Insecticidal protein and use thereof

Abstract

An insecticidal protein, a nucleic acid molecule encoding the protein, and a method and the use thereof for controlling Lepidopteran pests. The insecticidal protein contains an amino acid sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 33. The modified Cry1Da1 protein has a better insecticidal effect, with significantly greater insecticidal activity compared to the patented protein BD1-002.

Description

Insecticidal proteins and uses thereof TECHNICAL FIELD

[0001] The present application relates to an insecticidal protein, a nucleic acid molecule encoding the protein, and methods and uses thereof for controlling lepidopteran pests. BACKGROUND

[0002] Currently, biological stress (such as diseases and insect pests, etc.) and non-biological stress (such as drought, cold and salt, etc.) faced by agricultural production cause the growth potential of crops to weaken, and the yield to decrease, which poses a great threat to global food security. Among them, insect pests are one of the main biological stress factors affecting the productivity of agriculture and forestry. With the increasing environmental problems caused by the use of chemical pesticides for pest control, the use of biological insecticides gradually enters the field of vision of people.

[0003] Bacillus thuringiensis (Bt) is a gram-positive bacterium widely distributed in nature. The biggest feature of Bt bacteria that distinguishes other Bacillus is that crystal proteins are formed with the formation of spores in the late growth period, which are generally called parasporal crystals. Bt strains are considered to be an insect pathogen, and its pathogenicity mainly or completely depends on parasporal crystal proteins. In recent years, a large number of literatures have reported that various Bt proteins have insecticidal activity against Lepidoptera, Coleoptera, Diptera, Hymenoptera, Homoptera, etc. The commercial planting of Bt transgenic insect-resistant crops has become one of the main promoters to greatly improve the productivity of agriculture. In recent years, the industrialization scale of transgenic insect-resistant crops has been continuously expanding, effectively controlling the occurrence and damage of target pests, reducing the application of chemical insecticides, and providing an important guarantee for food and ecological safety.

[0004] Long-term and large-scale planting of Bt transgenic crops may lead to the development of Bt resistance in pests, which is a key factor affecting the sustainable application of transgenic pest-resistant crops. In order to delay the evolution of pest resistance to Bt crops, the "high dose / refuge" strategy is widely used globally. The theoretical basis of "high dose / refuge" includes two parts: "high dose" and "refuge". Among them, "refuge" refers to the non-transgenic plant host that provides a living space for sensitive individuals of target pests near Bt crops. "High dose" refers to the high dose of insecticidal protein expressed by transgenic pest-resistant crops, which can theoretically kill 100% of sensitive individuals and 95% of sensitive / resistant hybrid individuals in the target pest population. For this reason, countries have a relatively consistent requirement that 25 times the 99% lethal dose of sensitive target pests is used as the standard, and concentrations exceeding this concentration are considered high doses. However, due to the limitations of existing biotechnology and the carrying capacity of plants, the dose of Bt protein expressed in transgenic crops cannot be infinitely increased, and lower Bt expression is beneficial to reduce the metabolic consumption of transgenic plants and improve agronomic traits. Therefore, improving the insecticidal effect of Bt protein in transgenic crops is crucial for the sustainable application of pest-resistant transgenic crops.

[0005] Cry1Da1 protein is a Bacillus thuringiensis parasporal crystal protein, which is a lepidopteran-specific Bt insecticidal crystal protein with a new mechanism. Its receptor in the midgut of lepidopterans is different from other Cry proteins (reference 1), and it has good resistance to a variety of lepidopteran insects, especially Spodoptera pests. However, the insecticidal activity of the Cry1Da1 protein disclosed in the prior art still cannot meet the increasing insecticidal needs of agricultural production. Therefore, there is still an urgent need for Cry1Da1 protein with better insecticidal effect. SUMMARY

[0006] Therefore, the purpose of the present application is to provide a Cry1Da1 protein with better insecticidal effect.

[0007] In a first aspect, the present application provides an insecticidal protein comprising an amino acid sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 33.

[0008] In a second aspect, the present application provides a nucleic acid molecule encoding the insecticidal protein of the present application.

[0009] Preferably, the nucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 33 is as shown in SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 22 or SEQ ID NO: 34, respectively.

[0010] In a third aspect, the present application provides a recombinant expression vector comprising the nucleic acid molecule of the present application.

[0011] In a fourth aspect, the present application provides an insecticidal composition comprising the insecticidal protein of the present application.

[0012] In a fifth aspect, the present application provides a method for controlling a lepidopteran pest, comprising contacting the lepidopteran pest with the insecticidal protein or the insecticidal composition of the present application.

[0013] In a sixth aspect, the present application provides a method for controlling a lepidopteran pest, comprising introducing the nucleic acid molecule or the recombinant expression vector of the present application into a plant, so that the lepidopteran pest feeds on the plant.

[0014] In a seventh aspect, the present application provides the use of the insecticidal protein, the nucleic acid molecule, the recombinant expression vector or the insecticidal composition of the present application for controlling a lepidopteran pest.

[0015] The present application has the following beneficial effects:

[0016] The modified Cry1Dal protein of the present application has a significantly improved mortality rate of lepidopteran pests when fed to the lepidopteran pests. Meanwhile, the transgenic plants expressing the modified Cry1Dal protein of the present application also have more excellent pest resistance effect, and after inoculation of lepidopteran pests, the transgenic plants have a lower leaf damage rate and a higher mortality rate of lepidopteran pests. Therefore, the modified Cry1Dal protein of the present application has better pest resistance activity, and the effect is significantly better than that of the protein BD1-002. BRIEF DESCRIPTION OF DRAWINGS

[0017] FIG. 1 is a construction flow chart of a recombinant cloning vector DBN002A containing the nucleotide sequence of the Cry1Dal related protein BD1-002 of the present application;

[0018] FIG. 2 is a construction flow chart of a soybean recombinant expression vector DBN002A-B containing the nucleotide sequence of the Cry1Dal related protein BD1-002 of the present application;

[0019] Figure 3 is a flow chart of the construction of a recombinant expression vector DBN002A-C containing the Cry1Dal related protein BD1-002 nucleotide sequence of the present application. DETAILED DESCRIPTION

[0020] It should be noted that the technical terms or scientific terms used in the present application should be understood as the common meanings understood by the skilled person in the art, unless otherwise defined.

[0021] The experimental methods used in the following examples are all routine methods, unless otherwise specified. The medicinal material raw materials, reagent materials and the like used in the following examples are all commercially available products, unless otherwise specified.

[0022] In a first aspect, the present application provides an insecticidal protein comprising an amino acid sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 33.

[0023] Those skilled in the art will readily appreciate that advances in the field of molecular biology, such as site-specific mutagenesis and random mutagenesis, polymerase chain reaction methods and protein engineering techniques provide a wide variety of suitable tools and procedural steps for modifying or engineering the amino acid sequences and potentially the genetic sequences of proteins of agricultural interest.

[0024] The genes and proteins described in the present application include not only the specific example sequences, but also parts and / or fragments (including compared to the full-length protein and / or terminal deletions), variants, mutants, substitutions (proteins with substituted amino acids), chimeras and fusion proteins that preserve the insecticidal activity characteristics of the specific examples of proteins.

[0025] In the present application, the engineered Cry1Dal proteins include, but are not limited to, amino acid sequences that share homology with the amino acid sequences set forth in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 33. These sequences typically share greater than 60%, preferably greater than 75%, more preferably greater than 90%, even more preferably greater than 95%, and can be greater than 99% identity / similarity with the sequences of the present application. Preferred nucleotides and proteins of the present application can also be defined according to more specific ranges of identity and / or similarity. For example, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity / similarity with the exemplary sequences of the present application.

[0026] In a second aspect, the present application provides a nucleic acid molecule encoding the pesticidal protein of the present application. Preferably, the nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 33 is set forth in SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 34, respectively.

