MicroRNA detection method and kit based on intramolecular strand displacement reaction

Abstract

The invention relates to an intramolecular strand displacement reaction-based microRNA detection method and kit, and the kit is characterized in that the kit comprises four single-stranded sequences forming a DNA tetrahedron, a probe S and DNA polymerase; a probe T structure is designed at the top end of the DNA tetrahedron, and the probe T is used for capture of the probe S and intramolecular strand displacement reaction triggered by microRNA to be detected. The DNA tetrahedral structure is utilized to enhance the probe fixing efficiency and stability, and the detection sensitivity is improved; signal amplification is realized through intramolecular strand displacement reaction, and the detection limit is as low as 5 * 10 <-17 > mol / L; good selectivity is achieved, and single-base mismatch sequences can be distinguished; the kit has good performance in serum samples and has practical application potential.

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and in vitro detection, specifically to a method and kit for detecting microRNA based on intramolecular chain displacement reaction. Background Technology

[0002] MicroRNAs are an important class of gene regulatory elements, playing a crucial regulatory role in many physiological and pathological processes. Developing highly sensitive detection methods for microRNA molecules can contribute to the in-depth development of cell biology, basic medicine, and other disciplines. Currently, traditional microRNA detection methods include Northern blotting, microarrays, and real-time quantitative PCR. However, due to some inherent biological characteristics of microRNAs, including homology, short sequences, and low abundance, these traditional methods still present many inconveniences, such as complex primer design and insufficient sensitivity. In recent years, researchers have developed a series of novel detection methods based on isothermal signal amplification strategies, including the introduction of rolling circle amplification, double-stranded specific nuclease reactions, and hybridization chain reactions. However, these methods also have many shortcomings, including limited signal amplification efficiency and the potential interference of introducing large amounts of sequences or reagents with specific molecular recognition and detection. Therefore, the development of novel detection methods remains necessary. Summary of the Invention

[0003] To address the shortcomings of existing technologies, this invention designs a strategy for triggering intramolecular chain substitution reactions by target microRNA molecules, capturing electrochemical probes at the DNA tetrahedral reaction interface, and providing an efficient and convenient electrochemical detection method. A kit designed based on this method can perform accurate quantitative analysis of target microRNA.

[0004] To achieve the above objectives, the present invention provides the following technical solution: A kit for detecting microRNA based on intramolecular strand displacement reaction is characterized by comprising four single-stranded sequences constituting a DNA tetrahedron, a probe S, and a DNA polymerase; the apex of the DNA tetrahedron is designed with a probe T structure, which is used for the capture of probe S and the strand displacement reaction triggered by the microRNA to be detected; wherein... The four single-stranded sequences that make up the DNA tetrahedron are as follows: T1:ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTACAAACACCATTGTCACACTCCAGCGCGTAGGTATGGAGTGTGACAATGGAACCTACGC T2:SH-C6-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC T3:SH-C6-TCAACTGCCTGGTGATAAAACGACACTACGTGACAATCTACTATGGCGGCTCTTC T4:SH-C6-TTCAGACTTAGGAATGTGCTTGTCACGTAGTGTCGTTTGTATTGGACCCTCGCAT The sequence of the probe S is as follows: S: GCGTAGGTTTGTTTGTTTTT-MB.

[0005] Furthermore, the DNA polymerase is Klenow fragment polymerase.

