Modified nicotinamide phosphoribosyltransferase and method for producing nicotinamide mononucleotide using same

Abstract

Provided is an improved method for producing NMN.　The present invention pertains to: a modified nicotinamide phosphoribosyltransferase (Nampt) that is characterized by having, in an Nampt having an amino acid sequence indicated in SEQ ID NO. 1, a substitution of H (histidine) in the sequence to another amino acid, and that is not derived from human; and production of NMN using the modified Nampt.　SEQ ID NO. 1: S-[V / I]-P-A-[A / T / S / R]-E-H-S-[T / V / I]-[M / V / I / T]-[T / C / S] (wherein X1-X3 each represent an arbitrarily defined amino acid, and [ ] represents any one of the amino acids indicated in [ ]).

Description

Modified nicotinamide phosphoribosyltransferase and method for producing nicotinamide mononucleotide using the same

[0001] The present invention relates to a modified (mutated) nicotinamide phosphoribosyltransferase and a method for producing nicotinamide mononucleotide using the same.

[0002] Nicotinamide mononucleotide (NMN) is a synthetic intermediate of nicotinamide adenine dinucleotide (NAD+). In recent years, it has been revealed that NMN controls the activity of the longevity gene "sirtuin" through its conversion to NAD+, and that administration of NMN to mice exhibits anti-aging effects. Furthermore, it has been reported that NMN is effective in preventing and improving the symptoms of diseases such as diabetes, Alzheimer's disease, and heart failure. NMN is expected to be used as an ingredient in functional foods, pharmaceuticals, cosmetics, etc., and research and development of efficient manufacturing methods is underway with the aim of improving productivity.

[0003] Known methods for producing NMN include organic synthesis, as well as biological methods such as fermentation and enzymatic methods. Enzymatic NMN production can be broadly classified into two categories. One is the Nampt route enzymatic method, which involves the reaction of phosphoribosyl pyrophosphate (PRPP) and nicotinamide (NAM) with nicotinamide phosphoribosyltransferase (Nampt). The other is the NRK route enzymatic method, which involves the reaction of nicotinamide riboside (NR) and adenosine triphosphate (ATP) with nicotinamide riboside kinase (NRK). The NRK route enzymatic method is a one-step reaction that generally produces high yields, but the high price of the raw material NR itself is a challenge. While commercially available PRPP, the raw material used in the Nampt route enzymatic method, is expensive, it is possible to produce PRPP using inexpensive ribose as a raw material. In other words, the Nampt route enzymatic method has the potential to produce NMN more cheaply than the NRK route enzymatic method by involving three enzymatic reactions: (1) the first reaction to produce ribose-5-phosphate (R5P) from ribose, (2) the second reaction to produce phosphoribosyl pyrophosphate (PRPP) from R5P, and (3) the third reaction to produce NMN from PRPP and nicotinamide (NAM).

[0004] Nicotinamide phosphoribosyltransferase (Nampt) is the rate-limiting enzyme in the mammalian NAD synthesis pathway and catalyzes the third reaction (Non-Patent Document 1). Because the activity of wild-type Nampt is lower than that of other enzymes and is not sufficient for the industrial production of NMN, a search for highly active wild-type Nampt has been underway (Non-Patent Documents 2-4, Patent Documents 1 and 2).

[0005] Furthermore, attempts have been made to create mutant Nampt by introducing mutations into the wild-type Nampt sequence in order to improve the NMN production efficiency (Non-Patent Documents 5 to 8, Patent Documents 3 to 7). The present inventors have also reported the creation of a modified (mutant) Nampt with high enzymatic activity (Patent Document 7).

[0006] ATP is not essential for the Nampt-mediated synthesis of NMN from PRPP and NAM. However, research using human Nampt has shown that Nampt has ATP hydrolysis activity, and that ATP hydrolysis results in autophosphorylation of a histidine (His) residue located near the active center of Nampt, shifting enzymatic parameters and chemical equilibrium in a direction favorable for NMN production (Non-Patent Document 9). Recent research has proposed that coordination of Mg ions between the phosphorylated His and the substrate PRPP stabilizes the conformation of the phosphate group of PRPP, promoting a configuration favorable for the NMN synthesis reaction (Non-Patent Document 10).

[0007] In the Nampt route enzymatic method, ATP is used for phosphorylation of the precursor R5P or ribose, but since ATP is an expensive compound, it is desirable to consume as little ATP as possible when trying to produce NMN inexpensively.Furthermore, in the fermentation method using Nampt, ATP is biosynthesized from carbon sources such as glucose, so it is similarly desirable to consume as little ATP as possible.

[0008] WO2020 / 129997WO2023 / 210244WO2018 / 023206WO2022 / 227413WO2023 / 20228CN111718915WO2022 / 202952

[0009] Garten et al., "Physiological and pathophysiological roles of NAMPT and NAD metabolism" Nature Reviews Endocrinology Vol.11, pp535-546 (2015)Marinescu et al., "β-nicotinamide mononucleotide (NMN) production in Escherichia coli" Scientific Reports Vol.8, Article number:12278 (2018)Shoji et al., "Metabolic design for selective production of nicotinamide mononucleotide from glucose and nicotinamide" Metab Eng. Vol.65, pp167-177 (2021)Zhongshi et al., "Systematic Engineering of Escherichia coli for Efficient Production of Nicotinamide Mononucleotide From Nicotinamide" ACS Synth. Biol. Vol.11, No.9, pp2979-2988 (2022)Ambra et al., "Extracellular nicotinamide phosphoribosyltransferase, a new cancer metabokine" Br. J. Pharmacol. Vol.173, No.14, pp2182-2194 (2016)Petr et al., "Nuclear transport of nicotinamide phosphoribosyltransferase is cell cycle-dependent in mammalian cells, and its inhibition slows cell growth" J. Biol. Chem. Vol. 294, No.22, pp8676-8689 (2019)Uffe et al., "Target enzyme mutations are the molecular basis for resistance towards pharmacological inhibition of nicotinamide phosphoribosyltransferase" BMC Cancer Vol.10, Article number:677 (2010)Li et al., "Nicotinamide Phosphoribosyltransferase in Human Diseases" J. Bioanal. Biomed. Vol.3, pp13-25 (2011)Burgos and Schramm, "Weak Coupling of ATP Hydrolysis to the Chemical Equilibrium of Human Nicotinamide Phosphoribosyltransferase" Biochemistry, Vol.47, No.42, pp11086-11096 (2008)Dorothee et al., "Identification of structural determinants of nicotinamide phosphoribosyl transferase (NAMPT) activity and substrate selectivity" J. Struct. Biol. Vol.215, 108004 (2023).

[0010] The main objective of the present invention is to improve the method for producing NMN. In particular, the objective is to suppress the wasteful consumption of ATP in the Nampt route enzymatic method, to produce NMN stably and inexpensively without being affected by the ATP concentration in the reaction solution.

[0011] During the evaluation of the wild-type, highly active Nampt (VpNampt) described in Non-Patent Document 4, the inventors noticed that the enzymatic activity of this Nampt is ATP-dependent (its activity is significantly reduced in the presence of ATP). They hypothesized that this ATP-dependent reduction in activity might be related to the autophosphorylation of a His residue located near the active center of Nampt, and that modifying this His residue so that it is not subject to autophosphorylation might prevent the reduction in activity in the presence of ATP. Indeed, they found that substituting this His residue with another amino acid eliminated the ATP dependency of Nampt activity in all mutants, regardless of whether the mutation improved enzymatic activity, allowing the Nampt activity to be stably exerted regardless of the ATP concentration in the reaction solution, suppressing the wasteful consumption of ATP associated with autophosphorylation, and improving the NMN accumulation concentration in NMN synthesis reactions using PRPP, R5P, or ribose as raw materials. Furthermore, they found that modifying this His residue is universally effective in Nampt derived from prokaryotes and bacteriophages. This is unexpected from reports that autophosphorylation of Nampt is advantageous for NMN production (Burogs and Schramm, supra (Non-Patent Document 9)) and that introducing a mutation into the autophosphorylated His residue results in the loss or significant reduction of activity (Non-Patent Documents 5 and 8).

[0012] The present invention is based on the above findings and relates to the following [1] to

[14] . [1] A modified Nampt comprising the amino acid sequence of nicotinamide phosphoribosyltransferase (Nampt) shown in SEQ ID NO: 1 below, in which H (histidine) in the sequence is substituted with another amino acid, wherein the Nampt is not derived from human beings: SEQ ID NO: 1: S-[V / I]-PA-[A / T / S / R]-EHS-[T / V / I]-[M / V / I / T]-[T / C / S] (where [ ] represents any one of the amino acids within [ ]). [2] The modified Nampt according to [1], wherein Nampt is derived from a prokaryote or a bacteriophage. [3] The modified Nampt according to [1] or [2], wherein the other amino acid is any one selected from glycine (G), alanine (A), threonine (T), phenylalanine (F), methionine (M), and asparagine (N). The other amino acids are preferably G, A, or T, more preferably G or A, and most preferably G. [4] The modified Nampt according to any of [1] to [3], wherein the wild-type sequence of the modified Nampt has the amino acid sequence (1) or (2) below: (1) an amino acid sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, and 42; or (2) an amino acid sequence having 90% or more identity with any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, and 42, and encoding a protein having Nampt activity (among the above sequences, SEQ ID NOs: 2, 4, 6, and 8 are preferred, SEQ ID NOs: 2, 4, and 6 are more preferred, and SEQ ID NOs: 4 and 6 are particularly preferred). [5] A modified Nampt described in any of [1] to [4], wherein when the amino acid sequence of the modified Nampt is aligned with the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence shown in SEQ ID NO: 1 is located at positions corresponding to positions 232 to 242 of SEQ ID NO: 2.[6] The modified Nampt according to any one of [1] to [5], wherein the modified Nampt is derived from a prokaryote selected from the genera Vibrio, Xanthomonas, Aquimonas, Caulobacter, Stenotrophomonas, Haemophilus, Meiothermus, Sphingopyxis, Chitinophaga, Luteibacter, Bisgaardia, Deinococcus, Synechocystis, Shewanella, Oenococcus, Burkholderia, Pedobacter, Microbulbifer, and Labrenzia, or a bacteriophage that uses such a prokaryote as a host. [7] A method for producing nicotinamide mononucleotide, comprising contacting phosphoribosyl pyrophosphate and nicotinamide in the presence of the modified Nampt according to any one of [1] to [6]. [8] The method according to [7], wherein phosphoribosyl pyrophosphate is produced from ribose-5-phosphate in the presence of phosphoribosyl pyrophosphate synthase (Prs). [9] The method according to [8], wherein ribose-5-phosphate is produced from ribose in the presence of ribokinase (Rbk).

[10] A method for producing nicotinamide mononucleotide, comprising contacting ribose, nicotinamide, and ATP in the presence of ribokinase, phosphoribosyl pyrophosphate synthase, and the modified Nampt according to any one of [1] to [6].

[11] The modified Nampt according to any one of [1] to [6], wherein the wild-type sequence of the modified Nampt is a prokaryotic Nampt (Δ42-51 type Nampt) lacking the β1-β2 loop (formed by amino acid residues 42 to 51 in human Nampt).

[12] The modified Nampt according to any one of [1] to [6] and

[11] , wherein the Nampt is derived from an organism having nicotinamidase (NadA).

[13] The method according to any one of [7] to

[10] , wherein the wild-type sequence of the modified Nampt is a prokaryotic Nampt (Δ42-51 type Nampt) lacking the β1-β2 loop (formed by the 42nd to 51st amino acid residues in human Nampt).

[14] The method according to any one of [7] to

[10] and

[13] , wherein the Nampt is Nampt derived from an organism having nicotinamidase (NadA). This specification incorporates the disclosures of Japanese Patent Application No. 2024-047467, from which the present application claims priority.

[0013] The modified Nampt of the present invention has the advantage that its enzymatic activity is not ATP-dependent, and when used in the NMN production reaction from PRPP and NAM, it accumulates higher NMN concentrations than the wild-type, and its ATP hydrolysis activity is reduced, preventing unnecessary ATP consumption.

[0014] FIG. 1 shows the Nampt activity of crude enzymes of VpNampt autophosphorylation residue mutants in Example 2. FIG. 2 shows the time course of NMN concentration in the reaction solution in the absence of ATP (condition 1) in Example 3. FIG. 3 shows the time course of NMN concentration and ATP concentration in the presence of ATP (condition 2) in Example 3. FIG. 4 shows the activity of various wild-type Nampt autophosphorylation residue Gly mutants in Example 4. FIG. 5 shows the relative values ​​of NMN production concentrations of VpNampt autophosphorylation residue mutants when the NMN production concentration by wild-type VpNampt is set to 100% in Example 5. FIG. 6 shows the relative values ​​of NMN production concentrations of each Nampt autophosphorylation residue mutant when the NMN production concentration by wild-type AvNampt and wild-type CfNampt is set to 100% in Example 6. Figure 7 shows the relative concentrations of NMN produced for each Nampt under Condition 1 and Condition 2 in Example 7, with the NMN concentration produced for each wild-type Nampt under Condition 1 set to 100%. Figure 8-1 shows an alignment of the amino acid sequences of various wild-type Nampt. Figure 8-2 shows an alignment of the amino acid sequences of various wild-type Nampt. Figure 8-3 shows an alignment of the amino acid sequences of various wild-type Nampt. Figure 9 shows the relative concentrations of NMN produced under Condition 2 (using cell lysate derived from the N-AvWT strain, with added phosphate), Condition 3 (using cell lysate derived from the N-AvH232G strain, without added phosphate), and Condition 4 (using cell lysate derived from the N-AvH232G strain, with added phosphate) in Example 8, with the NMN concentration produced under Condition 1 (using cell lysate derived from the N-AvWT strain, without added phosphate) set to 100%. FIG. 10 shows the relative concentrations of NMN produced under conditions 2 (addition of 10 mM phosphoric acid), 3 (addition of 30 mM phosphoric acid), and 4 (addition of 100 mM phosphoric acid) using cell lysate derived from the N-AvH232G strain in Example 9, with the concentration of NMN produced under condition 1 (no added phosphoric acid) set at 100%.

