Oligonucleotide for inducing site-specific editing of target adenosine
Oligonucleotides with specific sequences recruit ADAR enzymes for site-specific adenosine editing in RNA, addressing the limitations of existing techniques by enabling precise and temporary genetic modifications in targeted RNAs, particularly those of GUCY2D, ABCA4, USH2A, and IL2 genes, enhancing medical and drug discovery applications.
Patent Information
- Application Number
- PCT/JP2025/012335
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-29
- Filing Date
- 2025-03-27
- Publication Date
- 2025-10-02
AI Technical Summary
Existing RNA modification techniques lack the ability to perform site-specific editing of adenosines in a targeted and controlled manner, particularly in specific cell types, limiting their applicability and effectiveness in medical and drug discovery applications.
The development of oligonucleotides comprising specific sequences and structures that can recruit ADAR1 or ADAR2 enzymes to target adenosines in RNA, enabling site-specific editing through complementary base pairing and nucleotide modifications such as deoxyinosine or deoxyuridine, specifically designed for various RNA transcripts including those of GUCY2D, ABCA4, USH2A, and IL2 genes.
These oligonucleotides enable precise and temporary genetic modifications by inducing site-specific editing of adenosines in target RNAs, allowing for controlled and targeted RNA editing with potential therapeutic applications.
Smart Images

Figure JP2025012335_02102025_PF_FP_ABST
Abstract
Description
Oligonucleotides that induce site-specific editing of target adenosines
[0001] The present invention relates to oligonucleotides that induce site-specific editing of a target adenosine contained in a target RNA.
[0002] With the development of genome editing technology, methods for controlling life phenomena by modifying genetic information, the blueprint of living organisms, i.e., DNA information within cells, are beginning to be used in the fields of medicine and drug discovery as a disease treatment approach. Because DNA is a constant and unchanging molecule within cells, the effects of DNA modification remain permanently in the target cell or target organism. On the other hand, RNA is a transient genetic information molecule. Therefore, modification of RNA information can impart a temporary, non-permanent genetic information modification effect to the target organism.
[0003] As an RNA modification technique, for example, Patent Document 1 describes an oligonucleotide construct for site-specific editing of nucleotides in a target RNA sequence, which includes a targeting portion containing an antisense sequence complementary to a portion of the target RNA and a recruitment portion capable of binding to and recruiting an RNA editing entity present in cells and capable of editing nucleotides. Furthermore, for example, Patent Document 2 describes a site-specific RNA mutagenesis method in which double-strand-specific adenosine deaminase (ADAR) acts on a complex between a target RNA and a target-editing guide RNA. Furthermore, Non-Patent Document 1 describes the introduction of a modified nucleic acid into an antisense oligonucleotide that recruits ADAR.
[0004] As adenosine deaminases having RNA editing activity, ADAR1 and ADAR2 isoforms are known, and these are thought to be expressed in a cell type-specific manner in vivo. For example, ADAR1 is thought to be barely expressed in human skeletal muscle cells. On the other hand, ADAR2 is thought to be barely expressed in human bone marrow cells. In addition, ADAR1 is generally thought to be more highly expressed in human cells.
[0005] International Publication No. 2016 / 097212 Pamphlet International Publication No. 2017 / 010556 Pamphlet
[0006] Nature Biotechnology 37, 133-138 (2019)
[0007] An object of the present invention is to provide an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0008] The present invention provides the following:
[0009] [Aspect 1A-1] (See Claim 1 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 3, 4, 5, 6, 7, 15, or 16 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides. [Aspect 1A-2] The oligonucleotide according to Aspect 1A-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR1. [Aspect 1A-3] The oligonucleotide according to Aspect 1A-1, wherein the target RNA is all or part of a transcription product of the GUCY2D gene. [Aspect 1A-4] The oligonucleotide according to Aspect 1A-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 1A-5] The oligonucleotide according to Aspect 1A-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0010] [Aspect 1B-1] (See Claim 2 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 4, 5, 6, 7, 15, or 16 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 21 or 22 nucleotides. [Aspect 1B-2] The oligonucleotide according to Aspect 1B-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR1. [Aspect 1B-3] The oligonucleotide according to Aspect 1B-1, wherein the target RNA is all or part of a transcription product of the GUCY2D gene. [Aspect 1B-4] The oligonucleotide according to Aspect 1B-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 1B-5] The oligonucleotide according to Aspect 1B-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0011] [Aspect 1C-1] (See Claim 3 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 3, 4, 5, or 6 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 19 or 20 nucleotides. [Aspect 1C-2] The oligonucleotide according to Aspect 1C-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR1. [Aspect 1C-3] The oligonucleotide according to Aspect 1C-1, wherein the target RNA is all or part of a transcription product of the GUCY2D gene. [Aspect 1C-4] The oligonucleotide according to Aspect 1C-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 1C-5] The oligonucleotide according to Aspect 1C-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0012] [Aspect 1D-1] (See Claim 4 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 4, 5, or 6 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 17 or 18 nucleotides. [Aspect 1D-2] The oligonucleotide according to Aspect 1D-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR1. [Aspect 1D-3] The oligonucleotide according to Aspect 1D-1, wherein the target RNA is all or part of a transcription product of the GUCY2D gene. [Aspect 1D-4] The oligonucleotide according to Aspect 1D-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 1D-5] The oligonucleotide according to Aspect 1D-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0013] [Aspect 2A-1] (See Claim 5 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 3, 4, 5, 6, 13, 14, or 15 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides. [Aspect 2A-2] The oligonucleotide according to Aspect 2A-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR2. [Aspect 2A-3] The oligonucleotide according to Aspect 2A-1, wherein the target RNA is all or part of a transcription product of the GUCY2D gene. [Aspect 2A-4] The oligonucleotide according to Aspect 2A-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 2A-5] The oligonucleotide according to Aspect 2A-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0014] [Aspect 2B-1] (See Claim 6 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 3, 4, 5, 6, 13, 14, or 15 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 21 or 22 nucleotides. [Aspect 2B-2] The oligonucleotide according to Aspect 2B-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR2. [Aspect 2B-3] The oligonucleotide according to Aspect 2B-1, wherein the target RNA is all or part of a transcription product of the GUCY2D gene. [Aspect 2B-4] The oligonucleotide according to Aspect 2B-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 2B-5] The oligonucleotide according to Aspect 2B-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0015] [Aspect 2C-1] (See Claim 7 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 3, 4, 5, 6, 10, 13, or 14 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 19 or 20 nucleotides. [Aspect 2C-2] The oligonucleotide according to Aspect 2C-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR2. [Aspect 2C-3] The oligonucleotide according to Aspect 2C-1, wherein the target RNA is all or part of a transcription product of the GUCY2D gene. [Aspect 2C-4] The oligonucleotide according to Aspect 2C-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 2C-5] The oligonucleotide according to Aspect 2C-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0016] [Aspect 2D-1] (See Claim 8 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 3, 4, or 5 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 17 or 18 nucleotides. [Aspect 2D-2] The oligonucleotide according to Aspect 2D-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR2. [Aspect 2D-3] The oligonucleotide according to Aspect 2D-1, wherein the target RNA is all or part of a transcription product of the GUCY2D gene. [Aspect 2D-4] The oligonucleotide according to Aspect 2D-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 2D-5] The oligonucleotide according to Aspect 2D-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0017] [Aspect 3-1] (See Claim 9 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 8, 9, 10, 11, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides. [Aspect 3-2] The oligonucleotide according to Aspect 3-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR1. [Aspect 3-3] The oligonucleotide according to Aspect 3-1, wherein the target RNA is all or part of a transcription product of the ABCA4 gene. [Aspect 3-4] The oligonucleotide according to Aspect 3-1, wherein the target RNA has a nucleoside mutation called c.6320G>A. [Aspect 3-5] The oligonucleotide according to Aspect 3-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0018] [Aspect 4-1] (See Claim 10 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 5, 13, 14, 16, 17, or 18 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides. [Aspect 4-2] The oligonucleotide according to Aspect 4-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR2. [Aspect 4-3] The oligonucleotide according to Aspect 4-1, wherein the target RNA is all or part of a transcription product of the ABCA4 gene. [Aspect 4-4] The oligonucleotide according to Aspect 4-1, wherein the target RNA has a nucleoside mutation called c.6320G>A. [Aspect 4-5] The oligonucleotide according to Aspect 4-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is used to induce site-specific editing of a target adenosine contained in a target RNA.
[0019] [Aspect 5-1] (See Claim 11 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 7, 8, 9, 14, 15, 16, 17, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides. [Aspect 5-2] The oligonucleotide according to Aspect 5-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR1. [Aspect 5-3] The oligonucleotide according to Aspect 5-1, wherein the target RNA is all or part of a transcription product of the USH2A gene. [Aspect 5-4] The oligonucleotide according to Aspect 5-1, wherein the target RNA has a nucleoside mutation called c.10073G>A. [Aspect 5-5] The oligonucleotide according to Aspect 5-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0020] [Aspect 6-1] (See Claim 12 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 1, 2, 13, 14, 15, 16, 17, or 18 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides. [Aspect 6-2] The oligonucleotide according to Aspect 6-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR2. [Aspect 6-3] The oligonucleotide according to Aspect 6-1, wherein the target RNA is all or part of a transcription product of the USH2A gene. [Aspect 6-4] The oligonucleotide according to Aspect 6-1, wherein the target RNA has a nucleoside mutation called c.10073G>A. [Aspect 6-5] The oligonucleotide according to Aspect 6-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0021] [Aspect 7-1] (See Claim 13 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is an oligonucleotide consisting of 23 or 24 nucleotides. [Aspect 7-2] The oligonucleotide according to Aspect 7-1, wherein site-specific editing of a target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 7-3] The oligonucleotide according to Aspect 7-1, wherein the target RNA is all or a part of a transcription product of the IL2 gene. [Aspect 7-4] The oligonucleotide according to Aspect 7-1, wherein the target RNA is mutated to N88D by editing of the target adenosine at c.322. [Aspect 7-5] The oligonucleotide according to Aspect 7-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA.
[0022] [Aspect 8-1] (See Claim 14 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, or 18 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is an oligonucleotide consisting of 23 or 24 nucleotides. [Aspect 8-2] The oligonucleotide according to Aspect 8-1, wherein site-specific editing of a target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 8-3] The oligonucleotide according to Aspect 8-1, wherein the target RNA is all or a part of a transcription product of the IL2 gene. [Aspect 8-4] The oligonucleotide according to Aspect 8-1, wherein the target RNA is mutated to N88D by editing of the target adenosine at c.322. [Aspect 8-5] The oligonucleotide according to Aspect 8-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA.