[0027] The nucleic acid molecule or fragment thereof of the present application hybridizes to the engineered CrylDal gene of the present application under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the engineered CrylDal gene of the present application. A nucleic acid molecule or fragment thereof is capable of specifically hybridizing to another nucleic acid molecule under certain circumstances. In the present application, two nucleic acid molecules are capable of specifically hybridizing to each other if the two molecules so share complementary sequences that form an anti-parallel, double-stranded nucleic acid structure. If the two molecules exhibit 100% complementarity, then one of the molecules is the "exact complement" of the other. In the present application, two nucleic acid molecules are said to exhibit "complete complementarity" when each nucleotide of one of the molecules is complementary to the corresponding nucleotide of the other molecule. If two nucleic acid molecules can hybridize to each other in an antiparallel fashion with sufficient stability to exchange protons without dissociating, then the two molecules are said to be "minimally complementary". Similarly, if two nucleic acid molecules can hybridize to each other in an antiparallel fashion with sufficient stability to exchange protons without dissociating, then the two molecules are said to be "complementary". Deviations from complete complementarity are permitted, as long as the molecules still hybridize to each other with sufficient stability to exchange protons without dissociating. To serve as a primer or probe, a nucleic acid molecule need only be sufficiently complementary to its target nucleic acid to form a stable double-stranded structure under the particular solvent, salt and buffer concentration, and temperature conditions it is being evaluated for its ability to hybridize.

[0028] In the present application, a substantially homologous sequence is a nucleic acid molecule that specifically hybridizes to the complementary strand of another nucleic acid molecule under highly stringent conditions. Suitable stringent conditions for promoting DNA hybridization, for example, about 6.0 x sodium chloride / sodium citrate (SSC) at 45°C, followed by a wash in 2.0 x SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the wash steps can be selected from a low of about 2.0 x SSC at 50°C to a high of about 0.2 x SSC at 50°C. Also, the temperature of the wash steps can range from low to high stringency conditions at room temperature about 22°C to elevated temperatures about 65°C. Both temperature and salt concentration can be varied, either individually or in combination, to achieve the desired stringency level. Preferably, the stringent conditions described herein can be specific hybridization to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 34 in 6 x SSC, 0.5% SDS at 65°C, followed by washing the membrane with 2 x SSC, 0.1% SDS and 1 x SSC, 0.1% SDS each.

[0029] Thus, sequences having insecticidal activity and which hybridize to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 34 of the present application under stringent conditions are included in the present application. These sequences are at least about 40% to 50% homologous, about 60%, 65% or 70% homologous, and even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence homology to the sequences of the present application.

[0030] Due to the redundancy of the genetic code, a variety of different DNA sequences can encode the same amino acid sequence. Alternative DNA sequences which encode the same or substantially the same protein are within the skill of the art. These different DNA sequences are included within the scope of the present application. By "substantially the same" sequences is meant sequences which have amino acid substitutions, deletions, additions or insertions which do not substantially affect the pesticidal activity, as well as fragments which retain pesticidal activity.

[0031] In a third aspect, the present application provides a recombinant expression vector comprising the nucleic acid molecule of the present application.

[0032] A "transgenic" as described herein refers to any cell, cell line, callus, tissue, plant part or plant having a genome that has been altered by the presence of heterologous nucleic acid, such as a recombinant DNA construct. "Transgenic" as described herein includes those initial transgenic events as well as those derived from the initial transgenic event through sexual crosses or asexual reproduction, and does not encompass genomic (chromosomal or extrachromosomal) alterations made by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.

[0033] In a fourth aspect, the present application provides an insecticidal composition comprising the insecticidal protein of the present application.

[0034] "Insecticidal" or "antinsect" as described herein means toxic to a crop pest, thereby achieving "control" and / or "prevention" of a crop pest. Preferably, "insecticidal" or "antinsect" means killing a crop pest. More specifically, the target insect is a lepidopteran pest.

[0035] In a fifth aspect, the present application provides a method of controlling a lepidopteran pest, comprising contacting the lepidopteran pest with the insecticidal protein or insecticidal composition of the present application.

[0036] In a sixth aspect, the present application provides a method of controlling a lepidopteran pest, comprising introducing into a plant the nucleic acid molecule or recombinant expression vector of the present application, such that the lepidopteran pest feeds on the plant.

[0037] "Contacting" as described herein means touching, residing and / or feeding, in particular an insect and / or pest touching, residing and / or feeding on a plant, plant organ, plant tissue or plant cell, either expressing the insecticidal protein in its body or having the insecticidal protein on the surface of the plant, plant organ, plant tissue or plant cell and / or having a microorganism producing the insecticidal protein.

[0038] "Control" and / or "prevention" as used herein means that the Lepidopteran pest is contacted with the CrylDal protein and / or engineered protein thereof, and as a result of the contact, the Lepidopteran pest is inhibited from growing and / or is caused to die. Further, the Lepidopteran pest is contacted with the CrylDal protein by feeding on plant tissue, and as a result of the contact, all or a portion of the Lepidopteran pest is inhibited from growing and / or is caused to die. Inhibition means sublethal, i.e., not lethal but causing some effect on growth and development, behavior, physiology, biochemistry, and organization, such as slowed and / or stopped growth and development. At the same time, the plant is morphologically normal and can be cultivated under conventional methods for the consumption and / or production of products. In addition, a plant and / or plant seed containing a nucleotide sequence encoding a CrylDal protein that controls Lepidopteran pests has reduced plant damage, as compared to a wild-type plant that is not transgenic, under conditions of artificial infestation with Lepidopteran pests and / or natural occurrence of Lepidopteran pests, as manifested by, but not limited to, improved leaf resistance, and / or increased grain weight, and / or increased yield. The "control" and / or "prevention" of Lepidopteran pests by the CrylDal protein is independent, i.e., any tissue of a transgenic plant (containing a nucleotide sequence encoding a CrylDal protein) can simultaneously and / or asynchronously, exist and / or produce the CrylDal protein and / or another substance that controls Lepidopteran pests, and the existence of the other substance does not cause the "control" and / or "prevention" to be fully and / or partially effected by the other substance independent of the CrylDal protein. Typically, in the field, the process of Lepidopteran pests feeding on plant tissue is brief and difficult to observe with the naked eye, and therefore, under conditions of artificial infestation with Lepidopteran pests and / or natural occurrence of Lepidopteran pests, the presence of dead Lepidopteran pests and / or Lepidopteran pests that are inhibited from growing on any tissue of a transgenic plant (containing a nucleotide sequence encoding a CrylDal protein), and / or reduced plant damage as compared to a wild-type plant that is not transgenic, i.e., the methods and / or uses of the present application are achieved, i.e., the methods and / or uses of the present application are achieved by contacting Lepidopteran pests with the CrylDal protein to control Lepidopteran pests.

[0039] In preferred embodiments, the Lepidopteran pest is Spodoptera frugiperda, Helicoverpa armigera, or Spodoptera litura.

[0040] In preferred embodiments, the plant is a monocot or a dicot; in more preferred embodiments, the plant is corn or soybean.

[0041] The term "plant" as used herein refers to any plant, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant cells that are intact plants or plant parts such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, and the like.

[0042] In a seventh aspect, the present application provides the use of the pesticidal protein, nucleic acid molecule, recombinant expression vector or pesticidal composition of the present application for controlling a lepidopteran pest.

[0043] In a preferred embodiment, the lepidopteran pest is Spodoptera frugiperda, Helicoverpa armigera or Spodoptera litura.

[0044] The amino acid and nucleotide sequences referred to herein are shown in the following table:

[0045] The technical solutions of the present application are further illustrated below by specific examples.

[0046] Example 1 Mutation of Cry1Dal protein

[0047] By analyzing the structure of the protein, we found that the loop region of Domain II of Cry1Dal (referred to herein as BD1-001) protein can play an important role in the binding of the receptor, and we focused on the improvement of this region, and mutated multiple amino acid sites. In addition, we found that the replacement of the C-terminal increased the insecticidal activity of the protein to some extent. The protein modification methods are shown in Table 1.

[0048] Table 1 Cry1Dal modified proteins and modification methods

[0049] In the modification method, the first amino acid abbreviation represents the original amino acid in the protein, and the number after it represents the position of the amino acid. The second amino acid abbreviation represents the amino acid placed at this position in the modified protein. The C-terminal of Cry8Ea1 and the C-terminal of Cry1Ac refer to replacing the amino acid sequence after position 606 in the original amino acid sequence with the corresponding amino acid sequence of Cry8Ea1 and Cry1Ac protein.

