Muscle cell LNP-mrna quality control assays

Abstract

The present disclosure provides an in vitro system comprising a plurality of isolated human muscle cells and a plurality of lipid-nanoparticle (LNP)-encapsulated messenger RNA (mRNA), and methods of screening LNP-encapsulated mRNA for polypeptide expression with said system.

Description

MUSCLE CELL LNP-mRNA QUALITY CONTROL ASSAYSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is claims priority to European Application Serial No. 24315123.0, filed April 5, 2024, which is hereby incorporated herein by reference in its entirety.BACKGROUND

[0002] Lipid nanoparticle (LNP)-mediated delivery has revolutionized the mRNA therapeutics field. The LNP provides a stable and effective vehicle to protect mRNA from degradation and ensure the mRNA transfects target cells to ensure expression of the encoded protein (e.g., an antigen or other therapeutic protein).

[0003] Commercial lots of LNP-mRNA formulations for therapeutic use must be sufficiently pure and effective before the formulations can be administered to a subject. However, a reliable system is necessary to ensure the product is ready for use. Currently mice, non-human primate (NHP), and HeLa or HEK293 cells are used to evaluate LNP-mRNA formulations for quality. However, each model system has certain limitations. The immune response of mice is substantially dissimilar from humans. NHPs have similar immune responses to humans, but their use as a model can be expensive and time consuming. HeLa or HEK293 cells, like mice, do not yield an expression profile that is similar to the muscle cells of a human, where LNP-mRNA formulations are often delivered, for example, following Intramuscular (IM) administration of an mRNA vaccine.

[0004] Accordingly, there exists a need for LNP-mRNA formulation quality control assays that are inexpensive, easy to use, and yield results that are predictive of in vivo studies or clinical outcomes in humans.BRIEF SUMMARY OF THE DISCLOSURE

[0005] In one aspect, the disclosure provides an in vitro system comprising: a plurality of isolated human muscle cells; and a plurality of lipid-nanoparticle (LNP)- encapsulated messenger RNA (mRNA), wherein the plurality of isolated LNP- encapsulated mRNA contact the plurality of isolated human muscle cells in vitro and transfect the plurality of isolated human muscle cells.

[0006] In certain embodiments, each of the plurality of LNP-encapsulated mRNA comprises an mRNA, wherein the mRNA encodes an antigen.

[0007] In certain embodiments, the antigen is membrane localized on the plurality of isolated human muscle cells.

[0008] In certain embodiments, the in vitro system further comprises an antigen binding protein that specifically binds to the antigen.

[0009] In certain embodiments, the antigen binding protein comprises a detectable moiety.

[0010] In certain embodiments, the antigen is linked to a detectable protein.

[0011] In certain embodiments, the detectable protein comprises a fluorescent protein.

[0012] In certain embodiments, the fluorescent protein is GFP, RFP, YFP, or dsRed.

[0013] In certain embodiments, the antigen is secreted from the plurality of isolated human muscle cells.

[0014] In certain embodiments, the plurality of isolated human muscle cells are skeletal muscle cells.

[0015] In certain embodiments, the skeletal muscle cells are myocytes, myosatellite cells, or myoblasts.

[0016] In certain embodiments, the skeletal muscle cells are primary skeletal muscle cells.

[0017] In certain embodiments, the skeletal muscle cells are immortalized skeletal muscle cells.

[0018] In certain embodiments, the immortalized skeletal muscle cells exhibit SV40 large T antigen expression, hTERT expression, HPV16 E6 / E7 expression, adenovirus E1A / E1 B expression, tumor suppressor gene inactivation, or fusion with one or more immortalized cell line.

[0019] In certain embodiments, the immortalized skeletal muscle cells express one or more of cyclin D1 (CCND1 ), cyclin-dependent kinase 4 (CDK4), telomerase (TERT), HPV16 E6 / E7, or adenovirus E1A / E1 B.

[0020] In certain embodiments, the immortalized skeletal muscle cells express cyclin D1 (CCND1 ), cyclin-dependent kinase 4 (CDK4), and telomerase (TERT).

[0021] In certain embodiments, the LNP comprises at least one cationic lipid.

[0022] In certain embodiments, the LNP further comprises at least one polyethylene glycol (PEG) conjugated (PEGylated) lipid, at least one cholesterol-based lipid, and at least one helper lipid.

[0023] In one aspect, the disclosure provides a multi-vessel in vitro system comprising a plurality of isolated human muscle cells contained within at least two separate vessels, wherein each of the at least two separate vessels comprises a plurality of lipid-nanoparticle (LNP)-encapsulated messenger RNA (mRNA), the plurality of LNP-encapsulated mRNA comprising an LNP, and wherein the LNP comprises a unique composition of lipids in each vessel.

[0024] In certain embodiments, the LNP comprises at least one cationic lipid and wherein each of the at least two separate vessels comprises an LNP with a different cationic lipid.

[0025] In certain embodiments, the LNP further comprises at least one polyethylene glycol (PEG) conjugated (PEGylated) lipid, at least one cholesterol-based lipid, and at least one helper lipid.

[0026] In certain embodiments, the LNP comprises at least one PEGylated lipid and wherein each of the at least two separate vessels comprises an LNP with a different PEGylated lipid.

[0027] In certain embodiments, the LNP further comprises at least one cationic lipid, at least one a cholesterol-based lipid, and at least one helper lipid.

[0028] In certain embodiments, the LNP comprises at least one cholesterol-based lipid and wherein each of the at least two separate vessels comprises an LNP with a different cholesterol-based lipid.

