Uses of insecticidal proteins
By introducing the Cry1Da1 protein into plants, which then exerts its insecticidal effect when the silver-striped armyworm feeds, the environmental pollution and incomplete efficacy problems of existing silver-striped armyworm control technologies have been solved, achieving stable control effects throughout the entire growth period and on the entire plant.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING DABEINONG BIOTECHNOLOGY CO LTD
- Filing Date
- 2024-12-23
- Publication Date
- 2026-06-30
AI Technical Summary
Existing technologies have failed to effectively utilize the insecticidal activity of Cry1Da1 protein against the soybean pest, the silver-striped armyworm, resulting in problems such as pollution, environmental damage, and incomplete effectiveness of chemical and biological control methods.
Nucleic acid molecules encoding the Cry1Da1 protein are introduced into plants, allowing them to be expressed within the plant. When the silver-striped armyworm feeds on plant tissues, it comes into contact with the Cry1Da1 protein, thus achieving endogenous control of the silver-striped armyworm.
It achieves protection of the entire plant and the entire growth cycle of the silver-striped cutworm, avoiding environmental pollution and pesticide damage. The effect is stable and thorough, simplifying the control process and saving manpower and resources.
Smart Images

Figure CN119823240B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the use of an insecticidal protein, and more particularly to the use of a Cry1Da1 protein to control the soybean pest, the silver-striped armyworm. Background Technology
[0002] The silver-striped noctuid moth (Argyrogramma agnata), belonging to the family Noctuidae in the order Lepidoptera, is mainly distributed in the Yangtze and Yellow River basins of my country. It is one of the major soybean pests in my country's main soybean-producing areas. The silver-striped noctuid moth is a polyphagous pest, primarily damaging various crops such as beans, rapeseed, cabbage, cauliflower, Chinese cabbage, and radishes, among other cruciferous vegetables. Its damage is characterized by larvae feeding on leaves, causing notches and holes; in severe infestations, the larvae can completely devour the leaves, significantly impacting yield. Cultivated soybean (Glycine max (L.) Merri) is a globally grown and important economic crop, serving as a major source of plant oil and protein, and is a crucial food crop in China. Soybeans are one of the silver-striped noctuid moth's favorite food sources, causing varying degrees of crop loss annually, ranging from 10-20% yield reduction in mild cases to 30-40% in severe cases. Common methods for controlling the silver-striped noctuid moth include agricultural control, chemical control, physical control, and biological control.
[0003] Agricultural pest control involves the comprehensive and coordinated management of multiple factors within the entire farmland ecosystem. This includes regulating crops, pests, and environmental factors to create a farmland ecological environment conducive to crop growth but unfavorable to the occurrence of the silver-striped armyworm. For example, deep plowing in winter can directly eliminate some overwintering pupae in fields with a high incidence of late-generation larvae in autumn. Pupae buried deep in the soil cannot emerge, while those exposed on the surface are either preyed upon by birds or die from dehydration, thus significantly reducing the insect population for the following year. However, because agricultural pest control is mostly preventative, its application has certain limitations and it cannot be used as an emergency measure, proving ineffective during silver-striped armyworm outbreaks.
[0004] Chemical control, also known as pesticide control, uses chemical insecticides to kill pests and is an important component of integrated pest management for the silver-striped armyworm. It is characterized by its speed, convenience, simplicity, and high economic efficiency, and is an indispensable emergency measure, especially in the event of a large-scale outbreak of the silver-striped armyworm. Currently, the main method of chemical control is spraying with pesticide solutions. This method is most effective before the third instar larvae of the silver-striped armyworm, when the larvae have a small appetite and weak resistance to pesticides. The timing of control can be determined by the peak period of adult moths attracted by lamps (1st-2nd instar larvae) or by the damage exhibited by the early-instar larvae. Commonly used pesticides include 2.5% deltamethrin, 4.5% lambda-cyhalothrin, 5% abamectin, 5% flufenoxuron EC, or 10% imidacloprid WP, diluted 1000-1500 times for spraying. At the same time, chemical control also has its limitations. For example, improper use often leads to pesticide damage to crops, pesticide resistance in pests, killing of natural enemies, environmental pollution, damage to farmland ecosystems, and pesticide residues threatening the safety of humans and livestock.
[0005] Physical control mainly relies on the pests' responses to various physical factors in the environment. It utilizes physical factors such as light, electricity, color, temperature, and humidity, as well as mechanical equipment for methods like trapping and radiation sterilization to control pests. During peak adult emergence, nets or lights are used for trapping and killing. Taking advantage of the strong phototaxis of adult silver-striped noctuid moths, black light lamps are used during the emergence period to trap and kill adults, reducing egg-laying and larval density in the field. However, black light lamps require daily cleaning of the filter; otherwise, the emission of black light will be affected, thus impacting the insecticidal effect. Furthermore, they require a stable power supply voltage and pose a risk of eye injury during operation. Additionally, the initial investment for installing the lamps is substantial.
[0006] Biological control utilizes beneficial organisms or their metabolites to control pest populations, thereby reducing or eliminating pests. This involves selecting pesticides with low toxicity to natural enemies and adjusting application times based on the differences in pest and natural enemy occurrence periods in the field, avoiding application when natural enemies are abundant to protect them. Secondly, artificial release of the rice leaf roller wasp or spraying with agents such as Bacillus thuringiensis SD-5 and the silver-striped armyworm nucleopolyhedrovirus can control the silver-striped armyworm. Its advantages include safety for humans and livestock, minimal environmental pollution, and the ability to achieve long-term control of certain pests; however, its effectiveness is often inconsistent, and the same investment is required regardless of the severity of the silver-striped armyworm infestation.
[0007] To address the limitations of agricultural, chemical, physical, and biological pest control in practical applications, scientists have discovered that transferring insect-resistant genes encoding insecticidal proteins into plants can produce some insect-resistant transgenic plants for controlling plant pests.
[0008] Bacillus thuringiensis (Bt) is a Gram-positive bacterium widely distributed in nature. The most distinctive feature of Bt, differentiating it from other Bacillus species, is the presence of a crystalline protein, commonly known as a parasporal crystal, that accompanies spore formation during its later growth stages. Bt strains are considered entomopathogenic, with their pathogenicity primarily or entirely dependent on this parasporal crystal protein. Recent literature has reported numerous studies demonstrating the insecticidal activity of various Bt strains against Lepidoptera, Coleoptera, Diptera, Hymenoptera, and Homoptera.