[0050] Example 2 Construction of in vitro expression vector of Cry1Dal protein and protein purification

[0051] 1. Construction of a recombinant cloning vector containing a Cry1Dal class gene

[0052] 1) After the amino acid sequence of BD1-001 was subjected to site-directed mutagenesis at the amino acid site, the amino acid sequences of BD1-011, BD1-013, BD1-014, BD1-015, BD1-018, BD1-019, BD1-020, BD1-021, and BD1-022 were obtained. After the amino acid sequence of BD1-022 was subjected to C-terminal truncation, BD1-022S was obtained.

[0053] 2) Using the BamHI and HindIII enzyme cutting sites, the nucleotide sequence of BD1-002 (SEQ ID NO: 13) was cloned and ligated to the pET28a plasmid (Novagen, USA, CAT: 69864-3) using the BD1-002 gene as an example, obtaining the recombinant vector DBN002A, and the construction process is shown in Figure 1 (wherein f1 origin represents the replication initiation site of phage f1; Kan represents the kanamycin resistance gene; T7 promoter represents the T7 RNA polymerase promoter; His Tag represents the His tag; BD1-002 represents the BD1-002 nucleotide sequence (SEQ ID NO: 13); T7 terminator represents the T7 terminator). The heat shock method was used to transform the E. coli BL21 (DE3) competent cells (Transgen, China, CAT: CD501). The heat shock conditions were: 50 μL of E. coli BL21 (DE3) competent cells, 10 μL of plasmid DNA, 42°C water bath for 30s; 37°C, 100 rpm shaking culture for 1h; then the cultured product was spread on LB solid plate (1% tryptone, 1% NaCl, 0.5% yeast extract, 1.5% agar) containing 50 mg / L kanamycin, and incubated at 37°C for 12h. A single colony was picked and inoculated in 5 mL of LB liquid medium (1% tryptone, 1% NaCl, 0.5% yeast extract, pH adjusted to 7.5 with NaOH), and 50 mg / L of kanamycin was added, and incubated at 37°C, 220 rpm for 16h. The AxyPrep plasmid DNA extraction kit (CORNING, China, CAT: AP-MN-P-50) was used to extract the plasmid. The obtained plasmid was subjected to BamHI and HindIII enzyme cutting verification, and the positive clone was subjected to sequencing verification. The results showed that the target nucleotide sequence inserted in the positive recombinant cloning vector was the nucleotide sequence shown in SEQ ID NO: 13 in the sequence listing, i.e. the BD1-002 nucleotide sequence was correctly inserted.

[0054] 3) According to the method for constructing the recombinant cloning vector described above, the nucleotide sequence of BD1-011 is connected to pET28a to obtain a recombinant cloning vector DBN011A, wherein BD1-011 is a BD1-011 nucleotide sequence (SEQ ID NO: 14). The results of enzyme digestion and sequencing verification show that the BD1-011 nucleotide sequence in the recombinant cloning vector DBN011A is correctly inserted.

[0055] 4) According to the method for constructing the recombinant cloning vector described above, the nucleotide sequence of BD1-013 is connected to pET28a to obtain a recombinant cloning vector DBN013A, wherein BD1-013 is a BD1-013 nucleotide sequence (SEQ ID NO: 15). The results of enzyme digestion and sequencing verification show that the BD1-013 nucleotide sequence in the recombinant cloning vector DBN013A is correctly inserted.

[0056] 5) According to the method for constructing the recombinant cloning vector described above, the nucleotide sequence of BD1-014 is connected to pET28a to obtain a recombinant cloning vector DBN014A, wherein BD1-014 is a BD1-014 nucleotide sequence (SEQ ID NO: 16). The results of enzyme digestion and sequencing verification show that the BD1-014 nucleotide sequence in the recombinant cloning vector DBN014A is correctly inserted.

[0057] 6) According to the method for constructing the recombinant cloning vector described above, the nucleotide sequence of BD1-015 is connected to pET28a to obtain a recombinant cloning vector DBN015A, wherein BD1-015 is a BD1-015 nucleotide sequence (SEQ ID NO: 17). The results of enzyme digestion and sequencing verification show that the BD1-015 nucleotide sequence in the recombinant cloning vector DBN015A is correctly inserted.

[0058] 7) According to the method for constructing the recombinant cloning vector described above, the nucleotide sequence of BD1-018 is connected to pET28a to obtain a recombinant cloning vector DBN018A, wherein BD1-018 is a BD1-018 nucleotide sequence (SEQ ID NO: 18). The results of enzyme digestion and sequencing verification show that the BD1-018 nucleotide sequence in the recombinant cloning vector DBN018A is correctly inserted.

[0059] 8) According to the method for constructing the recombinant cloning vector described above, the nucleotide sequence of BD1-019 is connected to pET28a to obtain a recombinant cloning vector DBN019A, wherein BD1-019 is a BD1-019 nucleotide sequence (SEQ ID NO: 19). The results of enzyme digestion and sequencing verification show that the BD1-019 nucleotide sequence in the recombinant cloning vector DBN019A is correctly inserted.

[0060] 9) According to the above method of constructing a recombinant cloning vector, the nucleotide sequence of BD1-020 is connected to pET28a to obtain a recombinant cloning vector DBN020A, wherein BD1-020 is a BD1-020 nucleotide sequence (SEQ ID NO: 20). The results of enzyme digestion and sequencing verification show that the BD1-020 nucleotide sequence in the recombinant cloning vector DBN020A is correctly inserted.

[0061] 10) According to the above method of constructing a recombinant cloning vector, the nucleotide sequence of BD1-021 is connected to pET28a to obtain a recombinant cloning vector DBN021A, wherein BD1-021 is a BD1-021 nucleotide sequence (SEQ ID NO: 21). The results of enzyme digestion and sequencing verification show that the BD1-021 nucleotide sequence in the recombinant cloning vector DBN021A is correctly inserted.

[0062] 11) According to the above method of constructing a recombinant cloning vector, the nucleotide sequence of BD1-022 is connected to pET28a to obtain a recombinant cloning vector DBN022A, wherein BD1-022 is a BD1-022 nucleotide sequence (SEQ ID NO: 22). The results of enzyme digestion and sequencing verification show that the BD1-022 nucleotide sequence in the recombinant cloning vector DBN022A is correctly inserted.

[0063] 12) According to the above method of constructing a recombinant cloning vector, the nucleotide sequence of BD1-022S is connected to pET28a to obtain a recombinant cloning vector DBN022SA, wherein BD1-022S is a BD1-022S nucleotide sequence (SEQ ID NO: 34). The results of enzyme digestion and sequencing verification show that the BD1-022S nucleotide sequence in the recombinant cloning vector DBN022SA is correctly inserted.

[0064] 2. In vitro expression of Cry1Dal class proteins

[0065] 1) Positive monoclonal colonies were picked and inoculated into 5 mL of LB liquid medium with a final concentration of 50 mg / L of kanamycin, and incubated at 37°C, 220 rpm for 16 h on a shaker to obtain activated strains.

[0066] 2) The bacterial solution was transferred to 2xYT medium (1.6% tryptone, 0.5% NaCl, 1% yeast extract) at a ratio of 1:10, and incubated at 37°C, 220 rpm for 1 h on a shaker.

[0067] 3) When the culture solution OD600 = 0.6-0.8, add IPTG with a final concentration of 0.5 mM to induce expression, and place on a shaker at 37°C, 220 rpm for 6 h.

[0068] 4) Collect the bacteria at 7000 rpm for 5 min, discard the supernatant, and resuspend the bacteria in an appropriate amount of PBS buffer. Sonicate the bacteria to obtain a broken bacterial solution. Centrifuge the broken bacterial solution at 7000 rpm for 5 min to obtain soluble components and insoluble components, wherein the insoluble components are resuspended in PBS buffer.