[0029] In certain embodiments, the LNP further comprises at least one cationic lipid, at least one PEGylated lipid, and at least one helper lipid.

[0030] In certain embodiments, the LNP comprises at least one helper lipid and wherein each of the at least two separate vessels comprises an LNP with a different helper lipid.

[0031] In certain embodiments, the LNP further comprises at least one cationic lipid, at least one PEGylated lipid, and at least one cholesterol-based lipid.

[0032] In certain embodiments, the plurality of isolated human muscle cells are skeletal muscle cells.

[0033] In one aspect, the disclosure provides a method of screening LNP-encapsulated mRNA for polypeptide or protein expression, the method comprising: a) contacting a plurality of isolated human muscle cells with a plurality of lipid-nanoparticle (LNP)-encapsulated messenger RNA (mRNA), wherein the plurality of LNP-encapsulated mRNA contact the plurality of isolated human muscle cells in vitro and transfect the plurality of isolated human muscle cells; and b) detecting polypeptide or protein expression.

[0034] In certain embodiments, each of the plurality of LNP-encapsulated mRNA comprises mRNA, wherein the mRNA encodes an antigen.

[0035] In certain embodiments, the antigen is membrane localized on the plurality of isolated human muscle cells.

[0036] In certain embodiments, the method further comprises an antigen binding protein that specifically binds to the antigen.

[0037] In certain embodiments, the antigen binding protein comprises a detectable moiety.

[0038] In certain embodiments, step b) comprises detecting the antigen binding protein comprising the detectable moiety.

[0039] In certain embodiments, the antigen is linked to a detectable protein.

[0040] In certain embodiments, the detectable protein comprises a fluorescent protein.

[0041] In certain embodiments, the fluorescent protein is GFP, RFP, YFP, or dsRed.

[0042] In certain embodiments, step b) comprises detecting the antigen linked to the detectable protein.

[0043] In certain embodiments, step b) is performed by fluorescence-activated cell sorting (FACS).

[0044] In certain embodiments, the antigen is secreted from the isolated human muscle cells into cell culture media.

[0045] In certain embodiments, step b) comprises detecting the antigen in the cell culture media.

[0046] In certain embodiments, the plurality of isolated human muscle cells are skeletal muscle cells.

[0047] In one aspect, the disclosure provides a method of producing a validated lipid- nanoparticle (LNP)-encapsulated messenger RNA (mRNA), the method comprising: a) mixing LNPs or LNP-forming lipids with mRNAs, thereby forming the LNP-encapsulated mRNA; b) contacting a plurality of isolated human muscle cells with the LNP-encapsulated mRNA; and c) detecting polypeptide or protein expression from the plurality of isolated human muscle cells to validate quality of the LNP-encapsulated mRNA, wherein the quality is validated if expression of the mRNA is detected above a baseline value.

[0048] In certain embodiments, the mRNA encodes an antigen.

[0049] In certain embodiments, the antigen is membrane localized on the plurality of isolated human muscle cells.

[0050] In certain embodiments, the method further comprises an antigen binding protein that specifically binds to the antigen.

[0051] In certain embodiments, the antigen binding protein comprises a detectable moiety.

[0052] In certain embodiments, step b) comprises detecting the antigen binding protein comprising the detectable moiety.

[0053] In certain embodiments, the antigen is linked to a detectable protein.

[0054] In certain embodiments, the detectable protein comprises a fluorescent protein.

[0055] In certain embodiments, the fluorescent protein is GFP, RFP, YFP, or dsRed.

[0056] In certain embodiments, step b) comprises detecting the antigen linked to the detectable protein.

[0057] In certain embodiments, step b) is performed by fluorescence-activated cell sorting (FACS).

[0058] In certain embodiments, the antigen is secreted from the isolated human muscle cells into cell culture media.

[0059] In certain embodiments, step b) comprises detecting the antigen in the cell culture media.

[0060] In certain embodiments, the plurality of isolated human muscle cells are skeletal muscle cells.

[0061] In certain embodiments, the baseline value is a value from a plurality of isolated human muscle cells transfected with an empty LNP.

[0062] In certain embodiments, the baseline value is a value from a plurality of isolated human muscle cells transfected with an LNP encapsulated with an mRNA encoding a polypeptide that is not detected.

[0063] In one aspect, the disclosure provides an LNP-encapsulated mRNA produced by the method of producing an lipid-nanoparticle (LNP)-encapsulated messenger RNA (mRNA) described herein.BRIEF DESCRIPTION OF THE DRAWINGS / FIGURES

[0064] The foregoing and other features and advantages of the present disclosure will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings.

[0065] FIG. 1 depicts a bar graph demonstrating that human skeletal muscle cells (HSkMC) display a lower autofluorescence background compared to HeLa cells.

[0066] FIG. 2 depicts HSkMCs displaying a high reproducibility for expressing proteinencoding mRNA.

[0067] FIG. 3 depicts that HSkMCs can be used for high-throughput antigen expression assays.

[0068] FIGs. 4A-4B depict ELISA results showing that HSkMC is comparable to animal IM injections. hEPO transfection efficiency in HSkMC (FIG. 4A) is similar to a nonhuman primate animal model (NHP, FIG. 4B). LNPs tested varied by cationic lipid employed. Timepoints for sample testing were 6 hours, 24 hours, and 48 hours in HSkMC and 6 hours, 24 hours, 48 hours, and 72 hours in NHP.

