs and cats under the same conditions.

[0051] <Explanation of Results> Figure 8 shows graphs (in place of drawings) showing tumor cell viability in feline mammary tumors, canine melanoma, and canine hemangiosarcoma, and the tables in the figures show cancer cell viability in each individual animal. In Example 4, cancer tissues were excised from cats and dogs with feline mammary tumors, canine melanoma, and canine hemangiosarcoma, and 2.5D cancer organoids were created from these cancer tissues. These cancer organoids were cultured with 1, 3, 10, and 30 μM JPH203 for 72 hours, and the cancer cell viability, an indicator of anticancer activity, was measured. The top three examples in Figure 8 show the results for different feline mammary tumors. Similarly, the middle row shows the results for canine malignant melanoma, and the bottom row shows the results for canine hemangiosarcoma. The vertical axis of each graph indicates the viability of each cell, and differences between individual cats and dogs are observed. The table in the figure shows the survival rate of cancer cells, expressed as a percentage, with the value before administration of JPH203 set at 100. As is clear from the graph and table, although differences were observed between patients, the survival rate of cancer cells was lower than 100% in all cases. In other words, an anti-cancer effect was observed without exception. What makes this result so significant in terms of anti-cancer effect is that repeated administration of the drug results in a power-of-magnitude effect as the anti-cancer effect increases with each administration. This will be discussed in the "Discussion" section below. [Discussion]

[0052] <Background of this patent application: Is it possible to predict the onset of cancer?> We consider the changes in the history of cancer diagnosis in humans. In the last century, patients diagnosed with cancer were often not informed of the name of their disease. The reason was simple: because cancer was a disease that quickly led to death, patients were often not told the name of their disease. Instead, for example, stomach cancer was often referred to as a gastric ulcer, a milder form of the disease. This was done to lessen the seriousness of the disease and prevent patients from becoming overly depressed. In this century, informing cancer patients of their actual disease name has become common. While the diversification of cancer treatments is one factor, another is encouraging patients to be aware of their own preparations for death and to control and respect their own right to life. Although advances in cancer treatment have led to an increase in cases where treatments actually contribute to life extension, the possibility of direct death remains unchanged. Because cancer remains a threat to life extension, informing patients of their cancer has become common practice. However, predicting cancer incidence remains difficult.

[0053] <Non-human animals and cancer predictions> Currently, various animals have become indispensable in human life, such as as pets. Like humans, these animals are experiencing longer lifespans and an increase in the number of diseases associated with aging. As mentioned above, cancer, which is extremely difficult to treat, is considered one of the most serious diseases, just like in humans. Currently, the number of animals kept as pets in Japan is said to be approximately 9 million cats and 6 million dogs. It is said that approximately half of dog deaths are due to cancer, a fairly high rate, similar to that in humans.

[0054] <Types of Cancer and Disease Names> Cancers are divided into solid cancers, which are visible as tumors, and non-solid cancers, which are not. However, many types of cancer are named by adding "cancer" to the name of the organ, tissue, or tissue in which the cancer is found, such as stomach cancer, liver cancer, and skin cancer. After a certain period of observation, depending on the nature of the cancer, it may be referred to as a benign or malignant tumor (cancer). Depending on the judgment and test results of a doctor, veterinarian, or dentist, the stage of cancer may be expressed as grade I to IV. It is important to understand that while cancers with the same name may have similarities, there is a wide range of differences that make them not identical. In other words, when viewed individually, there is no uniform pathology; there are as many types of cancer as there are patients, and individual differences are significant.

[0055] <Regarding Genetic Polymorphisms in Cancer-Inducing Molecules> Gene sequences expressing cancer-inducing target molecules differ significantly between humans and non-human mammals. Furthermore, it is known that the gene sequences encoding cancer-inducing target molecules differ (genetic polymorphisms exist) among different races within humans (humans; abbreviated as "h"). The differences in genetic polymorphisms between the phylogenetic trees of biological development in non-human mammals, such as dogs (canines; abbreviated as "c") and cats (felines; abbreviated as "f"), are thought to be greater than those observed among human races. Because the gene sequences of cancer-inducing target molecules and the amino acid sequences of the various expressed target molecules differ significantly between humans and non-human mammals, there are cases in which anticancer drugs effective in humans are ineffective against cancers in non-human mammals. As mentioned above, just as there are racial differences among humans, there are many different types of dogs and cats, and further detailed research is needed.

[0056] <About the Present Invention> Although the amino acid sequences of LAT1 differ among humans (human LAT1; hLAT1), dogs (canine LAT1; cLAT1), and cats (feline LAT1; fLAT1) (they share only about 80% to 90% homology), it has not yet been demonstrated in detail whether JPH203 binds to canine cLAT1 and inhibits its function. Furthermore, the amino acid sequence of feline fLAT1 also differs from that of humans and dogs. Therefore, just because JPH203 inhibits hLAT1 in human cancers, it cannot be predicted that it will also be effective in canine and feline cancers.