[0069] 5) Take an appropriate amount of sample and perform SDS-PAGE detection. The results show that the target protein mainly exists in the soluble components.

[0070] 3. Purification of Cry1Dal-like proteins

[0071] 1) Use the AKTA fast purification system to purify the soluble components using HisTrap HP nickel columns to obtain purified Cry1Dal-like proteins, and use HiTrap Desalting desalting columns to desalt the purified proteins. The operation steps are referred to the AKTA operation manual.

[0072] 2) Take an appropriate amount of desalted and purified sample and perform SDS-PAGE detection.

[0073] 3) Calculate the protein concentration in the desalted protein solution according to the BSA standard curve.

[0074] 4) Store the purified protein at -20°C for later use.

[0075] Example 3. Resistance test of modified proteins on lepidopteran insects

[0076] 3.1 Spodoptera exigua feeding test

[0077] Feed the prokaryotically expressed modified proteins to Spodoptera exigua to compare the insect resistance activities of each modified protein. Mix the concentrated protein solution with Spodoptera exigua feed (final concentration 1 μg / g), mix well, and place in a culture dish. Select healthy, unfed Spodoptera exigua newly hatched larvae as test insects, and introduce 10 larvae into the culture dish. Cover the culture dish and place it in a temperature of 25-28°C, relative humidity of 70%, and light cycle (light / dark) of 16:8. Continue the experiment until the third day. Compare the mortality rate and inhibition rate of the test insects to divide the insect resistance activities of each protein into four levels, indicated by "+". The more "+"s, the better the insect resistance effect. The results are shown in Table 2.

[0078] Table 2. Comparison of insect resistance activities of modified proteins on Spodoptera exigua The more "+"s, the better the insect resistance effect

[0079] The modified proteins with better resistance to Spodoptera frugiperda were selected for comparison of insecticidal activity with the patent protein BD1-002 (BD1-002 (Cry1Dal_7) sequence is a patent protection sequence modified from BD1-001 (Cry1Dal), and the sequences of BD1-001 and BD1-002 are from the disclosure of patent US10287605B2 or NCBI GenBank: CAA38099.1, with a full-length amino acid sequence of 1165 aa). The same protein feeding method was used, and the final concentration of the protein in the feed was adjusted to 1 μg / g. After 3 days of treatment, the mortality rate of Spodoptera frugiperda larvae was counted, and the mortality rate = number of dead insects / total number of insects × 100%. The feed with only CBS buffer and the feed with only sterile water were used as negative controls, and the mortality rate of the CBS buffer treatment group was used as the control mortality rate. The corrected mortality rate was calculated based on the control mortality rate, and the corrected mortality rate = (treatment mortality rate-control mortality rate) / (1-control mortality rate) × 100%. Each system was repeated 6 times, and the experiment was repeated 2 times, and the results are shown in Table 3.

[0080] Table 3. Insecticidal results of protein feeding Spodoptera frugiperda (3 days) * indicates that the data is significantly different.

[0081] As can be seen from Table 3, compared with the BD1-002 protein, the mortality rate of Spodoptera frugiperda that fed on the above modified proteins was significantly improved, indicating that the insecticidal activity of the above modified proteins on Spodoptera frugiperda was significantly better than that of the patent protein BD1-002.

[0082] 3.2 Cotton bollworm feed bioassay

[0083] The concentrated protein solution was mixed with cotton bollworm feed (final concentration 20 μg / g), and after uniform mixing, healthy, un-fed cotton bollworm newly hatched larvae were selected as test insects, 1 larva per well, and 12 larvae per repeat. After covering the culture plate, it was placed in a temperature of 25-28℃, relative humidity of 70%, and light cycle (light / dark) of 16:8. The experiment was ended on the 7th day, and the mortality rate of cotton bollworm larvae was counted, and the mortality rate = number of dead insects / total number of insects × 100%. The feed with only CBS buffer and the feed with only sterile water were used as negative controls, and the mortality rate of the CBS buffer treatment group was used as the control mortality rate. The corrected mortality rate was calculated based on the control mortality rate, and the corrected mortality rate = (treatment mortality rate-control mortality rate) / (1-control mortality rate) × 100%. Each system was repeated 6 times, and the experiment was repeated 2 times, and the results are shown in Table 4.

[0084] Table 4. Insecticidal results of protein feeding cotton bollworm (7 days) * indicates that the data is significantly different.

[0085] From Table 4, it can be seen that the mortality of cotton bollworms that ingested the modified proteins of the application was significantly increased compared with BD1-002 protein, indicating that the insecticidal activity of the modified proteins of the application on cotton bollworms was significantly better than that of the patent protein BD1-002.

[0086] 3.3 Laboratory test of Helicoverpa armigera

[0087] The concentrated protein solution was mixed with Helicoverpa armigera feed (final concentration 100 μg / g), and after uniform mixing, healthy, un-fed Helicoverpa armigera newly hatched larvae were selected as test insects, 10 larvae were introduced, and the culture plate was covered, and placed in a temperature of 25-28°C, relative humidity of 70%, light cycle (light / dark) of 16:8, until the end of the experiment on the third day, the mortality of Helicoverpa armigera larvae was counted, mortality = number of dead insects / total number of introduced insects x 100%. The feed with only CBS buffer added and the feed with only sterile water added were used as negative controls, and the mortality of the CBS buffer treatment group was used as the control mortality. The corrected mortality was calculated based on the control mortality, corrected mortality = (treatment mortality - control mortality) / (1 - control mortality) x 100%. Each system was repeated 6 times, and the experiment was repeated twice, and the results are shown in Table 5.

[0088] Table 5. Anti-insect results of protein feeding Helicoverpa armigera (3 days) * indicates that the data is significantly different.

[0089] From Table 5, it can be seen that the mortality of Helicoverpa armigera that ingested the modified proteins of the application was significantly increased compared with BD1-002 protein, indicating that the insecticidal activity of the modified proteins of the application on Helicoverpa armigera was significantly better than that of the patent protein BD1-002.

[0090] Example 4 Construction of plant transformants encoding engineered proteins

[0091] 4.1 Construction of transgenic maize plants

[0092] 4.1.1 Construction of expression cassette

[0093] 4.1.1.1 Construction of intermediate vector containing target gene

[0094] The promoter is the maize ubiquitin (Ubiquitin) gene promoter prZmUbi, and the terminator is the nopaline synthase (nos) terminator tNos. The detailed construction process is as follows:

[0095] 1) pCAMBIA2301 as a template, PCR amplification of the promoter pZmUbi. 5' end add DBN-backbone HindIII enzyme cutting site before 20bp homologous arm, 3' end add BD1-002 gene 5' end 20bp homologous arm, obtain prZmUbi promoter fragment;

[0096] 2) DBN002A as a template, PCR amplification of the target gene BD1-002. 5' end add prZmUbi 3' end 20bp homologous arm, 3' end add tNos gene 5' end 20bp homologous arm, obtain target gene BD1-002 fragment;

[0097] 3) pCAMBIA2301 as a template, PCR amplification of the terminator tNos. 5' end add BD1-002 gene 3' end 20bp homologous arm, 3' end add DBN-backbone SbfI enzyme cutting site after 20bp homologous arm, obtain tNos terminator fragment;

[0098] 4) using HindIII, SbfI double enzyme cutting DBN-backbone, obtain fragment HindIII-DBN-backbone-SbfI.

[0099] 5) the four fragments obtained in the above steps, using the method of seamless cloning, transformation, to obtain the intermediate vector DBN-BD1 (RB: right border; prZmUbi: maize ubiquitin gene promoter; BD1-002: BD1-002 nucleotide sequence (SEQ ID NO: 13); tNos: nos terminator), as shown in Figure 3.

