ACCURATE GUIDE RNA (gRNA) SCREENING METHOD FOR BASE EDITING OF ASIALOGLYCOPROTEIN RECEPTOR 1 (ASGR1) GENE

Abstract

Provided is an accurate guide RNA (gRNA) screening method for base editing of an asialoglycoprotein receptor 1 (ASGR1) gene, including the following steps: (1) gRNA design; (2) primer design; (3) in vitro transcription of gRNA; (4) cell transfection; (5) collection of cells, and extraction and polymerase chain reaction (PCR) of a genome; and (6) Sanger sequencing.

Description

ACCURATE GUIDE RNA (gRNA) SCREENING METHOD FOR BASE EDITING OF ASIALOGLYCOPROTEIN RECEPTOR 1 (ASGR1) GENETechnical Field

[0001] The present disclosure belongs to the technical field of biological gene editing, and in particular relates to an accurate guide RNA (gRNA) screening method for base editing of an asialoglycoprotein receptor 1 (ASGR1) gene.Background Art

[0002] High cholesterol is a major risk factor for cardio-cerebrovascular diseases (CCVDs) and may cause hyperlipidemia, coronary heart disease (CHD), cerebral infarction, atherosclerosis (AS), or the like, and hundreds of millions of people worldwide suffer from atherosclerotic cardiovascular diseases (ASCVDs). Therefore, high cholesterol is a very dangerous signal.

[0003] Currently, there are several types of drugs for treating high cholesterol, and conventional treatment drugs include competitive inhibitors (statins) for 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR) and inhibitors (ezetimibe) for cholesterol absorption. When used in a treatment, these two types of drugs need to be taken by a patient every day, which affects a life of the patient and has side effects to some degree. In recent years, two new drugs, PCSK9 monoclonal antibodies alirocumab and evolocumab, were approved by the Food and Drug Administration (FDA) for marketing in 2015. When used in a treatment, these two new drugs need to be injected once every two weeks or once every month, and have a higher annual medication cost than the conventional treatment drugs. In addition, there is a PCSK9 inhibitor inclisiran, a novel lipid-lowering drug. Inclisiran is a novel small interfering RNA (siRNA) lipid-lowering drug for treating primary hypercholesterolemia or mixed dyslipidemia in adults. When used in a treatment, inclisiran needs to be injected into a patient once on months 0 and 3, and then only needs to be injected twice a year, which reduces an administration frequency of the patient. However, inclisiran is expensive, and a price of two tubes of inclisiran is about 44,800 yuan. Although there are drugs on the market that can effectively treat high cholesterol and reduce a risk of related diseases, these drugs have problems such as specified side effects and high prices. According to analysis results of action mechanisms of drugs related to synthesis and degradation pathways of cholesterol, there is currently no drug that can reduce a cholesterol content by directly promoting the excretion of cholesterol. Therefore, the research and development of a gene therapy that reduces cholesterol through excretion is a novel promising research direction.

[0004] Human genetics research has confirmed that a loss-of-function variant of ASGR1 is associated with reduction of a cholesterol content and a risk of CCVDs, and can promote the excretion of cholesterol into the bile and intestinal lumen. ASGR1 is a major isotype of asialoglycoprotein receptor (ASGR), and ASGR is a liver-specific receptor that mediates the endocytosis and lysosomal degradation of various asialoglycoproteins, and is expressed only in the liver. Therefore, an ASGR1 gene is a potential target gene for investigating cholesterol reduction. In order to allow the accurate targeting of the ASGR1 gene, a specific mechanism of ASGR1 to affect the cholesterol metabolism is explored, novel drugs are developed to treat high cholesterol with a prolonged action time, such as to allow a vision of "one treatment, lifelong cure". To this end, potential gRNAs of the ASGR1 gene to lower a cholesterol level are screened to provide novel research directions and drug treatment strategies for treating high cholesterol.Technical Problem

[0005] An objective of the present disclosure is to provide an accurate gRNA screening method for base editing of an ASGR1 gene, which can provide a novel low-cost drug that can extend an administration interval of a patient to five or even ten years, thereby greatly improving a cure rate of a disease and reducing a risk of a series of CCVDs that may be caused by high cholesterol. Another objective of the present disclosure is to provide an accurate gRNA screening method for base editing of an ASGR1 gene, which can design a plurality of gRNAs by analyzing the ASGR1 gene, and selectively use an ABE base editor and ASGR1-targeted gRNA to screen out gRNA with high editing efficiency through cell transfection, thereby laying a foundation for development of a novel drug for treating high cholesterol based on the ASGR1 gene.Technical Solution