[0069] FIGs. 5A-5C depict the potency of various LNP formulated mRNA evaluated in HSkMC (FIG. 5A) and compared to NHP (FIGs. 5B and 5C).

[0070] FIGs. 6A-6B depict results from a quantitative potency assay measuring LNP formulated mRNA in HSkMC. Different parameters such as, but not limited to, percent transfected HSkMC (FIG. 6A) and mean fluorescence intensity (FIG. 6B) may be measured by flow cytometry. Cationic lipids employed in the tested LNPs were: 1 : cKK-E10; 2: GL-HEPES-E3-E12-DS-3-E14; 3: GL-HEPES-E3-E12-DS-4- E10; 4: GL-HEPES-E3-E10-DS-3-E18-1 ; and 5: OF-02.

[0071] FIGs. 7A-7B depict an example of a potency assay in HSkMC used to evaluate conformational correctness. FIG. 7A depicts the conversion of the prefusion form of RSV F to post-fusion F. FIG. 7B depicts the ability to distinguish the presence or absence of key protein epitopes in mRNA constructs (RSV F) in HSkMC.

[0072] FIGs. 8A-8C depict three different methods of protein detection in HSkMCs transfected with mRNA LNPs: cytosolic antigen eGFP (FIG. 8A) analyzed by Countess 3 FL imaging and / or flow cytometry, secreted antigen hEPO (FIG. 8B) analyzed by ELISA, and membrane-bound antigen HA (FIG. 8C) analyzed by Countess 3 FL and / or flow cytometry.

[0073] FIG. 9 depicts the reproducibility of a potency assay performed in three separate experiments. HSkMCs were treated with 1 pg mRNA LNP, and eGFP expression was detected. Similar expression profiles were observed between experiments with small increases in the percentage of cells expressing eGFP in later experiments.

[0074] FIG. 10 depicts a plot correlating in vitro HA expression in human myoblasts against in vivo HAI titers.

[0075] FIGs. 11A-11 B depict the impact of mRNA modification on HA protein expression in primary human myoblasts (HSMM). FIG. 11A depicts immunofluorescence images of HSMMs transfected with three different LNPs with modified (MNR) and unmodified (UNR) mRNA. FIG. 11 B graphically depicts H3 protein expression from the transfection of HSMMs.

[0076] FIG. 12 depicts a plot of mRNA puncta as assessed by single-molecule fluorescence in situ hybridization (smFISH) against antigen expression.DETAILED DESCRIPTION OF THE DISCLOSURE

[0077] The present disclosure is directed to, inter alia, an in vitro system comprising a plurality of isolated human muscle cells and a plurality of lipid-nanoparticle (LNP)- encapsulated messenger RNA (mRNA), wherein the plurality of LNP-encapsulated mRNA contacts the plurality of isolated human muscle cells in vitro and transfect the isolated human muscle cells. Also provided are methods of screening LNP- encapsulated mRNA for polypeptide or protein expression, the methods comprising: a) contacting a plurality of isolated human muscle cells with a plurality of lipid-nanoparticle (LNP)-encapsulated messenger RNA (mRNA), wherein the plurality of LNP-encapsulated mRNA contact the plurality of isolated human muscle cells in vitro and transfect the isolated human muscle cells and b) detecting the polypeptide or protein expression.

[0078] The present disclosure provides a quality control system for mRNA-LNP formulations, utilizing isolated human muscle cells that closely replicate transfection efficiency results in human subjects administered mRNA-LNP formulations via intramuscular injection. The recited quality control system is less expensive, yet of similar reliability, to the commonly used NHP model. The instantly described in vitro quality control system may be used to ensurecommercial lots of mRNA-LNP formulations meet select quality criteria, such as polypeptide or protein expression levels.I. Definitions

[0079] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure. In case of conflict, the present specification, including definitions, will control. Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicinal and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Throughout this specification and embodiments, the words “have” and “comprise,” or variations such as “has,” “having,” “comprises,” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents forms part of the common general knowledge in the art.

[0080] It is to be noted that the term “a” or “an” entity refers to one or more of that entity; for example, “a nucleotide sequence,” is understood to represent one or more nucleotide sequences. As such, the terms “a” (or “an”), “one or more,” and “at least one” can be used interchangeably herein.

[0081] Furthermore, “and / or,” where used herein, is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended toinclude “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0082] It is understood that wherever aspects are described herein with the language “comprising,” otherwise analogous aspects described in terms of “consisting of” and / or “consisting essentially of” are also provided.

[0083] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press, may provide one of skill with a general dictionary of many of the terms used in this disclosure.

[0084] Units, prefixes, and symbols are denoted in their International System of Units (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, amino acid sequences are written left to right in amino to carboxy orientation. The headings provided herein are not limitations of the various aspects of the disclosure. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.