[0009] Cry1Da1 protein is a parasporal crystal protein of Bacillus thuringiensis. Ingested by insects, it enters the midgut, where the protoxin dissolves in the alkaline pH environment. The N- and C-termini of the protein are digested by alkaline proteases, converting the protoxin into an active fragment. This active fragment binds to receptors on the upper surface of the insect's midgut epithelial cell membrane, inserts into the intestinal membrane, causing cell membrane perforation, disrupting osmotic pressure changes and pH balance, interfering with the insect's digestion process, and ultimately leading to death. Cry1Da1 protein is a Lepidoptera-specific Bt insecticidal crystal protein with a novel mechanism. Its midgut receptors in Lepidoptera differ from other Cry proteins (Reference 1), and it exhibits good resistance to various Lepidoptera insects such as the fall armyworm and the cotton bollworm. However, the insecticidal activity of Cry1Da1 protein and its variants against the soybean pest, the silver-striped armyworm, is not disclosed in existing technologies. Summary of the Invention
[0010] In view of this, the purpose of this invention is to provide a method and application for controlling the soybean pest, the silver-striped armyworm, using Cry1Da1 protein.
[0011] In a first aspect, the present invention provides a method for controlling lepidopteran pests, comprising contacting the lepidopteran pests with an insecticidal protein, said insecticidal protein comprising an amino acid sequence as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20.
[0012] In a second aspect, the present invention provides a method for controlling lepidopteran pests, comprising introducing a nucleic acid molecule encoding an insecticidal protein into a plant, causing the lepidopteran pests to feed on the plant, wherein the insecticidal protein comprises an amino acid sequence as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20.
[0013] In a third aspect, the present invention provides the use of an insecticidal protein for controlling lepidopteran pests, wherein the insecticidal protein comprises an amino acid sequence as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20.
[0014] The beneficial effects of this invention are as follows:
[0015] In this invention, the Cry1Da1-related protein is toxic to the silver-striped armyworm. The plants of this invention, particularly soybeans, contain exogenous DNA in their genome, which includes a nucleotide sequence encoding the Cry1Da1-related protein. The silver-striped armyworm comes into contact with this protein by ingesting plant tissues, resulting in inhibited growth and / or death. Inhibition refers to lethal or sublethal effects. Simultaneously, the plant should be morphologically normal and culturable under conventional methods for product consumption and / or generation. Furthermore, this plant essentially eliminates the need for chemical or biological pesticides (specifically, pesticides targeting the silver-striped armyworm, which is targeted by the Cry1Da1-related protein). This invention provides a use of an insecticidal protein with the following advantages:
[0016] 1. Internal control. Existing technologies mainly control the damage caused by the silver-striped armyworm through external factors, such as agricultural control, chemical control, physical control, and biological control. However, this invention controls the silver-striped armyworm by producing the Cry1Da protein within the plant that can kill it, i.e., it controls the pest through internal factors.
[0017] 2. No pollution or residue. While existing chemical control methods have played a role in controlling the damage caused by the silver-striped armyworm, they also cause pollution, damage, and residue to humans, livestock, and farmland ecosystems. The method for controlling the silver-striped armyworm using this invention can eliminate these adverse consequences.
[0018] 3. Control throughout the entire growth cycle. Existing technologies for controlling the silver-striped armyworm pest are all phased, while this invention provides protection for plants throughout their entire growth cycle. Transgenic plants (Cry1Da protein) can avoid being attacked by the silver-striped armyworm from germination and growth to flowering and fruiting.
[0019] 4. Whole-plant control. Most existing methods for controlling the silver-striped armyworm are localized, such as foliar spraying; however, this invention protects the entire plant, including the roots, leaves, stems, fruits, tassels, ears, anthers, and filaments of the transgenic plant (Cry1Da protein), all of which are resistant to silver-striped armyworm infestation.
[0020] 5. Stable efficacy. Existing technologies, whether agricultural or physical control methods, rely on environmental conditions for pest control, which are subject to numerous variables. This invention, by expressing the Cry1Da protein within plants, effectively overcomes the instability of environmental conditions. Furthermore, the control efficacy of the transgenic plants (Cry1Da protein) of this invention remains stable and consistent across different locations, times, and genetic backgrounds.
[0021] 6. Simple, convenient, and economical. Existing frequency-vibration insecticidal lamps require a large initial investment and pose a risk of electric shock if not operated properly. This invention only requires planting transgenic plants that express the Cry1Da protein, without the need for other measures, thus saving a significant amount of manpower, material resources, and financial resources.
[0022] 7. Thorough effect. Existing methods for controlling the silver-striped armyworm pest are incomplete, only mitigating the damage; however, the transgenic plant (Cry1Da protein) of this invention can cause mass mortality of newly hatched silver-striped armyworm larvae and greatly inhibit the development of the small number of surviving larvae, while the transgenic plant itself suffers only minor damage. Attached Figure Description
[0023] Figure 1 This is a flowchart of the construction process of the recombinant cloning vector DBN002A containing the nucleotide sequence of the Cry1Da1-related protein BD1-002 of the present invention;
[0024] Figure 2 This is a flowchart illustrating the construction process of the soybean recombinant expression vector DBN002A-B containing the nucleotide sequence of the Cry1Da1-related protein BD1-002 according to the present invention. Detailed Implementation
[0025] It should be noted that, unless otherwise defined, the technical or scientific terms used in this application shall have the ordinary meaning as understood by one of ordinary skill in the art.
[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the medicinal materials and reagents used in the following examples are commercially available products.
[0027] In a first aspect, the present invention provides a method for controlling lepidopteran pests, comprising contacting the lepidopteran pests with an insecticidal protein, said insecticidal protein comprising an amino acid sequence as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20.
[0028] In a second aspect, the present invention provides a method for controlling lepidopteran pests, comprising introducing a nucleic acid molecule encoding an insecticidal protein into a plant, causing the lepidopteran pests to feed on the plant, wherein the insecticidal protein comprises an amino acid sequence as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20.
[0029] Those skilled in the art will readily recognize that advances in molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, have provided a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequences and potential gene sequences of proteins of interest in agriculture.
[0030] The genes and proteins described in this invention include not only specific example sequences, but also portions and / or fragments (including those with incomplete or terminal deletions compared to the full-length protein), variants, mutants, substitutes (proteins with substituted amino acids), chimeras, and fusion proteins that preserve the insecticidal activity characteristics of the specific example proteins. The term "variant" or "mutation" refers to a nucleotide sequence encoding the same protein or an equivalent protein with insecticidal activity. The term "equivalent protein" refers to a protein that has the same or substantially the same biological activity against lepidopteran pests as the protein described in this invention.