[0006] A technical solution of the present disclosure is to provide an accurate gRNA screening method for base editing of an ASGR1 gene, including the following steps:

[0007] (1) gRNA design;

[0008] (2) primer design;

[0009] (3)in vitrotranscription of gRNA;

[0010] (4) cell transfection;

[0011] (5) collection of cells, and extraction and polymerase chain reaction (PCR) of a genome; and

[0012] (6) Sanger sequencing.

[0013] Preferably, step (1) further includes: designing three candidate gRNAs at cleavage sites of an exon and an intron, where the three candidate gRNAs target exon 2 and exon 4 of ASGR1; and an initiation codon g1 is ggtcatgatagggctggcgc, a cleavage site g2 is cctcaccttttctgagctga, and a cleavage site g3 is gccagactcccagctgcagg.

[0014] Preferably, step (2) further includes: ligating a target site sequence behind a T7 promoter, where forward primers are different only in 3 different target sites; and reverse primers have a same sequence.

[0015] Preferably, step (3) further includes:

[0016] (3.1) with P1 (G2 or G3) and P2 as primers and a pU6-gRNA plasmid as a template, conducting PCR, and recovering a target band of 125 bp, where sequences of the primers are shown in FIG. 3;

[0017] (3.2) with the product recovered in step (3.1) as a template, conductingin vitrotranscription with a T7in vitrotranscription kit of NEB;

[0018] (3.3) after thein vitrotranscription is completed, recovering an RNA product with an RNA purification and recovery kit; and testing the recovered RNA product for a concentration, labeling the RNA product, and storing the RNA product in a -80°C refrigerator; and

[0019] (3.4) subjecting 1 μL of the RNA product to electrophoresis for identification, where it is determined that the RNA product has a size of 125 bp.

[0020] Preferably, step (4) further includes:

[0021] (4.1) transfecting HEK293T cells according to instructions of a D-Nano liposome kit and an electroporation kit, where a working concentration of ABE mRNA is 1,000 ng / μL, a working concentration of ASGR1-g1 is 1,000 ng / μL, a working concentration of ASGR1-g2 is 1,000 ng / μL, and a working concentration of ASGR1-g3 is 1,000 ng / μL;

[0022] (4.2) transfecting cells from a 24-well plate, where a transfection amount of ASGR1-gRNA is 0.25 μg, a transfection amount of ABE mRNA is 1 μg, and a ratio of the transfection amount of ASGR1-gRNA to the transfection amount of ABE mRNA is 1:4; and

[0023] (4.3) repeating a cell transfection experiment under each condition twice.

[0024] Preferably, step (5) further includes: 48 h after the transfection, collecting the cells, extracting a whole genome of the cells according to instructions of a whole genome extraction kit, and designing a primer to allow PCR amplification of a target site sequence, where a sequence of the primer is shown in SEQ ID NO: 1.

[0025] Preferably, step (6) further includes: subjecting a PCR product successfully amplified to the Sanger sequencing, where sequencing results show that a point mutation efficiency of ASGR1-gRNA1 is 25%, ASGR1-gRNA2 has no editing effect, and a point mutation efficiency of ASGR1-gRNA3 is 50%.Advantageous Effects

[0026] (1) The base editor used in the present disclosure can accurately target a base site, and screens out a total of 3 gRNAs of ASGR1; and Sanger sequencing results show that a point mutation efficiency of ASGR1-g1 is about 25% and a point mutation efficiency of ASGR1-g3 is about 50%.

[0027] (2) In the present disclosure, a point mutation site acted by ASGR1-gRNA1 is an initiation codon ATG, and after mutation, the expression of an ASGR1 protein cannot be initiated; and a point mutation site acted by ASGR1-g3 is a cleavage site of exon 4, and after mutation, exon 4 undergoes abnormal splicing and normal ASGR1 mRNA may not be produced. Therefore, ASGR1-g1 and ASGR1-g3 both can be used for subsequent experiments, and ASGR1-g3 is the optimal target sequence. However, whether ASGR1-g3 can make the normal expression of an ASGR1 protein failed needs to be further determined through experiments.