[0085] The terms “approximately” or “about” are used herein to mean roughly, around, or in the regions of. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” can modify a numerical value above and below the stated value by a variance of, e.g., 10 percent, up or down (higher or lower). In some embodiments, the term indicates deviation from the indicated numerical value by ±10%, ±5%, ±4%, ±3%, ±2%, ±1 %, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ±0.5%, ±0.4%, ±0.3%, ±0.2%, ±0.1 %, ±0.05%, or ±0.01 %. In some embodiments, “about” indicates deviation from the indicated numerical value by ±10%. In some embodiments, “about” indicates deviation from the indicated numerical value by ±5%. In some embodiments, “about” indicates deviation from the indicated numerical value by ±4%. In some embodiments, “about” indicatesdeviation from the indicated numerical value by ±3%. In some embodiments, “about” indicates deviation from the indicated numerical value by ±2%. In some embodiments, “about” indicates deviation from the indicated numerical value by ±1 %. In some embodiments, “about” indicates deviation from the indicated numerical value by ±0.9%. In some embodiments, “about” indicates deviation from the indicated numerical value by ±0.8%. In some embodiments, “about” indicates deviation from the indicated numerical value by ±0.7%. In some embodiments, “about” indicates deviation from the indicated numerical value by ±0.6%. In some embodiments, “about” indicates deviation from the indicated numerical value by ±0.5%. In some embodiments, “about” indicates deviation from the indicated numerical value by ±0.4%. In some embodiments, “about” indicates deviation from the indicated numerical value by ±0.3%. In some embodiments, “about” indicates deviation from the indicated numerical value by ±0.1 %. In some embodiments, “about” indicates deviation from the indicated numerical value by ±0.05%. In some embodiments, “about” indicates deviation from the indicated numerical value by ±0.01 %.

[0086] As used herein, the terms “messenger RNA” or “mRNA” refer to a polynucleotide that encodes at least one polypeptide. mRNA, as used herein, encompasses both modified and unmodified RNA. mRNA may contain one or more coding and noncoding regions. A coding region is alternatively referred to as an open reading frame (ORF). Non-coding regions in mRNA include the 5’ cap, 5’ untranslated region (UTR), 3’ UTR, and a poly(A) tail. mRNA can be purified from natural sources, produced using recombinant expression systems (e.g., in vitro transcription) and optionally purified, or chemically synthesized.

[0087] As used herein, the term “immune response” refers to a response of a cell of the immune system, such as a B cell, T cell, dendritic cell, macrophage, or polymorphonucleocyte to a stimulus such as an antigen or vaccine. An immune response can include any cell of the body involved in a host defense response, including, for example, an epithelial cell that secretes an interferon or a cytokine. An immune response includes, but is not limited to, an innate and / or adaptive immune response.

[0088] As used herein, a “protective immune response” refers to an immune response that protects a subject from infection (e.g., prevents infection or prevents thedevelopment of disease associated with infection). Methods of measuring immune responses include, for example, measuring proliferation and / or activity of lymphocytes (such as B or T cells), secretion of cytokines or chemokines, inflammation, antibody production, and the like.

[0089] As used herein, an “antibody response” is an immune response in which antibodies are produced.

[0090] As used herein, an “antigen” refers to an agent that elicits an immune response, and / or an agent that is bound by a T cell receptor (e.g., when presented by an MHC molecule) or to an antibody (e.g., produced by a B cell) when exposed or administered to an organism. In some embodiments, an antigen elicits a humoral response (e.g., including production of antigen-specific antibodies) in an organism. Alternatively, or additionally, in some embodiments, an antigen elicits a cellular response (e.g., involving T-cells whose receptors specifically interact with the antigen) in an organism. A particular antigen may elicit an immune response in one or several members of a target organism (e.g., mice, rabbits, primates, or humans), but not in all members of the target organism species. In some embodiments, an antigen elicits an immune response in at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the members of a target organism species. In some embodiments, an antigen binds to an antibody and / or T cell receptor and may or may not induce a particular physiological response in an organism. In some embodiments, for example, an antigen may bind to an antibody and / or to a T cell receptor in vitro, whether or not such an interaction occurs in vivo. In some embodiments, an antigen reacts with the products of specific humoral or cellular immunity.

[0091] As used herein, an “adjuvant” refers to a substance or vehicle that enhances the immune response to an antigen. Adjuvants can include, without limitation, a suspension of minerals (e.g., alum, aluminum hydroxide, or phosphate) on which antigen is adsorbed; a water-in-oil or oil-in-water emulsion in which antigen solution is emulsified in mineral oil or in water (e.g., Freund’s incomplete adjuvant). Sometimes, killed mycobacteria is included (e.g., Freund’s complete adjuvant) to further enhance antigenicity. Immuno-stimulatory oligonucleotides (e.g., a CpG motif) can also be used as adjuvants (for example, see U.S. Patent Nos. 6, 194,388;6,207,646; 6,214,806; 6,218,371 ; 6,239,116; 6,339,068; 6,406,705; and 6,429,199). Adjuvants can also include biological molecules, such as toll-like receptor (TLR) agonists and costimulatory molecules.

[0092] As used herein, a “subject” refers to any member of the animal kingdom. In some embodiments, “subject” refers to humans. In some embodiments, “subject” refers to non-human animals. In some embodiments, subjects include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or worms. In certain embodiments, the non-human subject is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and / or a pig). In some embodiments, the mammal is a dog, a cat, a llama, a bovine, a sheep, a goat, or a horse. In some embodiments, the mammal is a human. In some embodiments, a subject may be a transgenic animal, genetically engineered animal, and / or a clone. In some embodiments, the terms “individual” or “patient” are used and are intended to be interchangeable with “subject.”

[0093] As used herein, the term “vaccination” or “vaccinate” refers to the administration of a composition intended to generate an immune response, for example, to a disease-causing agent. Vaccination can be administered before, during, and / or after exposure to a disease-causing agent, and / or to the development of one or more symptoms, and in some embodiments, before, during, and / or shortly after exposure to the agent. In some embodiments, vaccination includes multiple administrations, appropriately spaced in time, of a vaccinating composition.