[0031] In this invention, the Cry1Da1 protein includes, but is not limited to, amino acid sequences that have a certain degree of homology with the amino acid sequences shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:20. These sequences typically exhibit greater than 60% similarity / identity with the sequences of this invention, preferably greater than 75%, more preferably greater than 90%, even more preferably greater than 95%, and may be greater than 99%. Preferred nucleotides and proteins of this invention may also be defined according to more specific ranges of similarity and / or identity. For example, sequences of 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% similarity to those in the examples of this invention.
[0032] In a preferred embodiment, the nucleotide sequences encoding the amino acid sequences shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20 are shown in SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, and SEQ ID NO:21, respectively.
[0033] In this invention, nucleic acid molecules or fragments thereof hybridize with the modified Cry1Da1 gene under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the modified Cry1Da1 gene. Nucleic acid molecules or fragments thereof can specifically hybridize with other nucleic acid molecules under certain conditions. In this invention, if two nucleic acid molecules can form antiparallel double-stranded nucleic acid structures, it can be said that these two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules exhibit perfect complementarity, then one nucleic acid molecule is called a "complement" of the other nucleic acid molecule. In this invention, when every nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to exhibit "perfect complementarity." If two nucleic acid molecules can hybridize with sufficient stability to anneal and bind to each other under at least conventional "low-string" conditions, then the two nucleic acid molecules are called "minimally complementary." Similarly, if two nucleic acid molecules can hybridize with sufficient stability to anneal and bind to each other under conventional "high-string" conditions, then the two nucleic acid molecules are said to be "complementary." Deviations from perfect complementarity are permissible, as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. For a nucleic acid molecule to function as a primer or probe, it only needs to be sufficiently complementary in sequence to form a stable double-stranded structure under the specific solvent and salt concentration used.
[0034] In this invention, the substantially homologous sequence is a nucleic acid molecule that, under highly stringent conditions, can specifically hybridize with the complementary strand of a matching nucleic acid molecule. Suitable stringent conditions that promote DNA hybridization, such as treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C followed by washing with 2.0× SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from approximately 2.0× SSC, 50°C for low-stringent conditions to approximately 0.2× SSC, 50°C for high-stringent conditions. Furthermore, the temperature conditions in the washing step can be increased from approximately 22°C (room temperature) for low-stringent conditions to approximately 65°C for high-stringent conditions. Both the temperature conditions and the salt concentration can be changed, or one can remain constant while the other is changed. Preferably, the stringent conditions described in this invention can be as follows: specific hybridization with SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:21 in 6×SSC, 0.5% SDS solution at 65°C, followed by washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.
[0035] Therefore, sequences possessing insecticidal activity and hybridizing with SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, or SEQ ID NO:21 of the present invention under stringent conditions are included in the present invention. These sequences are at least about 40% to 50% homologous, about 60%, 65%, or 70% homologous, or even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater sequence homology with the sequences of the present invention.
[0036] Due to the abundance of genetic codons, many different DNA sequences can encode the same amino acid sequence. The production of alternative DNA sequences encoding these identical or substantially identical proteins is within the skill level of those skilled in the art. These different DNA sequences are included within the scope of this invention. The term "substantially identical" means a sequence with amino acid substitutions, deletions, additions, or insertions that do not substantially affect insecticidal activity, and also includes fragments that retain insecticidal activity.
[0037] As used in this invention, "transgenic" refers to any cell, cell line, callus, tissue, plant part, or plant whose genome has been altered due to the presence of a heterologous nucleic acid (such as a recombinant DNA construct). "Transgenic" as used in this invention includes those initial transgenic events and those resulting from those events through sexual hybridization or asexual reproduction, but does not cover genomic (chromosomal or extrachromosomal) alterations made through conventional plant breeding methods or through naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.
[0038] In this invention, "insecticide" or "insect-resistant" refers to being toxic to crop pests, thereby achieving "control" and / or "prevention" of crop pests. Preferably, "insecticide" or "insect-resistant" means killing crop pests. More specifically, the target insects are lepidopteran pests.
[0039] In this invention, "contact" refers to touching, staying and / or feeding, specifically insects and / or pests touching, staying and / or feeding on plants, plant organs, plant tissues or plant cells. The plants, plant organs, plant tissues or plant cells may express insecticidal proteins within themselves, or they may have insecticidal proteins on their surface and / or have microorganisms that produce insecticidal proteins.
[0040] The "control" and / or "prevention" described in this invention refer to the contact between lepidopteran pests and the Cry1Da1 protein, resulting in the inhibition of growth and / or death of the lepidopteran pests. Further, lepidopteran pests come into contact with the Cry1Da1 protein by ingesting plant tissues, resulting in the inhibition of growth and / or death of all or part of the lepidopteran pests. Inhibition refers to sublethality, meaning it does not cause death but induces some effect on growth, development, behavior, physiology, biochemistry, and tissue aspects, such as slowed and / or stopped growth. Simultaneously, the plant should be morphologically normal and culturable under conventional methods for the consumption and / or generation of products. Furthermore, plants and / or seeds containing the nucleotide sequence encoding the Cry1Da1 protein that control lepidopteran pests, under conditions of artificial inoculation with lepidopteran pests and / or natural pest damage, exhibit reduced plant damage compared to non-transgenic wild-type plants. Specific manifestations include, but are not limited to, improved leaf resistance, and / or increased grain weight, and / or increased yield. The “control” and / or “prevention” effect of Cry1Da1 protein on lepidopteran pests can exist independently. Specifically, if any tissue of a transgenic plant (containing a nucleotide sequence encoding Cry1Da1 protein) simultaneously and / or asynchronously contains and / or produces Cry1Da1 protein and / or another substance that controls lepidopteran pests, the presence of the other substance does not result in the “control” and / or “prevention” effect being wholly and / or partially achieved by the other substance, and is unrelated to Cry1Da1 protein. Normally, in the field, the process of lepidopteran pests feeding on plant tissues is brief and difficult to observe with the naked eye. Therefore, under conditions of artificial inoculation of lepidopteran pests and / or natural occurrence of lepidopteran pest damage, such as the presence of dead lepidopteran pests in any tissue of a transgenic plant (containing a nucleotide sequence encoding the Cry1Da1 protein), and / or lepidopteran pests with inhibited growth remaining on it, and / or reduced plant damage compared to non-transgenic wild-type plants, the method and / or use of the present invention is realized, namely, the method and / or use of controlling lepidopteran pests by contacting the Cry1Da1 protein with lepidopteran pests.