[0100] 4.1.1.2 Intermediate vector containing reporter gene Hpt construction

[0101] The reporter gene Hpt is a hygromycin phosphotransferase gene, the promoter is a cauliflower mosaic virus 35S promoter pr35S, and the terminator is a cauliflower mosaic virus 35S terminator t35S. The detailed construction process is as follows:

[0102] 1) pCAMBIA2301 as a template, PCR amplification of the promoter pr35S-06. 5' end add DBN-backbone HindIII enzyme cutting site before 20bp homologous arm, 3' end add Hpt gene 5' end 20bp homologous arm, obtain pr35S promoter fragment;

[0103] 2) PCR amplification of the reporter gene Hpt with pCAMBIA2301 as template. A 5' end of pr35S promoter 3' end 20bp homologous arm was added, and a 3' end of t35S terminator 5' end 20bp homologous arm was added, to obtain a gene Hpt fragment;

[0104] 3) PCR amplification of the terminator t35S with pCAMBIA2301 as template. A 5' end of Hpt gene 3' end 20bp homologous arm was added, and a 3' end of DBN-backbone SbfI enzyme cutting site after 20bp homologous arm was added, to obtain a t35S terminator fragment;

[0105] 4) HindIII and SbfI double enzyme cutting of DBN-backbone to obtain a fragment HindIII-DBN-backbone-SbfI.

[0106] 5) The four fragments obtained in the above steps were connected and transformed using seamless cloning to obtain an intermediate vector pDBN-Hpt (RB: right border; pr35S: cauliflower mosaic virus 35S promoter; Hpt: hygromycin phosphotransferase gene; t35S: cauliflower mosaic virus 35S terminator; LB: left border) as shown in Figure 3.

[0107] 4.1.1.3 Final vector construction

[0108] 1) HindIII and SbfI double enzyme cutting of DBN-backbone to obtain a fragment HindIII-DBN-backbone-SbfI;

[0109] 2) PCR amplification of BD1-002 cassette with pDBN-BD1 as template, 5' end of DBN-backbone HindIII enzyme cutting site before 20bp homologous arm was added, and 3' end of Hpt cassette 5' end 20bp homologous arm was added, to obtain a fragment BD1-002 cassette.

[0110] 3) PCR amplification of Hpt cassette with pDBN-Hpt as template, 5' end of BD1-002 cassette 3' end 20bp homologous arm was added, and 3' end of DBN-backbone SbfI enzyme cutting site after 20bp homologous arm was added, to obtain a fragment Hpt cassette.

[0111] 4) The three fragments obtained above were ligated using the method of seamless cloning to transform the final vector DBN002A-C (RB: right border; prZmUbi: maize ubiquitin gene promoter; BD1-002: BD1-002 nucleotide sequence (SEQ ID NO: 13); tNos: nopaline synthase (nos) terminator; pr35S: cauliflower mosaic virus 35S promoter; Hpt: hygromycin phosphotransferase gene; t35S: cauliflower mosaic virus 35S terminator; LB: left border) as shown in Figure 3.

[0112] 4.1.1.4 Transformation and identification of the vector

[0113] The recombinant expression vector DBN002A-C was transformed into E. coli T1 competent cells using the heat shock method, with the following heat shock conditions: 50 μL of E. coli T1 competent cells, 10 μL of plasmid DNA, 42°C water bath for 30 s; 37°C shaking culture for 1 h (100 rpm shaking speed); then the cultured product was spread on LB solid medium containing 50 mg / L kanamycin, and incubated at 37°C for 12 h. A single colony was picked and inoculated in 5 mL of LB liquid medium containing 50 mg / L kanamycin, and incubated at 37°C, 220 rpm for 16 h. A single colony was picked and inoculated in LB liquid medium containing 50 mg / L kanamycin, and incubated at 37°C overnight. The plasmid was extracted using the AxyPrep plasmid DNA extraction kit. The extracted plasmid was digested with restriction enzymes Sbf I and Hind III for identification, and the positive clones were sequenced for identification. The results showed that the nucleotide sequence of the recombinant expression vector DBN002A-C between the Sbf I and Hind III enzyme digestion sites contained the nucleotide sequence shown in SEQ ID NO: 13 in the sequence listing, i.e., the BD1-002 nucleotide sequence.

[0114] According to the above method for constructing DBN002A-C, the recombinant expression vector DBN018A-C was obtained. Enzymatic digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN018A-C contained the nucleotide sequence shown in SEQ ID NO: 18 in the sequence listing, i.e., the BD1-018 nucleotide sequence.

[0115] According to the above method for constructing DBN002A-C, the recombinant expression vector DBN019A-C was obtained. Enzymatic digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN019A-C contained the nucleotide sequence shown in SEQ ID NO: 19 in the sequence listing, i.e., the BD1-019 nucleotide sequence.

[0116] The recombinant expression vector DBN021A-C was obtained according to the above method of constructing DBN002A-C. The restriction enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN021A-C contained the nucleotide sequence shown in SEQ ID NO: 21 in the sequence listing, i.e., the BD1-021 nucleotide sequence.

[0117] The recombinant expression vector DBN022A-C was obtained according to the above method of constructing DBN002A-C. The restriction enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN022A-C contained the nucleotide sequence shown in SEQ ID NO: 22 in the sequence listing, i.e., the BD1-022 nucleotide sequence.

[0118] The recombinant expression vector DBN022SA-C was obtained according to the above method of constructing DBN002A-C. The restriction enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN022SA-C contained the nucleotide sequence shown in SEQ ID NO: 34 in the sequence listing, i.e., the BD1-022S nucleotide sequence.

[0119] 4.1.2 Transformation of Agrobacterium with the recombinant expression vector

[0120] The correctly constructed recombinant expression vectors DBN002A-C, DBN018A-C, DBN019A-C, DBN021A-C, DBN022A-C and DBN022SA-C were transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) using the liquid nitrogen method, and the transformation conditions were as follows: 100 μl of Agrobacterium LBA4404, 3 μl of plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 minutes, and then placed in a 37°C water bath for 10 minutes; the transformed Agrobacterium LBA4404 was inoculated into an LB test tube and incubated at a temperature of 28°C and a rotation speed of 200 rpm for 2 hours, and then spread on an LB plate containing 50 mg / L of Rifampicin and 100 mg / L of Kanamycin until positive monoclonal colonies were grown, and a single colony was picked and cultured and the plasmid was extracted. The recombinant expression vectors DBN002A-C, DBN018A-C, DBN019A-C, DBN021A-C, DBN022A-C and DBN022SA-C were digested with restriction enzymes and verified, and the results showed that the structures of the recombinant expression vectors DBN002A-C, DBN018A-C, DBN019A-C, DBN021A-C, DBN022A-C and DBN022SA-C were completely correct.

[0121] 4.1.3 Infection of maize plants with Agrobacterium

[0122] Aseptically cultured immature embryos of corn variety TJ806 were co-cultivated with Agrobacterium transformed with the recombinant expression vector to introduce the T-DNA of recombinant expression vector DBN002A-C into the corn genome to obtain corn plants with the BD1-002 nucleotide sequence inserted into the corn genome. Wild type corn plants were used as controls.

[0123] Using the above described method for obtaining corn plants with the BD1-002 nucleotide sequence inserted into the corn genome, corn plants with the BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequences inserted into the corn genome were obtained.

[0124] For Agrobacterium-mediated corn transformation, briefly, immature embryos are isolated from corn and contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of delivering the Cry1Dal nucleotide sequence to at least one cell of one of the immature embryos (Step 1 : Infection Step), wherein the immature embryos are preferably immersed in the Agrobacterium suspension (OD 660= 0.4 to 0.6, in infection medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 68.5 g / L, glucose 36 g / L, acetosyringone (AS) 40 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, pH = 5.3) to initiate inoculation. The immature embryos are co-cultured with Agrobacterium for 3 days (step 2: co-cultivation step). Preferably, the immature embryos are cultured on solid medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 100 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH = 5.8) after the infection step. After this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, a recovery medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8) is used in which at least one antibiotic (cefotaxime) known to inhibit the growth of Agrobacterium is present, but no selection agent for plant transformants is added (step 3: recovery step). The immature embryos are cultured on solid medium with the antibiotic but without the selection agent to eliminate Agrobacterium and to provide a recovery period for the infected cells and to generate callus. Next, the callus is inoculated on medium containing the selection agent (hygromycin) and the growing transformed callus is selected (step 4: selection step). Preferably, the callus is cultured on selection solid medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 5 g / L, hygromycin 50 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH = 5.8) with the selection agent, resulting in the selective growth of transformed cells. Then, the callus is regenerated into plants (step 5: regeneration step), preferably, the callus grown on medium with the selection agent is cultured on solid medium (MS differentiation medium and MS rooting medium) to regenerate plants. The resistant callus obtained is transferred to the MS differentiation medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzylaminopurine 2 mg / L, hygromycin 50 mg / L, agar 8 g / L, pH = 5.8) and cultured at 25°C to differentiate. The small shoots differentiated are transferred to the MS rooting medium (MS salts 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH = 5.8) and cultured at 25°C until they are about 10 cm high and are transferred to a greenhouse to be grown to seed. In the greenhouse, they are grown at 28°C for 16 hours and at 20°C for 8 hours per day.