[0094] As used herein, the term “kit” refers to a packaged set of related components, such as one or more compounds or compositions and one or more related materials such as solvents, solutions, buffers, instructions, or desiccants.II. In Vitro Muscle Cells - LNP-Encapsulated mRNA Systems & Methods with the Same

[0095] The instant disclosure is directed to the use of isolated human muscle cells (e.g., human skeletal muscle cells) for the assessment, detection, and / or measurement of polypeptide expression, protein expression, polypeptide production, or protein production from an LNP-encapsulated mRNA. The terms “polypeptide expression”, “protein expression”, “polypeptide production”, or “protein production” can be used interchangeably herein. The in vitro systems comprising isolatedhuman muscle cells or myoblasts and LNP-encapsulated mRNA can provide a readout of polypeptide expression that closely matches or approximates polypeptide expression in a human administered said LNP-encapsulated mRNA. In some embodiments, the readout of polypeptide expression using the in vitro systems provided herein may more closely match polypeptide expression in a human administered said LNP-encapsulated mRNA than a readout generated by a current method using, for example, mice, non-human primates (NHP), HeLa cells, or HEK293 cells. The in vitro systems described herein can display similar polypeptide expression profiles to that of mice, rabbits, ferrets, or NHPs, without the associated cost and time input.

[0096] In one aspect, the disclosure provides an in vitro system comprising: (a) a plurality of isolated human muscle cells; and (b) a plurality of lipid-nanoparticle (LNP)- encapsulated messenger RNA (mRNA), wherein the plurality of isolated LNP- encapsulated mRNA contact the plurality of isolated human muscle cells in vitro and transfect the plurality of isolated human muscle cells.

[0097] Isolated Human Muscle Cells

[0098] In certain embodiments, the isolated human muscle cells include human skeletal muscle cells (HSkMCs). The HSkMCs described herein can replicate the environment that LNP-encapsulated mRNA are exposed to upon intramuscular administration of LNP-encapsulated mRNA to humans, a common administration route for LNP-encapsulated mRNA-based vaccination. The isolated human muscle cells described herein can be maintained under cell culture conditions appropriate for their maintenance and propagation, for example, under the conditions described in Example 4.

[0099] Any HSkMC type is envisioned in the instant disclosure. For example, but in no way limiting, the HSkMCs may comprise any one or more of myocytes, myosatellite cells, and myoblasts (e.g., fetal myoblasts).

[0100] The term “myocyte” is a general term for a muscle cell, including a cardiac muscle cell, a smooth muscle cell, and a skeletal muscle cell. In the context of the instant disclosure, a myocyte corresponds to a skeletal muscle cell (e.g., a human skeletal muscle cell).

[0101] The term “myoblast” refers to an embryonic precursor cell that can differentiate into any one of a skeletal muscle cell, a cardiac muscle cell, or a smooth muscle cell.

[0102] The term “myosatellite cell” refers to a myoblast in skeletal muscle that does not form muscle fibers and dedifferentiates into the myosatellite cell. Myosatellite cells remain adjacent to a skeletal muscle fiber, situated between the sarcolemma and the basement membrane of the endomysium (the connective tissue that divides the muscle fascicles (bundle of muscle fibers) into individual fibers) (see Zammit et al. 2006. J Histochem Cytochem. 54(11 ): 1177-91 , incorporated herein by reference).

[0103] In certain embodiments, the HSkMCs are primary HSkMCs. Primary HSkMCs include HSkMCs that are directly isolated from skeletal muscle tissue. In certain embodiments, the HSkMCs are differentiated primary cells (e.g., myoblasts) isolated from a human donor.

[0104] In various embodiments, the HSkMCs are immortalized HSkMCs. Immortalized HSkMCs include cells that have been manipulated to proliferate indefinitely and can thus be cultured for long periods of time. Suitable methods of immortalizing cells can be used. In some embodiments, the immortalized skeletal muscle cells express SV40 large T antigen. Expression of the SV40 large T antigen can create immortalized cells, in part, by overcoming p53- and pRB-dependent cell cycle arrest (see May et al. Nucleic Acids Res. 2004. 32(18): 5529-5538, incorporated herein by reference).

[0105] In certain embodiments, the immortalized skeletal muscle cells express one or more of cyclin D1 (CCND1 ), cyclin-dependent kinase 4 (CDK4), and telomerase (TERT). Each of CCND1 , CDK4, and TERT have several activities that promote cell division. In various embodiments, the immortalized skeletal muscle cells express CCND1 and CDK4. In some embodiments, the immortalized skeletal muscle cells express CCND1 and TERT. In certain embodiments, the immortalized skeletal muscle cells express CDK4 and TERT. In various embodiments, the immortalized skeletal muscle cells express CCND1 , CDK4, and TERT. The use of CCND1 , CDK4, and TERT to create immortalized skeletal muscle cells is described in Pantic et al. (Exp Cell Res. 2016. 342(1 ): 39-51 ), Arandel et al. (Disease Models & Mechanisms. 2017. 10(4): 487-497), and Thorleyet al. (Skeletal Muscle, volume 6, Article number: 43. 2016), each of which is incorporated herein by reference.

[0106] In certain embodiments, the immortalized skeletal muscle cells express one or more of HPV16 E6 / E7 or adenovirus E1A / E1 B. The use of HPV16 E6 / E7 or adenovirus E1A / E1 B to immortalize cells is described in Halbert et al. (J Virol. 1992 Apr; 66(4): 2125-2134) and Douglas et al. (J Virol. 1995 Dec;69(12):8061 -5), 2016), each of which is incorporated herein by reference.