[0023] [Aspect 9-1] (See Claim 15 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 18, 17, 16, 15, 14, 13, 12, 11, 10, or 9 nucleotides. [Aspect 9-2] The oligonucleotide according to Aspect 9-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 9-3] The oligonucleotide according to Aspect 9-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 9-4] The oligonucleotide according to Aspect 9-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 9-5] The oligonucleotide according to Aspect 9-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 9-6] The oligonucleotide according to Aspect 9-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is deoxyinosine, deoxyuridine, or DNA. [Aspect 9-7] The oligonucleotide according to Aspect 9-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0024] [Aspect 10-1] (See Claim 16 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 18, 17, 16, 15, 14, 13, 12, 11, 10, or 9 nucleotides. [Aspect 10-2] The oligonucleotide according to Aspect 10-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 10-3] The oligonucleotide according to Aspect 10-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 10-4] The oligonucleotide according to Aspect 10-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 10-5] The oligonucleotide according to Aspect 10-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 10-6] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is the oligonucleotide according to Aspect 10-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA.[Aspect 10-7] The oligonucleotide according to Aspect 10-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0025] [Aspect 11-1] (See Claim 17 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide comprising 13, 12, 11, or 10 nucleotides. [Aspect 11-2] The oligonucleotide according to Aspect 11-1, wherein the first oligonucleotide comprises 10, 9, or 8 nucleotides. [Aspect 11-3] The oligonucleotide according to Aspect 11-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 11-4] The oligonucleotide according to Aspect 11-1, wherein the target RNA is all or a part of a transcription product of the ABCA4 gene. [Aspect 11-5] The oligonucleotide according to Aspect 11-1, wherein the target RNA has a nucleoside mutation called c.6320G>A. [Aspect 11-6] The oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA is the oligonucleotide according to Aspect 11-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 11-7] The oligonucleotide according to Aspect 11-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0026] [Aspect 12-1] (See Claim 18 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide comprising 6, 5, or 4 nucleotides. [Aspect 12-2] The oligonucleotide according to Aspect 12-1, wherein the first oligonucleotide comprises 17, 16, 15, 14, or 13 nucleotides. [Aspect 12-3] The oligonucleotide according to Aspect 12-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 12-4] The oligonucleotide according to Aspect 12-1, wherein the target RNA is all or a part of a transcription product of the USH2A gene. [Aspect 12-5] The oligonucleotide according to Aspect 12-1, wherein the target RNA has a nucleoside mutation called c.10073G>A. [Aspect 12-6] The oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA is the oligonucleotide according to Aspect 12-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 12-7] The oligonucleotide according to Aspect 12-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0027] [Aspect 13-1] (See Claim 19 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has an LNA at a nucleotide that is -5, -4, -3, -2, -1, +2, +4, +5, +6, +7, +8, +10, +11, +12, +13, +15, +16, or +17 of the target-corresponding nucleotide, wherein in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m. [Aspect 13-2] The oligonucleotide according to Aspect 13-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 13-3] The oligonucleotide according to Aspect 13-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 13-4] The oligonucleotide according to Aspect 13-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 13-5] The oligonucleotide according to Aspect 13-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 13-6] The oligonucleotide according to Aspect 13-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 13-7] The oligonucleotide according to Aspect 13-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 13-8] The oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA is the oligonucleotide according to Aspect 13-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 13-9] The oligonucleotide according to Aspect 13-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 13-10] The oligonucleotide according to Aspect 13, wherein all or some of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, except for the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide, have a 2'-O-methyl modification.[Aspect 13-11] The oligonucleotide according to Aspect 13, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0028] [Aspect 14-1] (See Claim 20 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-F modification at a nucleotide that is -3, -2, -1, +2, +3, +4, +5, +6, +9, +11, +13, +14, +15, or +17 of the target-corresponding nucleotide, wherein in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m. [Aspect 14-2] The oligonucleotide according to Aspect 14-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 14-3] The oligonucleotide according to Aspect 14-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 14-4] The oligonucleotide according to Aspect 14-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 14-5] The oligonucleotide according to Aspect 14-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 14-6] The oligonucleotide according to Aspect 14-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 14-7] The oligonucleotide according to Aspect 14-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 14-8] The oligonucleotide according to Aspect 14-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, in the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA. [Aspect 14-9] The oligonucleotide according to Aspect 14-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 14-10] The oligonucleotide according to Aspect 14, wherein, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, all or some of the nucleotides other than the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide have 2'-O-methyl modifications. [Aspect 14-11] The oligonucleotide according to Aspect 14, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0029] [Aspect 15-1] (See Claim 21 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a methylphosphonate bond at an internucleoside position of -4, -2, -1, 0, +1, +2, +3, +4, +11, +12, or +13, Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n. [Aspect 15-2] The oligonucleotide according to Aspect 15-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 15-3] The oligonucleotide according to Aspect 15-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 15-4] The oligonucleotide according to Aspect 15-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 15-5] The oligonucleotide according to Aspect 15-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 15-6] The oligonucleotide according to Aspect 15-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 15-7] The oligonucleotide according to Aspect 15-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 15-8] The oligonucleotide according to Aspect 15-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is used to induce site-specific editing of the target adenosine contained in the target RNA. [Aspect 15-9] The oligonucleotide according to Aspect 15-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 15-10] The oligonucleotide according to Aspect 15, wherein all or some of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, except for the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide, have a 2'-O-methyl modification.[Aspect 15-11] The oligonucleotide according to Aspect 15, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0030] [Aspect 16-1] (See Claim 22 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has an ethyl phosphate bond at an internucleoside position of -5, -1, 0, +1, +2, +3, +4, +10, +13, +14, or +16, Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n. [Aspect 16-2] The oligonucleotide according to Aspect 16-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 16-3] The oligonucleotide according to Aspect 16-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 16-4] The oligonucleotide according to Aspect 16-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 16-5] The oligonucleotide according to Aspect 16-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 16-6] The oligonucleotide according to Aspect 16-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 16-7] The oligonucleotide according to Aspect 16-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 16-8] The oligonucleotide according to Aspect 16-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, in the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA. [Aspect 16-9] The oligonucleotide according to Aspect 16-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 16-10] The oligonucleotide according to Aspect 16, wherein all or some of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, except for the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide, have a 2'-O-methyl modification.[Aspect 16-11] The oligonucleotide according to Aspect 16, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0031] [Aspect 17-1] (See Claim 23 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-F modification at the -1 nucleotide of the target-corresponding nucleotide or is DNA, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is designated as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is designated as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is designated as -m. [Aspect 17-2] The oligonucleotide according to Aspect 17-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 17-3] The oligonucleotide according to Aspect 17-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 17-4] The oligonucleotide according to Aspect 17-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 17-5] The oligonucleotide according to Aspect 17-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 17-6] The oligonucleotide according to Aspect 17-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 17-7] The oligonucleotide according to Aspect 17-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 17-8] The oligonucleotide according to Aspect 17-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, in the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA. [Aspect 17-9] The oligonucleotide according to Aspect 17-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 17-10] The oligonucleotide according to Aspect 17, wherein, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, all or some of the nucleotides other than the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide have 2'-O-methyl modifications. [Aspect 17-11] The oligonucleotide according to Aspect 17, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0032] [Aspect 18-1] (See Claim 24 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has an LNA at a nucleotide that is -4, -3, -2, -1, +2, +3, +4, +5, +6, +8, +11, +12, +13, +15, +16, or +18 of the target-corresponding nucleotide, wherein in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m. [Aspect 18-2] The oligonucleotide according to Aspect 18-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 18-3] The oligonucleotide according to Aspect 18-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 18-4] The oligonucleotide according to Aspect 18-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 18-5] The oligonucleotide according to Aspect 18-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 18-6] The oligonucleotide according to Aspect 18-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 18-7] The oligonucleotide according to Aspect 18-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 18-8] The oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA is the oligonucleotide according to Aspect 18-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 18-9] The oligonucleotide according to Aspect 18-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 18-10] The oligonucleotide according to Aspect 18, wherein, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, all or some of the nucleotides other than the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide have 2'-O-methyl modifications. [Aspect 18-11] The oligonucleotide according to Aspect 18, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0033] [Aspect 19-1] (See Claim 25 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-F modification at a nucleotide that is -4, -3, -2, -1, +2, +3, +4, +5, +6, +8, +9, +10, +11, +12, +17, or +18 of the target-corresponding nucleotide, wherein in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m. [Aspect 19-2] The oligonucleotide according to Aspect 19-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 19-3] The oligonucleotide according to Aspect 19-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 19-4] The oligonucleotide according to Aspect 19-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 19-5] The oligonucleotide according to Aspect 19-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 19-6] The oligonucleotide according to Aspect 19-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 19-7] The oligonucleotide according to Aspect 19-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 19-8] The oligonucleotide according to Aspect 19-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, in the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA. [Aspect 19-9] The oligonucleotide according to Aspect 19-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 19-10] The oligonucleotide according to Aspect 19, wherein, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, all or some of the nucleotides other than the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide have 2'-O-methyl modifications. [Aspect 19-11] The oligonucleotide according to Aspect 19, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0034] [Aspect 20-1] (See Claim 26 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a methylphosphonate bond at an internucleoside position of -5, -4, -3, -2, -1, 0, +1, +2, +3, +4, +7, +8, +9, +10, +11, or +15; Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n. [Aspect 20-2] The oligonucleotide according to Aspect 20-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 20-3] The oligonucleotide according to Aspect 20-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 20-4] The oligonucleotide according to Aspect 20-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 20-5] The oligonucleotide according to Aspect 20-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 20-6] The oligonucleotide according to Aspect 20-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 20-7] The oligonucleotide according to Aspect 20-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 20-8] The oligonucleotide according to Aspect 20-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is used to induce site-specific editing of the target adenosine contained in the target RNA. [Aspect 20-9] The oligonucleotide according to Aspect 20-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 20-10] The oligonucleotide according to Aspect 20, wherein all or some of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, except for the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide, have a 2'-O-methyl modification.[Aspect 20-11] The oligonucleotide according to Aspect 20, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0035] [Aspect 21-1] (See Claim 27 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has an ethyl phosphate bond at an internucleoside position of -5, -4, -3, -2, +1, 0, +2, +3, +4, +5, +6, +8, +9, +10, +11, +13, +14, +15, or +17; Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n. [Aspect 21-2] The oligonucleotide according to Aspect 21-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 21-3] The oligonucleotide according to Aspect 21-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 21-4] The oligonucleotide according to Aspect 21-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 21-5] The oligonucleotide according to Aspect 21-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 21-6] The oligonucleotide according to Aspect 21-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 21-7] The oligonucleotide according to Aspect 21-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 21-8] The oligonucleotide according to Aspect 21-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, that induces site-specific editing of the target adenosine contained in the target RNA. [Aspect 21-9] The oligonucleotide according to Aspect 21-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 21-10] The oligonucleotide according to Aspect 21, wherein all or some of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, except for the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide, have a 2'-O-methyl modification.[Aspect 21-11] The oligonucleotide according to Aspect 21, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0036] [Aspect 22-1] (See Claim 28 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-F modification at the -1 nucleotide of the target-corresponding nucleotide or is DNA, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is designated as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is designated as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is designated as -m. [Aspect 22-2] The oligonucleotide according to Aspect 22-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 22-3] The oligonucleotide according to Aspect 22-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 22-4] The oligonucleotide according to Aspect 22-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 22-5] The oligonucleotide according to Aspect 22-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 22-6] The oligonucleotide according to Aspect 22-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 22-7] The oligonucleotide according to Aspect 22-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 22-8] The oligonucleotide according to Aspect 22-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, that induces site-specific editing of the target adenosine contained in the target RNA. [Aspect 22-9] The oligonucleotide according to Aspect 22-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 22-10] The oligonucleotide according to Aspect 22, wherein, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, all or some of the nucleotides other than the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide have 2'-O-methyl modifications. [Aspect 22-11] The oligonucleotide according to Aspect 22, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0037] [Aspects 13+14+18+19-1] (See Claim 29 as originally filed) An oligonucleotide for inducing site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide for inducing site-specific editing of a target adenosine contained in the target RNA comprises: a nucleotide at -3, +4, +5, or +6 of the target-corresponding nucleotide having a 2'-O-methyl modification; wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is designated as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is designated as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is designated as -m. [Aspect 13+14+18+19-2] The oligonucleotide according to Aspect 13+14+18+19-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 13+14+18+19-3] The oligonucleotide according to Aspect 13+14+18+19-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 13+14+18+19-4] The oligonucleotide according to Aspect 13+14+18+19-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 13+14+18+19-5] The oligonucleotide according to Aspect 13+14+18+19-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1 or ADAR2. [Aspect 13+14+18+19-6] The oligonucleotide according to Aspect 13+14+18+19-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 13+14+18+19-7] The oligonucleotide according to Aspect 13+14+18+19-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 13+14+18+19-8] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is the oligonucleotide according to Aspect 13+14+18+19-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 13+14+18+19-9] The oligonucleotide according to Aspect 13+14+18+19-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.[Aspect 13+14+18+19-10] The oligonucleotide according to Aspect 13+14+18+19, wherein, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, all or some of the nucleotides other than the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide have a 2'-O-methyl modification. [Aspect 13+14+18+19-11] The oligonucleotide according to Aspect 13+14+18+19, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0038] [Aspect 15+16+20+21-1] (See Claim 30 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a phosphorothioate bond at a site where the internucleoside bond is 0, +2, or +3, Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n. [Aspect 15+16+20+21-2] The oligonucleotide according to Aspect 15+16+20+21-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 15+16+20+21-3] The oligonucleotide according to Aspect 15+16+20+21-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 15+16+20+21-4] The oligonucleotide according to Aspect 15+16+20+21-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 15+16+20+21-5] The oligonucleotide according to Aspect 15+16+20+21-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1 or ADAR2. [Aspect 15+16+20+21-6] The oligonucleotide according to Aspect 15+16+20+21-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 15+16+20+21-7] The oligonucleotide according to Aspect 15+16+20+21-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 15+16+20+21-8] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is the oligonucleotide according to Aspect 15+16+20+21-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 15+16+20+21-9] The oligonucleotide according to Aspect 15+16+20+21-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.