[0028] (3) The ABE base editor of the present disclosure is a prominent accurate targeted gene editor. In the present disclosure, cells are co-transfected with an ABE base editor and an ASGR1-targeted gRNA, and ASGR1-g3 with high editing efficiency is screened out through Sanger sequencing.

[0029] (4) In the present disclosure, according to comprehensive consideration of PAM and gRNA by the ASGR1 gene and base editor, an ABE base editing technology is used to investigate the ASGR1 gene, and gRNA with high editing efficiency is screened out, which lays a foundation for development of a novel drug for treating high cholesterol.Description of Drawings

[0030] FIG. 1 is a flow chart of the accurate gRNA screening method for base editing of an ASGR1 gene of the present disclosure;

[0031] FIG. 2 is a schematic diagram of design of candidate gRNAs in the present disclosure;

[0032] FIG. 3 is a schematic diagram of design of gRNA primers in the present disclosure;

[0033] FIG. 4 is an electrophoretogram forin vitrotranscription in the present disclosure;

[0034] FIG. 5 is an electrophoretogram for PCR amplification of a target site for cell transfection in the present disclosure; and

[0035] FIG. 6 is a Sanger sequencing map of the present disclosure.Best Mode

[0036] As shown in FIG. 1, an accurate gRNA screening method for base editing of an ASGR1 gene is provided, mainly including the following steps: design and construction of gRNA →in vitrotranscription of RNA → transfection of cells with gRNA and ABE → Sanger sequencing.Mode for Invention

[0037] The present disclosure will be described in detail below in conjunction with a specific example.

[0038] Example 1

[0039] As shown in FIG. 1, an accurate gRNA screening method for base editing of an ASGR1 gene was provided, including the following specific steps:

[0040] (1) gRNA design: Three candidate gRNAs were designed at cleavage sites of an exon and an intron, where the three candidate gRNAs targeted exon 2 and exon 4 of ASGR1; and an initiation codon g1 was ggtcatgatagggctggcgc, a cleavage site g2 was cctcaccttttctgagctga, and a cleavage site g3 was gccagactcccagctgcagg, as shown in FIG. 2.

[0041] (2) Primer design: A target site sequence was ligated behind a T7 promoter, where forward primers were different only in 3 different target sites; and reverse primers had a same sequence, as shown in FIG. 3.

[0042] (3)In vitrotranscription of gRNA:

[0043] (3.1) With P1 (G2 or G3) and P2 as primers and a pU6-gRNA plasmid as a template, PCR was conducted, and a target band of 125 bp was recovered, where sequences of the primers were shown in FIG. 3.

[0044] (3.2) With the product recovered in step (3.1) as a template,in vitrotranscription was conducted with a T7in vitrotranscription kit of NEB.

[0045] (3.3) After thein vitrotranscription was completed, an RNA product was recovered with an RNA purification and recovery kit; and the recovered RNA product was tested for a concentration, labeled, and stored in a -80°C refrigerator.

[0046] (3.4) 1 μL of the RNA product was subjected to electrophoresis for identification, where it was determined that the RNA product had a size of 125 bp, as shown in FIG. 4.

[0047] (4) Cell transfection:

[0048] (4.1) HEK293T cells were transfected according to instructions of a D-Nano liposome kit and an electroporation kit, where a working concentration of ABE mRNA was 1,000 ng / μL, a working concentration of ASGR1-g1 was 1,000 ng / μL, a working concentration of ASGR1-g2 was 1,000 ng / μL, and a working concentration of ASGR1-g3 was 1,000 ng / μL.

[0049] (4.2) Cells from a 24-well plate were transfected, where a transfection amount of ASGR1-gRNA was 0.25 μg, a transfection amount of ABE mRNA was 1 μg, and a ratio of the transfection amount of ASGR1-gRNA to the transfection amount of ABE mRNA was 1:4.

[0050] (4.3) A cell transfection experiment under each condition was repeated twice, where a cell transfection system was shown in Table 1.

[0051] Table 1 Cell transfection system

[0052]

[0053] (5) Collection of cells, and extraction and PCR of a genome:

[0054] (5.1) 48 h after the transfection, cells were collected, a whole genome of the cells was extracted according to instructions of a whole genome extraction kit, and a primer was designed to allow PCR amplification of a target site sequence, where a sequence of the primer was shown in SEQ ID NO: 1.