[0107] For each of the above immortalization factors described above (i.e., SV40 large T antigen, CCND1 , CDK4, TERT, HPV16 E6 / E7 and adenovirus E1A / E1 B), said factors may be introduced into the HSkMCs by any suitable method.

[0108] In some embodiments, the HSkMCs are transfected with an expression vector encoding one or more of SV40 large T antigen, CCND1 , CDK4, TERT, HPV16 E6 / E7, and adenovirus E1A / E1 B. In certain embodiments, one or more of SV40 large T antigen, CCND1 , CDK4, TERT, HPV16 E6 / E7, and adenovirus E1A / E1 B are expressed constitutively from the expression vector. In various embodiments, one or more of SV40 large T antigen, CCND1 , CDK4, TERT, HPV16 E6 / E7, and adenovirus E1 A / E1 B are expressed inducibly from the expression vector.

[0109] In certain embodiments, the HSkMCs are transduced with a viral vector that expresses one or more or SV40 large T antigen, CCND1 , CDK4, TERT, HPV16 E6 / E7, and adenovirus E1A / E1 B. In various embodiments, the viral vector is an adeno-associated virus (AAV). In some embodiments, the viral vector is a lentivirus.

[0110] In other embodiments, the HSkMCs are immortalized by inactivating a tumor suppressor gene, such as p16, p53, and pRb.

[0111] In other embodiments, the HSkMCs are immortalized by fusing said HSkMCs with one or more immortalized cell lines.

[0112] Polypeptides Encoded by the mRNA & Detection of the Same

[0113] In certain embodiments, each of the plurality of LNP-encapsulated mRNA in the in vitro system described herein comprises an mRNA, wherein the mRNA encodes a polypeptide. In certain embodiments, the polypeptide is an antigen. The antigen may be capable of eliciting an immune response in a subject.

[0114] To assess polypeptide expression from the LNP-encapsulated mRNA, the mRNA or the polypeptide encoded by said mRNA may be detected. Detection can be achieved intracellularly (i.e., the polypeptide expressed in the cell), on the surface of the isolated human muscle cells (i.e., the polypeptide is anchored to the cell membrane), and / or in the cell culture media (i.e., the polypeptide is secreted from the isolated human muscle cell).

[0115] In certain embodiments, the polypeptide (e.g., the antigen) is membrane localized on the plurality of isolated human muscle cells. The polypeptide may be modified such that it is directed to the membrane. For example, the polypeptide may be modified to contain a membrane localization sequence and a transmembrane domain.

[0116] In various embodiments, the polypeptide (e.g., the antigen) is secreted from the plurality of isolated human muscle cells. The polypeptide may be modified such that it is secreted out of the cell. For example, the polypeptide may be modified to contain a secretion sequence. In certain embodiments, when the polypeptide is secreted, the polypeptide may not comprise a transmembrane domain.

[0117] In some embodiments, the polypeptide (e.g., the antigen) is detected with an antigen binding protein (e.g., an antibody) that specifically binds to the polypeptide. In certain embodiments, the antigen binding protein comprises a detectable moiety. As used herein, the term “detectable moiety” is a moiety that is linked to the antigen binding protein and is capable of being imaged or otherwise detected.

[0118] In certain embodiments, the detectable moiety is a small molecule label, e.g., a fluorophore, a chromophore, a spin resonance probe, an imaging agent, or a radiolabel. Exemplary fluorophores include fluorescent dyes (e.g., fluorescein, rhodamine, and the like) and other luminescent molecules (e.g., luminal). A fluorophore may be environmentally- sensitive such that its fluorescence changes if it is located close to one or more residues in the modified antigen-binding protein that undergo structural changes upon binding a substrate (e.g., dansyl probes). Exemplary radiolabels include small molecules containing atoms with one or more low sensitivity nuclei. The radionuclide can be, for example, a gamma, photon, or positron-emitting radionuclide with a half-life suitable to permit activity or detection after the elapsed time between administration and localization to the imaging site.

[0119] In various embodiments, the detectable moiety is a polypeptide. Exemplary detectable polypeptides include enzymes with fluorogenic or chromogenic activity, e.g., the ability to cleave a substrate which forms a fluorophore or chromophore as a product (i.e. , reporter proteins such as luciferase). Other detectable proteins may have intrinsic fluorogenic or chromogenic activity (e.g., green, red, and yellow fluorescent bioluminescent aequorin proteins from bioluminescent marine organisms, i.e., green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), or Discosoma Red (dsRed)), or they may comprise a protein containing one or more low-energy radioactive nuclei (13C,15N, 2H,125l,124l,123l, "Tc,43K,52Fe,64Cu,68Ga,111In, and the like).

[0120] Multi-Vessel In Vitro Systems

[0121] In another aspect, the disclosure provides a multi-vessel in vitro system comprising a plurality of isolated human muscle cells contained within at least two separate vessels, wherein each of the at least two separate vessels comprises a plurality of lipid-nanoparticle (LNP)-encapsulated messenger RNA (mRNA), the plurality of LNP-encapsulated mRNA comprising an LNP, wherein the LNP comprises a unique composition of lipids in each vessel.

[0122] The multi-vessel in vitro system described herein may be useful for screening the activity of different lipids in the LNP of an LNP-mRNA formulation. For example, each vessel may contain a unique composition of lipids in the LNP, thereby allowing for the determination of activity of each LNP.

[0123] In certain embodiments, the LNP comprises at least one cationic lipid, wherein each of the at least two separate vessels comprises an LNP with a different cationic lipid. In various embodiments, the LNP further comprises at least one polyethylene glycol (PEG) conjugated (PEGylated) lipid, at least one cholesterol-based lipid, and at least one helper lipid.