[Aspect 15+16+20+21-10] The oligonucleotide according to Aspect 15+16+20+21, wherein, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, all or some of the nucleotides other than the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide have a 2'-O-methyl modification. [Aspect 15+16+20+21-11] The oligonucleotide according to Aspect 15+16+20+21, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0039] [Aspect 23-1] (See Claim 31 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, In the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the nucleotide that is -2 of the target-corresponding nucleotide is LNA, the nucleotide that is +3 of the target-corresponding nucleotide has a 2'-F modification, the internucleoside site that is +4 is a methylphosphonate bond, or the nucleotide that is -1 of the target-corresponding nucleotide is DNA, wherein in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m,Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n. [Aspect 23-2] The oligonucleotide according to Aspect 23-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 23-3] The oligonucleotide according to Aspect 23-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 23-4] The oligonucleotide according to Aspect 23-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 23-5] The oligonucleotide according to Aspect 23-1, wherein the site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1.[Aspect 23-6] The oligonucleotide according to Aspect 23-1, wherein the target RNA is all or part of a transcription product of the ABCA4 gene. [Aspect 23-7] The oligonucleotide according to Aspect 23-1, wherein the target RNA has a nucleoside mutation called c.6320G>A. [Aspect 23-8] The oligonucleotide according to Aspect 23-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is deoxyinosine, deoxyuridine, or DNA. [Aspect 23-9] The oligonucleotide according to Aspect 23-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 23-10] The oligonucleotide according to Aspect 23, wherein all or part of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, except for the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide, have a 2'-O-methyl modification. [Aspect 23-11] The oligonucleotide according to Aspect 23, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0040] [Aspect 24-1] (See Claim 32 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is such that the nucleotide that is -2 to the target-corresponding nucleotide is an LNA, or the nucleotide that is +2 to the target-corresponding nucleotide has a 2'-F modification, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is designated as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is designated as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is designated as -m. [Aspect 24-2] The oligonucleotide according to Aspect 24-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 24-3] The oligonucleotide according to Aspect 24-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 24-4] The oligonucleotide according to Aspect 24-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 24-5] The oligonucleotide according to Aspect 24-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 24-6] The oligonucleotide according to Aspect 24-1, wherein the target RNA is all or a part of a transcription product of the ABCA4 gene. [Aspect 24-7] The oligonucleotide according to Aspect 24-1, wherein the target RNA has a nucleoside mutation called c.6320G>A. [Aspect 24-8] The oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA is the oligonucleotide according to Aspect 24-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 24-9] The oligonucleotide according to Aspect 24-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 24-10] The oligonucleotide according to Aspect 24, wherein, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, all or some of the nucleotides other than the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide have 2'-O-methyl modifications. [Aspect 24-11] The oligonucleotide according to Aspect 24, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0041] [Aspect 25-1] (See Claim 33 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, In the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the nucleotide that is -2 of the target-corresponding nucleotide is LNA, the nucleotide that is +3 of the target-corresponding nucleotide has a 2'-F modification, the internucleoside site that is +4 is a methylphosphonate bond, or the nucleotide that is -1 of the target-corresponding nucleotide is DNA, wherein in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m,Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n. [Aspect 25-2] The oligonucleotide according to Aspect 25-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 25-3] The oligonucleotide according to Aspect 25-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 25-4] The oligonucleotide according to Aspect 25-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 25-5] The oligonucleotide according to Aspect 25-1, wherein the site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1.[Aspect 25-6] The oligonucleotide according to Aspect 25-1, wherein the target RNA is all or a part of a transcription product of the USH2A gene. [Aspect 25-7] The oligonucleotide according to Aspect 25-1, wherein the target RNA has a nucleoside mutation called c.10073G>A. [Aspect 25-8] The oligonucleotide according to Aspect 25-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is deoxyinosine, deoxyuridine, or DNA. [Aspect 25-9] The oligonucleotide according to Aspect 25-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 25-10] The oligonucleotide according to Aspect 25, wherein all or a part of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, except for the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide, have a 2'-O-methyl modification. [Aspect 25-11] The oligonucleotide according to Aspect 25, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0042] [Aspect 26-1] (See Claim 34 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has an LNA as the nucleotide that is -2 of the target-corresponding nucleotide, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is designated as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is designated as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is designated as -m. [Aspect 26-2] The oligonucleotide according to Aspect 26-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 26-3] The oligonucleotide according to Aspect 26-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 26-4] The oligonucleotide according to Aspect 26-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 26-5] The oligonucleotide according to Aspect 26-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 26-6] The oligonucleotide according to Aspect 26-1, wherein the target RNA is all or a part of a transcription product of the USH2A gene. [Aspect 26-7] The oligonucleotide according to Aspect 26-1, wherein the target RNA has a nucleoside mutation called c.10073G>A. [Aspect 26-8] The oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA is the oligonucleotide according to Aspect 26-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 26-9] The oligonucleotide according to Aspect 26-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 26-10] The oligonucleotide according to Aspect 26, wherein, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, all or some of the nucleotides other than the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide have 2'-O-methyl modifications. [Aspect 26-11] The oligonucleotide according to Aspect 26, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0043] [Aspect 27-1] (See Claim 35 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the target-corresponding nucleotide is DNA or has a 2'-O-methyl modification, the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA comprises: an LNA at a nucleotide -2 of the target-corresponding nucleotide; wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is designated as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is designated as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is designated as -m. [Aspect 27-2] The oligonucleotide according to Aspect 27-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 27-3] The oligonucleotide according to Aspect 27-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 27-4] The oligonucleotide according to Aspect 27-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 27-5] The oligonucleotide according to Aspect 27-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR1 or ADAR2. [Aspect 27-6] The oligonucleotide according to Aspect 27-1, wherein the target RNA is all or part of a transcription product of the GUCY2D gene. [Aspect 27-7] The oligonucleotide according to Aspect 27-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 27-8] The oligonucleotide according to Aspect 27-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is deoxyinosine, deoxyuridine, or DNA. [Aspect 27-9] The oligonucleotide according to Aspect 27, wherein all or part of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, except for the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide, have a 2'-O-methyl modification. [Aspect 27-10] The oligonucleotide according to Aspect 27, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0044] [Aspect 28-1] (See Claim 36 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, In the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the nucleotide that is −2 of the target-corresponding nucleotide has a 2'-F modification, the site where the internucleoside is −1 is a methylphosphonate bond, the site where the internucleoside is +1 is an ethyl phosphate bond, or the site where the internucleoside is −4 is a methylphosphonate bond, wherein in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counted in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counted in the 5' direction from the target-corresponding nucleotide is referred to as −m,Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n. [Aspect 28-2] The oligonucleotide according to Aspect 28-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 28-3] The oligonucleotide according to Aspect 28-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 28-4] The oligonucleotide according to Aspect 28-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 28-5] The oligonucleotide according to Aspect 28-1, wherein the site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1.[Aspect 28-6] The oligonucleotide according to Aspect 28-1, wherein the target RNA is all or part of a transcription product of the ABCA4 gene. [Aspect 28-7] The oligonucleotide according to Aspect 28-1, wherein the target RNA has a nucleoside mutation called c.6320G>A. [Aspect 28-8] The oligonucleotide according to Aspect 28-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is deoxyinosine, deoxyuridine, or DNA. [Aspect 28-9] The oligonucleotide according to Aspect 28-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 28-10] The oligonucleotide according to Aspect 28-1, wherein all or part of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, except for the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide, have a 2'-O-methyl modification. [Aspect 28-11] The oligonucleotide according to Aspect 28, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0045] [Aspect 29-1] (See Claim 37 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, In the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the nucleotide that is -2 of the target-corresponding nucleotide has a 2'-F modification, the site where the internucleoside is -1 is a methylphosphonate bond, the site where the internucleoside is +1 is an ethyl phosphate bond, the site where the internucleoside is -3 is a methylphosphonate bond, the nucleotide that is -1 of the target-corresponding nucleotide is DNA, or the nucleotide that is +3 of the target-corresponding nucleotide has a 2'-F modification; wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m;Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n. [Aspect 29-2] The oligonucleotide according to Aspect 29-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 29-3] The oligonucleotide according to Aspect 29-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 29-4] The oligonucleotide according to Aspect 29-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 29-5] The oligonucleotide according to Aspect 29-1, wherein the site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2.[Aspect 29-6] The oligonucleotide according to Aspect 29-1, wherein the target RNA is all or part of a transcription product of the ABCA4 gene. [Aspect 29-7] The oligonucleotide according to Aspect 29-1, wherein the target RNA has a nucleoside mutation called c.6320G>A. [Aspect 29-8] The oligonucleotide according to Aspect 29-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is deoxyinosine, deoxyuridine, or DNA. [Aspect 29-9] The oligonucleotide according to Aspect 24-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 29-10] The oligonucleotide according to Aspect 29-1, wherein all or part of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, except for the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide, have a 2'-O-methyl modification. [Aspect 29-11] The oligonucleotide according to Aspect 29-1, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0046] [Aspect 30-1] (See Claim 38 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-F modification at the -2 nucleotide of the target-corresponding nucleotide, a phosphate ethyl bond at the +1 internucleoside position, or a methylphosphonate bond at the -4 internucleoside position, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counted in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counted in the 5' direction from the target-corresponding nucleotide is referred to as -m; Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n.[Aspect 30-2] The oligonucleotide according to Aspect 30-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 30-3] The oligonucleotide according to Aspect 30-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 30-4] The oligonucleotide according to Aspect 30-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 30-5] The oligonucleotide according to Aspect 30-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 30-6] The oligonucleotide according to Aspect 30-1, wherein the target RNA is all or a part of a transcription product of the USH2A gene. [Aspect 30-7] The oligonucleotide according to Aspect 30-1, wherein the target RNA has a nucleoside mutation called c.10073G>A. [Aspect 30-8] The oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA is the oligonucleotide according to Aspect 30-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 30-9] The oligonucleotide according to Aspect 30-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.[Aspect 30-10] The oligonucleotide according to Aspect 30-1, wherein, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, all or some of the nucleotides other than the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide have 2'-O-methyl modifications. [Aspect 30-11] The oligonucleotide according to Aspect 30-1, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0047] [Aspect 31-1] (See Claim 39 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, In the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the nucleotide that is −2 of the target-corresponding nucleotide has a 2'-F modification, the site where the internucleoside is −1 is a methylphosphonate bond, the site where the internucleoside is +1 is a phosphate ethyl bond, the site where the internucleoside is −3 is a methylphosphonate bond, the site where the internucleoside is −4 is a methylphosphonate bond, the site where the internucleoside is −5 is a methylphosphonate bond, or the nucleotide that is −1 of the target-corresponding nucleotide is DNA; wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as −m;Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n. [Aspect 31-2] The oligonucleotide according to Aspect 31-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 31-3] The oligonucleotide according to Aspect 31-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 31-4] The oligonucleotide according to Aspect 31-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 31-5] The oligonucleotide according to Aspect 31-1, wherein the site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2.[Aspect 31-6] The oligonucleotide according to Aspect 31-1, wherein the target RNA is all or a part of a transcription product of the USH2A gene. [Aspect 31-7] The oligonucleotide according to Aspect 31-1, wherein the target RNA has a nucleoside mutation called c.10073G>A. [Aspect 31-8] The oligonucleotide according to Aspect 31-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is deoxyinosine, deoxyuridine, or DNA. [Aspect 31-9] The oligonucleotide according to Aspect 31-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 31-10] The oligonucleotide according to Aspect 31-1, wherein all or a part of the nucleotides contained in the oligonucleotide that induce site-specific editing of a target adenosine contained in the target RNA, except for the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide, have a 2'-O-methyl modification. [Aspect 31-11] The oligonucleotide according to Aspect 31-1, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0048] [Aspect 32-1] (See Claim 40 as originally filed) An oligonucleotide for inducing site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide for inducing site-specific editing of a target adenosine contained in the target RNA has a 2'-F modification at the nucleotide that is -2 of the target-corresponding nucleotide, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is designated as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is designated as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is designated as -m. [Aspect 32-2] The oligonucleotide according to Aspect 32-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 32-3] The oligonucleotide according to Aspect 32-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 32-4] The oligonucleotide according to Aspect 32-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 32-5] The oligonucleotide according to Aspect 32-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 32-6] The oligonucleotide according to Aspect 32-1, wherein the target RNA is all or a part of the transcription product of the IL2 gene. [Aspect 32-7] The oligonucleotide according to Aspect 32-1, wherein the target RNA is mutated to N88D by editing the target adenosine at c.322. [Aspect 32-8] The oligonucleotide according to Aspect 32-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, in the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA. [Aspect 32-9] The oligonucleotide according to Aspect 32-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 32-10] The oligonucleotide according to Aspect 32-1, wherein, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, all or some of the nucleotides other than the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide have 2'-O-methyl modifications. [Aspect 32-11] The oligonucleotide according to Aspect 32-1, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0049] [Aspect 33-1] (See Claim 41 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-MOE modification at the nucleotide that is -4, -3, +5, +13, +14, or +15 of the target-corresponding nucleotide, a 2'-MOE modification at the nucleotide that is -5, +4, +6, +7, +9, +10, +11, +12, or +16 of the target-corresponding nucleotide, or a 2'-MOE modification at the nucleotide that is +2 or +3 of the target-corresponding nucleotide, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m. [Aspect 33-2] The oligonucleotide according to Aspect 33-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 33-3] The oligonucleotide according to Aspect 33-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 33-4] The oligonucleotide according to Aspect 33-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 33-5] The oligonucleotide according to Aspect 33-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 33-6] The oligonucleotide according to Aspect 33-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 33-7] The oligonucleotide according to Aspect 33-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 33-8] The oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA is the oligonucleotide according to Aspect 33-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 33-9] The oligonucleotide according to Aspect 33-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 33-10] The oligonucleotide according to Aspect 33-1, wherein all or some of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, except for the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide, have a 2'-O-methyl modification.[Aspect 33-11] The oligonucleotide according to Aspect 33-1, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0050] [Aspect 34-1] (See Claim 42 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-MOE modification at the nucleotide that is -4, -1, +8, or +11 relative to the target-corresponding nucleotide, a 2'-MOE modification at the nucleotide that is -3, -2, or +4 relative to the target-corresponding nucleotide, or a 2'-MOE modification at the nucleotide that is +2, +3, or +5 relative to the target-corresponding nucleotide, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m. [Aspect 34-2] The oligonucleotide according to Aspect 34-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.[Aspect 34-3] The oligonucleotide according to Aspect 34-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 34-4] The oligonucleotide according to Aspect 34-1, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. [Aspect 34-5] The oligonucleotide according to Aspect 34-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 34-6] The oligonucleotide according to Aspect 34-1, wherein the target RNA is all or a part of a transcription product of the GUCY2D gene. [Aspect 34-7] The oligonucleotide according to Aspect 34-1, wherein the target RNA has a nucleoside mutation called c.2513G>A. [Aspect 34-8] The oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA is the oligonucleotide according to Aspect 34-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 34-9] The oligonucleotide according to Aspect 34-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification. [Aspect 34-10] The oligonucleotide according to Aspect 34-1, wherein all or some of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, except for the first nucleotide counting in the 3' direction from the 5' end of the second oligonucleotide, have a 2'-O-methyl modification.[Aspect 34-11] The oligonucleotide according to Aspect 34-1, wherein all or some of the internucleoside bonds in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA are phosphorothioate bonds.