[0006] The second objective of this invention is to provide a method for detecting microRNA based on intramolecular chain substitution reaction, using the above-mentioned kit to detect target microRNA, comprising the following steps: 1) Gold electrode pretreatment; 2) Assembly of DNA tetrahedrons: The DNA molecules involved in the detection are first dissolved in PBS solution. Probes T1, T2, T3, and T4 are mixed in a molar ratio of 1:1:1:1 and added to the DNA solution to form a mixture. The mixture is heated to 95 °C and then slowly cooled to room temperature to complete the assembly of DNA tetrahedrons. 3) DNA tetrahedral modified electrode: Immerse the treated gold electrode in the solution of step 2) for 8 h; prepare a reaction solution containing 2 v% Klenow fragment polymerase, 25 v% dNTPs and 10 v% 10×NEB buffer 2.1; first immerse the DNA tetrahedral modified electrode in microRNA solution for 30 min, then immerse it in the reaction solution for 60 min, then heat it to 80 ℃ and hold for 20 min, remove the electrode, rinse it, and incubate it with 1 μM probe S for 30 min; 4) Electrochemical detection: A three-electrode system is used, with the DNA tetrahedral modified electrode as the working electrode. Cyclic voltammetry, electrochemical impedance spectroscopy, or square wave voltammetry are used to detect the test sample. The concentration of the test microRNA is quantitatively analyzed based on the electrochemical signal intensity of the modified electrode after the reaction.

[0007] Furthermore, the gold electrode pretreatment process is as follows: First, it is immersed in piranha solution for 5 minutes and rinsed thoroughly. Then, it is polished with P5000 sandpaper and alumina slurry respectively. Subsequently, the electrode is ultrasonically treated in ethanol for 5 minutes, followed by ultrasonic treatment in double-distilled water for 5 minutes. Then, it is immersed in 0.5 M sulfuric acid for 20 cycles of cyclic voltammetry scanning to achieve electrochemical cleaning of the electrode. Finally, the electrode is rinsed with pure water and ready for use.

[0008] Furthermore, the electrolyte solution used for cyclic voltammetry and electrochemical impedance spectroscopy was a 5 mM [Fe(CN)6]³⁻ / L solution containing 1 MKCl. 4 ⁻ Solution; The electrolyte solution used in the square wave voltammetry measurement was 20 mM Tris-HCl containing 140 mM NaCl and 5 mM MgCl2.

[0009] The beneficial effects of this invention are: 1. This invention utilizes the tetrahedral structure of DNA to enhance probe immobilization efficiency and stability, thereby improving detection sensitivity.

[0010] 2. Signal amplification is achieved through intramolecular chain substitution reactions, with a detection limit as low as 5 × 10⁻⁶. -17 mol / L.

[0011] 3. It has good selectivity and can distinguish single-base mismatch sequences.

[0012] 4. It performs well in serum samples and has potential for practical application. Attached Figure Description

[0013] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0014] Figure 1 This is a schematic diagram illustrating the principle of microRNA electrochemical detection based on intramolecular chain displacement reaction.

[0015] Figure 2 Polyacrylamide gel electrophoresis images: (a) DNA tetrahedral assembly process (from left to right: T1, T1 / T2, T1 / T2 / T3, T1 / T2 / T3 / T4), (b) strand substitution reaction (from left to right: miR-122, T, S, miR-122 / T, miR-122 / T+Klenow fragment).

[0016] Figure 3 Electrochemical characterization diagrams of the electrode modification process (a, d cyclic voltammetry, b, e AC impedance diagrams, c, f square wave voltammetry).

[0017] Figure 4 The microRNA detection performance of the electrochemical sensor is shown in the graphs (a) square wave voltammetry curve, b, c peak current-concentration relationship graph, d, e mismatch resolution test, and f serum test. Detailed Implementation

[0018] The technical solution of the present invention will now be clearly and completely described with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0019] Furthermore, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0020] Unless otherwise specified, all materials and reagents used in the examples are commercially available. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of the invention. Experimental methods not specifying specific conditions in the examples are generally performed under conventional conditions or as recommended by the manufacturer.

[0021] Example 1: 1) Assembly of DNA tetrahedra: The DNA molecules involved in the detection were first dissolved in PBS solution (pH 7.5, containing 0.1M NaCl). These DNA molecules were heated to 95°C and then slowly cooled to room temperature. Probes T1, T2, T3, and T4 were all diluted to 3.2 μM. Subsequently, the four strands were mixed in a 1:1:1:1 ratio. The mixture was then heated to 95°C and slowly cooled to achieve the assembly of three-dimensional DNA tetrahedra.