[0015] The definitions of the abbreviations used in this specification are as follows: Nampt (Nicotinamide phosphoribosyltransferase): Nicotinamide phosphoribosyltransferase Prs (Phosphoribosyl pyrophosphate synthetase): Phosphoribosyl pyrophosphate synthase Rbk (Ribokinase): Ribokinase Ppk (Polyphosphate kinase): Polyphosphate kinase PPase (Pyrophosphatase): Pyrophosphatase NMN (Nicotinamide mononucleotide): Nicotinamide mononucleotide PRPP (Phosphoribosyl pyrophosphate): Phosphoribosyl pyrophosphate NAM (Nicotinamide): Nicotinamide R5P (Ribose-5-phosphate): Ribose-5-phosphate NR (Nicotinamide riboside): Nicotinamide riboside NaMN (Nicotinic acid mononucleotide): Nicotinic acid mononucleotide NAD (Nicotinamide adenine dinucleotide): Nicotinamide adenine dinucleotide PPi (Pyrophosphate): Pyrophosphate PolyP (Polyphosphate): Polyphosphate

[0016] 1. Nicotinamide phosphoribosyltransferase (Nampt) 1.1 Wild-type Nampt Nampt (EC number: 2.4.2.12) is generally known to be involved in the NAD (nicotinamide adenine dinucleotide) salvage pathway and is an enzyme used in the reaction that produces NMN from PRPP and NAM (the third reaction in the aforementioned NMN production method).

[0017] Known examples of Nampt include those derived from humans (Homo sapiens) (NP_005737), mice (Mus musculus) (NP_067499), rats (Rattus norvegicus) (NP_808789), zebrafish (Danio rerio) (NP_997833), and bacteria such as Haemophilus ducreyi (AAR87771), Deinococcus radiodurans (AE001890), Oenococcus oeni (KZD13878), and Shewanella oneidensis (NP_717588).

[0018] The modified Nampt of the present invention is derived from a non-human Nampt. The origin of Nampt is not particularly limited as long as it is non-human, but prokaryotic or bacteriophage-derived Nampt is preferred. Furthermore, Nampt without a β1-β2 loop is preferred, and Nampt derived from an organism containing NADA is preferred. Prokaryotes are unicellular organisms lacking a nucleus or other membrane-bound organelles and are divided into two domains: bacteria and archaea. Bacteria and archaea are distinguished by their genetic systems, protein synthesis mechanisms, cell wall and cell membrane composition, etc. Bacteria include Escherichia coli, Bacillus subtilis, and cyanobacteria. Archaea include extreme halophiles, hyperthermophiles, and thermoacidophiles. Bacteriophages (phages) are viruses that infect and replicate in bacteria or archaea. There are many types of phages, including T4 phage and λ phage, which infect Escherichia coli.

[0019] Specifically, Nampt derived from bacteria belonging to any one selected from the genera Vibrio, Xanthomonas, Aquimonas, Caulobacter, Stenotrophomonas, Haemophilus, Meiothermus, Sphingopyxis, Chitinophaga, Luteibacter, Bisgaardia, Deinococcus, Synechocystis, Shewanella, Oenococcus, Burkholderia, Pedobacter, Microbulbifer, and Labrenzia, and bacteriophages that infect these bacteria, are preferred. Among these, Nampt derived from bacteria of the genera Vibrio, Xanthomonas, Aquimonas, Caulobacter, Stenotrophomonas, Haemophilus, Meiothermus, Sphingopyxis, and Chitinophaga, and bacteriophages that infect these bacteria, is more preferred, Nampt derived from bacteria of the genera Vibrio, Xanthomonas, Aquimonas, and Caulobacter, and bacteriophages that infect these bacteria, is even more preferred, Nampt derived from bacteria of the genera Xanthomonas, Aquimonas, and Caulobacter is particularly preferred, and Nampt derived from bacteria of the genera Xanthomonas or Aquimonas, and bacteriophages that infect these bacteria is most preferred.

[0020] The origins, GenBank accession numbers, and sequence numbers of Nampts that can be used in the present invention are shown in Table 1. An alignment of the amino acid sequences of each Nampt is shown in Figure 8.

[0021]

[0022] The Nampt of the present invention is not limited to those having the above sequence, but also includes proteins that contain an amino acid sequence that has a homology or identity of about 60% or more, preferably about 70% or more, more preferably about 80% or more, even more preferably about 90% or more, particularly preferably about 95% or more, and most preferably about 98% or more to the amino acid sequence set forth in any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, and 42, and that have Nampt activity.

[0023] The Nampt of the present invention also includes proteins that contain an amino acid sequence in which one or several, specifically 1 to 20, preferably 1 to 10, more preferably 1 to 5, and even more preferably 1 to 2 amino acids are deleted, substituted or added in the amino acid sequence set forth in any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, and 42, and that have Nampt activity.

[0024] Among these, Nampt having the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 is preferred, Nampt having the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8 is more preferred, Nampt having the amino acid sequence shown in SEQ ID NO: 2, 4, 6 is even more preferred, and Nampt having the amino acid sequence shown in SEQ ID NO: 4, 6 is particularly preferred.

[0025] The Nampt gene of the present invention encodes the amino acid sequence described above. For example, the Nampt gene has the nucleotide sequence set forth in any one of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, and 41. However, the Nampt gene of the present invention also includes genes containing a nucleotide sequence that is about 60% or more, preferably about 70% or more, more preferably about 80% or more, even more preferably about 90% or more, particularly preferably about 95% or more, and most preferably about 98% or more identical to the nucleotide sequence described above, and that encodes a protein having Nampt activity.

[0026] The Nampt gene of the present invention also includes a gene containing a nucleotide sequence that hybridizes under stringent conditions with any of the nucleotide sequences set forth in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, and 41 and encodes a protein having Nampt activity. Examples of stringent conditions include, but are not limited to, incubating a nylon membrane with immobilized DNA together with a probe in a solution containing 6xSSC (1xSSC is prepared by dissolving 8.76 g of sodium chloride and 4.41 g of sodium citrate in 1 liter of water), 1% SDS, 100 μg / ml salmon sperm DNA, 0.1% bovine serum albumin, 0.1% polyvinylpyrrolidone, and 0.1% Ficoll at 65°C for 20 hours to perform hybridization. Those skilled in the art can set hybridization conditions by taking into account not only the salt concentration of the buffer, temperature, etc., but also other conditions such as probe concentration, probe length, reaction time, etc. Examples of post-hybridization washing conditions include "2×SSC, 0.1% SDS, 42°C" and "1×SSC, 0.1% SDS, 37°C," and more stringent conditions include "1×SSC, 0.1% SDS, 65°C" and "0.5×SSC, 0.1% SDS, 50°C."

[0027] One feature of the preferred wild-type Nampt used in the present invention is that it is a prokaryotic Nampt (Δ42-51 type Nampt) lacking the β1-β2 loop (formed by amino acid residues 42 to 51 in human Nampt) (Non-Patent Document 10). A recent study (PNAS Vol. 116, 15957-15966 (2019)) identified the β1-β2 loop as an evolutionary feature of vertebrate-derived Nampt that enhances its affinity for NAM. It has been confirmed that Δ42-51 type Nampt exhibits reduced autophosphorylation upon ATP hydrolysis, suggesting that the β1-β2 loop stabilizes chemically unstable phosphorylated His by shielding the area around the autophosphorylation site, potentially resulting in a longer lifespan of the phosphorylated state and increased catalytic efficiency. In other words, His, the autophosphorylation residue in Δ42-51 Nampt, does not remain stable even after phosphorylation, making Nampt activity susceptible to fluctuations depending on the reaction environment. Therefore, it is considered desirable that the corresponding residue in Δ42-51 Nampt is not His, but an amino acid that is not phosphorylated and can achieve a favorable configuration for converting the substrate PRPP to NMN. The present invention provides information regarding such amino acids.

[0028] Another feature of the preferred wild-type Nampt used in the present invention is that it is derived from an organism that possesses nicotinamidase (NadA). In vertebrates, where diverse signal transduction occurs, a high metabolic turnover rate of NAD (nicotinamide adenine dinucleotide) is required, and complex and strict NAM concentration control is thought to be necessary in the NAM salvage pathway. By acquiring the above-mentioned β1-β2 loop during evolution, vertebrate-derived Nampt is thought to have succeeded in stabilizing autophosphorylated His and significantly improving its affinity for NAM. Furthermore, upon acquiring the β1-β2 loop, it is thought that NadA, which had previously played a major role in the NAM salvage pathway, is no longer required. The preferred Nampt used in the present invention is the Δ42-51 type Nampt before acquiring the β1-β2 loop, as described above. From an evolutionary perspective, this Nampt can generally be characterized as Nampt derived from an organism that possesses NadA.

[0029] 1.2 Modified Nampt The modified Nampt of the present invention is a novel modified Nampt that contains a mutation in a His residue that is located near the active center of Nampt and is conserved in almost all Nampts, and is characterized by stably exhibiting its activity regardless of the ATP concentration in the reaction solution, suppressing the wasteful consumption of ATP associated with autophosphorylation, and achieving an improved NMN accumulation concentration compared to the wild-type in an NMN synthesis reaction using PRPP, R5P, or ribose as raw materials.

[0030] The origin of the modified Nampt of the present invention is not particularly limited as long as it is non-human, and for example, Nampt registered in the GenBank database provided by the National Center for Biotechnology Information (NCBI) (http: / / www.ncbi.nlm.nih.gov / entrez / query.fcgi?CMD=search&DB=protein) or Uniprot, which provides information on the amino acid sequences and functions of proteins operated by the Swiss Institute for Bioinformatics and the European Institute for Bioinformatics, or Nampt described in publicly known literature (e.g., WO2022 / 202952) can be used. Specifically, the publicly known Nampt described in 1.1 above can be used.

[0031] The modified Nampt of the present invention comprises the amino acid sequence shown in SEQ ID NO: 1 below, characterized in that H (histidine) in the sequence is substituted with another amino acid: SEQ ID NO: 1: S-[V / I]-PA-[A / T / S / R]-EHS-[T / V / I]-[M / V / I / T]-[T / C / S], where [ ] represents any one of the amino acids in [ ].

[0032] The "other amino acid" to be substituted for H is not particularly limited as long as it is an amino acid that is not autophosphorylated, but is preferably glycine (G), alanine (A), threonine (T), phenylalanine (F), methionine (M), or asparagine (N), more preferably G, A, or T, even more preferably G or A, and most preferably G.

[0033] The sequence shown in SEQ ID NO: 1 is a motif sequence commonly present in the amino acid sequences of known Nampt. As shown in Figure 8, when the amino acid sequence of the modified Nampt is aligned with the amino acid sequence of Nampt derived from Vibrio bacteriophage KVP40 shown in SEQ ID NO: 2, the amino acid sequence shown in SEQ ID NO: 1 is located at positions corresponding to positions 232 to 242 of SEQ ID NO: 2, and the substituted H (His, histidine) is located at position 238.

[0034] The modified Nampt of the present invention may have improved or decreased enzymatic activity due to the His substitution, but it is more preferable that in addition to improving the NMN accumulation concentration, the enzymatic activity is also improved compared to the wild type.

[0035] Here, "(enzyme) activity" refers to Nampt activity, i.e., the enzyme activity that catalyzes the reaction that produces NMN from PRPP and NAM. This activity can be calculated simply by contacting the substrates PRPP and NAM with Nampt, converting them to NMN, and then quantifying the resulting NMN. The substrate concentration during activity measurement ranges from, for example, 1 to 10 mM, the reaction temperature ranges from, for example, 10 to 40°C, and the reaction time ranges from, for example, 1 to 30 minutes. After the reaction has proceeded for a certain period of time, the reaction can be terminated by adding phosphoric acid, methanol, EDTA (ethylenediaminetetraacetic acid), or the like to the reaction solution or by removing Nampt using an ultrafiltration membrane. NMN can be quantified by high-performance liquid chromatography (HPLC) or liquid chromatography-mass spectrometry (LC-MS), or by using commercially available quantification kits that measure fluorescence or absorbance. If the amount of protein or liquid used in the measurement, or the reaction time, differs depending on the sample, the amount of NMN produced can be calculated per protein weight, liquid volume, or reaction time by dividing the amount of NMN produced by the protein weight, liquid volume, or reaction time of each sample, respectively, and appropriate comparisons can be made.

[0036] As mentioned above, Nampt can also have the activity of hydrolyzing ATP in association with autophosphorylation. This activity is called "ATP hydrolysis activity" to distinguish it from the original activity of Nampt, which produces NMN from PRPP and NAM. ATP hydrolysis activity can be calculated by quantifying the amount of ATP consumed in the reaction solution. As with the NMN production activity, appropriate comparisons can be made by dividing the amount of ATP consumed by the protein amount, solution volume, and reaction time of each sample, as needed. ATP quantification can also be performed using HPLC, LC-MS, or a commercially available quantification kit.

[0037] On the other hand, reactions that accumulate high concentrations of the target substance (NMN) over a relatively long reaction time require different conditions than activity measurements, which measure the production or consumption rate at the initial stage of the enzyme reaction. The substrate concentration ranges from 10 to 100 mM, the reaction temperature from 10 to 40°C, and the reaction time from 1 to 50 hours. The amount of NMN produced can be quantified in the same manner as the activity measurement described above, but because higher concentrations of substrate and product are present, it is desirable to appropriately dilute the sample as needed.

[0038] The wild-type amino acids may be substituted at positions [A / T / S / R] at position 5, E at position 6, and T / C / S at position 11 in SEQ ID NO: 1. Such substitutions are described, for example, in WO2022 / 202952.

[0039] Amino acid substitutions (introduction of mutations) can be performed by site-directed mutagenesis or genome editing using site-specific nucleases.

[0040] As site-directed mutagenesis, various methods are known, such as the QuikChange method, the Kunkel method, and the Gapped duplex method, and these can be easily performed using commercially available mutagenesis kits.

[0041] Genome editing using site-specific nucleases can be performed using known methods, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or genome editing using CRISPR / Cas9, and can be performed using commercially available kits.