[0125] 4.1.4 Identification of Transgenic Maize Materials

[0126] About 100 mg of leaf of each of the maize plants transformed with BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequence and wild type maize plant TJ806 were taken as samples, and the genomic DNA was extracted using Qiagen's Dneasy Plant Maxi Kit, and the copy number of Hpt gene was detected by Taqman probe fluorescence quantitative PCR method to determine the copy number of Cry1Dal gene. The wild type maize plant TJ806 was used as a control, and the detection and analysis were performed according to the above method, and the experiment was repeated for 3 times. The results of the analysis of the copy number of Hpt reporter gene showed that the nucleotide sequences of BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S were integrated into the chromosomes of the detected maize plants, and the maize plants transformed with BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequence obtained single copy of transgenic maize plants, and the single copy of transgenic maize plants was selected for breeding, and maize seeds were obtained.

[0127] The specific method for detecting the copy number of Hpt gene is as follows:

[0128] Step 1, about 100 mg of leaf of each of the maize plants transformed with BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequence and wild type maize plant TJ806 were taken as samples, and the genomic DNA was extracted using Qiagen's Dneasy Plant Maxi Kit, and the copy number of Hpt gene was detected by Taqman probe fluorescence quantitative PCR method to determine the copy number of Cry1Dal gene. The wild type maize plant TJ806 was used as a control, and the detection and analysis were performed according to the above method, and the experiment was repeated for 3 times. The results of the analysis of the copy number of Hpt reporter gene showed that the nucleotide sequences of BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S were integrated into the chromosomes of the detected maize plants, and the maize plants transformed with BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequence obtained single copy of transgenic maize plants, and the single copy of transgenic maize plants was selected for breeding, and maize seeds were obtained.

[0129] Step 2, the genomic DNA of the above samples was extracted using Qiagen's DNeasy Plant Mini Kit, and the specific method was referred to the product manual;

[0130] Step 3, the concentration of the genomic DNA of the above samples was determined using NanoDrop 2000 (Thermo Scientific);

[0131] Step 4, the concentration of the genomic DNA of the above samples was adjusted to the same concentration value, and the concentration value was in the range of 80-100 ng / μL;

[0132] Step 5, the copy number of the sample was identified by Taqman probe fluorescent quantitative PCR method, the sample with known copy number after identification was used as standard, the sample of wild type corn plant was used as control, each sample was repeated for 3 times, and the average value was taken; the sequence of the fluorescent quantitative PCR primer and probe was as follows:

[0133] Primer 5: cagggtgtcacgttgcaaga (SEQ ID NO: 27);

[0134] Primer 6: ccgctcgtctggctaagatc (SEQ ID NO: 28);

[0135] Probe 1: tgcctgaaaccgaactgcccgctg (SEQ ID NO: 29);

[0136] The PCR reaction system was as follows:

[0137] The 50x primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration and 860 μL of 1x TE buffer, and was stored in an amber test tube at 4°C. The PCR reaction condition was as follows:

[0138] Return to step 1, and perform 40x cycle.

[0139] The data was analyzed by using IBM SPSS software.

[0140] 4.2 Construction of transgenic soybean plants

[0141] 4.2.1 Construction of recombinant vector

[0142] The expression vector DBNBC-001 (vector backbone: pCAMBIA2301, provided by CAMBIA) was digested with restriction enzymes Asc I and Hind III, and the BD1-002 nucleotide sequence was amplified using primer 1 (SEQ ID NO: 23) and primer 2 (SEQ ID NO: 24). The amplified BD1-002 nucleotide sequence fragment was inserted into the expression vector DBNBC-001 between the restriction enzyme Asc I and Hind III sites by seamless cloning to construct a recombinant expression vector DBN002A-B, and the construction process is shown in FIG. 2 (RB: right border; eFMV: enhancer; prBrCBP: CBP1 gene promoter; spAtCTP2: signal peptide; cEPSPS: 5-enolpyruvylshikimate-3-phosphate synthase; tPsE9: pea small subunit E9 protein of ribulose-1,5-bisphosphate carboxylase / oxygenase gene terminator; prAtUbi10: Arabidopsis thaliana ubiquitin gene promoter; BD1-002: BD1-002 nucleotide sequence (SEQ ID NO: 13); tNos: nopaline synthase (nos) terminator; pr35s: cauliflower mosaic virus 35S promoter; PAT: phosphinothricin acetyltransferase gene; t35s: cauliflower mosaic virus 35S terminator; LB: left border). The construction method of the vector is well known to those skilled in the art.

[0143] The recombinant expression vector DBN002A-B was transformed into E. coli T1 competent cells by heat shock method, and the heat shock conditions were as follows: 50 μL of E. coli T1 competent cells, 10 μL of plasmid DNA, 42°C water bath for 30 s; 37°C shaking culture for 1 h (100 rpm shaking speed); then the cultured product was spread on LB solid plate containing 50 mg / L of kanamycin, and incubated at 37°C for 12 h. A single colony was picked and inoculated in 5 mL of LB liquid medium containing 50 mg / L of kanamycin, and incubated at 37°C, 220 rpm for 16 h. A single colony was picked and inoculated in LB liquid medium containing 50 mg / L of kanamycin, and incubated at 37°C overnight. The plasmid was extracted using AxyPrep plasmid DNA extraction kit. The extracted plasmid was digested with restriction enzymes Asc I and Hind III for identification, and the positive clones were sequenced for identification. The results showed that the nucleotide sequence of the recombinant expression vector DBN002A-B between the Asc I and Hind III sites was the nucleotide sequence shown in SEQ ID NO: 13 in the sequence listing, i.e., the BD1-002 nucleotide sequence.

[0144] BD1-018 nucleotide sequence, using primer 1 (SEQ ID NO: 23) and primer 3 (SEQ ID NO: 25), the amplified BD1-018 nucleotide sequence fragment was inserted into the restriction sites of the expression vector DBNBC-001 by using seamless cloning method, to obtain the recombinant expression vector DBN018A-B. The restriction enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN018A-B contained the nucleotide sequence shown in SEQ ID NO: 18 in the sequence listing, i.e., the BD1-018 nucleotide sequence.

[0145] BD1-019 nucleotide sequence, using primer 1 (SEQ ID NO: 23) and primer 3 (SEQ ID NO: 25), the amplified BD1-019 nucleotide sequence fragment was inserted into the restriction sites of the expression vector DBNBC-001 by using seamless cloning method, to obtain the recombinant expression vector DBN019A-B. The restriction enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN019A-B contained the nucleotide sequence shown in SEQ ID NO: 19 in the sequence listing, i.e., the BD1-019 nucleotide sequence.

[0146] BD1-021 nucleotide sequence, using primer 1 (SEQ ID NO: 23) and primer 3 (SEQ ID NO: 25), the amplified BD1-021 nucleotide sequence fragment was inserted into the restriction sites of the expression vector DBNBC-001 by using seamless cloning method, to obtain the recombinant expression vector DBN021A-B. The restriction enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN021A-B contained the nucleotide sequence shown in SEQ ID NO: 21 in the sequence listing, i.e., the BD1-021 nucleotide sequence.