[0022] 2) Electrode Modification: The gold working electrode was first polished and cleaned. First, it was immersed in a piranha solution (98% sulfuric acid: 30% hydrogen peroxide = 3:1) for 5 minutes. Next, the electrode was thoroughly rinsed and then polished using P5000 sandpaper and alumina slurry (1, 0.3, and 0.05 μm). Subsequently, the electrode was sonicated in ethanol for 5 minutes, followed by sonication in double-distilled water for 5 minutes. The electrode was then immersed in 0.5 M sulfuric acid for 20 cyclic voltammetric scans to achieve electrochemical cleaning. Afterward, the electrode was rinsed with pure water and incubated in a DNA tetrahedral solution for 8 hours.

[0023] 3) Intramolecular chain displacement reaction: A series of standard microRNA solutions of different concentrations were prepared. The DNA tetrahedral modified electrode was incubated with the microRNA solution for 30 minutes. Next, it was further incubated with 100 μL of chain displacement reaction solution containing 2 μL Klenow fragment polymerase, 25 μL dNTPs (2.5 mM), and 10 μL 10×NEB buffer 2.1. The solution was incubated at 37 °C for 60 minutes. Then, it was heated to 80 °C and held for 20 minutes to inactivate the enzyme. Subsequently, the electrode was rinsed and incubated with 100 μL probe S (1 μM) for 30 minutes to obtain the DNA tetrahedral modified gold working electrode.

[0024] 4) Electrochemical Detection: Electrochemical measurements employ a traditional three-electrode system, including a saturated calomel reference electrode, a platinum wire auxiliary electrode, and a DNA tetrahedral modified gold working electrode. The electrolyte solution used for cyclic voltammetry and electrochemical impedance spectroscopy is a 5 mM [Fe(CN)6]³⁻ / L electrolyte containing 1 M KCl. 4 The solution was used for cyclic voltammetry at a scan rate of 0.1 V / s, with a scan range of 0.6 to -0.1 V. The bias potential for electrochemical impedance spectroscopy was 0.21 V, the amplitude was 5 mV, and the frequency range was 0.1 to 100,000 Hz. Square wave voltammetry was performed using a 20 mM Tris-HCl solution (pH 7.4) containing 140 mM NaCl and 5 mM MgCl₂. The modulation amplitude was 25 mV, the step potential was 4 mV, and the frequency was 70 Hz.

[0025] T1:ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTACAAACACCATTGTCACACTCCAGCGCGTAGGTATGGAGTGTGACAATGGAACCTACGC T2:SH-C6-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC T3:SH-C6-TCAACTGCCTGGTGATAAAACGACACTACGTGACAATCTACTATGGCGGCTCTTC T4:SH-C6-TTCAGACTTAGGAATGTGCTTGTCACGTAGTGTCGTTTGTATTGGACCCTCGCAT The sequence of the probe S is: S: GCGTAGGTTTGTTTGTTTTT-MB.

[0026] The 5' ends of T2, T3, and T4 are labeled with three thiol groups, which are located at the three ground vertices after the three-dimensional DNA tetrahedron is assembled. Multiple gold-sulfur covalent interactions can help to firmly fix the DNA structure on the surface of the gold electrode.

[0027] refer to Figure 1 The single-stranded region of probe T contains a sequence complementary to that of probe S (labeled with methylene blue MB electrochemical signaling molecules). Therefore, after hybridization, a three-way linkage structure is formed, resulting in a significant electrochemical response. When the target microRNA is present in the system, the target molecule can open the initial hairpin structure of probe T, and the released single-stranded region refolds to form a new hairpin structure. Its 3' end sequence acts as a primer, triggering the extension reaction along the template in the presence of polymerase. Simultaneously, it displaces the microRNA into the solution, entering a new chain displacement reaction cycle. The resulting large number of intact hairpin structures inhibits the capture of probe S. By analyzing the degree of decrease in the electrochemical signal, the concentration of the target microRNA can be directly quantified.