[0042] 2. Gene (DNA) Encoding Modified Nampt The present invention also provides a gene (DNA) encoding the modified Nampt of the present invention. The "DNA encoding modified Nampt" of the present invention also includes DNA that hybridizes under stringent conditions to DNA having a nucleotide sequence complementary to the DNA encoding the modified Nampt and encodes a protein having higher Nampt activity than the wild-type.

[0043] "Stringent conditions" refers to conditions for washing after hybridization, including a salt concentration of 300 to 2000 mM and a temperature of 40 to 75°C, preferably a salt concentration of 600 to 900 mM and a temperature of 65°C. Examples of stringent conditions include 2xSSC at 50°C. Those skilled in the art will be able to appropriately determine conditions for obtaining the Nampt-encoding DNA of the present invention, taking into account not only conditions such as the salt concentration of the buffer and temperature, but also other conditions such as probe concentration, probe length, and reaction time.

[0044] For detailed procedures of the hybridization method, see, for example, Molecular Cloning, A Laboratory Manual 2nd ed. (Cold Spring Harbor Laboratory Press (1989)). Examples of hybridizing DNA include DNA or a partial fragment thereof containing a base sequence having at least 40% or more, preferably 60% or more, and more preferably 90% or more sequence identity to the gene DNA of the present invention.

[0045] 3. Expression Vector The present invention also provides an expression vector containing a gene (DNA) encoding the modified Nampt of the present invention. As described above, multiple enzymes are involved in the enzymatic synthesis of NMN. The expression vector of the present invention may contain, in addition to the gene encoding the modified Nampt, genes (DNA) encoding other enzymes that act in the NMN production pathway. For example, the expression vector may contain, in addition to Nampt, all of the genes encoding Prs and Ppk described below, or it may be an expression vector containing genes encoding Nampt and Prs, or an expression vector containing genes encoding Nampt and Ppk.

[0046] The expression vector used in the present invention can be constructed by known techniques. Generally, an expression cassette is constructed by inserting a transcription promoter upstream of a gene encoding a desired enzyme and, in some cases, a terminator downstream, and then inserting this cassette into an expression vector. Alternatively, if a transcription promoter and / or terminator already exist in the expression vector, the gene encoding the desired enzyme can be inserted between the transcription promoter and / or terminator of that vector without constructing an expression cassette. As described above, when a single expression vector contains genes encoding two or more enzymes, these genes may all be inserted under the control of the same promoter or different promoters. The type of promoter is not particularly limited as long as it enables appropriate expression in the host. Examples of promoters that can be used in Escherichia coli hosts include the T7 promoter, trp promoter, lac promoter, lambda phage-derived PL promoter and PR promoter, tac promoter, and trc promoter.

[0047] The genes encoding each predetermined enzyme can be obtained, for example, by (i) preparing primers based on the nucleotide sequence information and amplifying the gene using a genome or the like as a template, or by (ii) synthesizing DNA organically based on the amino acid sequence information of the enzyme. The genes may be optimized depending on the host cell of the transformant.

[0048] A gene encoding a desired enzyme can be inserted into an expression vector using a method using a restriction enzyme, a method using topoisomerase, or the like. If necessary, an appropriate linker may be added during insertion. Ribosome binding sequences such as the SD sequence and the Kozak sequence are known to be important nucleotide sequences for translation into amino acids, and these sequences may be inserted upstream of the gene. Part of the amino acid sequence encoded by the gene may be replaced upon insertion. It is also preferable that the vector contain a factor (selection marker) for selecting the desired transformant. Examples of selection markers include drug resistance genes, auxotrophy complementing genes, and assimilation-conferring genes, and these can be selected depending on the purpose and host. Examples of drug resistance genes used as selection markers in E. coli include the ampicillin resistance gene, the kanamycin gene, the dihydrofolate reductase gene, and the neomycin resistance gene.

[0049] Depending on the host, an appropriate expression vector may be used, selected from plasmid DNA, bacteriophage DNA, retrotransposon DNA, artificial chromosome DNA, etc. For example, when Escherichia coli is used as the host, examples of the vector include pTrc99A (GE Healthcare Biosciences), pACYC184 (Nippon Gene), pMW118 (Nippon Gene), pET series vectors (Novagen), and pSTV28 (Takara Bio). Examples of vectors having two or more insertion sites include pETDuet-1 (Novagen). Modified versions of these vectors can also be used as needed.

[0050] Expression vectors can enhance the expression of a given enzyme by inserting an expression cassette, which is a gene encoding the given enzyme linked to an appropriate promoter, terminator, marker gene, etc., into the host genome. Known methods can be used to obtain transformants with an expression cassette inserted into the genome. For example, when inserting an expression cassette into the genome by homologous recombination, transformation can be performed using a plasmid containing the expression cassette of the given enzyme and the sequence of a desired genomic region, which is non-replicable in the host, to obtain transformants with the entire plasmid or expression cassette inserted. In this case, by using a plasmid carrying a negative selection marker such as the SacB gene (encoding levansucrase) or a plasmid with a temperature-sensitive (ts) replication mechanism, transformants with only the expression cassette inserted into the genome can be efficiently obtained by two rounds of homologous recombination. Furthermore, transformation can also be performed using a DNA fragment consisting only of the expression cassette to obtain transformants with the expression cassette inserted at a random location on the genome.

[0051] When using an enzyme other than Nampt that is originally present in the genome of the host (endogenous enzyme), its expression can be enhanced by replacing the promoter of the gene encoding the endogenous enzyme in the genome with a stronger one. The promoter used in the expression vector can be used in the same way.

[0052] 4. Transformant The present invention also provides a transformant comprising a gene (DNA) encoding the modified Nampt of the present invention or the expression vector. As described in the previous section, the transformant of the present invention may also comprise, in addition to the DNA encoding the modified Nampt, DNA encoding other enzymes that act in the NMN production pathway.

[0053] The host for the transformant is not particularly limited as long as it is a cell capable of expressing a predetermined enzyme using a protein expression system utilizing an expression vector or the like. Examples include bacteria such as Escherichia coli, Bacillus subtilis, and actinomycetes (e.g., Rhodococcus and Corynebacterium); yeast (e.g., Saccharomyces, Candida, and Pichia); filamentous fungi; plant cells; insect cells, and animal cells such as mammalian cells. Among these, Escherichia coli, Corynebacterium bacteria, and Rhodococcus bacteria, as well as Saccharomyces yeast, Candida yeast, and Pichia yeast are preferred, with Escherichia coli being more preferred.

[0054] Examples of E. coli include E. coli K12 and B strains, as well as wild-type derivatives thereof such as W3110, JM109, XL1-Blue (e.g., XL1-BlueMRF'), K802, C600, BL21, BL21(DE3), and BN8 (WO2019 / 065876).

[0055] The method for introducing an expression vector into a host is not particularly limited as long as it is suitable for the host, and examples of methods that can be used include electroporation, a method using calcium ions, the spheroplast method, the lithium acetate method, the calcium phosphate method, and lipofection.

[0056] The transformant into which the expression vector has been introduced may be cultured by a method suitable for the host cell (bacterial body) to express each of the desired enzymes. As described above, when transformants each containing a gene encoding each of the desired enzymes separately are combined, for example, when a transformant expressing Nampt and Prs and a transformant expressing Ppk are prepared and combined, the respective transformants may be cultured in the same medium, or may be cultured in separate media and then mixed.

[0057] When NMN is produced using transformants, resting cells prepared from transformants, membrane-permeability-improved cells, inactivated cells, disrupted cells, cell-free extracts prepared from disrupted cells, or stabilized products of these (see the information about Step 2 below for details), decomposition or side reactions of the reactants (substrates) ribose and NAM and the product NMN may occur, preventing efficient production of NMN. In such cases, a host in which the genes causing the decomposition or side reactions have been disrupted or deleted can be used. Specifically, a host in which the genes encoding the enzymes classified under one or more of the EC numbers listed below (a) to (i) have been deleted or disrupted can be used. (a) EC 3.1.3.5 (b) EC 3.5.1.19 (c) EC 2.4.2.1 (d) EC 3.5.1.42 (e) EC 1.17.2.1 (f) EC 1.17.1.5 (g) EC 3.2.2.1 (h) EC 3.2.2.3 (i) EC 3.2.2.14

[0058] (a) Enzymes classified in EC 3.1.3.5 are 5'-nucleotidases, including enzymes that catalyze the reaction of hydrolyzing NMN to produce nicotinamide riboside (NR) phosphate. Examples include Escherichia coli ushA, surE, yrfG, and yjjG, with UshA or its homologs being particularly preferred.

[0059] (b) Enzymes classified under EC 3.5.1.19 are nicotinamidases, including enzymes involved in the degradation of NAM, such as pncA from Escherichia coli.

[0060] (c) Enzymes classified in EC 2.4.2.1 are purine-nucleoside phosphorylases, including enzymes that catalyze the phosphorolysis of NR to produce NAM and ribose-1-phosphate (R1P). Examples include the deoD gene of Escherichia coli and its homologs.

[0061] (d) Enzymes classified in EC 3.5.1.42 are nicotinamide mononucleotide deaminases, including enzymes that catalyze the reaction of hydrolyzing NMN to produce NaMN and ammonia. Examples include pncC of Escherichia coli and its homologous genes.

[0062] Enzymes classified as (e) EC 1.17.2.1 and (f) EC 1.17.1.5 are nicotinate dehydrogenases, and include enzymes that may be involved in the by-production of hydroxynicotinic acid from NAM.

[0063] (g) Enzymes classified in EC 3.2.2.1 are purine nucleosidases, including enzymes that catalyze the hydrolysis of NR to produce NAM and ribose, such as Pu-N or its homologs.

[0064] (h) Enzymes classified into EC 3.2.2.3 are uridine nucleosidases, including enzymes that can catalyze the reaction of hydrolyzing NR to produce NAM and ribose. Examples include URH1 and its homologs.

[0065] (i) Enzymes classified under EC 3.2.2.14 are NMN nucleosidases, and include enzymes that catalyze the reaction of hydrolyzing NMN to produce NAM and R5P. In the present invention, it is preferable to disrupt or delete the gene encoding NMN nucleosidase.

[0066] The genes to be deleted or disrupted are preferably a gene encoding an enzyme classified under the EC number shown in (d) and a gene encoding an enzyme classified under one or more of the EC numbers shown in (a), (c), (g), (h), and (i), and more preferably a gene encoding an enzyme classified under the EC number shown in (d) and a gene encoding an enzyme classified under the EC number shown in (a).

[0067] The method for disrupting or deleting a gene is not particularly limited, and can be performed by a known gene disruption or deletion method, such as a method using a linearized fragment for gene disruption or deletion, a method using a circular gene disruption or deletion plasmid that does not contain a replication origin, a method using a group II intron, Red-ET homologous recombination, or a genome editing method such as ZFN, TALEN, or CRISPR / Cas9.

[0068] 5. Method for Producing Modified Nampt The modified Nampt can be produced by culturing the transformant and collecting a protein having Nampt activity from the resulting culture. The present invention also provides a method for producing such a modified Nampt.

[0069] In the present invention, the term "culture" includes any of culture supernatant, cultured cells, cultured bacterial cells, and disrupted cells or bacterial cells.

[0070] The transformant is cultured according to a method commonly used for culturing a host. The medium for culturing the transformant of the present invention may be either a natural medium or a synthetic medium, as long as it contains a carbon source, a nitrogen source, inorganic salts, etc. that can be assimilated by the host bacterium and allows efficient cultivation of the transformant. Examples of carbon sources include carbohydrates such as glucose, galactose, fructose, sucrose, raffinose, and starch; organic acids such as acetic acid and propionic acid; and alcohols such as ethanol and propanol. Examples of nitrogen sources include inorganic acids such as ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, and ammonium phosphate, or ammonium salts of organic acids, or other nitrogen-containing compounds.

[0071] Other ingredients that may be used include peptone, yeast extract, meat extract, corn steep liquor, and various amino acids. Examples of inorganic substances include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, zinc sulfate, copper sulfate, and calcium carbonate. If necessary, an antifoaming agent may be added to prevent foaming during culture. Furthermore, a compound that acts as an inducer for enzyme expression may be added to the medium.

[0072] To prevent loss of the vector and gene of interest during culture, the cells may be cultured under selective pressure, i.e., by adding a corresponding drug to the medium when the selection marker is a drug resistance gene, or by removing a corresponding nutritional factor from the medium when the selection marker is an auxotrophy-complementing gene.

[0073] Furthermore, when the selection marker is a gene that confers assimilation, the corresponding assimilation factor can be added as the sole factor, if necessary. For example, when culturing E. coli transformed with a vector containing an ampicillin resistance gene, ampicillin can be added during culture as necessary.

[0074] When culturing a transformant transformed with a recombinant vector using an inducible promoter, an inducer may be added to the medium as needed. For example, when culturing a transformant transformed with an expression vector having a promoter inducible with isopropyl-β-D-thiogalactoside (IPTG), IPTG or the like can be added to the medium. Furthermore, when culturing a transformant transformed with an expression vector using an indoleacetic acid (IAA)-inducible trp promoter, IAA or the like can be added to the medium.

[0075] The conditions for culturing the transformant are not particularly limited as long as they do not impair the productivity of the target modified Nampt or the growth of the host, but the culture is usually carried out for 5 to 100 hours at 10 to 40° C., preferably 20 to 37° C. The pH is adjusted to, for example, pH 6 to 9 using an inorganic or organic acid, an alkaline solution, or the like.

[0076] Examples of the culture method include solid culture, static culture, shaking culture, and aeration and stirring culture, but it is particularly preferable to culture under aerobic conditions by shaking culture or aeration and stirring culture (jar fermenter).

[0077] When cultured under the above culture conditions, the modified Nampt of the present invention can be accumulated in high yield in the culture, that is, in at least one of the culture supernatant, cultured cells, cultured bacterial cells, or cell or bacterial cell lysate.