[0041] In a preferred embodiment, the lepidopteran pest is the silver-striped noctuid moth. The silver-striped noctuid moth is widely distributed in my country, mainly in the Yangtze and Yellow River basins. The number of generations per year varies across regions: 2-3 generations in Ningxia Hui Autonomous Region, approximately 3-4 generations in Hebei and Jiangsu, approximately 5-6 generations in Hunan and Hubei, and 7 generations in Guangzhou. The insect overwinters as a pupa. Adults emerge in April of the following year, and after 4-5 days, they enter their peak oviposition period. Eggs are mostly laid singly on the underside of leaves. The second and third generations lay the most eggs. Adults are nocturnal and exhibit phototaxis and chemotaxis. Newly hatched larvae primarily feed on the leaf mesophyll on the underside of leaves, leaving the epidermis behind. After the third instar, they feed on tender leaves, creating holes, and their appetite increases significantly. The larvae have five instars and exhibit feigning death; when startled, they curl up and fall to the ground. At room temperature, the larval stage lasts approximately 10 days. Mature larvae spin white silk cocoons on the underside of host leaves to pupate. Adults can still be seen from late November to early December. The damage caused by the silver-striped noctuid moth is mainly affected by the initial population of insects and temperature and humidity. Higher humidity and lower temperature in summer are conducive to its occurrence, but heavy rain during the egg stage and early larval stage is unfavorable.
[0042] In classification systems, Lepidoptera are generally divided into suborders, superfamilies, and families based on morphological characteristics such as the venation sequence, linkage pattern, and antennae type of adult wings. Noctuidae is the most diverse family within Lepidoptera, with over 20,000 species discovered worldwide, and several thousand recorded in China alone. Most Noctuidae insects are agricultural pests, feeding on leaves and borer bolls, such as the cotton bollworm and the beet armyworm. Although the cotton bollworm, beet armyworm, and silver-striped armyworm all belong to the Noctuidae family of Lepidoptera, they differ greatly in morphology and structure, aside from similarities in classification criteria. This is similar to the difference between strawberries and apples (both belonging to the Rosaceae family of the Rosales order); both have bisexual flowers, radial symmetry, and five petals, but their fruits and plant morphologies are vastly different. However, because people have limited contact with insects, especially agricultural pests, they pay little attention to these morphological differences, leading to the misconception that insects are largely similar in appearance. In fact, the silver-striped noctuid moth possesses unique characteristics in both its larval and adult forms. For example, the head of the beet armyworm larva is dark brown, and its thorax varies in color, ranging from yellowish-brown to dark green; the adult beet armyworm is dark brown with white tufts of hair on the back of its thorax, and grayish-brown forewings with numerous patterns. In contrast, the silver-striped noctuid moth, which also belongs to the noctuid family, has a pale green larva; the adult silver-striped noctuid moth is grayish-brown with two tufts of long, upright, brownish-red scales on the back of its thorax, and dark brown forewings with silvery-white markings.
[0043] Insects belonging to the same family, Noctuidae, exhibit significant differences not only in morphological characteristics but also in feeding habits. For example, the cotton bollworm, also a member of the Noctuidae family, bores into cotton bolls or corn ears, while the beet armyworm prefers to feed on leaves, leaving only the midrib. Its host range is extremely broad, affecting nearly 300 species of plants from over 100 families, including melons, eggplants, beans, onions, leeks, spinach, cruciferous vegetables, grains, and cash crops, in addition to corn and soybeans. The silver-striped armyworm, on the other hand, has a relatively concentrated host range on cruciferous vegetables and legumes, primarily feeding on leaves. These differences in feeding habits suggest variations in the enzymes and receptor proteins produced by their digestive systems. Enzymes produced in the digestive tract are crucial for the function of Bt genes; only enzymes or receptor proteins that can bind to specific Bt genes can provide resistance to a particular pest. Increasing research indicates that insects from different families within the same order, and even different species within the same family, exhibit varying sensitivities to the same Bt protein. For example, the Cry1Ab protein exhibits completely different effects on four noctuid moths. It shows good resistance to the cotton bollworm (Helicoverpa armigera), but has almost no effect on the beet armyworm (Spodoptera exigua), and shows no activity at all against the cotton bollworm (Spodoptera litura) and the cutworm (Agrotis ipsilon). These pests all belong to the Noctuid moth family (Lepidoptera), yet the same Bt protein shows different resistance effects against these different noctuid moths. This fully demonstrates that the interaction between Bt protein and enzymes and receptors in insects is complex and unpredictable.
[0044] In a preferred embodiment, the plant is a monocotyledonous plant or a dicotyledonous plant; in a more preferred embodiment, the plant is soybean.
[0045] The term "plant" as used in this invention refers to any plant, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can regenerate, plant callus, and complete plant cells in a plant or plant part, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc.
[0046] The genetically modified plant can be at any stage of growth.
[0047] In a third aspect, the present invention provides the use of an insecticidal protein for controlling lepidopteran pests, wherein the insecticidal protein comprises an amino acid sequence as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20.
[0048] In a preferred embodiment, the nucleotide sequences encoding the amino acid sequences shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:20 are shown in SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:21, respectively.
[0049] In a preferred embodiment, the lepidopteran pest is the silver-striped noctuid moth.
[0050] In a preferred embodiment, the insecticidal protein is brought into contact with lepidopteran pests to control them.
[0051] In a preferred embodiment, the insecticidal protein is used to control lepidopteran pests in plants; preferably, the plant is a monocotyledonous or dicotyledonous plant; more preferably, the plant is soybean.
[0052] The amino acid and nucleotide sequences involved in this article are shown in the table below:
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059] The technical solution of the present invention will be further illustrated below through specific embodiments.
[0060] Example 1: Obtaining and synthesizing Cry1Da1-like protein genes
[0061] The BD1-002 sequence is a patented sequence modified from BD1-001 (Cry1Da1). The BD1-001 and BD1-002 sequences are derived from the public information of patent US10287605B2 or NCBI GenBank:CAA38099.1, and have a full-length amino acid sequence of 1165 aa. BD1-018, BD1-019, BD1-021, BD1-022, and BD1-022S are sequences modified by the inventors based on BD1-001.
[0062] 1. Obtain the nucleotide sequence
[0063] The amino acid sequence (1165 amino acids) of the BD1-002 insecticidal protein is shown in SEQ ID NO:2 in the sequence listing; the BD1-002 nucleotide sequence (3498 nucleotides) encoding the amino acid sequence of the BD1-002 insecticidal protein is shown in SEQ ID NO:8 in the sequence listing.