[0124] In some embodiments, the LNP comprises at least one polyethylene glycol (PEG) conjugated (PEGylated) lipid, wherein each of the at least two separate vessels comprises an LNP with a different PEGylated lipid. In certain embodiments, the LNP further comprises at least one cationic lipid, at least one cholesterol-based lipid, and at least one helper lipid.

[0125] In certain embodiments, the LNP comprises at least one helper lipid, wherein each of the at least two separate vessels comprises an LNP with a different helper lipid. In certain embodiments, the LNP further comprises at least one cationic lipid, at least one cholesterol-based lipid, and at least one PEGylated lipid.

[0126] Methods of Screening LNP-encapsulated mRNA

[0127] In another aspect, the disclosure provides a method of screening LNP- encapsulated mRNA for polypeptide or protein expression, the method comprising: a) contacting a plurality of isolated human muscle cells with a plurality of lipid- nanoparticle (LNP)-encapsulated messenger RNA (mRNA), wherein the plurality of LNP-encapsulated mRNA contact the plurality of isolated human muscle cells in vitro and transfect the plurality of isolated human muscle cells; and b) detecting polypeptide or protein expression.

[0128] The step of detecting polypeptide or protein expression may be employed as described herein under “Polypeptides Encoded by the mRNA & Detection of the Same.” In the context of a fluorescent detectable moiety used to detect the polypeptide expressed from the mRNA, step b) can be performed by fluorescence- activated cell sorting (FACS). When the polypeptide is secreted from the isolate human muscle cells into the cell culture media, step b) may comprise detecting the polypeptide in the cell culture media. In certain embodiments, the polypeptide can be detected by a western blot. In various embodiments, the polypeptide may be detected by an enzyme linked immunosorbent assay (ELISA) or immunofluorescence imaging (IF).

[0129] Methods of Producing LNP-encapsulated mRNA

[0130] In another aspect, the disclosure provides a method of producing a validated lipid- nanoparticle (LNP)-encapsulated messenger RNA (mRNA), the method comprising: a) mixing LNPs or LNP-forming lipids with mRNAs, thereby forming LNP-encapsulated mRNAs; b) contacting a plurality of isolated human muscle cells with the LNP-encapsulated mRNAs; and c) detecting polypeptide expression (i.e., from the LNP-encapsulated mRNAs) in the plurality of isolated human muscle cells to validate guality or integrity of the LNP-encapsulated mRNA. The guality or integrity may be validated if the polypeptide expression (e.g., from the LNP-encapsulated mRNA) is detected above a baseline value. As used herein, the term “validated LNP-encapsulated mRNA” refers to an LNP-encapsulated mRNA that is capable of transfecting a human skeletal muscle cell (either in vitro or in vivo) and that results in detectable expression of polypeptide (e.g., protein) from the LNP- encapsulated mRNAs. A plurality of validated LNP-encapsulated mRNAs may be administered to a subject.

[0131] The above recited method can be useful as a quality control assay for determining or validating one or more quality metrics in an LNP-mRNA formulation or in LNP- encapsulated mRNAs. Along with polypeptide expression quality metrics include, but are not limited to, mRNA stability, LNP stability, LNP-mRNA formulation or LNP-encapsulated mRNA potency, and toxicity or adverse immunoreactions associated with administration of the LNP-mRNA formulation or LNP-encapsulated mRNAs. Quality metrics such as mRNA stability, LNP stability, and LNP-mRNA formulation or LNP-encapsulated mRNA potency can be extrapolated from the polypeptide expression results of the assay. With respect to toxicity or adverse immunoreactions, cell cytotoxicity may be detected from a population of isolated human muscle cells upon incubation with the LNP-mRNA formulation or LNP- encapsulated mRNAs.

[0132] Numerous lots of LNP-encapsulated mRNA may be produced for future commercial use (e.g., LNP-encapsulated mRNA for vaccination through intramuscular administration). Each lot of LNP-encapsulated mRNA may be validated and allowed to be used for therapy based on the results of that lot in one or more of the above-described assays (i.e. , based on polypeptide expression in the isolated human muscle cells).

[0133] In another aspect, the disclosure provides an LNP-encapsulated mRNA produced by the method described above.Methods of Screening LNP-Encapsulated mRNA in HSKMs to Predict In Vivo Polypeptide Expression or Antibody Response

[0134] In another aspect, the disclosure provides methods of screening LNP- encapsulated mRNA to predict in vivo polypeptide expression (e.g., protein expression or antigen expression) or antibody response. In some embodiments, the methods may comprise: a) contacting a plurality of isolated human muscle cellsor myoblasts with a plurality of LNP-encapsulated mRNA, wherein the plurality of LNP-encapsulated mRNA contact the plurality of isolated human muscle cells or myoblasts in vitro and transfect the plurality of isolated human muscle cells or myoblasts and b) detecting the presence of mRNA (e.g., the LNP-encapsulated mRNA) in the plurality of isolated human muscle cells or myoblasts. In some embodiments, b) may include assessing, detecting, and / or measuring in vitro mRNA accumulation and / or mRNA uptake in the plurality of isolated human muscle cells or myoblasts. In various embodiments, the methods may further comprise c) detecting in vitro polypeptide expression.

[0135] In certain embodiments, the methods may include d) correlating the in vitro mRNA accumulation and / or the mRNA uptake with in vitro polypeptide expression or antibody response. The methods may further include e) correlating the in vitro polypeptide expression with in vivo polypeptide expression or antibody response.