[0078] After cultivation, when modified Nampt is produced intracellularly, the desired modified Nampt can be collected by disrupting the bacterial or cell bodies, which can be disrupted by high-pressure treatment using a French press or homogenizer, ultrasonic treatment, grinding treatment using glass beads, enzyme treatment using lysozyme, cellulase, pectinase, or the like, freeze-thaw treatment, hypotonic solution treatment, phage-mediated bacteriolysis induction treatment, etc.

[0079] After disruption, bacterial or cell disruption residue (including the cell extract-insoluble fraction) can be removed as needed. Methods for removing residue include, for example, centrifugation and filtration. If necessary, the efficiency of residue removal can be increased by using a flocculant, filter aid, or the like. The supernatant obtained after removing the residue is the soluble fraction of the cell extract and can be used as a crudely purified modified Nampt solution.

[0080] Furthermore, when modified Nampt is produced intracellularly or intracellularly, the bacterial bodies or cells themselves can be recovered by centrifugation, membrane separation, or the like, and used without being disrupted.

[0081] When modified Nampt is produced extracellularly or extracellularly, the culture medium is used as is, or the bacterial bodies or cells are removed by centrifugation, filtration, etc. Thereafter, if necessary, modified Nampt can be collected from the culture by extraction using ammonium sulfate precipitation, etc., and further isolated and purified, if necessary, using dialysis or various types of chromatography (gel filtration, ion exchange chromatography, affinity chromatography, etc.).

[0082] The production yield of the modified Nampt obtained by culturing the transformant can be determined, for example, in units per culture medium, per wet or dry weight of bacterial cells, per protein in a crude enzyme solution, or by SDS-PAGE (polyacrylamide gel electrophoresis) or Nampt activity measurement, but is not particularly limited thereto. SDS-PAGE can be performed by methods known to those skilled in the art. The Nampt activity can be determined using the activity values ​​described above.

[0083] In addition to the above-mentioned methods, modified Nampt can also be produced using a cell-free protein synthesis system. A cell-free protein synthesis system is a system in which proteins are synthesized in an artificial container such as a test tube using a cell extract. The cell-free protein synthesis system used in the present invention also includes a cell-free transcription system in which RNA is synthesized using DNA as a template.

[0084] In this case, the organism corresponding to the host corresponds to the organism derived from the cell extract described below. Here, the cell extract can be an extract derived from a eukaryotic cell or a prokaryotic cell, such as an extract from wheat germ or Escherichia coli. Note that these cell extracts may be concentrated or not.

[0085] Cell extracts can be obtained, for example, by ultrafiltration, dialysis, polyethylene glycol (PEG) precipitation, etc. Furthermore, in the present invention, cell-free protein synthesis can also be performed using commercially available kits. Examples of such kits include the reagent kit PROTEIOS™ (Toyobo) and TNT™ System (Promega), and the synthesis device PG-Mate™ (Toyobo) and RTS (Roche Diagnostics).

[0086] The modified Nampt obtained by cell-free protein synthesis as described above can be purified by appropriately selecting a chromatography method as described above.

[0087] 6. Method for Producing Nicotinamide Mononucleotide 6.1 Production of NMN Using Modified Nampt The modified Nampt of the present invention can be used to produce NMN as an enzyme catalyst in the Nampt-based enzymatic method or as an enzyme catalyst in a metabolic pathway in a fermentation method. In the enzymatic method, for example, phosphoribosyl pyrophosphate (PRPP) and nicotinamide (NAM) are contacted in the presence of modified Nampt, and the resulting nicotinamide mononucleotide (NMN) is collected to produce the NMN compound. In other words, NMN can be produced by contacting the substrates PRPP and NAM with modified Nampt.

[0088]

[0089] The enzyme catalyst may be separated and purified Nampt, or a culture obtained by culturing the transformant of the present invention, or a processed product of the culture. Examples of the processed product include cells (transformants) after culture encapsulated in a gel such as acrylamide, treated with glutaraldehyde, supported on an organic carrier such as a resin, or supported on an inorganic carrier such as alumina, silica, zeolite, or diatomaceous earth.

[0090] Here, "contact" means that modified Nampt, PRPP, and NAM are present in the same reaction system or culture system, and includes, for example, mixing separated and purified modified Nampt with PRPP and NAM, adding PRPP and NAM to a culture vessel of cells (transformants) expressing the modified Nampt gene, culturing the cells in the presence of PRPP and NAM, and mixing an extract of the cells with PRPP and NAM.

[0091] Phosphoribosyl pyrophosphate can be produced from ribose-5-phosphate in the presence of phosphoribosyl pyrophosphate synthase. Examples of phosphoribosyl pyrophosphate synthase include those derived from humans (Homo sapiens) (NP_002755), Bacillus subtilis (BAA05286), Bacillus caldolyticus (CAA58682), Arabidopsis thaliana (Q680A5), and Methanocaldococcus jannaschii (Q58761). Mutant phosphoribosyl pyrophosphate synthases can also be used if necessary. Examples of mutant phosphoribosyl pyrophosphate synthases include mutants such as Asp51His (substitution of Asp at position 51 with His, the same applies below), Asn113Ser, Leu128Ile, Aspl82His, Ala189Val, and Hisl92Gln in human-derived Prs, as well as corresponding mutants in Prs from other organisms, such as Asn120Ser (corresponding to the aforementioned Asn113Ser) and Leu135Ile (corresponding to the aforementioned Leu128Ile) in Bacillus subtilis-derived Prs.

[0092] Ribose-5-phosphate can be produced from ribose in the presence of ribokinase. Ribokinases that can be used include natural ribokinases derived from various organisms and mutant ribokinases prepared by modifying their amino acid sequences, such as those derived from human (Homo sapiens) (NP_002755), yeast (Saccharomyces cerevisiae) (P25332), Bacillus subtilis (P36945), Escherichia coli (AAA51476), and Haemophilus influenzae (P44331).

[0093] As described above, nicotinamide mononucleotide can be produced by reacting ribose, nicotinamide, and ATP in the presence of ribokinase, phosphoribosylpyrophosphate synthase, and the modified Nampt of the present invention.

[0094] 6.2 Coupling of the ATP Regeneration System The method for producing NMN of the present invention may be carried out, for example, according to the method described in WO2019 / 065876, i.e., an enzymatic method coupled with an ATP regeneration system. This production method includes a step of contacting a transformant in which expression of the three enzymes of the present invention, modified Nampt, Prs, and Ppk, has been enhanced, a cell-free protein synthesis reaction solution in which the three enzymes have been expressed, or a processed product thereof, with R5P, NAM, ATP, and polyphosphate. Preferably, the method for producing NMN of the present invention further includes a step of contacting a transformant in which expression of the two enzymes Rbk and Ppk has been enhanced, a cell-free protein synthesis reaction solution in which the two enzymes have been expressed, or a processed product thereof, with a mixture containing ribose, ATP, and polyphosphate as the R5P production step. In other words, in the present invention, NMN is produced by allowing a predetermined enzymatic reaction to proceed while utilizing an ATP regeneration reaction.

[0095] Such a method for producing NMN is typically carried out by sequentially performing the following steps (1) to (3) (referred to herein as step 1, step 2, and step 3, respectively). These steps may be performed by the same person or different people. These steps may be performed continuously or in stages with a predetermined interval between each step. (1) A step of producing and culturing a transformant containing genes encoding each of the modified Nampt, Prs, Rbk, and Ppk enzymes, or performing a protein synthesis reaction in a cell-free protein synthesis reaction solution containing genes encoding each of the enzymes, thereby expressing each of the enzymes (step 1); (2) A step of preparing a processed product from the transformant or cell-free protein synthesis reaction solution that has undergone step 1, as necessary (step 2); and (3) A step of contacting the transformant, cell-free protein synthesis reaction solution, or processed product thereof that has undergone steps 1 and 2 with each of the substrate compounds (step 3).

[0096] The method for producing NMN of the present invention will be described in further detail below, along with an embodiment in which steps 1, 2, and 3 are performed. However, the method for producing NMN of the present invention can also be performed in an embodiment in which steps 1, 2, and 3 specifically described below are appropriately modified, without departing from the spirit of the present invention.

[0097] [Step 1] Step 1 is a step of producing and culturing a transformant containing genes encoding each of the modified Nampt, Prs, Rbk, and Ppk enzymes, or performing a protein synthesis reaction in a cell-free protein synthesis reaction solution containing genes encoding each of the enzymes, thereby expressing each of the enzymes.

[0098] In this embodiment, four enzymes are used: modified Nampt, Prs, and Ppk, and, if necessary, Rbk. The modified Nampt is described in Sections 1.1 and 1.2 above. Prs, Ppk, and Rbk are all known enzymes, and their amino acid sequences and the nucleotide sequences of the genes encoding them are readily available to those skilled in the art. The four enzymes may be naturally occurring enzymes, as long as they are capable of catalyzing the respective target reactions. Alternatively, they may be mutant enzymes prepared by modifying the amino acid sequences of naturally occurring enzymes, preferably with improved expression levels or enzymatic activity. Furthermore, various tags (proteins or peptides) may be attached to each enzyme for the purposes of simplifying purification, promoting soluble expression, antibody detection, etc. Examples of tags include His tag (histidine tag), Strep(II) tag, GST tag (glutathione-S-transferase tag), MBP tag (maltose-binding protein tag), GFP tag (green fluorescent protein tag), SUMO tag (small ubiquitin-related(like) modifier tag), FLAG tag, HA tag, myc tag, etc. Furthermore, the four enzymes may be expressed as fusion proteins with each other.

[0099] Examples of Prs include those derived from humans (Homo sapiens) (NP_002755), Bacillus subtilis (BAA05286), Bacillus caldolyticus (CAA58682), Arabidopsis thaliana (Q680A5), and Methanocaldococcus jannaschii (Q58761). To enable the production of PRPP via the second reaction and the subsequent production of NMN via the third reaction to continue over long periods of time, especially when the substrate concentration in the production system is high (i.e., to continuously increase the concentration of the final product, NMN, in the production system), mutant Prs such as those described in WO2019 / 065876 can also be used. Examples of mutant Prs include, for example, mutants such as Asp51His (substitution of Asp at position 51 with His, same below), Asn113Ser, Leu128Ile, Aspl82His, Ala189Val, and Hisl92Gln in human-derived Prs, as well as corresponding mutants in Prs from other organisms, for example, mutants such as Asn120Ser (corresponding to the aforementioned Asn113Ser) and Leu135Ile (corresponding to the aforementioned Leu128Ile) in Bacillus subtilis-derived Prs.

[0100] Rbk can be naturally occurring Rbk derived from various organisms, or a mutant Rbk produced by modifying its amino acid sequence. Examples include Rbk derived from humans (Homo sapiens) (NP_002755), yeast (Saccharomyces cerevisiae) (P25332), Bacillus subtilis (P36945), Escherichia coli (AAA51476), and Haemophilus influenzae (P44331).

[0101] In the present invention, Ppk (EC number: 2.7.4.1) is an enzyme used in a reaction to regenerate ATP (ATP regeneration reaction) from ADP produced in the first reaction or AMP produced in the second reaction and polyphosphate.

[0102] Ppks can be classified into two families, the polyphosphate kinase type 1 family (Ppk1) and the polyphosphate kinase type 2 family (Ppk2), based on differences in amino acid sequence and kinetics. Ppk2 has a higher activity of regenerating ATP using polyphosphate as a substrate than Ppk1. Therefore, it is preferable to use Ppk2 as the Ppk in the present invention.

[0103] Ppk2 can be further classified into three subfamilies: class 1, class 2, and class 3. Class 1 and class 2 Ppk2 catalyze the phosphorylation of ADP to produce ATP and the phosphorylation of AMP to produce ADP, respectively. In contrast, class 3 Ppk2 can catalyze both the phosphorylation of AMP and the phosphorylation of ADP, and can therefore produce ATP solely from AMP.

[0104] The Ppk in the present invention can be a combination of Ppk2 class 1 for regenerating ATP from ADP and Ppk2 class 2 for regenerating ADP from AMP. Alternatively, when adenylate kinase (which catalyzes the reaction AMP + ATP → 2ADP) is used in combination to regenerate ADP from AMP, Ppk2 class 1 or Ppk1 alone for regenerating ATP from ADP can be used as the Ppk in the present invention. However, Ppk2 class 3 is preferred because it can efficiently catalyze both the regeneration of ATP from ADP and the regeneration of ATP from AMP independently. When such a Ppk is used, the Ppk for the first reaction and the Ppk for the second reaction can be the same.

[0105] Examples of Ppk2 class 3 include those derived from Deinococcus radiodurans (NP_293858), Paenarthrobacter aurescens (ABM08865), Meiothermus rube (ADD29239), Deinococcus geothermalis (WP_011531362), and Thermosynechococcus elongatus (NP_682498). On the other hand, examples of Ppk2 class 1 include those derived from Rhodobacter sphaeroides (CS253628), Sinorhizobium meliloti (NP_384613), Pseudomonas aeruginosa (PA0141) (NP_248831), Pseudomonas aeruginosa (PA2428) (NP_251118), and Francisella tularensis (AJI69883). Examples of Ppk2 class 2 include Pseudomonas aeruginosa (PA3455) (NP_252145). Examples of adenylate kinase include those derived from Bacillus cereus (AAP07232).

[0106] [Step 2] Step 2 is a step of preparing a processed product from the transformant or cell-free protein synthesis reaction solution that has undergone step 1, as necessary. Examples of processed transformant products include resting cells, membrane permeability-improved cells, inactivated cells, and disrupted cells prepared from the transformant. Cell-free extracts and purified enzymes prepared from disrupted cells are also included in the processed product of the present invention. Examples of processed cell-free protein synthesis reaction solutions include purified enzymes prepared from the cell-free protein synthesis reaction solution. Furthermore, stabilized products obtained by subjecting transformants, cell-free protein synthesis reaction solutions, and these processed products to stabilization treatment are also included in the processed product of the present invention.