[0064] The amino acid sequence (1165 amino acids) of the BD1-018 insecticidal protein is shown in SEQ ID NO:3 in the sequence listing; the BD1-018 nucleotide sequence (3498 nucleotides) encoding the amino acid sequence of the BD1-018 insecticidal protein is shown in SEQ ID NO:9 in the sequence listing.
[0065] The amino acid sequence (1165 amino acids) of the BD1-019 insecticidal protein is shown in SEQ ID NO:4 in the sequence listing; the BD1-019 nucleotide sequence (3498 nucleotides) encoding the amino acid sequence of the BD1-019 insecticidal protein is shown in SEQ ID NO:10 in the sequence listing.
[0066] The amino acid sequence (1165 amino acids) of the BD1-021 insecticidal protein is shown in SEQ ID NO:5 in the sequence listing; the BD1-021 nucleotide sequence (3498 nucleotides) encoding the amino acid sequence of the BD1-021 insecticidal protein is shown in SEQ ID NO:11 in the sequence listing.
[0067] The amino acid sequence (1161 amino acids) of the BD1-022 insecticidal protein is shown in SEQ ID NO:6 in the sequence listing; the BD1-022 nucleotide sequence (3486 nucleotides) encoding the amino acid sequence of the BD1-022 insecticidal protein is shown in SEQ ID NO:12 in the sequence listing.
[0068] The amino acid sequence (615 amino acids) of the BD1-022S insecticidal protein is shown in SEQ ID NO:20 of the sequence listing; the BD1-022S nucleotide sequence (1848 nucleotides) encoding the amino acid sequence of the BD1-022S insecticidal protein is shown in SEQ ID NO:21 of the sequence listing.
[0069] 2. Synthesize the above nucleotide sequence
[0070] The following nucleotide sequences were synthesized: BD1-002 (as shown in SEQ ID NO:8 in the sequence listing), BD1-018 (as shown in SEQ ID NO:9 in the sequence listing), BD1-019 (as shown in SEQ ID NO:10 in the sequence listing), BD1-021 (as shown in SEQ ID NO:11 in the sequence listing), BD1-022 (as shown in SEQ ID NO:12 in the sequence listing), and BD1-022S (as shown in SEQ ID NO:21 in the sequence listing). The 5' end of each of the synthesized nucleotide sequences (SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:21) is further connected to a BamHI restriction site, and the 3' end is further connected to a Hind III restriction site.
[0071] Example 2: Vector construction, in vitro expression and purification of Cry1Da1 protein
[0072] 1. Construct a recombinant cloning vector containing Cry1Da1-like genes.
[0073] 1) Using BamHI and HindIII restriction sites, the nucleotide sequence (SEQ ID NO:8) of BD1-002 was cloned and ligated into the pET28a plasmid (Novagen, USA, CAT:69864-3) to obtain the recombinant vector DBN002A. The construction procedure is as follows: Figure 1As shown (where f1 origin represents the replication initiation site of phage f1; Kan represents the kanamycin resistance gene; T7 promoter represents the T7 RNA polymerase promoter; His Tag represents the His tag; BD1-002 represents the BD1-002 nucleotide sequence (SEQ ID NO:8); T7 terminator represents the T7 terminator). *E. coli* BL21(DE3) competent cells (Transgen, China, CAT:CD501) were transformed using a heat shock method. The heat shock conditions were: 50 μL *E. coli* BL21(DE3) competent cells, 10 μL plasmid DNA, incubated at 42°C for 30 s; cultured at 37°C with shaking at 100 rpm for 1 h; then the cultured product was plated on LB agar plates (1% tryptone, 1% NaCl, 0.5% yeast extract, 1.5% agar) containing 50 mg / L kanamycin and cultured at 37°C for 12 h. Single colonies were picked and inoculated into 5 mL of LB liquid medium (1% tryptone, 1% NaCl, 0.5% yeast extract, pH adjusted to 7.5 with NaOH), and kanamycin was added to a final concentration of 50 mg / L. The medium was then incubated on a shaker at 37°C and 220 rpm for 16 h. Plasmids were extracted using the AxyPrep plasmid DNA extraction kit (CORNING, China, CAT: AP-MN-P-50). The obtained plasmids were verified by BamHI and HindIII restriction enzyme digestion, and positive clones were sequenced. The results showed that the target nucleotide sequence inserted into the positive recombinant clone vector was the nucleotide sequence shown in SEQ ID NO:8 in the sequence listing, i.e., the BD1-002 nucleotide sequence was correctly inserted.
[0074] 2) Following the method described above for constructing a recombinant cloning vector, the nucleotide sequence of BD1-018 was ligated to pET28a to obtain the recombinant cloning vector DBN018A, wherein BD1-018 is the nucleotide sequence of BD1-018 (SEQ ID NO:9). Enzyme digestion and sequencing verification results showed that the BD1-018 nucleotide sequence was correctly inserted into the recombinant cloning vector DBN018A.
[0075] 3) Following the method described above for constructing a recombinant cloning vector, the nucleotide sequence of BD1-019 was ligated to pET28a to obtain the recombinant cloning vector DBN019A, wherein BD1-019 is the nucleotide sequence of BD1-019 (SEQ ID NO:10). Enzyme digestion and sequencing verification results showed that the BD1-019 nucleotide sequence was correctly inserted into the recombinant cloning vector DBN019A.
[0076] 4) Following the method described above for constructing a recombinant cloning vector, the nucleotide sequence of BD1-021 was ligated to pET28a to obtain the recombinant cloning vector DBN021A, wherein BD1-021 is the nucleotide sequence of BD1-021 (SEQ ID NO: 11). Enzyme digestion and sequencing verification results showed that the BD1-021 nucleotide sequence was correctly inserted into the recombinant cloning vector DBN021A.
[0077] 5) Following the method described above for constructing a recombinant cloning vector, the nucleotide sequence of BD1-022 was ligated to pET28a to obtain the recombinant cloning vector DBN022A, wherein BD1-022 is the nucleotide sequence of BD1-022 (SEQ ID NO:12). Enzyme digestion and sequencing verification results showed that the BD1-022 nucleotide sequence was correctly inserted into the recombinant cloning vector DBN022A.
[0078] 6) Following the method described above for constructing a recombinant cloning vector, the nucleotide sequence of BD1-022S was ligated to pET28a to obtain the recombinant cloning vector DBN022SA, wherein BD1-022S is the nucleotide sequence of BD1-022S (SEQ ID NO: 21). Enzyme digestion and sequencing verification results showed that the BD1-022S nucleotide sequence was correctly inserted into the recombinant cloning vector DBN022SA.