[0057] Because drugs are foreign substances to the body, they have the ability to be excreted from the body. This process, called pharmacokinetics, consists of four steps: drug absorption, distribution, metabolism, and excretion. Metabolism is extremely important, and the differences between humans and non-humans and their significance are explained below. One of the important factors related to the evaluation of the anticancer effect of this drug is the drug's metabolic enzymes. It is known that this drug is metabolized in the body by N-acetyltransferase and loses its efficacy. It is important to note that there are significant species differences in the enzymatic activity of this drug between humans, dogs, and cats. Specifically, humans contain the metabolic enzyme NAT2 (N-acetyl transferase 2), which metabolizes this drug and attenuates its effect, mainly in the liver. In contrast, dogs genetically lack this enzyme almost completely. Cats also experience similar deletion, although to a lesser extent than dogs (Veterinary Toxicology (Second Edition), edited by the Japanese Society of Comparative Pharmacology and Toxicology, edited by Teraoka Hiroki, Ishizuka Mayumi, Sato Koichi, and Nakamura Kazuichi, Kindai Publishing Co., Ltd., March 1, 2022). Due to these differences, JPH203 is metabolized by NAT2 in the human body, and therefore remains in the body for a shorter time than in dogs and cats. For this reason, it is estimated that the duration of the pharmacological effect of JPH203 in dogs and cats is longer than in humans, and that the pharmacological effect is stronger and maintained for a longer period than in humans.

[0058] Next, based on the data presented here, we consider the anti-cancer effects of this drug and assert the following: From the results of Figure 8, we can infer the following significant differences between the anti-cancer effects of humans and non-humans (dogs and cats): 1) When 2.5D organoids created from cancer tissues of three cats with mammary adenocarcinoma (mammary tumors), three canine melanomas, and three canine hemangiosarcomas were treated with JPH203 at concentrations of 1, 3, 10, and 30 μM for 72 hours, the survival rate of cancer cells decreased in all cases (confirmation of anti-cancer effect). 2) On the other hand, although data is not shown, in the case of human cancer, it is rare for the effectiveness of an anti-cancer drug to be observed in all cases of nine cancer patients with the same disease. Therefore, when comparing the effects in humans and these animals, the common anti-cancer effects observed in dogs and cats, as described above in 1), are in contrast to those observed in humans. Comparing these data suggests that LAT1 expressed in canine and feline tumor cells shares a common sensitivity to JPH203, albeit to varying degrees. 3) Next, we consider the case where this drug is administered to a living organism. In clinical practice, multiple doses are typically administered to non-human and human cancer patients. As seen in the data presented here, the initial anticancer effect was lower in all cases than the survival rate of cancer cells without anticancer drug administration (100%). Repeating this procedure several times is expected to result in a power-wise decrease in cancer cell survival. Therefore, the anticancer effect of JPH203 in canines and felines is considered to be stable and significantly higher than its effect in humans.

[0059] <Summary of Results> 1. The sensitivity (effect) of LAT1 to this drug was observed to be roughly the same in dogs and cats, although to a lesser extent. This result was in stark contrast to that in humans. 2. There were significant differences in the metabolic enzyme activity of this drug between humans, dogs, and cats, and it was found that dogs and cats genetically lack this enzyme. This suggests that the drug has a longer residence time in the body compared to humans, resulting in a longer duration of efficacy.

[0060] The present invention can be preferably used in the field of animal medicine.

Claims

1. A therapeutic agent for cancer in non-human mammals, comprising O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine or a pharmaceutically acceptable salt thereof as an active ingredient.

2. The agent according to claim 1, wherein the non-human mammal is a dog or a cat.

3. The agent according to claim 1, wherein the non-human mammal is a dog.

4. The agent according to claim 2, wherein the cancer is lung cancer, hepatocellular carcinoma, kidney cancer, bladder cancer, breast tumor, melanoma, or angiosarcoma.

5. The agent according to claim 2, wherein the cancer is lung cancer, hepatocellular carcinoma, or bladder cancer.

6. The agent according to claim 2, wherein the cancer is bladder cancer.

7. A method for predicting the efficacy of O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine or a pharmaceutically acceptable salt thereof against cancer in a dog, comprising a step of measuring either or both of the amount of LAT1 protein and the amount of LAT1 mRNA contained in a canine-derived measurement object, wherein the canine-derived measurement object is excised cancer tissue, blood, or urine from the dog.

8. The method according to claim 7, wherein the canine-derived measurement object is canine urine.

Citation Information

Patent Citations

  • Pharmaceutical composition for cancer treatment in patient having specific gene marker

    WO2021040042A1