[0028] like Figure 2 As shown, the assembly process of DNA tetrahedrons can be achieved by... Figure 2 As demonstrated by the polyacrylamide gel electrophoresis image in Figure a, the molecular weight of the product gradually increases with the increase in the number of hybridized strands, indicating that hybridization occurred in the regions where different DNA strands paired with each other, and the final DNA tetrahedron exhibits the largest molecular weight. Figure 2 The polyacrylamide gel electrophoresis image in b confirms the strand displacement reaction process. Specifically, the band appearing in the mixture of miR-122 and probe T has a higher molecular weight than either miR-122 or probe T, indicating that the two hybridized to form a miRNA / DNA hybrid. After further addition of polymerase, the band of miR-122 brightened, indicating that a strand displacement reaction had occurred.

[0029] The results of the cyclic voltammetry test are as follows Figure 3 As shown in a and 3d, the bare electrode exhibits significant oxidation and reduction peaks. After modifying the DNA tetrahedron, the peak current decreases, indicating the successful assembly of an electronegative DNA molecule layer capable of repelling potassium ferricyanide molecules. Further capture of probe S results in a further decrease in peak current, verifying that probe S is tetrahedralized and fixed to the electrode surface. However, when the target microRNA triggers the strand displacement reaction, probe S cannot be fixed, but the polymerase still increases the electronegativity of the DNA molecule layer to some extent, thus the peak current still decreases to some degree. Specific peak current values ​​are compared below. Figure 3 As shown in d.

[0030] The results of the electrochemical impedance spectroscopy test are as follows: Figure 3 As shown in b and 3e, the trend of increasing impedance is consistent with the trend of decreasing peak current in the cyclic voltammogram.

[0031] The square wave voltammetry test process is as follows: Figure 3 As shown in c and 3f, the methylene blue signal during the modification process was detected using square wave voltammetry. Since this signal molecule is labeled with probe S, a significant current peak can only be detected when the DNA tetrahedron successfully captures probe S before the strand displacement reaction occurs. Figure 3 c), a comparison of specific peak current values ​​is as follows: Figure 3 As shown in f.

[0032] The above electrochemical response demonstrates the effectiveness of the detection strategy.

[0033] We prepared a series of standard microRNA solutions at different concentrations to trigger corresponding reactions on DNA tetrahedral modified electrodes. The resulting square wave voltammetry maps were superimposed on... Figure 4 In diagram a, as the concentration increases, the peak current in the square wave voltammogram gradually decreases. Based on the difference between the peak current and the initial value, a graph showing the relationship between the current difference and the logarithm of the microRNA concentration is plotted. Figure 4 b). It can be observed that within the concentration range of 10... -16 – 10 -12 There is a linear relationship between mol / L and ( Figure 4 c). Calculations show that the detection limit for microRNA is 5 × 10⁻⁶. -17 mol / L.

[0034] Verify the selectivity of the method in this application Selective verification was performed using six sequences that contained mismatched bases with the target miR-122.

[0035] The sequence of the mismatched microRNA used to test the selectivity of this method is as follows: M1: UGCAGUGUGACAAUGGUGUUUG M2: UGGAGUGUGACAAUGGUGGUUG M3: UGGAGUGUGACUAUGGUGUUUG M4: UGGAGACUGACAAUGGUGUUUG M5: UGGAGUGUGACAAUGGUACUUG M6: UGGUGUGUGACAAUGCUGUUUG like Figure 4As shown in Figure d, none of these mismatch sequences produced a significant decrease in current. However, when the target miR-122 was added to the mismatch sequence, the current decrease produced by the mixture was consistent with the difference produced by the target miR-122, confirming that these mismatch sequences do not affect the detection method's ability to detect the target miR-122.