[0147] BD1-022 nucleotide sequence, using primer 1 (SEQ ID NO: 23) and primer 4 (SEQ ID NO: 26), the amplified BD1-022 nucleotide sequence fragment was inserted into the restriction sites of the expression vector DBNBC-001 by using seamless cloning method, to obtain the recombinant expression vector DBN022A-B. The restriction enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN022A-B contained the nucleotide sequence shown in SEQ ID NO: 22 in the sequence listing, i.e., the BD1-022 nucleotide sequence.

[0148] BD1-022S nucleotide sequence was amplified using primer 1 (SEQ ID NO: 23) and primer 9 (SEQ ID NO: 35) according to the method for constructing DBN002A-B described above, and the amplified BD1-022S nucleotide sequence fragment was inserted into the expression vector DBNBC-001 between the enzyme cutting sites by means of seamless cloning to obtain the recombinant expression vector DBN022SA-B. Enzyme cutting and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN022SA-B contained the nucleotide sequence shown in SEQ ID NO: 34 in the sequence listing, i.e., the BD1-022S nucleotide sequence.

[0149] 4.2.2 Transformation of Agrobacterium with the recombinant expression vector

[0150] The correctly constructed recombinant expression vectors DBN002A-B, DBN018A-B, DBN019A-B, DBN021A-B, DBN022A-B and DBN022SA-B were transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) by liquid nitrogen method, and the transformation conditions were as follows: 100 μl of Agrobacterium LBA4404, 3 μl of plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 minutes, and then in a 37°C water bath for 10 minutes; the transformed Agrobacterium LBA4404 was inoculated into an LB test tube and incubated at a temperature of 28°C and a rotation speed of 200 rpm for 2 hours, and then spread on an LB plate containing 50 mg / L of Rifampicin and 100 mg / L of Kanamycin until positive monoclonal colonies were grown, and a single colony was picked and cultured and its plasmid was extracted, and the recombinant expression vectors DBN002A-B, DBN018A-B, DBN019A-B, DBN021A-B, DBN022A-B and DBN022SA-B were verified by enzyme cutting, and the results showed that the structures of the recombinant expression vectors DBN002A-B, DBN018A-B, DBN019A-B, DBN021A-B, DBN022A-B and DBN022SA-B were completely correct.

[0151] 4.2.3 Infection of soybean plants with Agrobacterium

[0152] According to the conventional Agrobacterium infection method, the cotyledon node tissue of the aseptically cultured soybean variety SY2043C was co-cultured with the recombinant expression vector transformed Agrobacterium, and the T-DNA of the recombinant expression vector DBN002A-B was introduced into the soybean chromosome to obtain a soybean plant into which the BD1-002 nucleotide sequence was introduced; and a wild type soybean plant was used as a control.

[0153] Soybean plants into which the BD1-018, BD1-019, BD1-021, BD1-022, and BD1-022S nucleotide sequences were introduced were obtained according to the above-described method. For Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in soybean germination medium (B5 salts 3 g / L, B5 vitamins, sucrose 20 g / L, agar 8 g / L, pH = 5.6), and the seeds were inoculated on the germination medium and incubated under the following conditions: temperature 25 ± 1 °C; photoperiod (light / dark) 16 / 8 h. After 4-6 days of germination, the fresh green cotyledonary node swollen soybean aseptic seedlings were taken, and the hypocotyls were cut off at 3-4 mm below the cotyledonary node, the cotyledons were cut open longitudinally, and the apical buds, lateral buds, and seed roots were removed. The back of a scalpel was used to wound the cotyledonary node at the cotyledonary node, and the wounded cotyledonary node tissue was contacted with an Agrobacterium suspension, wherein the Agrobacterium was capable of delivering the Cry1Dal nucleotide sequence to the wounded cotyledonary node tissue (Step 1: Infection Step). In this step, the cotyledonary node tissue was preferably immersed in the Agrobacterium suspension (OD 660= 0.5-0.8) in an infection medium (MS salts 2 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, acetosyringone 40 mg / L, pH = 5.3) to initiate inoculation. The cotyledonary node tissue is co-cultivated with Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Preferably, the cotyledonary node tissue is cultured on solid medium (MS salts 4 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, agar 8 g / L, MES 4 g / L, ZT 2 mg / L, pH = 5.6) after the infection step. After this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, a recovery medium (B5 salts 3 g / L, B5 vitamins, agar 8 g / L, sucrose 30 g / L, MES 1 g / L, ZT 2 mg / L, cefotaxime 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, pH = 5.6) is provided with at least one antibiotic (cefotaxime) known to inhibit the growth of Agrobacterium, without the addition of a selection agent for plant transformants (step 3: recovery step). Preferably, the cotyledonary node regenerated tissue pieces are cultured on solid medium with the antibiotic but without the selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the cotyledonary node regenerated tissue pieces are cultured on medium containing the selection agent (phosphinothricin) and growing transformed callus is selected (step 4: selection step). Preferably, the cotyledonary node regenerated tissue pieces are cultured on selection solid medium (sucrose 30 g / L, agar 8 g / L, B5 salts 3 g / L, B5 vitamins, MES 1 g / L, 6-benzylaminopurine 1 mg / L, cefotaxime 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, phosphinothricin 6 mg / L, pH = 5.6) with the selection agent, resulting in the selective growth of transformed cells. The transformed cells are then regenerated into plants (step 5: regeneration step), preferably, the cotyledonary node regenerated tissue pieces grown on medium with the selection agent are cultured on solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0154] The resistant tissue pieces obtained by screening are transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, glufosinate 6 mg / L, pH = 5.6) and cultured to differentiate at 25°C. The seedlings differentiated are transferred to the B5 rooting medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid 1 mg / L) and cultured to about 10 cm high at 25°C, and then moved to a greenhouse for cultivation to seed. In the greenhouse, the seedlings are cultured at 26°C for 16 h and at 20°C for 8 h per day.

[0155] 4.2.4 Identification of transgenic soybean materials

[0156] About 100 mg of leaf of each of the soybean plants into which the BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequences are introduced is taken as a sample, and the genomic DNA is extracted using the Dneasy Plant Maxi Kit kit of Qiagen. The copy number of the PAT gene is detected by Taqman probe fluorescence quantitative PCR method to determine the copy number of the Cry1Dal gene. At the same time, wild-type SY2043C soybean plants are used as controls, and the detection and analysis are performed according to the above method, and the experiment is repeated for 3 times. Through analysis of the experimental results of the copy number of the target gene, it is shown that the BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequences have been integrated into the chromosome of the detected soybean plants, and the soybean plants into which the BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequences are introduced have obtained single-copy transgenic soybean plants. The single-copy transgenic soybean plants are selected for breeding to obtain soybean seeds.

[0157] The specific method for detecting the copy number of the PAT gene is as follows:

[0158] Step 1, 100 mg of leaves of soybean plants transformed with BD1-002 nucleotide sequence, soybean plants transformed with BD1-018 nucleotide sequence, soybean plants transformed with BD1-019 nucleotide sequence, soybean plants transformed with BD1-021 nucleotide sequence, soybean plants transformed with BD1-022 nucleotide sequence, soybean plants transformed with BD1-022S nucleotide sequence and wild type soybean plants were respectively ground into homogenate in a mortar with liquid nitrogen, and 3 replicates were taken for each sample;

[0159] Step 2, the genomic DNA of the above samples was extracted using Qiagen's DNeasy Plant Mini Kit, and the specific method was referred to the product manual;

[0160] Step 3, the genomic DNA concentration of the above samples was determined by NanoDrop 2000 (Thermo Scientific);

[0161] Step 4, the genomic DNA concentration of the above samples was adjusted to the same concentration value, and the concentration value was in the range of 80-100 ng / μL;

[0162] Step 5, the copy number of the samples was identified by Taqman probe fluorescence quantitative PCR method, and the samples with known copy number identified were used as standard, and the sample of wild type soybean plant was used as control, 3 replicates were taken for each sample, and the average value was taken; the sequences of the fluorescence quantitative PCR primers and probes were as follows:

[0163] Primer 7: gagggtgttgtggctggtattg (SEQ ID NO: 30);

[0164] Primer 8: tctcaactgtccaatcgtaagcg (SEQ ID NO: 31);

[0165] Probe 2: cttacgctgggccctggaaggctag (SEQ ID NO: 32);

[0166] The PCR reaction system was as follows:

[0167] The 50x primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration and 860 μL of 1x TE buffer, and was stored in amber test tubes at 4℃. The PCR reaction conditions were as follows:

[0168] Return to step 1, 40x cycle

[0169] The data was analyzed by IBM SPSS software.