[0079] 2. In vitro expression of Cry1Da1-like proteins
[0080] 1) Select positive single colonies and inoculate them into 5 mL of LB liquid medium, add kanamycin to a final concentration of 50 mg / L, and incubate on a shaker at 37°C and 220 rpm for 16 h to obtain the activated strain.
[0081] 2) Transfer the bacterial culture to 2×YT medium (1.6% tryptone, 0.5% NaCl, 1% yeast extract) at a ratio of 1:10 and incubate on a shaker at 37°C and 220 rpm for 1 h.
[0082] 3) When the OD600 of the culture medium is 0.6 to 0.8, add IPTG to a final concentration of 0.5 mM to induce expression, and incubate on a shaker at 37°C and 220 rpm for 6 h.
[0083] 4) Collect bacterial cells at 7000 rpm for 5 min, discard the supernatant, and resuspend the bacterial cells in an appropriate amount of PBS buffer. Sonicate the bacterial cells to obtain a lysed bacterial solution. Centrifuge the lysed bacterial solution at 7000 rpm for 5 min to obtain soluble and insoluble components. Resuspend the insoluble components in PBS buffer.
[0084] 5) Take an appropriate amount of sample and perform SDS-PAGE analysis. The results show that the target protein is mainly present in the soluble fraction.
[0085] 3. Purification of Cry1Da1-like proteins
[0086] 1) Using the AKTA rapid purification system, the soluble components were purified using a HisTrap HP nickel column to obtain purified Cry1Da1-like proteins; the purified proteins were then desalted using a HiTrap Desalting column. Refer to the AKTA operating manual for the operating procedures.
[0087] 2) Take an appropriate amount of the desalted and purified sample and perform SDS-PAGE detection.
[0088] 3) Calculate the protein concentration in the desalted protein solution based on the BSA standard curve.
[0089] 4) The purified protein is stored at -20℃ for later use.
[0090] Example 3: Feeding and testing of Silver-striped Noctuid moths
[0091] The purified protein solution was mixed into the feed for *Leptochloa crus-galli* (final concentration 100 μg / g), and after thorough mixing, placed in a petri dish. Healthy, unfeeded newly hatched larvae of *Leptochloa crus-galli* were selected as test insects, with 10 larvae introduced at a time. The petri dishes were covered and placed under conditions of 25–28℃, 70% relative humidity, and a photoperiod (light / dark) of 16:8 until the third day. The mortality rate of the *Leptochloa crus-galli* larvae was calculated as: mortality rate = number of dead larvae / total number of introduced larvae × 100%. Feeds with only CBS buffer and feeds with only sterile water were used as negative controls. Each system was repeated 6 times, with 2 replicates per system. The mortality rate of the CBS buffer-treated group was used as the control mortality rate, and the corrected mortality rate for each treatment group was calculated as: corrected mortality rate = (treatment mortality rate - control mortality rate) / (1 - control mortality rate) × 100%. The results are shown in Table 1.
[0092] Table 1. Results of feeding bioassays on the silver-striped noctuid moth.
[0093]
[0094] The results showed that the silver-striped armyworms that consumed the Cry1Da1 protein described in this application all had a high corrected mortality rate, indicating that the Cry1Da1 protein described in this application has good insecticidal activity against the silver-striped armyworm.
[0095] Example 4: Obtaining Transgenic Soybean Plants
[0096] 4.1 Construction of recombinant expression vectors
[0097] The expression vector DBNBC-001 (vector backbone: pCAMBIA2301, provided by CAMBIA) was digested with restriction endonucleases AscⅠ and HindⅢ. The BD1-002 nucleotide sequence was amplified using primers 1 (SEQ ID NO: 13) and 2 (SEQ ID NO: 14). The amplified BD1-002 nucleotide sequence fragment was then seamlessly inserted between the AscⅠ and HindⅢ restriction endonuclease sites of the expression vector DBNBC-001 to construct the recombinant expression vector DBN002A-B. The construction procedure is as follows: Figure 2 As shown (RB: right boundary; eFMV: enhancer; prBrCBP: CBP1 gene promoter; spAtCTP2: signal peptide; cEPSPS: 5-enolpyruvate-shikimate-3-phosphate synthase; tPsE9: pea ribulose-1,5-bisphosphate carboxylase / oxygenase small subunit E9 protein gene terminator; prAtUbi10: Arabidopsis ubiquitin gene promoter; BD1-002: BD1-002 nucleotide sequence (SEQ ID NO:8); tNos: carmine synthase (nos) terminator; pr35s: cauliflower mosaic virus 35S promoter; PAT: glufosinate acetyltransferase gene; t35s: cauliflower mosaic virus 35S terminator; LB: left boundary). The method for constructing this vector is well known to those skilled in the art.
[0098] The recombinant expression vector DBN002A-B was transformed into *E. coli* T1 competent cells using a heat shock method. The heat shock conditions were: 50 μL *E. coli* T1 competent cells, 10 μL plasmid DNA, incubated at 42°C for 30 s; then cultured at 37°C with shaking for 1 h (shaking at 100 rpm). The cultured product was then plated onto LB agar plates containing 50 mg / L kanamycin and cultured at 37°C for 12 h. Single colonies were picked and inoculated into 5 mL of LB liquid medium, with kanamycin added to a final concentration of 50 mg / L. The plates were then cultured at 37°C and 220 rpm for 16 h. Single colonies were picked again, and kanamycin was added to LB liquid medium to a final concentration of 50 mg / L. The plates were then cultured overnight at 37°C. The plasmid was extracted using the AxyPrep plasmid DNA extraction kit. The extracted plasmids were identified by digestion with restriction endonucleases AscⅠ and HindⅢ, and positive clones were sequenced for identification. The results showed that the nucleotide sequence between the AscⅠ and HindⅢ restriction sites of the recombinant expression vector DBN002A-B was the nucleotide sequence shown in SEQ ID NO:8 in the sequence listing, namely the BD1-002 nucleotide sequence.
[0099] Following the method described above for constructing DBN002A-B, the BD1-018 nucleotide sequence was amplified using primers 1 (SEQ ID NO:13) and 3 (SEQ ID NO:15). The amplified BD1-018 nucleotide sequence fragment was then seamlessly cloned and inserted between the restriction enzyme sites of the expression vector DBNBC-001 to obtain the recombinant expression vector DBN018A-B. Restriction enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN018A-B contains the nucleotide sequence shown in SEQ ID NO:9 of the sequence listing, i.e., the BD1-018 nucleotide sequence.