[0051] [Aspect 35-1] (See Claim 43 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 10, 14, 15, 16, or 17 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides. [Aspect 35-2] The oligonucleotide according to Aspect 35-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR1. [Aspect 35-3] The oligonucleotide according to Aspect 35-1, wherein the target RNA is all or a part of a transcription product of the ABCA4 gene. [Aspect 35-4] The oligonucleotide according to Aspect 35-1, wherein the target RNA has a nucleoside mutation called c.5882G>A. [Aspect 35-5] The oligonucleotide according to Aspect 35-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0052] [Aspect 36-1] (See Claim 44 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 13, 14, 15, or 16 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides. [Aspect 36-2] The oligonucleotide according to Aspect 36-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR2. [Aspect 36-3] The oligonucleotide according to Aspect 36-1, wherein the target RNA is all or a part of a transcription product of the ABCA4 gene. [Aspect 36-4] The oligonucleotide according to Aspect 36-1, wherein the target RNA has a nucleoside mutation called c.5882G>A. [Aspect 36-5] The oligonucleotide according to Aspect 36-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0053] [Aspect 37-1] (See Claim 45 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 8, 9, 10, 11, 12, 13, 15, 16, 17, or 18 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA comprising 23 or 24 nucleotides. [Aspect 37-2] The oligonucleotide according to Aspect 37-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 37-3] The oligonucleotide according to Aspect 37-1, wherein the target RNA is all or a part of a transcription product of the EYS gene. [Aspect 37-4] The oligonucleotide according to Aspect 37-1, wherein the target RNA has a nucleoside mutation called c.2528G>A. [Aspect 37-5] The oligonucleotide according to Aspect 37-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA.
[0054] [Aspect 38-1] (See Claim 46 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 10, 11, 12, 13, or 14 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides. [Aspect 38-2] The oligonucleotide according to Aspect 38-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 38-3] The oligonucleotide according to Aspect 38-1, wherein the target RNA is all or a part of a transcription product of the EYS gene. [Aspect 38-4] The oligonucleotide according to Aspect 38-1, wherein the target RNA has a nucleoside mutation called c.2528G>A. [Aspect 38-5] The oligonucleotide according to Aspect 38-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA.
[0055] [Aspect 39-1] (See Claim 47 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 5, 6, 7, 8, 9, 10, 11, 12, 16, 17, 18, 19, or 20 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is an oligonucleotide consisting of 23 or 24 nucleotides. [Aspect 39-2] The oligonucleotide according to Aspect 39-1, wherein site-specific editing of a target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 39-3] The oligonucleotide according to Aspect 39-1, wherein the target RNA is all or a part of a transcription product of the IL2 gene. [Aspect 39-4] The oligonucleotide according to Aspect 39-1, wherein the target RNA is mutated to N88S by editing the target adenosine at c.323. [Aspect 39-5] The oligonucleotide according to Aspect 39-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA.
[0056] [Aspect 40-1] (See Claim 48 as originally filed) An oligonucleotide for inducing site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 6, 7, 8, 9, 10, 11, 14, 15, 16, 17, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is an oligonucleotide consisting of 23 or 24 nucleotides. [Aspect 40-2] The oligonucleotide according to Aspect 40-1, wherein site-specific editing of a target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 40-3] The oligonucleotide according to Aspect 40-1, wherein the target RNA is all or a part of a transcription product of the IL2 gene. [Aspect 40-4] The oligonucleotide according to Aspect 40-1, wherein the target RNA is mutated to H16R by editing of the target adenosine at c.107. [Aspect 40-5] The oligonucleotide according to Aspect 40-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA.
[0057] [Aspect 41-1] (See Claim 49 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 6, 8, 11, 14, 15, 16, 17, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides. [Aspect 41-2] The oligonucleotide according to Aspect 41-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR1. [Aspect 41-3] The oligonucleotide according to Aspect 41-1, wherein the target RNA is all or a part of a transcription product of the p53 gene. [Aspect 41-4] The oligonucleotide according to Aspect 41-1, wherein the target RNA has a nucleoside mutation called c.524G>A. [Aspect 41-5] The oligonucleotide according to Aspect 41-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0058] [Aspect 42-1] (See Claim 50 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 8, 9, 10, 15, 16, 17, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides. [Aspect 42-2] The oligonucleotide according to Aspect 42-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR1. [Aspect 42-3] The oligonucleotide according to Aspect 42-1, wherein the target RNA is all or a part of a transcription product of the p53 gene. [Aspect 42-4] The oligonucleotide according to Aspect 42-1, wherein the target RNA has a nucleoside mutation called c.743G>A. [Aspect 42-5] The oligonucleotide according to Aspect 42-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0059] [Aspect 43-1] (See Claim 51 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 5, 6, 7, 14, 15, 17, 18, 19, or 20 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides. [Aspect 43-2] The oligonucleotide according to Aspect 43-1, wherein site-specific editing of a target adenosine contained in a target RNA is mediated by ADAR1. [Aspect 43-3] The oligonucleotide according to Aspect 43-1, wherein the target RNA is all or a part of a transcription product of the p53 gene. [Aspect 43-4] The oligonucleotide according to Aspect 43-1, wherein the target RNA has a nucleoside mutation called c.818G>A. [Aspect 43-5] The oligonucleotide according to Aspect 43-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA, is an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA.
[0060] [Aspect 44-1] (See Claim 52 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 17 or 16 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA. [Aspect 44-2] The oligonucleotide according to Aspect 44-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 44-3] The oligonucleotide according to Aspect 44-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 44-4] The oligonucleotide according to Aspect 44-1, wherein the target RNA is all or a part of the transcription product of the ABCA4 gene. [Aspect 44-5] The oligonucleotide according to Aspect 44-1, wherein the target RNA has a nucleoside mutation called c.6320G>A. [Aspect 44-6] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is the oligonucleotide according to Aspect 44-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 44-7] The oligonucleotide according to Aspect 44-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0061] [Aspect 45-1] (See Claim 53 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 17 or 16 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA. [Aspect 45-2] The oligonucleotide according to Aspect 45-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 45-2-2] The oligonucleotide according to Aspect 45-1, wherein the second oligonucleotide consists of 9 or 8 nucleotides. [Aspect 45-3] The oligonucleotide according to Aspect 45-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 45-4] The oligonucleotide according to Aspect 45-1, wherein the target RNA is all or a part of a transcription product of the USH2A gene. [Aspect 45-5] The oligonucleotide according to Aspect 45-1, wherein the target RNA has a nucleoside mutation called c.10073G>A. [Aspect 45-6] The oligonucleotide according to Aspect 45-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is deoxyinosine, deoxyuridine, or DNA.[Aspect 45-7] The oligonucleotide according to Aspect 45-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0062] [Aspect 46-1] (See Claim 54 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 nucleotides. [Aspect 46-2] The oligonucleotide according to Aspect 46-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 46-2-2] The oligonucleotide according to Aspect 46-1, wherein the first oligonucleotide consists of 9, 8, 7, 6, 5, or 4 nucleotides. [Aspect 46-3] The oligonucleotide according to Aspect 46-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 46-4] The oligonucleotide according to Aspect 46-1, wherein the target RNA is all or a part of a transcription product of the IL2 gene. [Embodiment 46-5] The oligonucleotide according to embodiment 46-1, wherein the target RNA is mutated to N88D by editing the target adenosine at c.322.[Aspect 46-6] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is the oligonucleotide according to Aspect 46-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 46-7] The oligonucleotide according to Aspect 46-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0063] [Aspect 47-1] (See Claim 55 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 9 or 8 nucleotides. [Aspect 47-2] The oligonucleotide according to Aspect 47-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 47-2-2] The oligonucleotide according to Aspect 47-1, wherein the first oligonucleotide consists of 14 or 13 nucleotides. [Aspect 47-3] The oligonucleotide according to Aspect 47-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 47-4] The oligonucleotide according to Aspect 47-1, wherein the target RNA is all or a part of a transcription product of the IL2 gene. [Aspect 47-5] The oligonucleotide according to Aspect 47-1, wherein the target RNA is mutated to N88D by editing the target adenosine at c.322. [Aspect 47-6] The oligonucleotide according to Aspect 47-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide in the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA is deoxyinosine, deoxyuridine, or DNA.[Aspect 47-7] The oligonucleotide according to Aspect 47-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0064] [Aspect 48-1] (See Claim 56 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 13, 12, 11, 10, 9, 8, 7, or 6 nucleotides. [Aspect 48-2] The oligonucleotide according to Aspect 48-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 48-3] The oligonucleotide according to Aspect 48-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 48-4] The oligonucleotide according to Aspect 48-1, wherein the target RNA is all or a part of the transcription product of the ABCA4 gene. [Aspect 48-5] The oligonucleotide according to Aspect 48-1, wherein the target RNA has a nucleoside mutation called c.5882G>A. [Aspect 48-6] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is the oligonucleotide according to Aspect 48-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 48-7] The oligonucleotide according to Aspect 48-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0065] [Aspect 49-1] (See Claim 57 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 10, 9, 8, or 7 nucleotides. [Aspect 49-2] The oligonucleotide according to Aspect 49-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 49-3] The oligonucleotide according to Aspect 49-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 49-4] The oligonucleotide according to Aspect 49-1, wherein the target RNA is all or a part of the transcription product of the ABCA4 gene. [Aspect 49-5] The oligonucleotide according to Aspect 49-1, wherein the target RNA has a nucleoside mutation called c.5882G>A. [Aspect 49-6] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is the oligonucleotide according to Aspect 49-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 49-7] The oligonucleotide according to Aspect 49-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0066] [Aspect 50-1] (See Claim 58 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 14, 13, 12, 11, 10, or 9 nucleotides. [Aspect 50-2] The oligonucleotide according to Aspect 50-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 50-3] The oligonucleotide according to Aspect 50-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 50-4] The oligonucleotide according to Aspect 50-1, wherein the target RNA is all or a part of the transcription product of the EYS gene. [Aspect 50-5] The oligonucleotide according to Aspect 50-1, wherein the target RNA has a nucleoside mutation called c.2528G>A. [Aspect 50-6] The oligonucleotide according to Aspect 50-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is deoxyinosine, deoxyuridine, or DNA. [Aspect 50-7] The oligonucleotide according to Aspect 50-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0067] [Aspect 51-1] (See Claim 59 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 10 or 9 nucleotides. [Aspect 51-2] The oligonucleotide according to Aspect 51-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 51-3] The oligonucleotide according to Aspect 51-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2. [Aspect 51-4] The oligonucleotide according to Aspect 51-1, wherein the target RNA is all or a part of the transcription product of the EYS gene. [Aspect 51-5] The oligonucleotide according to Aspect 51-1, wherein the target RNA has a nucleoside mutation called c.2528G>A. [Aspect 51-6] The oligonucleotide according to Aspect 51-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is deoxyinosine, deoxyuridine, or DNA. [Aspect 51-7] The oligonucleotide according to Aspect 51-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0068] [Aspect 52-1] (See Claim 60 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 17, 16, 15, 14, 13, 12, 11, 10, 9, or 8 nucleotides. [Aspect 52-2] The oligonucleotide according to Aspect 52-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 52-2-2] The oligonucleotide according to Aspect 52-1, wherein the first oligonucleotide consists of 6, 5, or 4 nucleotides. [Aspect 52-3] The oligonucleotide according to Aspect 52-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 52-4] The oligonucleotide according to Aspect 52-1, wherein the target RNA is all or a part of a transcription product of the IL2 gene. [Embodiment 52-5] The oligonucleotide according to embodiment 52-1, wherein the target RNA is mutated to N88S by editing the target adenosine at c.323.[Aspect 52-6] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is the oligonucleotide according to Aspect 52-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 52-7] The oligonucleotide according to Aspect 52-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0069] [Aspect 53-1] (See Claim 61 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 12, 9, 8, 7, 6, 5, or 4 nucleotides. [Aspect 53-2] The oligonucleotide according to Aspect 53-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 53-2-2] The oligonucleotide according to Aspect 53-1, wherein the first oligonucleotide consists of 10, 9, 8, 7, 6, or 5 nucleotides. [Aspect 53-3] The oligonucleotide according to Aspect 53-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 53-4] The oligonucleotide according to Aspect 53-1, wherein the target RNA is all or a part of a transcription product of the IL2 gene. [Aspect 53-5] The oligonucleotide according to Aspect 53-1, wherein the target RNA is mutated to H16R by editing the target adenosine at c.107.[Aspect 53-6] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is the oligonucleotide according to Aspect 53-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 53-7] The oligonucleotide according to Aspect 53-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0070] [Aspect 54-1] (See Claim 62 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 18, 17, 16, 15, 14, 13, 12, 11, 10, or 9 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA. [Aspect 54-2] The oligonucleotide according to Aspect 54-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 54-2-2] The oligonucleotide according to Aspect 54-1, wherein the second oligonucleotide consists of 5 or 4 nucleotides. [Aspect 54-3] The oligonucleotide according to Aspect 54-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 54-4] The oligonucleotide according to Aspect 54-1, wherein the target RNA is all or a part of a transcription product of the p53 gene. [Aspect 54-5] The oligonucleotide according to Aspect 54-1, wherein the target RNA has a nucleoside mutation called c.524G>A.[Aspect 54-6] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is the oligonucleotide according to Aspect 54-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 54-7] The oligonucleotide according to Aspect 54-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0071] [Aspect 55-1] (See Claim 63 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 nucleotides. [Aspect 55-2] The oligonucleotide according to Aspect 55-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 55-2-2] The oligonucleotide according to Aspect 55-1, wherein the first oligonucleotide consists of 9, 8, 7, or 6 nucleotides. [Aspect 55-3] The oligonucleotide according to Aspect 55-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 55-4] The oligonucleotide according to Aspect 55-1, wherein the target RNA is all or a part of a transcription product of the p53 gene. [Aspect 55-5] The oligonucleotide according to Aspect 55-1, wherein the target RNA has a nucleoside mutation called c.743G>A.[Aspect 55-6] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is the oligonucleotide according to Aspect 55-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 55-7] The oligonucleotide according to Aspect 55-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0072] [Aspect 56-1] (See Claim 64 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 18, 17, 16, 15, 14, 13, or 12 nucleotides. [Aspect 56-2] The oligonucleotide according to Aspect 56-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 56-2-2] The oligonucleotide according to Aspect 56-1, wherein the first oligonucleotide consists of 5, 4, or 3 nucleotides. [Aspect 56-3] The oligonucleotide according to Aspect 56-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 56-4] The oligonucleotide according to Aspect 56-1, wherein the target RNA is all or a part of a transcription product of the p53 gene. [Aspect 56-5] The oligonucleotide according to Aspect 56-1, wherein the target RNA has a nucleoside mutation called c.818G>A. [Aspect 56-6] The oligonucleotide according to Aspect 56-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is deoxyinosine, deoxyuridine, or DNA.[Aspect 56-7] The oligonucleotide according to Aspect 56-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0073] [Aspect 57-1] (See Claim 65 as originally filed) An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the target RNA is all or a part of a transcription product of the ABCA4 gene, EYS gene, GUCY2D gene, IL2 gene, p53 gene, or USH2A gene. [Aspect 57-2] The oligonucleotide according to Aspect 57-1, wherein the first oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 57-3] The oligonucleotide according to Aspect 57-1, wherein the second oligonucleotide consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. [Aspect 57-4] The oligonucleotide according to Aspect 57-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR1. [Aspect 57-4-2] The oligonucleotide according to Aspect 57-1, wherein site-specific editing of the target adenosine contained in the target RNA is mediated by ADAR2.[Aspect 57-5] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA is the oligonucleotide according to Aspect 57-1, wherein the first nucleotide counting in the 3' direction from the target-corresponding nucleotide is deoxyinosine, deoxyuridine, or DNA. [Aspect 57-6] The oligonucleotide according to Aspect 57-1, wherein the target-corresponding nucleotide has a 2'-O-methyl modification.