[0107] Resting cells can be prepared using known methods. Resting cells refer to cells in which growth has essentially ceased. Specifically, transformants grown by culture are recovered from the medium and then suspended in a buffer solution or the like that does not contain a readily available carbon source, or the recovered transformant is frozen or dried and powdered. Any method may be used to recover transformants from the medium, including, for example, centrifugation and membrane filtration. Centrifugation is not particularly limited as long as it can provide a centrifugal force sufficient to sediment the transformant; for example, a cylindrical or disc-type centrifuge can be used. The centrifugal force can be, for example, approximately 500 G to 20,000 G. Membrane filtration may be performed using either a microfiltration (MF) membrane or an ultrafiltration (UF) membrane, as long as it allows the transformant to be recovered from the medium. The buffer solution in which the transformant is suspended may be any solution that substantially stops the growth of the transformant and maintains the function of each of the predetermined enzymes. Examples of such a solution include phosphate buffer, acrylic acid buffer, Tris (tris(hydroxymethyl)aminomethane)-hydrochloric acid buffer, HEPES (2-(4-(2-hydroxyethyl)-1-piperazinyl)ethanesulfonic acid), and other Good's buffers. The transformant may be frozen after removing most of the water by centrifugation or other procedures, or after being suspended in an appropriate buffer. The freezing temperature varies depending on the components of the buffer solution in which the transformant is suspended, but may be any temperature at which the transformant is substantially frozen, such as -210°C to 0°C. The transformant may be dried using any method that substantially stops the growth of the transformant and maintains the function of each of the predetermined enzymes. Examples of such a method include freeze-drying and spray-drying.

[0108] Bacterial cells with improved membrane permeability can be prepared using known methods. For example, treating the transformant with an organic solvent or a surfactant makes it easier for substrates and products to pass through the cell membrane or cell wall of the transformant. The types of organic solvents and surfactants used are not particularly limited as long as they improve membrane permeability and maintain the function of each predetermined enzyme. Examples of organic solvents include toluene and methanol, and examples of surfactants include Triton-X100 and benzethonium chloride.

[0109] Inactivated bacterial cells can be prepared using known techniques. For example, chemical treatment or heat treatment can be used. For chemical treatment, for example, cationic surfactants such as benzethonium chloride, cetylpyridinium chloride, methyl stearoyl chloride, and cetyltrimethylammonium bromide, and zwitterionic surfactants such as alkyldiaminoethylglycine hydrochloride can be used. Other examples of chemical surfactants include alcohols such as ethanol, thiols such as 2-mercaptoethanol, amines such as ethylenediamine, and amino acids such as cysteine, ornithine, and citrulline. Heat treatment can be performed at a temperature and for a time that does not inactivate the target enzyme.

[0110] Disrupted bacterial cells can be prepared using known techniques. Examples include ultrasonic treatment, high-pressure treatment using a French press or homogenizer, grinding treatment using a bead mill, collision treatment using an impact crusher, enzyme treatment using lysozyme, cellulase, pectinase, etc., freeze-thaw treatment, hypotonic solution treatment, and phage-mediated bacteriolysis induction treatment. Any of these methods can be used alone or in combination as needed. When disrupting cells on an industrial scale, taking into consideration operability, recovery rate, cost, etc., it is preferable to use, for example, high-pressure treatment, grinding treatment, collision treatment, or a combination of these treatments with enzyme treatment, etc.

[0111] When grinding is performed using a bead mill, the beads used have a density of, for example, 2.5 to 6.0 g / cm 3Crushing can be carried out by filling the machine with particles of 0.1 to 1.0 mm in size at a rate of usually 80 to 85%, and either a batch or continuous operation method can be used.

[0112] When performing high-pressure treatment, the treatment pressure is not particularly limited as long as it ensures a sufficiently high recovery rate of the target protein from the cells, but disruption can be performed, for example, at a pressure of about 40 to 200 MPa, preferably about 60 to 150 MPa, and more preferably about 80 to 120 MPa. If necessary, it is possible to perform multi-stage treatment by arranging the devices in series or using a device with a multi-stage structure, thereby improving disruption and operational efficiency. Since a temperature increase of 2 to 3°C occurs per 10 MPa of treatment pressure, it is preferable to perform a cooling treatment as needed.

[0113] In the case of collision treatment, for example, the cell slurry is first frozen into fine particles (e.g., 50 μm or less) using a spray rapid freezing treatment (freezing rate: e.g., several thousand degrees Celsius per minute), and then these are collided with a collision plate using a carrier gas at high speed (e.g., approximately 300 m / s), thereby efficiently crushing the cells.

[0114] Cell-free extracts can be prepared by removing the disruption residue (insoluble fractions including cell membranes and cell walls) from disrupted bacterial cells. Removal of the disruption residue can be performed by known techniques, such as centrifugation, membrane filtration, and filter cloth filtration. Centrifugation can be performed as described above. However, if the disruption residue of the transformant is fine and difficult to settle, a flocculant or the like can be used to increase the residue precipitation efficiency as needed. Membrane filtration can also be performed as described above. Ultrafiltration (UF) membranes can be used, particularly when the disruption residue of the transformant is fine. Filter cloth filtration can be performed in combination with a filter aid or flocculant. Examples of filter aids include diatomaceous earth, cellulose powder, and activated carbon. Examples of flocculants include cationic flocculants, anionic flocculants, amphoteric flocculants, and nonionic flocculants. By using any of the above procedures, the supernatant free of bacterial cells can be recovered and decellularized (made cell-free), thereby preparing a cell-free extract containing each of the desired enzymes.

[0115] The purified enzyme can be prepared by common biochemical methods, such as ammonium sulfate precipitation, various types of chromatography (e.g., gel filtration chromatography (e.g., Sephadex column), ion exchange chromatography (e.g., DEAE-Toyopearl), affinity chromatography (e.g., TALON Metal Affinity Resin), hydrophobic chromatography (e.g., butyl Toyopearl), anion chromatography (e.g., MonoQ column)), SDS polyacrylamide gel electrophoresis, etc., either alone or in appropriate combination.

[0116] In the present invention, the above-mentioned transformants, cell-free protein synthesis reaction solutions, and processed products thereof can also be used as stabilized products. The stabilization treatment can be any treatment that improves the stability of each specified enzyme against environmental factors (temperature, pH, chemical concentration, etc.) or its stability during storage compared to the untreated state. Examples of such treatments include inclusion in a gel such as acrylamide, treatment with aldehydes such as glutaraldehyde (including CLEA: Cross-linked enzyme aggregate), and support on an inorganic carrier (alumina, silica, zeolite, diatomaceous earth, etc.).

[0117] The substrates and products used in the present invention are relatively highly polar, and the cell membrane or cell wall may be rate-limiting for mass transfer. Therefore, from the viewpoint of permeability of the substrates and products, it is particularly preferable to use disrupted bacterial cells, cell-free extracts, purified enzymes, or stabilized products thereof in the present invention.

[0118] The transformant, the cell-free protein synthesis reaction solution, or a processed product thereof can be stored under any conditions as long as the enzyme activity is maintained. If desired, the solution may be frozen under appropriate conditions (e.g., −80° C. to −20° C., for 1 day to 1 year) and stored until use (the time of carrying out the third step).

[0119] As described above, when combining transformants containing separate genes encoding each of the specified enzymes, for example, when preparing and combining a transformant with enhanced expression of modified Nampt and Prs and a transformant with enhanced expression of Ppk, (i) each treatment may be performed separately for each transformant and then the treated products may be mixed, or (ii) the transformants may be mixed and then the respective treatments may be performed all at once.

[0120] [Step 3] Step 3 involves contacting the transformant or cell-free protein synthesis reaction solution that has undergone Step 1, or a processed product thereof that has further undergone Step 2, if necessary, with substrates that serve as raw materials for the enzymatic reactions. In Step 3, the second reaction catalyzed by Prs and the third reaction catalyzed by modified Nampt can be carried out in conjunction with an ATP regeneration reaction catalyzed by Ppk. In the second reaction catalyzed by Prs, the substrate is phosphorylated using ATP as a phosphate source, resulting in ATP consumption. However, in the third reaction using modified Nampt, autophosphorylation due to ATP hydrolysis does not occur, resulting in less ATP consumption than when wild-type Nampt is used. By coupling at least the second reaction with the ATP regeneration reaction, the reaction can proceed efficiently while replenishing consumed ATP. However, because phosphoribosyl pyrophosphate (PRPP), the product of the second reaction catalyzed by Prs, is a relatively unstable compound, carrying out the second and third reactions in the same system allows the third reaction catalyzed by modified Nampt to proceed promptly after PRPP generation. In the present invention, ATP is regenerated from ADP and / or AMP by the ATP regeneration reaction, so ATP is not depleted. However, it is necessary to add an appropriate amount of ATP to the reaction solvent depending on the ATP concentration to be maintained during the reaction. In this case, ADP or AMP may be added to the reaction solvent instead of ATP, if necessary. The added ADP or AMP is immediately regenerated into ATP in the system by the ATP regeneration system, resulting in a state essentially equivalent to adding an appropriate amount of ATP. Alternatively, a mixture containing ADP and / or AMP in any ratio may be added.

[0121] The second and third reactions may be combined with the first reaction by Rbk coupled with the ATP regeneration reaction by Ppk, if necessary. When combining the two, the first reaction by Rbk may be performed first, and the resulting reaction solution may be used as a raw material to perform the second reaction by Prs and the third reaction by modified Nampt. Alternatively, the first reaction by Rbk and the second reaction by Prs and the third reaction by modified Nampt may be performed in the same reaction system.

[0122] The second reaction by Prs and the third reaction by modified Nampt are carried out by contacting a transformant in which the expression of the three enzymes modified Nampt, Prs, and Ppk is enhanced, a cell-free protein synthesis reaction solution in which the three enzymes are expressed, or a processed product thereof, with R5P, NAM, ATP, and polyphosphate.

[0123] The first reaction catalyzed by Rbk is carried out by contacting a transformant in which expression of the two enzymes Rbk and Ppk is enhanced, a cell-free protein synthesis reaction solution in which the two enzymes are expressed, or a processed product thereof, with ribose, ATP, and polyphosphate.

[0124] The raw materials used in step 3 can be purchased from general suppliers or synthesized by performing a reaction in-house. For example, although a commercially available product can be used for R5P, from the viewpoint of raw material costs, it is preferable to use R5P synthesized by the first reaction catalyzed by Rbk, i.e., by contacting a transformant in which expression of the two enzymes Rbk and Ppk is enhanced, a cell-free protein synthesis reaction solution in which the two enzymes are expressed, or a processed product thereof, with ribose and polyphosphate.

[0125] Polyphosphate, one of the raw materials, is known to have various chain lengths. The chain length of the polyphosphate used in the present invention may be any length as long as it allows the ATP regeneration reaction to proceed efficiently. However, from the viewpoints of the viscosity of the solution when dissolved and the cost, the chain length is preferably about 3 to 100, and more preferably about 3 to 30.

[0126] In the third step, if necessary, compounds other than the raw materials may be contacted with the transformant in which the expression of the specified enzymes is enhanced, the cell-free protein synthesis reaction solution in which the specified enzymes are expressed, or a processed product thereof, or may be included in the reaction solvent (production system). For example, it is appropriate to include metal ions such as magnesium ions as components for the expression of the enzymes. It is also preferable to include buffer components. Furthermore, in the present invention, it is desirable to have phosphate ions present in the reaction system. This is because the addition of phosphate ions to the reaction system of the modified Nampt of the present invention further improves the NMN accumulation concentration. The phosphate concentration is not particularly limited as long as NMN is produced appropriately, and may vary depending on the substrate concentration and enzyme concentration. However, it is preferably 1 mM or more, more preferably 10 mM or more, and even more preferably 30 mM or more. The phosphate concentration is preferably less than 100 mM, more preferably 90 mM or less, and even more preferably 80 mM or less. One possible reason why the addition of phosphate increases the concentration of NMN accumulation is that the presence of a certain amount of phosphate ions in the reaction system makes it easier for the enzyme, substrate, ions, etc. in the active center of modified Nampt to adopt a configuration that is favorable for NMN production.

[0127] The amounts of the transformant in which expression of each of the specified enzymes is enhanced, the cell-free protein synthesis reaction solution in which each of the specified enzymes is expressed, or their processed products, i.e., more specifically, the amounts of modified Nampt, Prs, Rbk, and Ppk, contained in the reaction solvent (production system), can be adjusted appropriately. Similarly, the amounts of R5P, NAM, ATP, polyphosphate, ribose, and other raw materials used as needed contained in the reaction medium can also be adjusted appropriately. The concentrations of each of the above substances in the reaction solvent (production system) are as follows.

[0128] The concentration of modified Nampt is, for example, 1 μg / L to 5 g / L. The concentration of Prs is, for example, 1 μg / L to 1 g / L. The concentration of Rbk is, for example, 1 μg / L to 1 g / L. The concentration of Ppk is, for example, 1 μg / L to 5 g / L. The concentration of each enzyme in the reaction solvent can be adjusted to fall within the above-mentioned ranges by appropriately adjusting the amount of a transformant in which expression of each predetermined enzyme is enhanced, a cell-free protein synthesis reaction solution in which each predetermined enzyme is expressed, or a processed product thereof added to the reaction solvent.

[0129] The concentration of R5P is, for example, 1 μg / L to 100 g / L. The concentration of ribose is, for example, 1 μg / L to 100 g / L. The concentration of NAM is, for example, 1 μg / L to 500 g / L. The concentration of ATP is, for example, 1 μg / L to 100 g / L. The concentration of polyphosphate is, for example, 1 μg / L to 200 g / L. The concentrations of each raw material in the reaction solvent can be adjusted to fall within the above ranges by adjusting the amounts of these raw materials added to the reaction solvent. Depending on the raw materials, a predetermined amount may be added all at once at the beginning of the third step, or predetermined amounts may be added sequentially at appropriate stages at the beginning and / or during the third step.

[0130] Other than the concentration of each substance as described above, the conditions for the enzymatic reaction, such as temperature and time, can also be adjusted appropriately. The reaction temperature is preferably adjusted within a range that optimizes the catalytic efficiency of each enzyme. The reaction time can be set until the production amount of the target compound, NMN, reaches a predetermined amount.