[0100] Following the method described above for constructing DBN002A-B, primers 1 (SEQ ID NO:13) and 3 (SEQ ID NO:15) were used to amplify the BD1-019 nucleotide sequence. The amplified BD1-019 nucleotide sequence fragment was then seamlessly cloned and inserted between the restriction enzyme sites of the expression vector DBNBC-001 to obtain the recombinant expression vector DBN019A-B. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN019A-B contains the nucleotide sequence shown in SEQ ID NO:10 of the sequence listing, i.e., the BD1-019 nucleotide sequence.
[0101] Following the method described above for constructing DBN002A-B, the BD1-021 nucleotide sequence was amplified using primers 1 (SEQ ID NO:13) and 3 (SEQ ID NO:15). The amplified BD1-021 nucleotide sequence fragment was then seamlessly cloned and inserted between the restriction enzyme sites of the expression vector DBNBC-001 to obtain the recombinant expression vector DBN021A-B. Restriction enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN021A-B contains the nucleotide sequence shown in SEQ ID NO:11 of the sequence listing, i.e., the BD1-021 nucleotide sequence.
[0102] Following the method described above for constructing DBN002A-B, primers 1 (SEQ ID NO:13) and 4 (SEQ ID NO:16) were used to amplify the BD1-022 nucleotide sequence. The amplified BD1-022 nucleotide sequence fragment was then seamlessly inserted between the restriction enzyme sites of the expression vector DBNBC-001 to obtain the recombinant expression vector DBN022A-B. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN022A-B contains the nucleotide sequence shown in SEQ ID NO:12 of the sequence listing, i.e., the BD1-022 nucleotide sequence.
[0103] Following the method described above for constructing DBN002A-B, the BD1-022S nucleotide sequence was amplified using primers 1 (SEQ ID NO:13) and 7 (SEQ ID NO:22). The amplified BD1-022S nucleotide sequence fragment was then seamlessly inserted between the restriction enzyme sites of the expression vector DBNBC-001 to obtain the recombinant expression vector DBN022SA-B. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN022SA-B contains the nucleotide sequence shown in SEQ ID NO:21 of the sequence listing, i.e., the BD1-022S nucleotide sequence.
[0104] 4.2 Transformation of Agrobacterium with recombinant expression vector
[0105] The correctly constructed recombinant expression vectors DBN002A-B, DBN018A-B, DBN019A-B, DBN021A-B, DBN022A-B, and DBN022SA-B were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) using liquid nitrogen. The transformation conditions were as follows: 100 μl Agrobacterium LBA4404, 3 μl plasmid DNA (recombinant expression vector); incubation in liquid nitrogen for 10 minutes, followed by a 37°C water bath for 10 minutes; the transformed Agrobacterium LBA4404 was then inoculated into LB tubes and incubated at 28°C and 200 rpm. After culturing for 2 hours, the samples were plated on LB agar plates containing 50 mg / L rifampicin and 100 mg / L kanamycin until positive single clones grew. Single clones were picked, cultured, and their plasmids were extracted. The recombinant expression vectors DBN002A-B, DBN018A-B, DBN019A-B, DBN021A-B, DBN022A-B, and DBN022SA-B were digested with restriction endonucleases for verification. The results showed that the recombinant expression vectors DBN002A-B, DBN018A-B, DBN019A-B, DBN021A-B, DBN022A-B, and DBN022SA-B had completely correct structures.
[0106] 4.3 Agrobacterium infection of soybean plants
[0107] Following the conventional Agrobacterium infection method, cotyledonary node tissues of the aseptically cultured soybean variety SY2043C were co-cultured with Agrobacterium transformed by the recombinant expression vector. The T-DNA of the recombinant expression vector DBN002A-B was transferred into the soybean chromosome to obtain soybean plants with the BD1-002 nucleotide sequence. Wild-type soybean plants were used as a control.
[0108] Following the method described above for obtaining soybean plants containing BD1-002, soybean plants transformed with the nucleotide sequences BD1-018, BD1-019, BD1-021, BD1-022, and BD1-022S were obtained. For Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in soybean germination medium (3 g / L B5 salt, B5 vitamin, 20 g / L sucrose, 8 g / L agar, pH = 5.6). Seeds were inoculated onto the germination medium and cultured under the following conditions: temperature 25 ± 1℃; photoperiod (light / dark) 16 / 8 h. After 4–6 days of germination, fresh, green, swollen, sterile soybean seedlings were harvested. The hypocotyl was removed 3–4 mm below the cotyledon node, the cotyledons were longitudinally cut open, and the terminal bud, lateral buds, and seed roots were removed. Inoculate the cotyledonary segment with the back of a scalpel. Contact the injured cotyledonary segment tissue with an Agrobacterium suspension, in which Agrobacterium can deliver the Cry1Da1 nucleotide sequence to the injured cotyledonary segment tissue (Step 1: Infection Step). In this step, the cotyledonary segment tissue is preferably immersed in an Agrobacterium suspension (OD660 = 0.5–0.8) and an infection medium (MS salt 2 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, acetylsuccione 40 mg / L, pH = 5.3) to initiate inoculation. The cotyledonary segment tissue is co-cultured with Agrobacterium for a period of time (3 days) (Step 2: Co-culture Step). Preferably, after the infection step, the cotyledonary node tissue is cultured on a solid medium (MS salt 4 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, agar 8 g / L, MES 4 g / L, ZT 2 mg / L, pH = 5.6). Following this co-culture phase, a selective "recovery" step may be performed. In the "recovery" step, the recovery medium (B5 salt 3 g / L, vitamin B5, agar 8 g / L, sucrose 30 g / L, MES 1 g / L, ZT 2 mg / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, pH = 5.6) contains at least one known antibiotic (cephalosporin) that inhibits Agrobacterium growth, without the addition of a plant transformant selector (step 3: recovery step). Preferably, the regenerated cotyledonary node tissue blocks are cultured on a solid medium containing antibiotics but without a selector to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the tissue blocks regenerated from the cotyledonary nodes were cultured on a medium containing a selector (glufosinate) and the growing transformed callus tissue was selected (step 4: selection step).Preferably, the cotyledonary regenerated tissue blocks are cultured on a selective solid medium containing a selector (sucrose 30 g / L, agar 8 g / L, B5 salt 3 g / L, B5 vitamin, MES 1 g / L, 6-benzyladenine 1 mg / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, glufosinate 6 mg / L, pH 5.6), leading to selective growth of the transformed cells. The transformed cells then regenerate into plants (step 5: regeneration step). Preferably, the cotyledonary regenerated tissue blocks grown on the selective medium are cultured on solid media (B5 differentiation medium and B5 rooting medium) to regenerate plants.