[0074] [Aspect 58-1] (See claim 66 as originally filed) A pharmaceutical composition comprising the oligonucleotide according to any one of the above as an active ingredient, and used for treating or preventing a disease associated with the target RNA. [Aspect 58-2] (See claim 67 as originally filed) Use of the oligonucleotide according to any one of the above for manufacturing a medicament for treating or preventing a disease associated with the target RNA. [Aspect 58-3] (See claim 68 as originally filed) The oligonucleotide according to any one of the above for use in treating or preventing a disease associated with the target RNA. [Aspect 58-4] (See claim 69 as originally filed) A method for treating or preventing a disease associated with the target RNA in a subject, by administering to the subject a pharmacologically effective amount of the oligonucleotide according to any one of the above.
[0075] According to a specific aspect of the present invention, by identifying the minimum nucleic acid sequence (core sequence) of a guide RNA that exhibits RNA-editing activity, it becomes possible to shorten the guide RNA while maintaining its RNA-editing activity, and superior medicinal efficacy can be expected due to improved intracellular permeability and tissue distribution.
[0076] FIG. 1A is a graph showing the results of Test Example 1 (24mer). FIG. 1B is a graph showing the results of Test Example 1 (22mer). FIG. 1C is a graph showing the results of Test Example 1 (20mer). FIG. 1D is a graph showing the results of Test Example 1 (18mer). FIG. 2A is a graph showing the results of Test Example 2 (24mer). FIG. 2B is a graph showing the results of Test Example 2 (22mer). FIG. 2C is a graph showing the results of Test Example 2 (20mer). FIG. 2D is a graph showing the results of Test Example 2 (18mer). FIG. 3 is a graph showing the results of Test Example 3. FIG. 4 is a graph showing the results of Test Example 4. FIG. 5 is a graph showing the results of Test Example 5. FIG. 6 is a graph showing the results of Test Example 6. FIG. 7 is a graph showing the results of Test Example 7. FIG. 8 is a graph showing the results of Test Example 8. FIG. 9 is a graph showing the results of Test Example 9. FIG. 10 is a graph showing the results of Test Example 10. FIG. 11 is a graph showing the results of Test Example 11. FIG. 12 is a graph showing the results of Test Example 12. FIG. 13 is a graph showing the results of Test Example 13. FIG. 14 is a graph showing the results of Test Example 14. FIG. 15 is a graph showing the results of Test Example 15. FIG. 16 is a graph showing the results of Test Example 16. FIG. 17 is a graph showing the results of Test Example 17. FIG. 18 is a graph showing the results of Test Example 18. FIG. 19 is a graph showing the results of Test Example 19. FIG. 20 is a graph showing the results of Test Example 20. FIG. 21 is a graph showing the results of Test Example 21. FIG. 22 is a graph showing the results of Test Example 22. FIG. 23 is a graph showing the results of Test Example 23. FIG. 24 is a graph showing the results of Test Example 24. FIG. 25 is a graph showing the results of Test Example 25. FIG. 26 is a graph showing the results of Test Example 26. FIG. 27 is a graph showing the results of Test Example 27. FIG. 28 is a graph showing the results of Test Example 28. FIG. 29 is a graph showing the results of Test Example 29. FIG. 30 is a graph showing the results of Test Example 30. FIG. 31 is a graph showing the results of Test Example 31. FIG. 32 is a graph showing the results of Test Example 32. FIG. 33 is a graph showing the results of Test Example 33. FIG. 34 is a graph showing the results of Test Example 34. FIG. 35 is a graph showing the results of Test Example 35. FIG. 36 is a graph showing the results of Test Example 36.FIG. 37 is a graph showing the results of Test Example 37. FIG. 38 is a graph showing the results of Test Example 38. FIG. 39 is a graph showing the results of Test Example 39. FIG. 40 is a graph showing the results of Test Example 40. FIG. 41 is a graph showing the results of Test Example 41. FIG. 42 is a graph showing the results of Test Example 42. FIG. 43 is a graph showing the results of Test Example 43. FIG. 44 is a graph showing the results of Test Example 44. FIG. 45 is a graph showing the results of Test Example 45. FIG. 46 is a graph showing the results of Test Example 46. FIG. 47 is a graph showing the results of Test Example 47. FIG. 48 is a graph showing the results of Test Example 48. FIG. 49 is a graph showing the results of Test Example 49. FIG. 50 is a graph showing the results of Test Example 50. FIG. 51 is a graph showing the results of Test Example 51. FIG. 52 is a graph showing the results of Test Example 52. FIG. 53 is a graph showing the results of Test Example 53. Fig. 54 is a graph showing the results of Test Example 54. Fig. 55 is a graph showing the results of Test Example 55. Fig. 56 is a graph showing the results of Test Example 56. Fig. 57 is a diagram summarizing the results of Test Examples 13 to 22.
[0077] Aspect 1A In Aspect 1A, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 3, 4, 5, 6, 7, 15, or 16 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA comprising 23 or 24 nucleotides.
[0078] Site-specific editing of the target adenosine contained in the target RNA is preferably mediated by ADAR1. Examples of ADAR1 include ADAR1p110 and ADAR1p150.
[0079] The target RNA is preferably all or part of the transcription product of the GUCY2D gene.
[0080] The target RNA preferably has a nucleoside mutation designated c.2513G>A.
[0081] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0082] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0083] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0084] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0085] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0086] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0087] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0088] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0089] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0090] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0091] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0092] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below.(hGU_T_NB_1_1)GCiCUCCCGGAUCAGAUCCUCCAG (hGU_T_NB_1_2)UGCiCUCCCGAUCCUCCA (hGU_T_NB_1_3)GUGCiCUCCCGGAUCAGAUCCUCC (hGU_T_NB_1_4)CGUGCiCUCCCGGAUCAGAUCCUC (hGU_T_NB_1_5)CCGUGCiCUCCCGGAUCAGAUCCU (hGU_T_NB_1_6)UCCGUGCiCUCCCGAUCC (hGU_T_NB_1_7)CUCCGUGCiCUCCCGGAUCAGAUC (hGU_T_NB_1_8)CCUCCGUGCiCUCCCGGAUCAGAU (hGU_T_NB_1_9)UCCUCCGUGCiCUCCCGGAUCAGA (hGU_T_NB_1_10)CUCCUCCGUGCiCUCCCGGAUCAG (hGU_T_NB_1_11)GCUCCUCCGUGCiCUCCCGGAUCA (hGU_T_NB_1_12)AGCUCCUCCGUGCiCUCCCGGAUC (hGU_T_NB_1_13)CAGCUCCUCCGUGCiCUCCCGGAU (hGU_T_NB_1_14)CCAGCUCCUCCGUGCiCUCCCGGA (hGU_T_NB_1_15)UCCAGCUCCUCCGUGCiCUCCCGG (hGU_T_NB_1_16)CUCCAGCUCCUCCGUGCiCUCCCG (hGU_T_NB_1_17)GCUCCAGCUCCUCCGUGCiCUCCC (hGU_T_NB_1_18)AGCUCCAGCUCCUCCGUGCiCUCC (hGU_T_NB_1_19)CAGCUCCAGCUCCUCCGUGCiCUC (hGU_T_NB_1_20)CCAGCUCCCAGCUCCUCCGUGCiCU (hGU_T_NB_1_21)UCCAGCUCCAGCUCCUCCGUGCiC (hGU_T_NB_1_22)UCCAGCUCCCUCCGUGCi。
[0093] Aspect 1B In Aspect 1B-1, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 4, 5, 6, 7, 15, or 16 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA comprising 21 or 22 nucleotides.
[0094] Site-specific editing of a target adenosine contained in a target RNA is preferably performed by ADAR1. Examples of ADAR1 include ADAR1p110 and ADAR1p150.
[0095] The target RNA is preferably all or part of the transcription product of the GUCY2D gene.
[0096] The target RNA preferably has a nucleoside mutation designated c.2513G>A.
[0097] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0098] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0099] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0100] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0101] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0102] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0103] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0104] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0105] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0106] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0107] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0108] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below.(hGU_T_NB_5_1)GCiCUCCCGGAUCAGAUCCUCC (hGU_T_NB_5_2)UGCiCUCCCGGAUCAGAUCCUC (hGU_T_NB_5_3)GUGCiCUCCCGGAUCAGAUCCU (hGU_T_NB_5_4)CGUGCiCUCCCGAUCC (hGU_T_NB_5_5)CCGUGCiCUCCCGGAUCAGAUC (hGU_T_NB_5_6)UCCGUGCiCUCCCGAUCAGAU (hGU_T_NB_5_7)CUCCGUGCiCUCCCGGAUCAGA (hGU_T_NB_5_8)CCUCCGUGCiCUCCCGGAUCAG (hGU_T_NB_5_9)UCCUCCGUGCiCUCCCGGAUCA (hGU_T_NB_5_10)CUCCUCCGUGCiCUCCCGGAUC (hGU_T_NB_5_11)GCUCCUCCGUGCiCUCCCGGAU (hGU_T_NB_5_12)AGCUCCUCCGUGCiCUCCCGGA (hGU_T_NB_5_13)CAGCUCCUCCGUGCiCUCCCGG (hGU_T_NB_5_14)CCAGCUCCUCCGUGCiCUCCCG (hGU_T_NB_5_15)UCCAGCUCCUCCGUGCiCUCCC (hGU_T_NB_5_16)CUCCAGCUCCUCCGUGCiCUCC (hGU_T_NB_5_17)GCUCCAGCUCCUCCGUGCiCUC (hGU_T_NB_5_18)AGCUCCAGCUCCUCCGUGCiCU (hGU_T_NB_5_19)CAGCUCCAGCUCCUCCGUGCiC (hGU_T_NB_5_20)CCAGCUCCCAGCUCCUCCGUGCi。
[0109] Aspect 1C In Aspect 1C, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 3, 4, 5, or 6 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA comprising 19 or 20 nucleotides.
[0110] Site-specific editing of the target adenosine contained in the target RNA is preferably mediated by ADAR1. Examples of ADAR1 include ADAR1p110 and ADAR1p150.
[0111] The target RNA is preferably all or part of the transcription product of the GUCY2D gene.
[0112] The target RNA preferably has a nucleoside mutation designated c.2513G>A.