[0131] The produced NMN can be recovered from the production system using standard methods and appropriately concentrated and purified. Any recovery and purification method can be used as long as it can improve the purity of NMN and efficiently recover NMN. Examples include the following: After the NMN synthesis reaction, if the reaction was performed using bacterial cells, the bacterial cells can be removed by centrifugation, membrane filtration, or other means. Alternatively, if the reaction was performed using a cell-free extract or purified enzyme, proteins and other components can be removed by filtration through an ultrafiltration membrane or by precipitation with perchloric acid or other precipitation followed by centrifugation. If treatment with perchloric acid was performed, the pH can be returned to a weakly acidic state using potassium hydroxide, and the resulting potassium perchlorate precipitate can be removed again by centrifugation. After removing the bacterial cells or proteins, a washing process using activated carbon adsorption can be performed, if necessary. An aqueous solution containing NMN is brought into contact with activated carbon to adsorb NMN. After filtering the activated carbon with adsorbed NMN using filter paper, certain impurities can be removed by washing with a solvent such as isoamyl alcohol. Further purification can be performed by treatment with an anion exchange resin. A solution containing NMN can be passed through an anion exchange resin such as Dowex, and the adsorbed NMN can be eluted with water. Furthermore, by acidifying the pH of the resulting NMN aqueous solution and adding a large amount of acetone, NMN can be obtained as a precipitate. Purified NMN can be obtained by drying this precipitate.

[0132] 6.3 Reaction in the Presence of PPase The method for producing NMN of the present invention may comprise a step of contacting a transformant in which expression of modified Nampt has been enhanced, a cell-free protein synthesis reaction solution in which the enzyme has been expressed, or a processed product thereof, with NAM and PRPP in the presence of PPase.

[0133] The steps of this embodiment are carried out by sequentially performing steps 1, 2, and 3, similarly to embodiment 6.2, except for the following point: Steps 1 and 2 are steps for preparing a transformant in which expression of at least modified Nampt is enhanced, a cell-free protein synthesis reaction solution in which the enzyme is expressed, or a processed product thereof, and for preparing a transformant in which expression of PPase is enhanced or a microorganism in which expression is not particularly enhanced but which expresses PPase as an endogenous enzyme, a cell-free protein synthesis reaction solution in which the enzyme is expressed, or a processed product thereof; and in step 3, the transformant, cell-free protein synthesis reaction solution, or processed product thereof that has been subjected to steps 1 and 2 is contacted with at least NAM and PRPP.

[0134] PPase (EC number: 3.6.1.1) is an enzyme that hydrolyzes pyrophosphate into two molecules of phosphate. In the method for producing NMN of the present invention using modified Nampt, the third reaction can be carried out efficiently by performing the third reaction in the presence of PPase.

[0135] Examples of PPases include those derived from yeast (P00817), Escherichia coli (NP_418647), Bacillus subtilis (P37487), Thermus thermophilus (P38576), Streptococcus gordonii (P95765), and Streptococcus mutans (O68579).

[0136] PPase may be in any form and prepared by any method as long as it can be added to the third reaction system. Specifically, as in step 1 of 6.2, a transformant containing a gene encoding PPase is first prepared and cultured, or a protein synthesis reaction is carried out in a cell-free protein synthesis reaction solution containing the genes encoding each enzyme, thereby expressing each enzyme. Furthermore, since PPase is expressed at a certain level as an enzyme necessary for survival in ordinary microorganisms, microorganisms whose expression is not particularly enhanced can be cultured and used as is. Subsequently, as in step 2 of 6.2, a treated product can be prepared from the transformant, microorganisms whose expression is not particularly enhanced, or cell-free protein synthesis reaction solution that has undergone step 1. Alternatively, commercially available purified PPase enzymes can be used as one embodiment of the treated product. Examples of commercially available purified PPase enzymes include yeast-derived PPase purified enzyme (Sigma-Aldrich, product number 10108987001) and the like.

[0137] A method for producing NMN in the presence of PPase can be carried out by contacting a transformant in which expression of modified Nampt is enhanced, a cell-free protein synthesis reaction solution in which the enzyme is expressed, or a processed product thereof, with NAM and PRPP in the presence of PPase obtained as described above. By carrying out the reaction in the presence of PPase, the third reaction can proceed extremely efficiently, allowing for efficient production of NMN. The third reaction in the presence of PPase can be carried out alone, or can be combined with one or more of the first reaction, the second reaction, and the ATP regeneration reaction and carried out in the same reaction system.

[0138] 6.4 Use of a host in which unnecessary genes have been disrupted or deleted The method for producing NMN of the present invention may comprise the step of contacting a transformant or a processed product thereof in which a gene encoding an enzyme classified under the EC number shown in (d) EC 3.5.1.42 and a gene encoding an enzyme classified under one or more of the EC numbers shown in the following (a), (c), (g), (h), and (i) have been disrupted or deleted, and in which expression of modified Nampt has been enhanced, with at least nicotinamide (NAM): (a) EC 3.1.3.5 (c) EC 2.4.2.1 (g) EC 3.2.2.1 (h) EC 3.2.2.3 (i) EC 3.2.2.14

[0139] The steps of this embodiment are carried out by sequentially performing steps 1, 2, and 3, similarly to embodiment 6.2, except for the following point: Steps 1 and 2 are steps for preparing a transformant or a processed product thereof in which genes encoding enzymes classified into various EC numbers have been disrupted or deleted and in which expression of modified Nampt has been enhanced, and in step 3, the transformant or a processed product thereof that has undergone steps 1 and 2 is brought into contact with at least NAM.

[0140] 6.5 Reduction in the Amount of ATP Used The method for producing NMN of the present invention may be such that the total number of moles of ATP, ADP, and AMP added to the reaction system for producing NMN is 0.5 equivalents or less of the number of moles of NMN produced.

[0141] Because ATP is an expensive compound, it is desirable to use as little ATP as possible when producing NMN inexpensively. In other words, in the NMN production method of the present invention, it is preferable that the total number of moles of ATP, ADP, and AMP added to the reaction system to produce NMN be 0.5 equivalents or less of the number of moles of NMN produced.

[0142] Adding an appropriate amount of ATP to the reaction system allows for efficient production of NMN. The number of moles of ATP added to the reaction system is preferably 1 equivalent or less of the number of moles of NMN produced, more preferably 0.5 equivalents or less, and even more preferably 0.1 equivalents or less.

[0143] The modified Nampt of the present invention has the advantage of not wasting ATP because of its reduced ATP hydrolysis activity, making it easier to reduce the amount of ATP used.

[0144] The present invention will be specifically explained below with reference to examples, but the present invention is not limited to these examples.

[0145] Example 1: Preparation of wild-type Nampt and Nampt autophosphorylation residue mutant expression plasmids (1) Preparation of wild-type Nampt expression plasmids Expression plasmids for each wild-type Nampt were prepared as follows. For each Nampt listed in Table 2, DNA encoding its amino acid sequence was synthesized and cloned into the NdeI-XhoI site of the expression vector pET-26b(+) (Novagen). Gene synthesis was outsourced to GenScript Japan, and the nucleotide sequence was codon-optimized for expression in Escherichia coli. Note that the stop codon (TAA) of each nucleotide sequence was deleted prior to cloning to add a 6xHis tag present in the vector sequence. The resulting plasmids were named as shown in Table 2.

[0146]

[0147] (2) Preparation of Plasmids Expressing Nampt Autophosphorylation Residue Mutants Plasmids expressing Nampt autophosphorylation residue mutants were prepared as follows. Mutagenesis PCR was performed using each wild-type Nampt expression plasmid listed in Table 2 as a template. Table 3 shows the names of the primers used for mutagenesis and their sequence numbers, the wild-type Nampt expression plasmids used as templates, the names of the resulting Nampt autophosphorylation residue mutants, and the names of the expression plasmids.

[0148]

[0149] The mutagenesis PCR reaction was carried out using the reaction solution composition (Table 4) and reaction conditions (Table 5) shown below.

[0150]

[0151] After PCR, the PCR product was purified using a QIAquick PCR Purification Kit (Qiagen) according to the attached protocol. The resulting PCR product was digested with DpnI (New England Biolabs), and the resulting reaction mixture was used to transform Escherichia coli HST08 (Takara Bio). Plasmids were extracted from the resulting colonies, and the nucleotide sequences were confirmed using primers T7-PP (SEQ ID NO: 110) or T7-TP (SEQ ID NO: 111). Plasmids with correctly introduced mutations were designated as Nampt autophosphorylation residue mutant expression plasmids listed in Table 3.

[0152] Example 2: Evaluation of Nampt activity of crude enzymes containing VpNampt autophosphorylation residue mutants (1) Preparation of transformants Competent cells of E. coli BL21(DE3) strain (Zip Competent Cell BL21 (DE3), Funakoshi) was thawed on ice, and the competent cells were mixed with the wild-type VpNampt expression plasmid (pEVpNpt) prepared in Example 1(1) or the 19 VpNampt autophosphorylation residue mutant expression plasmids (pEVpH238A, pEVpH238C, pEVpH238D, pEVpH238E, pEVpH238F, pEVpH238G, pEVpH238I, pEVpH238K, pEVpH238L, pEVpH238M, pEVpH238N, pEVpH238P, pEVpH238Q, pEVpH238R, pEVpH238S, pEVpH238T, pEVpH238V, pEVpH238W, pEVpH238Y) prepared in Example 1(2), and the mixture was left to stand on ice for 10 minutes. After a 45-second heat shock at 42°C, the cells were cooled on ice again and SOC medium was added. After shaking culture at 37°C for 1 hour, the cells were plated on LB agar medium (containing 50 mg / L kanamycin sulfate) and incubated overnight at 37°C.

[0153] (2) Culturing of VpNampt-Expressing Transformants A colony of the transformant obtained in (1) was inoculated into 2 ml of LB medium (containing 50 mg / L kanamycin sulfate). After culturing at 37°C with agitation at 200 rpm for 3 hours, IPTG (isopropyl-β-D(-)-thiogalactopyranoside) was added to a final concentration of 0.5 mM. The temperature was changed to 18°C ​​with agitation at 200 rpm, and culturing was continued for an additional 18 hours.

[0154] (3) Preparation of VpNampt Crude Enzyme: The culture medium obtained in (2) was centrifuged (5,000 × g, 10 minutes), and the supernatant was discarded. 50 mM HEPES-NaOH buffer (pH 7.5) was added to the precipitated cells, and the turbidity at 630 nm was adjusted to approximately 10. 0.5 ml of the buffered cell suspension was disrupted in a Bioruptor (Cosmo Bio) for 15 minutes. The disrupted solution was centrifuged (5,000 × g, 10 minutes), and the resulting supernatant was used as the crude enzyme of wild-type VpNampt or the VpNampt autophosphorylation residue mutant. The protein concentration of the crude enzyme solution was measured using a Bio-Rad protein assay (Bio-Rad) with bovine serum albumin (BSA) as a standard protein.

[0155] (4) Measurement of Nampt activity Nampt activity was measured using the crude enzymes of wild-type VpNampt and VpNampt autophosphorylation residue mutants prepared in (3). Each reaction solution was prepared in a volume of 200 μL with the composition shown in Table 6, and the reaction was allowed to stand at 37°C for 10 minutes.

[0156]

[0157] After the reaction was completed, 10 μL of 10 vol% phosphoric acid was added to the reaction solution, and ultrafiltration was performed using Nanocep10K (Cytiva). The resulting filtrate was subjected to HPLC analysis under the following conditions, and the NMN concentration in the reaction solution produced over 10 minutes was calculated using a calibration curve prepared using an NMN standard (Oriental Yeast). Column: InertSustain AQ-C18 (GL Sciences); Mobile phase: 0.05M KH2PO4 / K2HPO4 (pH 7); Flow rate: 1.5 mL / min; Detection: UV 261 nm; Column temperature: 40°C.

[0158] (5) Experimental Results The experimental results are shown in Figure 1. Wild-type VpNampt (residue 238 is histidine, H) produced less than half the NMN concentration in the presence of ATP (condition 2) compared to the absence of ATP (condition 1), confirming that Nampt activity is significantly affected by ATP in the reaction solution. On the other hand, all VpNampt autophosphorylation residue mutants in which residue 238 was substituted with other amino acids produced NMN at the same level in the presence of ATP (condition 2) as in the absence of ATP (condition 1). In particular, mutants in which residue 238 was substituted with threonine (T), glycine (G), alanine (A), methionine (M), asparagine (N), phenylalanine (F), or other amino acids produced higher NMN concentrations than wild-type VpNampt. In other words, by modifying the 238th amino acid, which is thought to be the autophosphorylation residue of VpNampt, to another amino acid, mutants can be obtained that exhibit stable NMN synthesis activity that is not affected by the ATP concentration in the reaction solution, and some of these mutants have higher NMN synthesis activity than wild-type VpNampt.

[0159] Example 3: Synthesis of NMN from PRPP Using Crude Enzymes of VpNampt Autophosphorylation Residue Mutants (1) High-Concentration Third Reaction Using the crude enzymes of wild-type VpNampt and VpNampt autophosphorylation residue mutants (VpH238A, VpH238G, VpH238M, VpH238N, and VpH238T) prepared in Example 2(3), NMN synthesis reactions were performed using a high-concentration substrate solution. Each reaction solution was prepared in 100 μL volume with the composition shown in Table 7, and the reaction was allowed to stand at 37°C. Immediately after the start of the reaction, 3 hours, 6 hours, and 22 hours later, 10 μL of each reaction solution was sampled and mixed with 190 μL of the mobile phase described in Example 2(4). The resulting filtrate was subjected to HPLC analysis under the conditions described in Example 2(4), and the NMN concentration in the reaction solution at each time point was calculated.