[0109] The selected resistant tissue blocks were transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, glufosinate 6 mg / L, pH 5.6) and cultured at 25°C for differentiation. The differentiated seedlings were transferred to the B5 rooting medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid 1 mg / L) and cultured at 25°C until approximately 10 cm tall. They were then transferred to a greenhouse for further cultivation until fruit set. In the greenhouse, the seedlings were cultured at 26°C for 16 hours daily, followed by 8 hours at 20°C.
[0110] 4.4 Identification of genetically modified soybean materials
[0111] Approximately 100 mg of leaves from soybean plants transformed with the nucleotide sequences BD1-002, BD1-018, BD1-019, BD1-021, BD1-022, and BD1-022S were collected as samples. Genomic DNA was extracted using the Qiagen Dneasy Plant Maxi Kit, and the copy number of the PAT gene was determined by TaqMan probe-based quantitative PCR to confirm the copy number of the Cry1Da1 gene. Wild-type SY2043C soybean plants were used as controls, and the same analysis was performed in triplicate. The experimental results of analyzing the copy number of the target gene showed that the nucleotide sequences of BD1-002, BD1-018, BD1-019, BD1-021, BD1-022, and BD1-022S had been integrated into the chromosomes of the tested soybean plants. Moreover, the soybean plants transformed with the nucleotide sequences of BD1-002, BD1-018, BD1-019, BD1-021, BD1-022, and BD1-022S had obtained single-copy transgenic soybean plants. The single-copy transgenic soybean plants were selected for propagation to obtain soybean seeds.
[0112] The specific method for detecting the PAT gene copy number is as follows:
[0113] Step 1: Take 100 mg of leaves from soybean plants with BD1-002 nucleotide sequence, soybean plants with BD1-018 nucleotide sequence, soybean plants with BD1-019 nucleotide sequence, soybean plants with BD1-021 nucleotide sequence, soybean plants with BD1-022 nucleotide sequence, soybean plants with BD1-022S nucleotide sequence, and wild-type soybean plants respectively. Grind them into homogenates in a mortar with liquid nitrogen. Take 3 replicates for each sample.
[0114] Step 2: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. Refer to the product instructions for specific methods.
[0115] Step 3: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);
[0116] Step 4: Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80 to 100 ng / μL;
[0117] Step 5: The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and wild-type soybean plant samples were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR were as follows:
[0118] Primer 5: gagggtgttgtggctggtattg is shown in SEQ ID NO: 17 in the sequence listing;
[0119] Primer 6: tctcaactgtccaatcgtaagcg is shown in SEQ ID NO: 18 in the sequence listing;
[0120] Probe 1: cttacgctgggccctggaaggctag as shown in SEQ ID NO: 19 in the sequence listing;
[0121] The PCR reaction system is as follows:
[0122]
[0123] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and is stored in amber tubes at 4°C.
[0124] The PCR reaction conditions are as follows:
[0125]
[0126] Return to step 1 and perform 40 cycles.
[0127] Analyze the data using IBM SPSS software.
[0128] Example 5: Insect resistance of transgenic soybeans to the silver-striped armyworm.
[0129] When soybean plants reached stage V3, the second leaf from the top was used for the bioassay of the silver-striped armyworm. The leaves were rinsed clean with sterile water and dried. The veins were removed, and the leaves were cut into strips approximately 2cm x 3.5cm. One strip was placed on the moisturizing filter paper at the bottom of a round plastic petri dish. Ten newly hatched silver-striped armyworm larvae were placed in each dish. After covering the petri dishes, they were placed under conditions of 25–28℃, 70% relative humidity, and a photoperiod (light / dark) of 16:8 for 3 days. The mortality rate of the silver-striped armyworm larvae and the extent of leaf damage were then calculated. Mortality rate = (number of dead larvae / total number of infested larvae) × 100%. The larval inhibition rate was the proportion of larvae with a lower age than the control. Soybeans with the same genetic background but without the transfer of insect-resistant proteins were used as a negative control. The corrected mortality rate was calculated using the same formula. The results are shown in Table 2.
[0130] Table 2. Bioassay results of transgenic plants on silver-striped noctuid moth.
[0131]
[0132] As shown in Table 2, compared with the negative control, soybean plants expressing the Cry1Da1 protein constructed in this application exhibited a higher inhibition rate against the silver-striped armyworm, a higher mortality rate of the silver-striped armyworm, and a significantly lower leaf damage rate. This indicates that soybean plants expressing the Cry1Da1 protein constructed in this application can not only inhibit the development of the silver-striped armyworm but also reduce the insect's feeding on the leaves, demonstrating a significant insect-resistant effect.
[0133] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.
[0134] References:
[0135] 1.Bacillus thuringiensis Cry1Da_7and Cry1B.868Protein Interactionswith Novel Receptors Allow Control of Resistant Fall Armyworms,Spodopterafrugiperda(JESmith).(2019)Appl Environ Microbiol 85.
Claims
1. A method for controlling lepidopteran pests, comprising contacting the lepidopteran pests with an insecticidal protein, the amino acid sequence of which is shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 20, wherein the lepidopteran pest is the silver-striped noctuid moth.
2. A method for controlling lepidopteran pests, comprising introducing a nucleic acid molecule encoding an insecticidal protein into a plant, causing the lepidopteran pest to feed on the plant, wherein the amino acid sequence of the insecticidal protein is shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 20, wherein the lepidopteran pest is the silver-striped noctuid moth, and the plant is a monocotyledonous or dicotyledonous plant.
3. The method according to claim 1 or 2, wherein the nucleotide sequences encoding the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 20 are shown in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 21, respectively.
4. The method according to claim 2, wherein the plant is soybean.
5. The use of an insecticidal protein for controlling lepidopteran pests, wherein the amino acid sequence of the insecticidal protein is shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 20, wherein the lepidopteran pest is the silver-striped noctuid moth.
6. The use according to claim 5, wherein the nucleotide sequences encoding the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 20 are shown in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 21, respectively.
7. The use according to claim 5 or 6, wherein the insecticidal protein is contacted with the silver-striped armyworm to control it.
8. The use according to claim 5 or 6, wherein the insecticidal protein is used to control the silver-striped armyworm in plants; wherein the plants are monocotyledonous or dicotyledonous plants.
9. The use according to claim 8, wherein the plant is soybean.
Citation Information
Patent Citations
US10287605B2
CN112175052A
CN114747590A