[0113] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0114] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0115] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0116] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0117] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0118] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0119] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0120] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0121] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0122] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0123] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0124] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below. (hGU_T_NB_6_1) GCiCUCCCGGAUCAGAUCCU (hGU_T_NB_6_2) UGCiCUCCCGGAUCAGAUCC (hGU_T_NB_6_3) GUGCiCUCCCGGAUCAGAUC (hGU_T_NB_6_4) CGUGCiCUCCCGGAUCAGAU (hGU_T_NB_6_5) CCGUGCiCUCCCGGAUCAGA (hGU_T_NB_6_6) UCCGUGCiCUCCCGGAUCAG (hGU_T_NB_6_7)CUCCGUGCiCUCCCGGAUCA (hGU_T_NB_6_8) CCUCCGUGCiCUCCCGGAUC (hGU_T_NB_6_9) UCCUCCGUGCiCUCCCGGAU (hGU_T_NB_6_10) CUCCUCCGUGCiCUCCCGGA (hGU_T_NB_6_11) GCUCCUCCGUGCiCUCCCG (hGU_T_NB_6_12) AGCUCCUCCGUGCiCUCCCG (hGU_T_NB_6_13) CAGCUCCUCCGUGCiCUCC (hGU_T_NB_6_14) CCAGCUCCUCCGUGCiCUCC (hGU_T_NB_6_15) UCCAGCUCCUCCGUGCiCUC (hGU_T_NB_6_16) CUCCAGCUCCUCCGUGCiCU (hGU_T_NB_6_17) GCUCCAGCUCCUCCGUGCiC (hGU_T_NB_6_18) AGCUCCAGCUCCUCCGUGCi
[0125] Aspect 1D In Aspect 1D, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 4, 5, or 6 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA comprising 17 or 18 nucleotides.
[0126] Site-specific editing of the target adenosine contained in the target RNA is preferably mediated by ADAR1. Examples of ADAR1 include ADAR1p110 and ADAR1p150.
[0127] The target RNA is preferably all or part of the transcription product of the GUCY2D gene.
[0128] The target RNA preferably has a nucleoside mutation designated c.2513G>A.
[0129] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0130] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0131] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0132] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0133] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0134] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0135] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0136] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0137] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0138] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0139] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0140] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below. (hGU_T_NB_7_1) GCiCUCCCGGAUCAGAUC (hGU_T_NB_7_2) UGCiCUCCCGGAUCAGAU (hGU_T_NB_7_3) GUGCiCUCCCGGAUCAGA (hGU_T_NB_7_4) CGUGCiCUCCCGGAUCAG (hGU_T_NB_7_5) CCGUGCiCUCCCGGAUCA (hGU_T_NB_7_6) UCCGUGCiCUCCCGGAUC (hGU_T_NB_7_7)CUCCGUGCiCUCCCGGAU (hGU_T_NB_7_8) CCUCCGUGCiCUCCCGGA (hGU_T_NB_7_9) UCCUCCGUGCiCUCCCG (hGU_T_NB_7_10) CUCCUCCGUGCiCUCCCG (hGU_T_NB_7_11) GCUCCUCCGUGCiCUCCC (hGU_T_NB_7_12) AGCUCCUCCGUGCiCUCC (hGU_T_NB_7_13) CAGCUCCUCCGUGCiCUC (hGU_T_NB_7_14) CCAGCUCCUCCGUGCiCU (hGU_T_NB_7_15)UCCAGCUCCUCCGUGCiC (hGU_T_NB_7_16)CUCCAGCUCCUCCGUGCi
[0141] Aspect 2A In Aspect 2A, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 3, 4, 5, 6, 13, 14, or 15 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA comprising 23 or 24 nucleotides.
[0142] Site-specific editing of a target adenosine contained in a target RNA is preferably by ADAR2.
[0143] The target RNA is preferably all or part of the transcription product of the GUCY2D gene.
[0144] The target RNA preferably has a nucleoside mutation designated c.2513G>A.
[0145] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0146] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0147] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0148] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0149] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0150] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0151] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0152] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0153] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0154] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0155] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0156] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below.(hGU_T_NB_1_1)GCiCUCCCGGAUCAGAUCCUCCAG (hGU_T_NB_1_2)UGCiCUCCCGAUCCUCCA (hGU_T_NB_1_3)GUGCiCUCCCGGAUCAGAUCCUCC (hGU_T_NB_1_4)CGUGCiCUCCCGGAUCAGAUCCUC (hGU_T_NB_1_5)CCGUGCiCUCCCGGAUCAGAUCCU (hGU_T_NB_1_6)UCCGUGCiCUCCCGAUCC (hGU_T_NB_1_7)CUCCGUGCiCUCCCGGAUCAGAUC (hGU_T_NB_1_8)CCUCCGUGCiCUCCCGGAUCAGAU (hGU_T_NB_1_9)UCCUCCGUGCiCUCCCGGAUCAGA (hGU_T_NB_1_10)CUCCUCCGUGCiCUCCCGGAUCAG (hGU_T_NB_1_11)GCUCCUCCGUGCiCUCCCGGAUCA (hGU_T_NB_1_12)AGCUCCUCCGUGCiCUCCCGGAUC (hGU_T_NB_1_13)CAGCUCCUCCGUGCiCUCCCGGAU (hGU_T_NB_1_14)CCAGCUCCUCCGUGCiCUCCCGGA (hGU_T_NB_1_15)UCCAGCUCCUCCGUGCiCUCCCGG (hGU_T_NB_1_16)CUCCAGCUCCUCCGUGCiCUCCCG (hGU_T_NB_1_17)GCUCCAGCUCCUCCGUGCiCUCCC (hGU_T_NB_1_18)AGCUCCAGCUCCUCCGUGCiCUCC (hGU_T_NB_1_19)CAGCUCCAGCUCCUCCGUGCiCUC (hGU_T_NB_1_20)CCAGCUCCCAGCUCCUCCGUGCiCU (hGU_T_NB_1_21)UCCAGCUCCAGCUCCUCCGUGCiC (hGU_T_NB_1_22)UCCAGCUCCCUCCGUGCi。
[0157] Aspect 2B In Aspect 2B, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 3, 4, 5, 6, 13, 14, or 15 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA comprising 21 or 22 nucleotides.
[0158] Site-specific editing of a target adenosine contained in a target RNA is preferably by ADAR2.
[0159] The target RNA is preferably all or part of the transcription product of the GUCY2D gene.
[0160] The target RNA preferably has a nucleoside mutation designated c.2513G>A.
[0161] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0162] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0163] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0164] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0165] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0166] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0167] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0168] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0169] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0170] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0171] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0172] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below.(hGU_T_NB_5_1)GCiCUCCCGGAUCAGAUCCUCC (hGU_T_NB_5_2)UGCiCUCCCGGAUCAGAUCCUC (hGU_T_NB_5_3)GUGCiCUCCCGGAUCAGAUCCU (hGU_T_NB_5_4)CGUGCiCUCCCGAUCC (hGU_T_NB_5_5)CCGUGCiCUCCCGGAUCAGAUC (hGU_T_NB_5_6)UCCGUGCiCUCCCGAUCAGAU (hGU_T_NB_5_7)CUCCGUGCiCUCCCGGAUCAGA (hGU_T_NB_5_8)CCUCCGUGCiCUCCCGGAUCAG (hGU_T_NB_5_9)UCCUCCGUGCiCUCCCGGAUCA (hGU_T_NB_5_10)CUCCUCCGUGCiCUCCCGGAUC (hGU_T_NB_5_11)GCUCCUCCGUGCiCUCCCGGAU (hGU_T_NB_5_12)AGCUCCUCCGUGCiCUCCCGGA (hGU_T_NB_5_13)CAGCUCCUCCGUGCiCUCCCGG (hGU_T_NB_5_14)CCAGCUCCUCCGUGCiCUCCCG (hGU_T_NB_5_15)UCCAGCUCCUCCGUGCiCUCCC (hGU_T_NB_5_16)CUCCAGCUCCUCCGUGCiCUCC (hGU_T_NB_5_17)GCUCCAGCUCCUCCGUGCiCUC (hGU_T_NB_5_18)AGCUCCAGCUCCUCCGUGCiCU (hGU_T_NB_5_19)CAGCUCCAGCUCCUCCGUGCiC (hGU_T_NB_5_20)CCAGCUCCCAGCUCCUCCGUGCi。
[0173] Aspect 2C In Aspect 2C, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 3, 4, 5, 6, 10, 13, or 14 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA comprising 19 or 20 nucleotides.
[0174] Site-specific editing of a target adenosine contained in a target RNA is preferably by ADAR2.
[0175] The target RNA is preferably all or part of the transcription product of the GUCY2D gene.
[0176] The target RNA preferably has a nucleoside mutation designated c.2513G>A.
[0177] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0178] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0179] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0180] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0181] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0182] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0183] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0184] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0185] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0186] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0187] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0188] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below. (hGU_T_NB_6_1) GCiCUCCCGGAUCAGAUCCU (hGU_T_NB_6_2) UGCiCUCCCGGAUCAGAUCC (hGU_T_NB_6_3) GUGCiCUCCCGGAUCAGAUC (hGU_T_NB_6_4) CGUGCiCUCCCGGAUCAGAU (hGU_T_NB_6_5) CCGUGCiCUCCCGGAUCAGA (hGU_T_NB_6_6) UCCGUGCiCUCCCGGAUCAG (hGU_T_NB_6_7)CUCCGUGCiCUCCCGGAUCA (hGU_T_NB_6_8) CCUCCGUGCiCUCCCGGAUC (hGU_T_NB_6_9) UCCUCCGUGCiCUCCCGGAU (hGU_T_NB_6_10) CUCCUCCGUGCiCUCCCGGA (hGU_T_NB_6_11) GCUCCUCCGUGCiCUCCCG (hGU_T_NB_6_12) AGCUCCUCCGUGCiCUCCCG (hGU_T_NB_6_13) CAGCUCCUCCGUGCiCUCC (hGU_T_NB_6_14) CCAGCUCCUCCGUGCiCUCC (hGU_T_NB_6_15) UCCAGCUCCUCCGUGCiCUC (hGU_T_NB_6_16) CUCCAGCUCCUCCGUGCiCU (hGU_T_NB_6_17) GCUCCAGCUCCUCCGUGCiC (hGU_T_NB_6_18) AGCUCCAGCUCCUCCGUGCi
[0189] Aspect 2D In Aspect 2D, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 3, 4, or 5 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA comprising 17 or 18 nucleotides.
[0190] Site-specific editing of a target adenosine contained in a target RNA is preferably by ADAR2.
[0191] The target RNA is preferably all or part of the transcription product of the GUCY2D gene.
[0192] The target RNA preferably has a nucleoside mutation designated c.2513G>A.
[0193] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0194] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0195] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0196] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0197] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0198] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0199] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0200] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0201] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0202] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0203] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0204] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below. (hGU_T_NB_7_1) GCiCUCCCGGAUCAGAUC (hGU_T_NB_7_2) UGCiCUCCCGGAUCAGAU (hGU_T_NB_7_3) GUGCiCUCCCGGAUCAGA (hGU_T_NB_7_4) CGUGCiCUCCCGGAUCAG (hGU_T_NB_7_5) CCGUGCiCUCCCGGAUCA (hGU_T_NB_7_6) UCCGUGCiCUCCCGGAUC (hGU_T_NB_7_7)CUCCGUGCiCUCCCGGAU (hGU_T_NB_7_8) CCUCCGUGCiCUCCCGGA (hGU_T_NB_7_9) UCCUCCGUGCiCUCCCG (hGU_T_NB_7_10) CUCCUCCGUGCiCUCCCG (hGU_T_NB_7_11) GCUCCUCCGUGCiCUCCC (hGU_T_NB_7_12) AGCUCCUCCGUGCiCUCC (hGU_T_NB_7_13) CAGCUCCUCCGUGCiCUC (hGU_T_NB_7_14) CCAGCUCCUCCGUGCiCU (hGU_T_NB_7_15)UCCAGCUCCUCCGUGCiC (hGU_T_NB_7_16)CUCCAGCUCCUCCGUGCi
[0205] Aspect 3 In Aspect 3, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 8, 9, 10, 11, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA comprising 23 or 24 nucleotides.
[0206] Site-specific editing of the target adenosine contained in the target RNA is preferably mediated by ADAR1. Examples of ADAR1 include ADAR1p110 and ADAR1p150.
[0207] The target RNA is preferably all or part of the transcription product of the ABCA4 gene.
[0208] The target RNA preferably has a nucleoside mutation designated c.6320G>A.
[0209] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0210] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0211] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0212] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0213] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0214] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0215] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0216] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0217] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0218] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0219] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0220] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below.(hAB_T_NB_1_1)GCiGCGUGCCUGGGGGUCCAUCCC (hAB_T_NB_1_2)UGCiGCGUGCCUGGGGGUCCAUCC (hAB_T_NB_1_3)AUGCiGCGUGCCUGGGGGUCCAUC (hAB_T_NB_1_4)CAUGCiGCGUGCCUGGGGGUCCAU (hAB_T_NB_1_5)GCAUGCiGCGUGCCUGGGGGUCCA (hAB_T_NB_1_6)AGCAUGCiGCGUGCCUGGGGGUCC (hAB_T_NB_1_7)CAGCAUGCiGCGUGCCUGGGGGUC (hAB_T_NB_1_8)ACAGCAUGCiGCGUGCCUGGGGGU (hAB_T_NB_1_9)CACAGCAUGCiGCGUGCCUGGGGG (hAB_T_NB_1_10)CCACAGCAUGCiGCGUGCCUGGGG (hAB_T_NB_1_11)UCCACAGCAUGCiGCGUGCCUGGG (hAB_T_NB_1_12)UUCCACAGCAUGCiGCGUGCCUGG (hAB_T_NB_1_13)GUUCCACAGCAUGCiGCGUGCCUG (hAB_T_NB_1_14)CGUUCCACAGCAUGCiGCGUGCCU (hAB_T_NB_1_15)ACGUUCCACAGCAUGCiGCGUGCC (hAB_T_NB_1_16)GACGUUCCACAGCAUGCiGCGUGC (hAB_T_NB_1_17)UGACGUUCCACAGCAUGCiGCGUG (hAB_T_NB_1_18)AUGACGUUCCACAGCAUGCiGCGU (hAB_T_NB_1_19)GAUGACGUUCCACAGCAUGCiGCG (hAB_T_NB_1_20)CGAUGACGUUCCACAGCAUGCiGC (hAB_T_NB_1_21)ACGAUGACGUUCCACAGCAUGCiG (hAB_T_NB_1_22)CACGAUGACGUUCCACAGCAUGCi。
[0221] Aspect 4 In Aspect 4, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 5, 13, 14, 16, 17, or 18 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA comprising 23 or 24 nucleotides.