[0055] (5.1.1) A PCR system and procedure were shown in Tables 2 and 3.

[0056] Table 2 PCR system

[0057]

[0058] Table 3 PCR procedure

[0059]

[0060] (5.1.2) PCR results were shown in FIG. 5, which was an electrophoretogram for PCR of cell transfection.

[0061] (6) Sanger sequencing:

[0062] (6.1) A PCR product successfully amplified was subjected to Sanger sequencing. Sequencing results showed that a point mutation efficiency of ASGR1-gRNA1 was about 25%, ASGR1-gRNA2 had no editing effect, and a point mutation efficiency of ASGR1-gRNA3 was about 50%. A sequencing peak map was shown in FIG. 6.Industrial Applicability

[0063] The above is merely a preferred example of the present disclosure, and all equivalent changes and modifications made according to the scope of the claims of the present disclosure shall fall within the scope covered by the claims of the present disclosure.

Claims

1. An accurate guide RNA (gRNA) screening method for base editing of an asialoglycoprotein receptor 1 (ASGR1) gene, comprising the following steps:(1) gRNA design;(2) primer design;(3)in vitrotranscription of gRNA;(4) cell transfection;(5) collection of cells, and extraction and polymerase chain reaction (PCR) of a genome; and(6) Sanger sequencing.

2. The accurate gRNA screening method for base editing of an ASGR1 gene according to claim 1, wherein step (1) further comprises: designing three candidate gRNAs at cleavage sites of an exon and an intron, wherein the three candidate gRNAs target exon 2 and exon 4 of ASGR1; and an initiation codon g1 is ggtcatgatagggctggcgc, a cleavage site g2 is cctcaccttttctgagctga, and a cleavage site g3 is gccagactcccagctgcagg.

3. The accurate gRNA screening method for base editing of an ASGR1 gene according to claim 1, wherein step (2) further comprises: ligating a target site sequence behind a T7 promoter, wherein forward primers are different only in 3 different target sites; and reverse primers have a same sequence.

4. The accurate gRNA screening method for base editing of an ASGR1 gene according to claim 1, wherein step (3) further comprises:(3.1) with P1 (G2 or G3) and P2 as primers and a pU6-gRNA plasmid as a template, conducting PCR, and recovering a target band of 125 bp;(3.2) with the product recovered in step (3.1) as a template, conductingin vitrotranscription with a T7in vitrotranscription kit of NEB;(3.3) after thein vitrotranscription is completed, recovering an RNA product with an RNA purification and recovery kit; and testing the recovered RNA product for a concentration, labeling the RNA product, and storing the RNA product in a -80°C refrigerator; and(3.4) subjecting 1 μL of the RNA product to electrophoresis for identification, wherein it is determined that the RNA product has a size of 125 bp.

5. The accurate gRNA screening method for base editing of an ASGR1 gene according to claim 1, wherein step (4) further comprises:(4.1) transfecting HEK293T cells according to instructions of a D-Nano liposome kit and an electroporation kit, wherein a working concentration of ABE mRNA is 1,000 ng / μL, a working concentration of ASGR1-g1 is 1,000 ng / μL, a working concentration of ASGR1-g2 is 1,000 ng / μL, and a working concentration of ASGR1-g3 is 1,000 ng / μL;(4.2) transfecting cells from a 24-well plate, wherein a transfection amount of ASGR1-gRNA is 0.25 μg, a transfection amount of ABE mRNA is 1 μg, and a ratio of the transfection amount of ASGR1-gRNA to the transfection amount of ABE mRNA is 1:4; and(4.3) repeating a cell transfection experiment under each condition twice.6.The accurate gRNA screening method for base editing of an ASGR1 gene according to claim 1, wherein step (5) further comprises: 48 h after the transfection, collecting the cells, extracting a whole genome of the cells according to instructions of a whole genome extraction kit, and designing a primer to allow PCR amplification of a target site sequence, wherein a sequence of the primer is shown in SEQ ID NO: 1.

7. The accurate gRNA screening method for base editing of an ASGR1 gene according to claim 1, wherein step (6) further comprises: subjecting a PCR product successfully amplified to the Sanger sequencing, wherein sequencing results show that a point mutation efficiency of ASGR1-gRNA1 is 25%, ASGR1-gRNA2 has no editing effect, and a point mutation efficiency of ASGR1-gRNA3 is 50%.

Images