[0036] Specific concentrations of miR-122 were added to different serum samples, and the results were detected using this method. Figure 4 As shown in f, the electrochemical response in serum samples corresponds one-to-one with that in PBS, indicating that this method can demonstrate good practical value in biological sample detection.

[0037] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.

Claims

1. A kit for detecting microRNA based on intramolecular chain displacement reaction, characterized in that, It includes four single-stranded sequences that make up a DNA tetrahedron, probe S, and DNA polymerase; the apex of the DNA tetrahedron is designed with a probe T structure, which is used for the capture of probe S and the strand displacement reaction triggered by the microRNA to be tested; wherein The four single-stranded sequences that make up the DNA tetrahedron are as follows: T1:ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTACAAACACCATTGTCACACTCCAGCGCGTAGGTATGGAGTGTGACAATGGAACCTACGC T2:SH-C6-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC T3:SH-C6-TCAACTGCCTGGTGATAAAACGACACTACGTGACAATCTACTATGGCGGCTCTTC T4:SH-C6-TTCAGACTTAGGAATGTGCTTGTCACGTAGTGTCGTTTGTATTGGACCCTCGCAT The sequence of the probe S is as follows: S: GCGTAGGTTTGTTTGTTTTT-MB.

2. The kit for detecting microRNA via intramolecular chain displacement reaction according to claim 1, characterized in that, The DNA polymerase is Klenow fragment polymerase.

3. A method for detecting microRNA based on intramolecular chain displacement reaction, characterized in that, The target microRNA was detected using the kit described in claim 1 or 2.

4. The microRNA detection method based on intramolecular chain substitution reaction according to claim 3, characterized in that, Includes the following steps: 1) Gold electrode pretreatment; 2) Assembly of DNA tetrahedrons: The DNA molecules involved in the detection are first dissolved in PBS solution. Probes T1, T2, T3, and T4 are mixed in a molar ratio of 1:1:1:1 and added to the DNA solution to form a mixture. The mixture is heated to 95 °C and then slowly cooled to room temperature to complete the assembly of DNA tetrahedrons. 3) DNA tetrahedral modified electrode: The treated gold electrode was immersed in the solution in step 2) and incubated for 8 h; a reaction solution containing 2 v% Klenow fragment polymerase, 25 v% dNTPs and 10 v% 10×NEB buffer 2.1 was prepared; the DNA tetrahedral modified electrode was first immersed in microRNA solution for 30 min, then immersed in the reaction solution and incubated for 60 min, then heated to 80 ℃ and held for 20 min, the electrode was removed and rinsed, and incubated with 1 μM probe S for 30 min; 4) Electrochemical detection: A three-electrode system is used, with the DNA tetrahedral modified electrode as the working electrode. Cyclic voltammetry, electrochemical impedance spectroscopy, or square wave voltammetry are used to detect the test sample. The concentration of the test microRNA is quantitatively analyzed based on the electrochemical signal intensity of the modified electrode after the reaction.

5. The microRNA detection method based on intramolecular chain substitution reaction according to claim 4, characterized in that, The pretreatment process for the gold electrode is as follows: First, it is immersed in a piranha solution for 5 minutes and rinsed thoroughly. Then, it is polished with P5000 sandpaper and alumina slurry respectively. Subsequently, the electrode is ultrasonically treated in ethanol for 5 minutes, followed by ultrasonic treatment in double-distilled water for 5 minutes. Then, it is immersed in 0.5 M sulfuric acid for 20 cycles of cyclic voltammetry scanning to achieve electrochemical cleaning of the electrode. Finally, the electrode is rinsed with pure water and ready for use.

6. The microRNA detection method based on intramolecular chain substitution reaction according to claim 4, characterized in that, The electrolyte solution used in cyclic voltammetry and electrochemical impedance spectroscopy was 5 mM [Fe(CN)6]³⁻ / L containing 1 M KCl. 4 ⁻ Solution; The electrolyte solution used in the square wave voltammetry measurement was 20 mM Tris-HCl containing 140 mM NaCl and 5 mM MgCl2.

Images