[0222] Site-specific editing of a target adenosine contained in a target RNA is preferably by ADAR2.
[0223] The target RNA is preferably all or part of the transcription product of the ABCA4 gene.
[0224] The target RNA preferably has a nucleoside mutation designated c.6320G>A.
[0225] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0226] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0227] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0228] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0229] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0230] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0231] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0232] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0233] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0234] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0235] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0236] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below.(hAB_T_NB_1_1)GCiGCGUGCCUGGGGGUCCAUCCC (hAB_T_NB_1_2)UGCiGCGUGCCUGGGGGUCCAUCC (hAB_T_NB_1_3)AUGCiGCGUGCCUGGGGGUCCAUC (hAB_T_NB_1_4)CAUGCiGCGUGCCUGGGGGUCCAU (hAB_T_NB_1_5)GCAUGCiGCGUGCCUGGGGGUCCA (hAB_T_NB_1_6)AGCAUGCiGCGUGCCUGGGGGUCC (hAB_T_NB_1_7)CAGCAUGCiGCGUGCCUGGGGGUC (hAB_T_NB_1_8)ACAGCAUGCiGCGUGCCUGGGGGU (hAB_T_NB_1_9)CACAGCAUGCiGCGUGCCUGGGGG (hAB_T_NB_1_10)CCACAGCAUGCiGCGUGCCUGGGG (hAB_T_NB_1_11)UCCACAGCAUGCiGCGUGCCUGGG (hAB_T_NB_1_12)UUCCACAGCAUGCiGCGUGCCUGG (hAB_T_NB_1_13)GUUCCACAGCAUGCiGCGUGCCUG (hAB_T_NB_1_14)CGUUCCACAGCAUGCiGCGUGCCU (hAB_T_NB_1_15)ACGUUCCACAGCAUGCiGCGUGCC (hAB_T_NB_1_16)GACGUUCCACAGCAUGCiGCGUGC (hAB_T_NB_1_17)UGACGUUCCACAGCAUGCiGCGUG (hAB_T_NB_1_18)AUGACGUUCCACAGCAUGCiGCGU (hAB_T_NB_1_19)GAUGACGUUCCACAGCAUGCiGCG (hAB_T_NB_1_20)CGAUGACGUUCCACAGCAUGCiGC (hAB_T_NB_1_21)ACGAUGACGUUCCACAGCAUGCiG (hAB_T_NB_1_22)CACGAUGACGUUCCACAGCAUGCi。
[0237] Aspect 5 In Aspect 5, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 7, 8, 9, 14, 15, 16, 17, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA comprising 23 or 24 nucleotides.
[0238] Site-specific editing of the target adenosine contained in the target RNA is preferably mediated by ADAR1. Examples of ADAR1 include ADAR1p110 and ADAR1p150.
[0239] The target RNA is preferably all or part of the transcription product of the USH2A gene.
[0240] The target RNA preferably has a nucleoside mutation designated c.10073G>A.
[0241] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0242] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0243] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0244] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0245] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0246] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0247] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0248] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0249] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0250] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0251] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0252] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below.(hUS_T_NB_1_1)GCaUUUUACUGGCACCGGGUCAUU (hUS_T_NB_1_2)AGCaUUUUACUGGCACCGGGUCAU (hUS_T_NB_1_3)CAGCaUUUUACUGGCACCGGGUCA (hUS_T_NB_1_4)ACAGCaUUUUACUGGCACCGGGUC (hUS_T_NB_1_5)CACAGCaUUUUACUGGCACCGGGU (hUS_T_NB_1_6)UCACAGCaUUUUACUGGCACCGGG (hUS_T_NB_1_7)CUCACAGCaUUUUACUGGCACCGG (hUS_T_NB_1_8)UCUCACAGCaUUUUACUGGCACCG (hUS_T_NB_1_9)GUCUCACAGCaUUUUACUGGCACC (hUS_T_NB_1_10)AGUCUCACAGCaUUUUACUGGCAC (hUS_T_NB_1_11)CAGUCUCACAGCaUUUUACUGGCA (hUS_T_NB_1_12)UCAGUCUCACAGCaUUUUACUGGC (hUS_T_NB_1_13)UUCAGUCUCACAGCaUUUUACUGG (hUS_T_NB_1_14)GUUCAGUCUCACAGCaUUUUACUG (hUS_T_NB_1_15)AGUUCAGUCUCACAGCaUUUUACU (hUS_T_NB_1_16)AAGUUCAGUCUCACAGCaUUUUAC (hUS_T_NB_1_17)UAAGUUCAGUCUCACAGCaUUUUA (hUS_T_NB_1_18)AUAAGUUCAGUCUCACAGCaUUUU (hUS_T_NB_1_19)AAUAAGUUCAGUCUCACAGCaUUU (hUS_T_NB_1_20)GAAUAAGUUCAGUCUCACAGCaUU (hUS_T_NB_1_21)GGAAUAAGUUCAGUCUCACAGCaU (hUS_T_NB_1_22)UGGAAUAAGUUCAGUCUCACAGCa。
[0253] Aspect 6 In Aspect 6, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 1, 2, 13, 14, 15, 16, 17, or 18 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of the target adenosine contained in the target RNA comprising 23 or 24 nucleotides.
[0254] Site-specific editing of a target adenosine contained in a target RNA is preferably by ADAR2.
[0255] The target RNA is preferably all or part of the transcription product of the USH2A gene.
[0256] The target RNA preferably has a nucleoside mutation designated c.10073G>A.
[0257] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0258] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0259] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0260] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0261] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0262] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0263] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0264] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0265] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0266] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0267] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0268] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below.(hUS_T_NB_1_1)GCaUUUUACUGGCACCGGGUCAUU (hUS_T_NB_1_2)AGCaUUUUACUGGCACCGGGUCAU (hUS_T_NB_1_3)CAGCaUUUUACUGGCACCGGGUCA (hUS_T_NB_1_4)ACAGCaUUUUACUGGCACCGGGUC (hUS_T_NB_1_5)CACAGCaUUUUACUGGCACCGGGU (hUS_T_NB_1_6)UCACAGCaUUUUACUGGCACCGGG (hUS_T_NB_1_7)CUCACAGCaUUUUACUGGCACCGG (hUS_T_NB_1_8)UCUCACAGCaUUUUACUGGCACCG (hUS_T_NB_1_9)GUCUCACAGCaUUUUACUGGCACC (hUS_T_NB_1_10)AGUCUCACAGCaUUUUACUGGCAC (hUS_T_NB_1_11)CAGUCUCACAGCaUUUUACUGGCA (hUS_T_NB_1_12)UCAGUCUCACAGCaUUUUACUGGC (hUS_T_NB_1_13)UUCAGUCUCACAGCaUUUUACUGG (hUS_T_NB_1_14)GUUCAGUCUCACAGCaUUUUACUG (hUS_T_NB_1_15)AGUUCAGUCUCACAGCaUUUUACU (hUS_T_NB_1_16)AAGUUCAGUCUCACAGCaUUUUAC (hUS_T_NB_1_17)UAAGUUCAGUCUCACAGCaUUUUA (hUS_T_NB_1_18)AUAAGUUCAGUCUCACAGCaUUUU (hUS_T_NB_1_19)AAUAAGUUCAGUCUCACAGCaUUU (hUS_T_NB_1_20)GAAUAAGUUCAGUCUCACAGCaUU (hUS_T_NB_1_21)GGAAUAAGUUCAGUCUCACAGCaU (hUS_T_NB_1_22)UGGAAUAAGUUCAGUCUCACAGCa。
[0269] Aspect 7 In Aspect 7, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is provided as an oligonucleotide consisting of 23 or 24 nucleotides.
[0270] Site-specific editing of the target adenosine contained in the target RNA is preferably mediated by ADAR1. Examples of ADAR1 include ADAR1p110 and ADAR1p150.
[0271] The target RNA is preferably all or part of the transcription product of the IL2 gene.
[0272] The target RNA is preferably mutated by editing the target adenosine at c.322 to N88D.
[0273] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0274] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0275] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0276] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0277] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0278] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0279] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0280] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0281] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0282] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0283] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0284] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below.(hIL_T_NB_1_1)UCiCUGAUUAAGUCCCUGGGUCUU (hIL_T_NB_1_2)AUCiCUGAUUAAGUCCCUGGGUCU (hIL_T_NB_1_3)UAUCiCUGAUUAAGUCCCUGGGUC (hIL_T_NB_1_4)AUAUCiCUGAUUAAGUCCCUGGGU (hIL_T_NB_1_5)GAUAUCiCUGAUUAAGUCCCUGGG (hIL_T_NB_1_6)UGAUAUCiCUGAUUAAGUCCCUGG (hIL_T_NB_1_7)UUGAUAUCiCUGAUUAAGUCCCUG (hIL_T_NB_1_8)GUUGAUAUCiCUGAUUAAGUCCCU (hIL_T_NB_1_9)CGUUGAUAUCiCUGAUUAAGUCCC (hIL_T_NB_1_10)ACGUUGAUAUCiCUGAUUAAGUCC (hIL_T_NB_1_11)UACGUUGAUAUCiCUGAUUAAGUC (hIL_T_NB_1_12)UUACGUUGAUAUCiCUGAUUAAGU (hIL_T_NB_1_13)AUUACGUUGAUAUCiCUGAUUAAG (hIL_T_NB_1_14)UAUUACGUUGAUAUCiCUGAUUAA (hIL_T_NB_1_15)CUAUUACGUUGAUAUCiCUGAUUA (hIL_T_NB_1_16)ACUAUUACGUUGAUAUCiCUGAUU (hIL_T_NB_1_17)AACUAUUACGUUGAUAUCiCUGAU (hIL_T_NB_1_18)GAACUAUUACGUUGAUAUCiCUGA (hIL_T_NB_1_19)AGAACUAUUACGUUGAUAUCiCUG (hIL_T_NB_1_20)CAGAACUAUUACGUUGAUAUCiCU (hIL_T_NB_1_21)CCAGAACUAUUACGUUGAUAUCiC (hIL_T_NB_1_22)UCCAGAACUAUUACGUUGAUAUCi。
[0285] Aspect 8 In Aspect 8, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide comprising 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, or 18 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA comprising 23 or 24 nucleotides. Oligonucleotides are provided.
[0286] Site-specific editing of a target adenosine contained in a target RNA is preferably by ADAR2.
[0287] The target RNA is preferably all or part of the transcription product of the IL2 gene.
[0288] The target RNA is preferably mutated by editing the target adenosine at c.322 to N88D.
[0289] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0290] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0291] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-O-methyl modification.
[0292] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not phosphorothioate linkages.
[0293] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not phosphorothioate linkages.
[0294] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside linkages are not methylphosphonate linkages, or
[0295] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not methylphosphonate linkages.
[0296] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the internucleoside bonds are not ethyl phosphate bonds, or
[0297] Preferably, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the internucleoside linkages are not ethyl phosphate linkages.
[0298] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides are not or have a 2'-MOE modification.
[0299] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a 2'-MOE modification.
[0300] The oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA preferably comprises or consists of all or a portion of an oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence is intended to specify any continuous portion of the oligonucleotide represented by the following sequence. The portion of the oligonucleotide represented by the following sequence includes those containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or insertions relative to all or a portion of the oligonucleotide represented by the following sequence. The meaning of the sequence notation is in accordance with Table 22 described below.(hIL_T_NB_1_1)UCiCUGAUUAAGUCCCUGGGUCUU (hIL_T_NB_1_2)AUCiCUGAUUAAGUCCCUGGGUCU (hIL_T_NB_1_3)UAUCiCUGAUUAAGUCCCUGGGUC (hIL_T_NB_1_4)AUAUCiCUGAUUAAGUCCCUGGGU (hIL_T_NB_1_5)GAUAUCiCUGAUUAAGUCCCUGGG (hIL_T_NB_1_6)UGAUAUCiCUGAUUAAGUCCCUGG (hIL_T_NB_1_7)UUGAUAUCiCUGAUUAAGUCCCUG (hIL_T_NB_1_8)GUUGAUAUCiCUGAUUAAGUCCCU (hIL_T_NB_1_9)CGUUGAUAUCiCUGAUUAAGUCCC (hIL_T_NB_1_10)ACGUUGAUAUCiCUGAUUAAGUCC (hIL_T_NB_1_11)UACGUUGAUAUCiCUGAUUAAGUC (hIL_T_NB_1_12)UUACGUUGAUAUCiCUGAUUAAGU (hIL_T_NB_1_13)AUUACGUUGAUAUCiCUGAUUAAG (hIL_T_NB_1_14)UAUUACGUUGAUAUCiCUGAUUAA (hIL_T_NB_1_15)CUAUUACGUUGAUAUCiCUGAUUA (hIL_T_NB_1_16)ACUAUUACGUUGAUAUCiCUGAUU (hIL_T_NB_1_17)AACUAUUACGUUGAUAUCiCUGAU (hIL_T_NB_1_18)GAACUAUUACGUUGAUAUCiCUGA (hIL_T_NB_1_19)AGAACUAUUACGUUGAUAUCiCUG (hIL_T_NB_1_20)CAGAACUAUUACGUUGAUAUCiCU (hIL_T_NB_1_21)CCAGAACUAUUACGUUGAUAUCiC (hIL_T_NB_1_22)UCCAGAACUAUUACGUUGAUAUCi。
[0301] Aspect 9 In Aspect 9, the present invention provides an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 18, 17, 16, 15, 14, 13, 12, 11, 10, or 9 nucleotides.