[0160]

[0161] (2) Experimental Results Figure 2 shows the change in NMN concentration in the reaction solution in the absence of ATP (condition 2), and Figure 3 shows the change in NMN and ATP concentrations in the presence of ATP (condition 1). In the absence of ATP (condition 2), wild-type VpNampt and the VpNampt autophosphorylation residue mutants produced NMN at concentrations of 20 mM or more. In the presence of ATP (condition 1), all VpNampt autophosphorylation residue mutants produced NMN at concentrations of 20 mM or more, similar to the condition in the absence of ATP (condition 2), but wild-type VpNampt produced NMN at concentrations below 10 mM. Furthermore, after 22 hours of reaction, the remaining ATP concentration in wild-type VpNampt was 1.1 mM, while approximately 3 mM ATP remained in all VpNampt autophosphorylation residue mutants. These results confirmed that the autophosphorylation residue mutants can produce high concentrations of NMN regardless of the presence or absence of ATP in the reaction solution, while consuming less than half the amount of ATP of wild-type VpNampt. These results suggest that the mutants are efficient enzymes that can produce high concentrations of NMN while minimizing ATP consumption in NMN-producing reaction systems where other enzymatic reactions that use ATP coexist.

[0162] Example 4 Evaluation of activity of various wild-type Nampt autophosphorylation residue Gly mutants (1) Preparation of transformants Transformants were prepared in the same manner as in Example 2(1) using the five wild-type expression plasmids prepared in Example 1 (pEVpNpt, pEXtNpt, pEAvNpt, pECfNpt, pESsNpt) and the corresponding wild-type Nampt autophosphorylation residue Gly mutant expression plasmids (pEVpH238G, pEXtH229G, pEAvH232G, pECfH227G, pESsH229G).

[0163] (2) Preparation of purified enzymes of various wild-type Nampt and autophosphorylation residue Gly mutants. The transformant colonies obtained in (1) were cultured in the same manner as in Example 2(2). Crude enzymes were then prepared in the same manner as in Example 2(3). The crude enzymes were purified using the ME personal purification system and PhyTip (1 mL, 160 μL Ni-IMAC) (Biotage Japan). The resulting eluate was placed in a boiled and washed dialysis tube and dialyzed against 50 mM potassium phosphate buffer (pH 7.5). The dialyzed solution was recovered and used as purified enzymes of various wild-type Nampt and autophosphorylation residue Gly mutants.

[0164] (3) Measurement of Nampt activity Nampt activity was measured in the same manner as in Example 2(4) using the purified enzymes of various wild-type Nampt and autophosphorylated residue Gly mutants prepared in (2) and the reaction solution composition shown in Table 8.

[0165]

[0166] (4) Experimental Results The experimental results are shown in Figure 4. Although there were some differences depending on the source, wild-type Nampt showed a significant change in NMN production concentration depending on the ATP concentration. The ratio of the highest NMN production concentration under Condition 2 (0.1 mM ATP) to the lowest NMN production concentration under Condition 4 (10 mM ATP) was confirmed to be 1.6 to 2.6 times. In contrast, the NMN production concentration of various autophosphorylation residue Gly mutants showed little change with ATP concentration, with the ratio of NMN production concentration under Condition 2 to Condition 4 remaining 0.9 to 1.4 times. This suggests that the evaluation using purified enzyme also showed that the autophosphorylation residue Gly mutants exhibited stable NMN synthesis activity unaffected by the ATP concentration in the reaction solution, and that this property is universally shared by prokaryotic and bacteriophage-derived Nampt.

[0167] Example 5 Synthesis of NMN from Ribose Using VpNampt Autophosphorylation Residue Mutants (1) Preparation of Rbk, Prs, Ppk, and Ppa To evaluate VpNampt autophosphorylation residue Gly mutants in the reaction for synthesizing NMN from ribose described in Figure 1 of WO2019 / 065876, ScRbk required for the first reaction, BsPrsL135I required for the second reaction, DrPpk required for the ATP regeneration reaction, and pyrophosphatase EcPpa required for the decomposition of pyrophosphate by-product in the third reaction were prepared as follows: pEScRbk and pEDrPpk listed in Table 2 of WO2019 / 065876, and pEBsPrsL135I listed in Table 5 of the same were used as expression plasmids for ScRbk, BsPrsL135I, and DrPpk. The EcPpa expression plasmid used was pEEcPpa, which was prepared by synthesizing DNA (consisting of the nucleotide sequence shown in SEQ ID NO: 113) encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 112 and cloning it into the NdeI-XhoI site of the expression vector pET-26b(+) (Novagen) (gene synthesis was performed by GenScript Japan). Using these expression plasmids, transformants were prepared in the same manner as in Example 2(1). The resulting transformed colonies were cultured in the same manner as in Example 2(2), and crude enzymes of ScRbk, BsPrsL135I, DrPpk, and EcPpa were prepared in the same manner as in Example 2(3).

[0168] (2) Synthesis of NMN from ribose using VpNampt autophosphorylation residue mutants. The crude enzymes of wild-type VpNampt and 19 VpNampt autophosphorylation residue mutants used in Example 2(3), and the crude enzymes of ScRbk, BsPrsL135I, DrPpk, and EcPpa prepared in (1), were used to carry out an NMN synthesis reaction from ribose coupled with an ATP regeneration system. Each reaction solution was prepared in a volume of 100 μL with the composition shown in Table 9, and the reaction was allowed to stand at 37°C.

[0169]

[0170] After 3 and 6 hours of reaction, metaphosphoric acid was added to a final concentration of 5 mM. After 24 hours, 5 μL of each reaction solution was sampled and mixed with 245 μL of the mobile phase described in Example 2(5). HPLC analysis was performed under the conditions described in Example 2(5). The NMN concentration produced by wild-type Nampt was defined as 100%, and the relative NMN concentrations produced by VpNampt autophosphorylation residue mutants were calculated.

[0171] (3) Experimental Results The experimental results are shown in Figure 5. Mutants in which the 238th amino acid of VpNampt was substituted with threonine (T), glycine (G), alanine (A), methionine (M), asparagine (N), or the like, showed higher NMN production concentrations than wild-type VpNampt (histidine, H). That is, as with the crude enzyme activity in Example 2(5), it was confirmed that by modifying the 238th amino acid, which is thought to be the autophosphorylation residue of VpNampt, with another amino acid, mutants can be obtained that improve the NMN production concentration in the NMN synthesis reaction from ribose coupled to an ATP regeneration system.

[0172] Example 6 Synthesis of NMN from Ribose Using AvNampt and CfNampt Autophosphorylation Residue Mutants (1) Preparation of Enzymes To investigate whether the VpNampt autophosphorylation residue mutants, which produced high levels of NMN in Example 5, would produce similar results with other wild-type Nampt, transformants were prepared in the same manner as in Example 2(1) using the wild-type Nampt expression plasmids for AvNampt and CfNampt (pEAvNpt, pECfNpt) prepared in Example 1(2) and the corresponding three autophosphorylation residue mutant expression plasmids (pEAvH232A, pEAvH232G, pECfH227A, pECfH227G). The resulting transformed colonies were cultured in the same manner as in Example 2(2), and then crude enzymes of wild-type AvNampt and CfNampt (AvNpt, CfNpt) and six autophosphorylation residue mutants (AvH232A, AvH232G, CfH227A, CfH227G) were prepared in the same manner as in Example 2(3). Crude enzymes of ScRbk, BsPrsL135I, DrPpk, and EcPpa were also prepared in the same manner as in Example 5(1).

[0173] (2) Synthesis of NMN from ribose using AvNampt and CfNampt autophosphorylation residue mutants The NMN synthesis reaction from ribose, sampling, and HPLC analysis were carried out in the same manner as in Example 5(2), except that the crude enzymes prepared in (1) were used. The NMN production concentration of each wild-type Nampt, AvNampt, and CfNampt, was defined as 100%, and the relative NMN concentration of each Nampt autophosphorylation residue mutant was calculated.

[0174] (3) Experimental Results The experimental results are shown in Figure 6. In AvNampt and CfNampt, mutants in which the autophosphorylated residue was substituted with alanine (A) or glycine (G) showed higher NMN production levels than wild-type VpNampt (histidine, H). In the mutant in which the autophosphorylated residue was substituted with threonine (T), the NMN production level was slightly lower in AvNampt than in wild-type Nampt, but an improvement was observed in CfNampt. In other words, it was confirmed that even in Nampt other than VpNampt, by modifying the residue thought to be the autophosphorylated residue with another amino acid, mutants can be obtained that improve the NMN production level in the NMN synthesis reaction from ribose coupled to the ATP regeneration system.

[0175] Example 7 Synthesis of NMN from Ribose Using Various Nampt Autophosphorylation Residue Gly Mutants (1) Preparation of Rbk, Prs, Ppk, and Ppa Crude enzymes of ScRbk, BsPrsL135I, DrPpk, and EcPpa were prepared by the method described in Example 5 (1). Purified enzyme of DrPpk was prepared by the same method as in Example 4 (2).

[0176] (2) Synthesis of NMN from Ribose Using Various Nampt Autophosphorylation Residue Gly Mutants Purified enzymes of wild-type Nampt (VpNpt, XtNpt, AvNpt, CfNpt, SsNpt) and the corresponding autophosphorylation residue Gly mutants (VpH238G, XtH229G, AvH232G, CfH227G, SsH229G) prepared in Example 4(2), purified enzymes of DrPpk prepared in (1), and crude enzymes of ScRbk, BsPrsL135I, and EcPpa were used to synthesize NMN from ribose via an ATP regeneration system. Each reaction solution was prepared in a volume of 100 μL with the composition shown in Table 10, and the reaction was allowed to stand at 37°C.

[0177]

[0178] After 3 and 6 hours of reaction, metaphosphoric acid was added to a final concentration of 5 mM. After 24 hours, 5 μL of each reaction solution was sampled and mixed with 245 μL of the mobile phase described in Example 2(5). HPLC analysis was performed under the conditions described in Example 2(5). The NMN concentration produced under Condition 1 for each wild-type Nampt was defined as 100%, and the relative NMN concentrations under Conditions 1 and 2 for each Nampt were calculated.

[0179] (3) Experimental Results The experimental results are shown in Figure 7. Under condition 1, in which the ATP concentration added to the reaction system was 1.5 mM, the Nampt autophosphorylation residue Gly mutants produced NMN equivalent to 101% to 162% of the NMN concentration produced by the corresponding wild-type Nampt. Furthermore, under condition 2, in which the ATP concentration added to the reaction system was reduced to 1 mM, the Nampt autophosphorylation residue Gly mutants produced NMN equivalent to 101% to 130% of the NMN concentration produced by the corresponding wild-type Nampt. In other words, it was demonstrated that the use of the Nampt autophosphorylation residue Gly mutants makes it possible to reduce the ATP concentration added to the reaction system from 1.5 mM to 1 mM.

[0180] Example 8 Synthesis of NMN from Ribose Using Crude Enzyme Derived from Escherichia coli Coexpressing NMN Synthase Group Containing Nampt Autophosphorylation Residue Mutants (1) Preparation of Crude Enzyme Containing NMN Synthase Group Escherichia coli expressing the NMN synthase group intracellularly was constructed as follows: DNA encoding AvH232G, ScRbk, DrPpk, BsPrsL135I, and EcPpa, cloned in plasmids pEAvH232G described in Example 1(2), and pEScRbk, pEDrPpk, pEBsPrsL135I, and pEEcPpa described in Example 5, was ligated to expression vector pET-26b(+) (Novagen) or pSTV28 (Takara Bio) to construct expression plasmids, and both plasmids were introduced into the E. coli BL21(DE3) strain, resulting in a transformant designated N-AvH232G. Similarly, expression plasmids were constructed by ligating the DNAs encoding AvNampt (wild-type), ScRbk, DrPpk, BsPrsL135I, and EcPpa, which were cloned into the pEAvNpt plasmid described in Example 1(1) and the pEScRbk, pEDrPpk, pEBsPrsL135I, and pEEcPpa plasmids described in Example 5, to the expression vectors pET-26b(+) (Novagen) or pSTV28 (Takara Bio). Both plasmids were introduced into the Escherichia coli BL21(DE3) strain, and the resulting transformant was designated the N-AvWT strain. Glycerol stocks of N-AvH232G and N-AvWT strains were inoculated into LB medium and cultured at 37°C and 200 rpm for 3 hours. IPTG (isopropyl-β-D(-)-thiogalactopyranoside) was added to a final concentration of 0.5 mM, and the culture was continued for an additional 18 hours at 18°C ​​and 200 rpm. The resulting cultures were centrifuged (5000 × g, 10 minutes), the supernatant was discarded, and the precipitated bacterial cells were collected. The resulting bacterial cells were added with 50 mM potassium phosphate buffer (pH 7.8) to adjust the turbidity at 630 nm to 150. The resulting bacterial cell suspensions were disrupted using a GEA Niro Soavi benchtop high-pressure homogenizer, PandaPLUS 2000 (100 MPa, 2 cycles).The cell suspension was thoroughly cooled on ice before being subjected to a high-pressure homogenizer, and the resulting disrupted solution was also immediately cooled on ice.

[0181] (2) NMN synthesis from ribose. The NMN synthesis reaction was carried out as follows using the cell lysates of the N-AvH232G and N-AvWT strains obtained in (1). The reaction mixture was 300 ml and heated to 37°C with the raw materials listed in Table 11. The mixture was then stirred at 300 rpm (disk turbine impeller), and 7.7 mmol of magnesium oxide (MgO) was added as a pH maintainer to adjust the pH to 7.5-8.0. The reaction was then initiated by adding 3.2 wt% of each cell lysate obtained in (1). Sodium polyphosphate (as a 25% aqueous solution) was added in 1.5 mmol increments at 2, 4, and 6 hours after the start of the reaction. Sodium metaphosphate (Fujifilm Wako Pure Chemical Industries, Ltd.) was used, assuming a molecular weight of 1388 g / mol. During the reaction, MgO powder was added as a pH maintaining agent in 8 to 10 portions so that the cumulative amount added reached the value shown in Table 11, thereby maintaining the pH of the reaction solution at 7.4 to 8.9.