[0170] Example 5 Activity test of transgenic maize against lepidopteran pests

[0171] 5.1 Anti-insect effect on Spodoptera exigua

[0172] When the transgenic maize plants expressing the engineered protein grow to V3-V4 stage, fresh maize leaves are taken for Spodoptera exigua bioassay. The leaves are washed with sterile water and the water on the leaves is absorbed with gauze, and at the same time, the leaves are cut into about 2 cm x 3.5 cm strips. One piece of the cut strip is placed on the bottom of the moist filter paper in a round plastic culture dish, and 10 Spodoptera exigua newly hatched larvae are placed in each culture dish. After the culture dish is covered, it is placed in a condition of temperature 25-28°C, relative humidity 70%, and light cycle (light / dark) 16:8 for 1 day. Then the mortality rate of the Spodoptera exigua larvae and the damage to the leaves are counted. The mortality rate = the number of dead insects / the total number of insects x 100%. The same genetic background maize without the anti-insect protein is used as a control. The corrected mortality rate is calculated based on the control mortality rate. The corrected mortality rate = (treatment mortality rate-control mortality rate) / (1-control mortality rate) x 100%. The results are shown in Table 6.

[0173] Table 6. Anti-insect experiment results of transgenic maize plants inoculated with Spodoptera exigua (1 day)

[0174] 5.2 Anti-insect effect of transgenic maize on Helicoverpa armigera

[0175] When the transgenic maize plants expressing the engineered protein grow to V3-V4 stage, fresh maize leaves are taken for Helicoverpa armigera bioassay. The leaves are washed with sterile water and the water on the leaves is absorbed with gauze, and at the same time, the leaves are cut into about 2 cm x 3.5 cm strips. One piece of the cut strip is placed on the bottom of the moist filter paper in a round plastic culture dish, and 10 Helicoverpa armigera newly hatched larvae are placed in each culture dish. After the culture dish is covered, it is placed in a condition of temperature 25-28°C, relative humidity 70%, and light cycle (light / dark) 16:8 for 3 days. Then the mortality rate of the Helicoverpa armigera larvae is counted. The mortality rate = the number of dead insects / the total number of insects x 100%. The same genetic background maize without the anti-insect protein is used as a control. The corrected mortality rate is calculated based on the control mortality rate. The corrected mortality rate = (treatment mortality rate-control mortality rate) / (1-control mortality rate) x 100%. The results are shown in Table 7.

[0176] Table 7. Anti-insect experiment results of transgenic maize plants inoculated with Helicoverpa armigera (3 days)

[0177] As can be seen from Tables 6-7, the mortality rate of the insects is higher after the corn plants expressing the modified proteins of the application are inoculated with Spodoptera exigua and Helicoverpa armigera, which indicates that the corn plants expressing the modified proteins of the application have more excellent insect resistance effect on Spodoptera exigua and Helicoverpa armigera.

[0178] Example 6 Insect resistance effect of transgenic soybean on Lepidoptera pests

[0179] 6.1 Insect resistance effect of transgenic soybean on Spodoptera litura

[0180] When the transgenic soybean plants expressing the modified proteins grow to V3 stage, the second leaves from the top are taken for Spodoptera litura bioassay. The leaves are washed with sterile water and the water on the leaves is absorbed with gauze, and then cut into strips of about 2 cm x 3.5 cm. One piece of the cut leaf strip is placed on the bottom of a round plastic culture dish with moist filter paper, and 10 Spodoptera litura newly hatched larvae are placed in each culture dish. After the culture dish is covered, it is placed in a condition of temperature 25-28°C, relative humidity 70%, and light cycle (light / dark) 16:8 for 3 days. Then the mortality rate of the Spodoptera litura larvae and the damage to the leaves are counted. The mortality rate = (number of dead insects / total number of insects) x 100%, and the insect inhibition rate is the proportion of the number of insects at a smaller stage than the control insects. The same genetic background soybean without the insect-resistant protein is used as a control. The corrected mortality rate is calculated based on the control mortality rate, and the corrected mortality rate = (treatment mortality rate-control mortality rate) / (1-control mortality rate) x 100%. The results are shown in Table 8.

[0181] Table 8. Spodoptera litura soybean leaf bioassay results (3 days)

[0182] 6.2 Insect resistance effect of transgenic soybean on Spodoptera exigua

[0183] When the transgenic soybean plants expressing the modified proteins grow to V3 stage, the second leaves from the top are taken for Spodoptera exigua bioassay. The leaves are washed with sterile water and the water on the leaves is absorbed with gauze, and then cut into strips of about 2 cm x 3.5 cm. One piece of the cut leaf strip is placed on the bottom of a round plastic culture dish with moist filter paper, and 10 Spodoptera exigua newly hatched larvae are placed in each culture dish. After the culture dish is covered, it is placed in a condition of temperature 25-28°C, relative humidity 70%, and light cycle (light / dark) 16:8 for 3 days. Then the mortality rate of the Spodoptera exigua larvae is counted. The mortality rate = (number of dead insects / total number of insects) x 100%, and the same genetic background corn without the insect-resistant protein is used as a control. The corrected mortality rate is calculated based on the control mortality rate, and the corrected mortality rate = (treatment mortality rate-control mortality rate) / (1-control mortality rate) x 100%. The results are shown in Table 9.

[0184] Table 9. Spodoptera exigua soybean leaf bioassay results (3 days)

[0185] As can be seen from Table 8, compared with the transgenic soybean expressing BD1-002 protein, the soybean plants expressing the modified protein of the application have lower leaf injury rate, higher mortality rate and higher inhibition rate of the insect body of the Helicoverpa armigera, indicating that the soybean plants expressing the modified protein of the application have more excellent insect resistance effect on the Helicoverpa armigera; similarly, as can be seen from Table 9, the soybean plants expressing the modified protein of the application also have higher mortality rate on the Spodoptera frugiperda than the transgenic soybean expressing BD1-002 protein, indicating that the modified protein of the application has more excellent insect resistance effect on the Helicoverpa armigera.

[0186] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and are not limiting. Although the present application has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can be modified or replaced equivalently without departing from the spirit and scope of the technical solutions of the present application.

[0187] References:

[0188] 1. Bacillus thuringiensis Cry1Da_7 and Cry1B.868 Protein Interactions with Novel Receptors Allow Control of Resistant Fall Armyworms, Spodoptera frugiperda (J.E. Smith). (2019) Appl Environ Microbiol 85.

Claims

1. An insecticidal protein comprising an amino acid sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO:

33.

2. A nucleic acid molecule encoding the insecticidal protein of claim 1. Preferably, the nucleotide sequence encoding the amino acid sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 33 is as set forth in SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 34, respectively.

3. A recombinant expression vector comprising the nucleic acid molecule of claim 2.

4. An insecticidal composition comprising the insecticidal protein of claim 1.

5. A method of controlling a lepidopteran pest, comprising contacting a lepidopteran pest with the insecticidal protein of claim 1 or the insecticidal composition of claim 4.

6. A method of controlling a lepidopteran pest, comprising introducing into a plant the nucleic acid molecule of claim 2 or the recombinant expression vector of claim 3, such that the lepidopteran pest feeds on the plant.

7. The method of claim 5 or 6, wherein the lepidopteran pest is Spodoptera frugiperda, Helicoverpa armigera, or Spodoptera litura.

8. The method of claim 6, wherein the plant is a monocot or a dicot; preferably, the plant is corn or soybean.

9. Use of the insecticidal protein of claim 1, the nucleic acid molecule of claim 2, the recombinant expression vector of claim 3, or the insecticidal composition of claim 4 for controlling a lepidopteran pest.

10. The use of claim 9, wherein the lepidopteran pest is Spodoptera frugiperda, Helicoverpa armigera, or Spodoptera litura.

Images