[0302] The first oligonucleotide preferably consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.
[0303] Site-specific editing of the target adenosine contained in the target RNA is preferably mediated by ADAR1. Examples of ADAR1 include ADAR1p110 and ADAR1p150.
[0304] The target RNA is preferably all or part of the transcription product of the GUCY2D gene.
[0305] The target RNA preferably has a nucleoside mutation designated c.2513G>A.
[0306] In an oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the first nucleotide counting in the 3' direction from the target corresponding nucleotide is, or is not, deoxyinosine, deoxyuridine, or DNA.
[0307] The target-corresponding nucleotides preferably have or do not have a 2'-O-methyl modification.
[0308] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 0%, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 100% of the nucleotides do not have or have a 2'-O-methyl modification.
[0309] Preferably, of the nucleotides contained in the oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, 100%, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, or 0% of the nucleotides are not or have a...
Claims
1. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 3, 4, 5, 6, 7, 15, or 16 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
2. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 4, 5, 6, 7, 15, or 16 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 21 or 22 nucleotides.
3. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 3, 4, 5, or 6 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 19 or 20 nucleotides.
4. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 4, 5, or 6 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 17 or 18 nucleotides.
5. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 3, 4, 5, 6, 13, 14, or 15 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
6. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 3, 4, 5, 6, 13, 14, or 15 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 21 or 22 nucleotides.
7. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 3, 4, 5, 6, 10, 13, or 14 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 19 or 20 nucleotides.
8. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 3, 4, or 5 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 17 or 18 nucleotides.
9. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 8, 9, 10, 11, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
10. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 5, 13, 14, 16, 17, or 18 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
11. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 7, 8, 9, 14, 15, 16, 17, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
12. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 1, 2, 13, 14, 15, 16, 17, or 18 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
13. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is an oligonucleotide consisting of 23 or 24 nucleotides.
14. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, or 18 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
15. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 18, 17, 16, 15, 14, 13, 12, 11, 10, or 9 nucleotides.
16. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 18, 17, 16, 15, 14, 13, 12, 11, 10, or 9 nucleotides.
17. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 13, 12, 11, or 10 nucleotides.
18. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 6, 5, or 4 nucleotides.
19. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, wherein the first oligonucleotide is an oligonucleotide having a base sequence complementary to the second RNA, wherein the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide is an oligonucleotide having a base sequence complementary to the first RNA, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is such that the nucleotide at -5, -4, -3, -2, -1, +2, +4, +5, +6, +7, +8, +10, +11, +12, +13, +15, +16, or +17 of the target-corresponding nucleotide is an LNA, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m.
20. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-F modification at a nucleotide that is -3, -2, -1, +2, +3, +4, +5, +6, +9, +11, +13, +14, +15, or +17 of the target-corresponding nucleotide, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m.
21. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a methylphosphonate bond at an internucleoside position of -4, -2, -1, 0, +1, +2, +3, +4, +11, +12, or +13, Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n.
22. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has an ethyl phosphate bond at an internucleoside position of -5, -1, 0, +1, +2, +3, +4, +10, +13, +14, or +16, Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n.
23. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-F modification at the -1 nucleotide of the target-corresponding nucleotide or is DNA, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m.
24. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is such that the nucleotide at -4, -3, -2, -1, +2, +3, +4, +5, +6, +8, +11, +12, +13, +15, +16, or +18 of the target-corresponding nucleotide is an LNA, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m.
25. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-F modification at a nucleotide that is -4, -3, -2, -1, +2, +3, +4, +5, +6, +8, +9, +10, +11, +12, +17, or +18 of the target-corresponding nucleotide, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m.
26. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a methylphosphonate bond at an internucleoside position of -5, -4, -3, -2, -1, 0, +1, +2, +3, +4, +7, +8, +9, +10, +11, or +15, Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n.
27. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has an ethyl phosphate bond at an internucleoside position of -5, -4, -3, -2, +1, 0, +2, +3, +4, +5, +6, +8, +9, +10, +11, +13, +14, +15, or +17; Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n.
28. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-F modification at the -1 nucleotide of the target-corresponding nucleotide or is DNA, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m.
29. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA comprises a nucleotide that is -3, +4, +5, or +6 of the target-corresponding nucleotide having a 2'-O-methyl modification, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m.
30. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a phosphorothioate bond at a site where the internucleoside bond is 0, +2, or +3, Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n.
31. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is such that the nucleotide at position -2 of the target-corresponding nucleotide is an LNA, the nucleotide at position +3 of the target-corresponding nucleotide has a 2'-F modification, the internucleoside position +4 is a methylphosphonate bond, or the nucleotide at position -1 of the target-corresponding nucleotide is DNA, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counted in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counted in the 5' direction from the target-corresponding nucleotide is referred to as -m; Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n.
32. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has an LNA at the -2 position of the target-corresponding nucleotide or an LNA at the +2 position of the target-corresponding nucleotide, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m.
33. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA is such that the nucleotide at position -2 of the target-corresponding nucleotide is LNA, the nucleotide at position +3 of the target-corresponding nucleotide has a 2'-F modification, the internucleoside position +4 is a methylphosphonate bond, or the nucleotide at position -1 of the target-corresponding nucleotide is DNA, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counted in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counted in the 5' direction from the target-corresponding nucleotide is referred to as -m; Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n.
34. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has an LNA as the nucleotide that is -2 of the target-corresponding nucleotide, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m.
35. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the target-corresponding nucleotide is DNA or has a 2'-O-methyl modification, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA comprises an LNA at a nucleotide -2 of the target-corresponding nucleotide, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m.
36. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, In the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the nucleotide that is −2 of the target-corresponding nucleotide has a 2'-F modification, the site where the internucleoside is −1 is a methylphosphonate bond, the site where the internucleoside is +1 is an ethyl phosphate bond, or the site where the internucleoside is −4 is a methylphosphonate bond, wherein in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counted in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counted in the 5' direction from the target-corresponding nucleotide is referred to as −m, Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n.
37. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, In the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the nucleotide that is -2 of the target-corresponding nucleotide has a 2'-F modification, the site where the internucleoside is -1 is a methylphosphonate bond, the site where the internucleoside is +1 is an ethyl phosphate bond, the site where the internucleoside is -3 is a methylphosphonate bond, the nucleotide that is -1 of the target-corresponding nucleotide is DNA, or the nucleotide that is +3 of the target-corresponding nucleotide has a 2'-F modification; wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m;Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n.
38. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, wherein the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-F modification at the -2 nucleotide of the target-corresponding nucleotide, a phosphate ethyl bond at the +1 internucleoside position, or a methylphosphonate bond at the -4 internucleoside position, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counted in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counted in the 5' direction from the target-corresponding nucleotide is referred to as -m; Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n.
39. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, In the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the nucleotide that is −2 of the target-corresponding nucleotide has a 2'-F modification, the site where the internucleoside is −1 is a methylphosphonate bond, the site where the internucleoside is +1 is a phosphate ethyl bond, the site where the internucleoside is −3 is a methylphosphonate bond, the site where the internucleoside is −4 is a methylphosphonate bond, the site where the internucleoside is −5 is a methylphosphonate bond, or the nucleotide that is −1 of the target-corresponding nucleotide is DNA; wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as −m;Here, counting in the 3' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the nucleoside and the first nucleoside in the target-corresponding nucleotide is referred to as internucleoside 0, the position of the phosphorus-containing linking group linking the nth nucleoside and the (n+1)th nucleoside is referred to as internucleoside +n, and counting in the 5' direction from the nucleoside in the target-corresponding nucleotide, the position of the phosphorus-containing linking group linking the first nucleoside and the nucleoside in the target-corresponding nucleotide is referred to as internucleoside -1, and the position of the phosphorus-containing linking group linking the nth nucleoside and the (n-1)th nucleoside is referred to as internucleoside -n.
40. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising a first oligonucleotide, a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide, and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-F modification at the nucleotide that is -2 of the target-corresponding nucleotide, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m.
41. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-MOE modification at the nucleotide that is -4, -3, +5, +13, +14, or +15 of the target-corresponding nucleotide, a 2'-MOE modification at the nucleotide that is -5, +4, +6, +7, +9, +10, +11, +12, or +16 of the target-corresponding nucleotide, or a 2'-MOE modification at the nucleotide that is +2 or +3 of the target-corresponding nucleotide, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m.
42. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide comprising an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide comprising an oligonucleotide having a base sequence complementary to the first RNA, The oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA has a 2'-MOE modification at the nucleotide that is -4, -1, +8, or +11 relative to the target-corresponding nucleotide, a 2'-MOE modification at the nucleotide that is -3, -2, or +4 relative to the target-corresponding nucleotide, or a 2'-MOE modification at the nucleotide that is +2, +3, or +5 relative to the target-corresponding nucleotide, wherein, in the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA, the target-corresponding nucleotide is referred to as 0, the nth nucleotide counting in the 3' direction from the target-corresponding nucleotide is referred to as +n, and the mth nucleotide counting in the 5' direction from the target-corresponding nucleotide is referred to as -m.
43. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 10, 14, 15, 16, or 17 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
44. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 13, 14, 15, or 16 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
45. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 15, 16, 17, or 18 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
46. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 10, 11, 12, 13, or 14 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
47. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 5, 6, 7, 8, 9, 10, 11, 12, 16, 17, 18, 19, or 20 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
48. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 6, 7, 8, 9, 10, 11, 14, 15, 16, 17, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
49. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 6, 8, 11, 14, 15, 16, 17, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
50. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 8, 9, 10, 15, 16, 17, 18, or 19 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
51. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 5, 6, 7, 14, 15, 17, 18, 19, or 20 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the oligonucleotide that induces site-specific editing of a target adenosine contained in the target RNA consisting of 23 or 24 nucleotides.
52. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 17 or 16 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA.
53. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 17 or 16 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA.
54. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 nucleotides.
55. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 9 or 8 nucleotides.
56. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 13, 12, 11, 10, 9, 8, 7, or 6 nucleotides.
57. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 10, 9, 8, or 7 nucleotides.
58. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 14, 13, 12, 11, 10, or 9 nucleotides.
59. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 10 or 9 nucleotides.
60. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 17, 16, 15, 14, 13, 12, 11, 10, 9, or 8 nucleotides.
61. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 12, 9, 8, 7, 6, 5, or 4 nucleotides.
62. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the first oligonucleotide consisting of 18, 17, 16, 15, 14, 13, 12, 11, 10, or 9 nucleotides, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA.
63. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 nucleotides.
64. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the second oligonucleotide consisting of 18, 17, 16, 15, 14, 13, or 12 nucleotides.
65. An oligonucleotide that induces site-specific editing of a target adenosine contained in a target RNA, the oligonucleotide comprising: a first oligonucleotide; a target-corresponding nucleotide linked to the 3' side of the first oligonucleotide; and a second oligonucleotide linked to the 3' side of the target-corresponding nucleotide, wherein the target RNA comprises a first RNA, the target adenosine linked to the 3' side of the first RNA, and a second RNA linked to the 3' side of the target adenosine, the first oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the second RNA, the target-corresponding nucleotide corresponds to the target adenosine, and the second oligonucleotide consisting of an oligonucleotide having a base sequence complementary to the first RNA, and the target RNA is all or a part of a transcription product of the ABCA4 gene, EYS gene, GUCY2D gene, IL2 gene, p53 gene, or USH2A gene.
66. A pharmaceutical composition containing an oligonucleotide according to any one of claims 1 to 65 as an active ingredient, for use in treating or preventing a disease associated with said target RNA.
67. Use of an oligonucleotide described in any one of claims 1 to 65 for the manufacture of a medicament for the treatment or prevention of a disease associated with the target RNA.
68. An oligonucleotide according to any one of claims 1 to 65 for use in the treatment or prevention of a disease associated with said target RNA.
69. A method for treating or preventing a disease associated with a target RNA in a subject by administering to the subject a pharmacologically effective amount of an oligonucleotide described in any one of claims 1 to 65.
Citation Information
Patent Citations
CRISPR / CAS-Adenine Deaminase Based Compositions, Systems, and Methods for Targeted Nucleic Acid Editing
JP2020528761A
Oligonucleotide, and target RNA site-specific editing method
WO2021060527A1
Oligonucleotide and target RNA site-specific editing method
WO2021182474A1
Stable target-editing guide RNA to which chemically modified nucleic acid is introduced
WO2022124345A1