[0182] (3) Analysis of NMN The NMN synthesis reaction solution was analyzed by HPLC under the following conditions: Column: InertSustain AQ-C18 (5 μm, 150 × 4.6 mm I.D., GL Sciences Inc.) Mobile phase: 50 mM potassium phosphate buffer, pH 7.5 Flow rate: 1.5 mL / min Detection: UV 261 nm Column temperature: 40°C

[0183] (4) Experimental Results Figure 9 shows the relative NMN concentrations after 9 hours of reaction using cell lysates derived from the N-AvH232G strain and cell lysates derived from the N-AvWT strain. The NMN concentration after 9 hours of reaction using cell lysates derived from the N-AvH232G strain was confirmed to be 5% higher (condition 3) than when cell lysates derived from the N-AvWT strain were used (condition 1). Furthermore, when sodium phosphate was added, the NMN concentration increased by 15% when cell lysates derived from the N-AvH232G strain were used (condition 4). On the other hand, when cell lysates derived from the N-AvWT strain were used, the addition of phosphate increased the NMN concentration by 3%, but this was not as significant an improvement as observed with cell lysates derived from the N-AvH232G strain (condition 2). In other words, it was shown that the use of Nampt autophosphorylation residue mutants improved the NMN accumulation concentration compared to when wild-type Nampt was used, and that the coexistence of phosphate ions in the reaction system further improved the NMN accumulation concentration.

[0184]

[0185] Example 9 (1) NMN Synthesis from Ribose The NMN synthesis reaction was carried out as follows using the cell lysate from the N-AvH232G strain obtained in Example 8 (1). The reaction mixture was 300 ml and heated to 37°C with the raw materials listed in Table 12. The mixture was then stirred at 300 rpm (disk turbine impeller), and 7.7 mmol of magnesium oxide (MgO) was added as a pH maintainer to adjust the pH to 7.5-8.0. The reaction was then initiated by adding 3.2 wt% of the cell lysate obtained in Example 8 (1). Sodium polyphosphate (as a 25% aqueous solution) was added in 1.5 mmol increments at 2, 4, and 6 hours after the start of the reaction. Sodium metaphosphate (Fujifilm Wako Pure Chemical Industries, Ltd.) was used, with an assumed molecular weight of 1388 g / mol. During the reaction, MgO powder was added in 8 to 10 portions as a pH maintaining agent so that the cumulative amount added reached the value shown in Table 12, thereby maintaining the pH of the reaction solution at 7.4 to 8.9. The resulting reaction solution was analyzed by the method described in (3) of [Example 8].

[0186] (2) Experimental Results Figure 10 shows the relative NMN accumulation concentration at 9 hours after reaction using cell lysate derived from the N-AvH232G strain, when phosphate concentrations were varied from 0 to 100 mM. An increase of up to 8% in the accumulation concentration was confirmed in the presence of 30 mM phosphate (Condition 3). Furthermore, it was confirmed that the NMN accumulation concentration increased depending on the phosphate concentration (Conditions 1 to 3). This confirms that adding phosphate to the reaction system improves the NMN accumulation concentration in NMN synthesis reactions using cell lysate derived from the N-AvH232G strain, i.e., the AvNampt autophosphorylation residue Gly mutant. On the other hand, adding 100 mM phosphate reduced the NMN accumulation concentration by 4% (Condition 4), suggesting that there is an appropriate range for the amount of phosphate added.

[0187]

[0188] The present invention is useful in the industrial production of nicotinamide mononucleotide.

[0189] All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety.

[0190] Sequence Listing Synthetic Construct: VpNampt_H238A-F: GCAAGAGAAGCTAGCACCACCACGATTTAT (SEQ ID NO: 44) VpNampt_H238A-R: GGTGGTGCTAGCTTCTCTTGCCGGGATGCT (SEQ ID NO: 45) VpNampt_H238C-F: GCAAGAGAATGCAGCACCACCACGATTTAT (SEQ ID NO: 46) VpNampt_H238C-R: GGTGGTGCTGCATTCTCTTGCCGGGATGCT (SEQ ID NO: 47) VpNampt_H238D-F: GCAAGAGAAAGACAGCACCACCACGATTTAT (SEQ ID NO: 48) VpNampt_H238D-R: GGTGGTGCTGTCTTCTCTTGCCGGGATGCT (SEQ ID NO: 49) VpNampt_H238E-F: GCAAGAGAAGAAAGCACCACCACGATTTAT (SEQ ID NO: 50) VpNampt_H238E-R: GGTGGTGCTTTCTTCTCTTGCCGGGATGCT (SEQ ID NO: 51) VpNampt_H238F-F: GCAAGAGAATTTCAGCACCACCACGATTTAT (SEQ ID NO: 52) VpNampt_H238F-R: GGTGGTGCTGAATTCTCTTGCCGGGATGCT (SEQ ID NO: 53) VpNampt_H238G-F: GCAAGAGAAGGTAGCACCACCACGATTTAT (SEQ ID NO: 54) VpNampt_H238G-R: GGTGGTGCACCTTCTCTTGCCGGGATGCT (SEQ ID NO: 55) VpNampt_H238I-F: GCAAGAGAAATCAGCACCACCACGATTTAT (SEQ ID NO: 56) VpNampt_H238I-R: GGTGGTGCTGATTTCTCTTGCCGGGATGCT (SEQ ID NO: 57) VpNampt_H238K-F: GCAAGAGAAAAAAGCACCACCACGATTTAT (SEQ ID NO: 58) VpNampt_H238K-R: GGTGGTGCTTTTTTCTCTTGCCGGGATGCT (SEQ ID NO: 59) VpNampt_H238L-F: GCAAGAGAACTGAGCACCACCACGATTTAT (SEQ ID NO: 60)VpNampt_H238L-R: GGTGGTGCTCAGTTCTCTTGCCGGGATGCT (SEQ ID NO: 61) VpNampt_H238M-F: GCAAGAGAAATGAGCACCACCACGATTTAT (SEQ ID NO: 62) VpNampt_H238M-R: GGTGGTGCTCATTTCTCTTGCCGGGATGCT (SEQ ID NO: 63) VpNampt_H238N-F: GCAAGAGAAAACAGCACCACCACGATTTAT (SEQ ID NO: 64) VpNampt_H238N-R: GGTGGTGCTGTTTTCTCTTGCCGGGATGCT (SEQ ID NO: 65) VpNampt_H238P-F: GCAAGAGAACCGAGCACCACCACGATTTAT (SEQ ID NO: 66) VpNampt_H238P-R: GGTGGTGCTCGGTTCTCTTGCCGGGATGCT (SEQ ID NO: 67) VpNampt_H238Q-F: GCAAGAGAACAGAGCACCACCACGATTTAT (SEQ ID NO: 68) VpNampt_H238Q-R: GGTGGTGCTCTGTTCTCTTGCCGGGATGCT (SEQ ID NO: 69) VpNampt_H238R-F: GCAAGAGAACGTAGCACCACCACGATTTAT (SEQ ID NO: 70) VpNampt_H238R-R: GGTGGTGCTACGTTCTCTTGCCGGGATGCT (SEQ ID NO: 71) VpNampt_H238S-F: GCAAGAGAATCTAGCACCACCACGATTTAT (SEQ ID NO: 72) VpNampt_H238S-R: GGTGGTGCTAGATTCTCTTGCCGGGATGCT (SEQ ID NO: 73) VpNampt_H238T-F: GCAAGAGAAACCAGCACCACCACGATTTAT (SEQ ID NO: 74) VpNampt_H238T-R: GGTGGTGCTGGTTTCTCTTGCCGGGATGCT (SEQ ID NO: 75) VpNampt_H238V-F: GCAAGAGAAGTTAGCACCACCACGATTTAT (SEQ ID NO: 76) VpNampt_H238V-R: GGTGGTGCTAACTTCTCTTGCCGGGATGCT (SEQ ID NO: 77) VpNampt_H238W-F: GCAAGAGAATGGAGCACCACCACGATTTAT(SEQ ID NO: 78) VpNampt_H238W-R: GGTGGTGCTCCATTCTCTTGCCGGGATGCT (SEQ ID NO: 79) VpNampt_H238Y-F: GCAAGAGGAATACAGCACCACCACGATTTAT (SEQ ID NO: 80) VpNampt_H238Y-R: GGTGGTGCTGTATTCTCTTGCCGGGATGCT (SEQ ID NO: 81) XtNampt_H229G-F: GCGGCCGAAGGTAGCACCATCACCTCCTGG (SEQ ID NO: 82) XtNampt_H229G-R: GATGGTGCTACCTTCGGCCGCTGGAATGCT (SEQ ID NO: 83) AvNampt_H232G-F: GCTGCAGAAGGTAGCACCATTACGTCTTGG (SEQ ID NO: 84) AvNampt_H232G-R: AATGGTGCTACCTTCTGCAGCCGGAATCGA (SEQ ID NO: 85) AvNampt_H232T-F: GCTGCAGAAACCAGCACCATTACGTCTTGG (SEQ ID NO: 86) AvNampt_H232T-R: AATGGTGCTGTTTCTGCAGCCGGAATCGA (SEQ ID NO: 87) AvNampt_H232A-F: GCTGCAGAAGCGAGCACCATTACGTCTTGG (SEQ ID NO: 88) AvNampt_H232A-R: AATGGTGCTGCTCGCTTCTGCAGCCGGAATCGA (SEQ ID NO: 89) AvNampt_H232M-F: GCTGCAGAAATGAGCACCATTACGTCTTGG (SEQ ID NO: 90) AvNampt_H232M-R: AATGGTGCTCATTTCTGCAGCCGGAATCGA (SEQ ID NO: 91) AvNampt_H232N-F: GCTGCAGAAAACAGCACCATTACGTCTTGG (SEQ ID NO: 92) AvNampt_H232N-R: AATGGTGCTGTTTCTGCAGCCGGAATCGA (SEQ ID NO: 93) AvNampt_H232Q-F: GCTGCAGAACAGAGCACCATTACGTCTTGG (SEQ ID NO: 94) AvNampt_H232Q-R: AATGGTGCTCTTGTTCTGCAGCCGGAATCGA (SEQ ID NO: 95)CfNampt_H227G-F: GCCGCAGAGGGTAGCACCATTACTAGTTGG (SEQ ID NO: 96) CfNampt_H227G-R: AATGGTGCTACCCTCTGCGGCAGGAATACT (SEQ ID NO: 97) CfNampt_H227T-F: GCCGCAGAGACCAGCACCATTACTAGTTGG (SEQ ID NO: 98) CfNampt_H227T-R: AATGGTGCTGGTCTCTGCGGCAGGAATACT (SEQ ID NO: 99) CfNampt_H227A-F: GCCGCAGAGGCGAGCACCATTACTAGTTGG (SEQ ID NO: 100) CfNampt_H227A-R: AATGGTGCTCGCCTCTGCGGCAGGAATACT (SEQ ID NO: 101) CfNampt_H227M-F: GCCGCAGAGATGAGCACCATTACTAGTTGG (SEQ ID NO: 102) CfNampt_H227M-R: AATGGTGCTCATCTCTGCGGCAGGAATACT (SEQ ID NO: 103) CfNampt_H227N-F: GCCGCAGAGAACAGCACCATTACTAGTTGG (SEQ ID NO: 104) CfNampt_H227N-R: AATGGTGCTGTTCTCTGCGGCAGGAATACT (SEQ ID NO: 105) CfNampt_H227Q-F: GCCGCAGAGCAGAGCACCATTACTAGTTGG (SEQ ID NO: 106) CfNampt_H227Q-R: AATGGTGCTCTGCTCTGCGGCAGGAATACT (SEQ ID NO: 107) SsNampt_H229G-F: GCGGCCGAGGGTAGCACCATCACTTCGTGG (SEQ ID NO: 108) SsNampt_H229G-R: GATGGTGCTACCCTCGGCCGCGGGGATAGA (SEQ ID NO: 109) T7-PP: TAATACGACTCACTATAGGG (SEQ ID NO: 110) T7-TP: GCTAGTTATTGCTCAGCGG (SEQ ID NO: 111)

Claims

1. A modified Nampt comprising the amino acid sequence of nicotinamide phosphoribosyltransferase (Nampt) shown in SEQ ID NO: 1 below, in which H (histidine) in the sequence is replaced with another amino acid, and the Nampt is not of human origin: SEQ ID NO: 1: S-[V / I]-PA-[A / T / S / R]-EHS-[T / V / I]-[M / V / I / T]-[T / C / S] (where [ ] represents any one of the amino acids within [ ]).

2. The modified Nampt of claim 1, wherein the Nampt is derived from a prokaryote or a bacteriophage.

3. The modified Nampt according to claim 1, wherein the other amino acid is any one selected from the group consisting of glycine, alanine, threonine, phenylalanine, methionine and asparagine.

4. The modified Nampt according to claim 1, wherein the wild-type sequence of the modified Nampt has the amino acid sequence (1) or (2) below: (1) an amino acid sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, and 42; (2) an amino acid sequence which has 90% or more identity with the amino acid sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, and 42 and encodes a protein having Nampt activity.

5. The modified Nampt described in claim 1, wherein, when the amino acid sequence of the modified Nampt is aligned with the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence shown in SEQ ID NO: 1 is located at positions corresponding to positions 232 to 242 of SEQ ID NO:

2.

6. The modified Nampt according to claim 1, wherein the modified Nampt is derived from a prokaryote selected from the genera Vibrio, Xanthomonas, Aquimonas, Caulobacter, Stenotrophomonas, Haemophilus, Meiothermus, Sphingopyxis, Chitinophaga, Luteibacter, Bisgaardia, Deinococcus, Synechocystis, Shewanella, Oenococcus, Burkholderia, Pedobacter, Microbulbifer, and Labrenzia, or a bacteriophage that uses such a prokaryote as a host.

7. A method for producing nicotinamide mononucleotide, comprising contacting phosphoribosyl pyrophosphate and nicotinamide in the presence of the modified Nampt according to any one of claims 1 to 6.

8. The method of claim 7, wherein phosphoribosyl pyrophosphate is produced from ribose-5-phosphate in the presence of phosphoribosyl pyrophosphate synthase (Prs).

9. The method of claim 8, wherein the ribose-5-phosphate is produced from ribose in the presence of ribokinase (Rbk).

10. A method for producing nicotinamide mononucleotide, comprising contacting ribose, nicotinamide, and ATP in the presence of ribokinase, phosphoribosyl pyrophosphate synthase, and the modified Nampt of any one of claims 1 to 6.

Images