[0136] The in vitro mRNA accumulation and / or mRNA uptake and / or the in vitro polypeptide expression may be predictive of in vivo polypeptide expression and / or of an antibody response to in vivo polypeptide expression. In certain embodiments, the antibody response may correspond to antibody titers.

[0137] In some embodiments, the methods may further comprise studying a mechanism of action. That is, mechanistic studies such as, visualizing LNP / mRNA uptake and trafficking by live imaging, smFISH, or immunofluorescence (IF) and protein trafficking studies can be performed in the plurality of human muscle cells or myoblasts.

[0138] There may be a correlation between 1 ) in vitro polypeptide expression (e.g., in isolated human muscle cells or myoblasts) and 2) in vivo polypeptide expression or antibody response (e.g., in a model system such as mice, rats, rabbits, ferrets, NHPs, or human subjects). In some embodiments, there may be a correlation between 1 ) in vitro mRNA accumulation, mRNA uptake, and / or polypeptide expression (e.g., in isolated human muscle cells or myoblasts) and 2) in vivo antibody response (e.g., in a model system such as mice, rats, rabbits, ferrets, NHPs, or human subjects). In vitro polypeptide expression may be predictive of an in vivo response (e.g., in vitro polypeptide expression may be correlative of in vivo polypeptide expression or antibody response / titers).III. RNA

[0139] The mRNA component of the mRNA-LNP formulations of the present disclosure comprises at least one ribonucleic acid (RNA) comprising an ORF encoding a polypeptide. In certain embodiments, the RNA is a messenger RNA (mRNA) comprising an open reading frame encoding a polypeptide. In certain embodiments, the RNA (e.g., mRNA) further comprises at least one 5’ UTR, 3’ UTR, poly(A) tail, and / or 5’ cap.II. A. 5’ Cap

[0140] An mRNA 5’ cap can provide resistance to nucleases found in most eukaryotic cells and promote translation efficiency. Suitable types of 5’ caps can be used. A 7-methylguanosine cap (also referred to as “m7G” or “Cap-0”) comprises a guanosine that is linked through a 5’ - 5’ - triphosphate bond to the first transcribed nucleotide.

[0141] A 5’ cap can be added as follows: first, an RNA terminal phosphatase can be used to remove one of the terminal phosphate groups from the 5’ nucleotide, leaving two terminal phosphates; guanosine triphosphate (GTP) can then be added to the terminal phosphates via a guanylyl transferase, producing a 5 ‘5 ‘5 triphosphate linkage; and the 7-nitrogen of guanine can then be methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5’)ppp, (5’(A,G(5’)ppp(5’)A, and G(5’)ppp(5’)G. Additional cap structures are described in U.S. Publication No. US 2016 / 0032356 and U.S. Publication No. US 2018 / 0125989, which are incorporated herein by reference.

[0142] 5’-capping of polynucleotides may be completed concomitantly during the in vitro- transcription reaction using the following chemical RNA cap analogs to generate the 5’-guanosine cap structure according to manufacturer protocols: 3’-0-Me- m7G(5’)ppp(5’)G (the ARCA cap); G(5’)ppp(5’)A; G(5’)ppp(5’)G; m7G(5’)ppp(5’)A; m7G(5’)ppp(5’)G; m7G(5’)ppp(5’)(2’OMeA)pG; m7G(5’)ppp(5’)(2’OMeA)pU; m7G(5’)ppp(5’)(2’OMeG)pG (New England BioLabs, Ipswich, MA; TriLink Biotechnologies). 5’-capping of modified RNA may be completed post- transcriptionally using a vaccinia virus capping enzyme to generate the Cap-0 structure: m7G(5’)ppp(5’)G. Cap-1 structure may be generated using both vaccinia virus capping enzyme and a 2’-0 methyl-transferase to generate m7G(5’)ppp(5’)G-2’-0-methyl. Cap 2 structure may be generated from the Cap-1 structure followed by the 2’-O-methylation of the 5’-antepenultimate nucleotide using a 2’-0 methyltransferase. Cap 3 structure may be generated from the Cap 2 structure followed by the 2’-O-methylation of the 5’-preantepenultimate nucleotide using a 2’-0 methyl-transferase.

[0143] In certain embodiments, the mRNA of the disclosure comprises a 5’ cap selected from the group consisting of 3’-O-Me-m7G(5’)ppp(5’)G (the ARCA cap), G(5’)ppp(5’)A, G(5’)ppp(5’)G, m7G(5’)ppp(5’)A, m7G(5’)ppp(5’)G, m7G(5’)ppp(5’)(2’OMeA)pG, m7G(5’)ppp(5’)(2’OMeA)pU, and m7G(5’)ppp(5’)(2’OMeG)pG.

[0144] In certain embodiments, the mRNA of the disclosure comprises a 5’ cap of:II. B. Untranslated Region (UTR)

[0145] In some embodiments, the mRNA of the disclosure includes a 5’ and / or 3’ untranslated region (UTR). In mRNA, the 5’ UTR may start at the transcription start site and continue to the start codon but not include the start codon. In mRNA, the 3’ UTR may start immediately following the stop codon and continue until the transcriptional termination signal.

[0146] In certain embodiments, the mRNA disclosed herein comprises a 5’ UTR that includes one or more elements that affect stability or translation of the mRNA. In various embodiments, a 5’ UTR may be about 10 to 5,000 nucleotides in length. In some embodiments, a 5’ UTR may be about 50 to 500 nucleotides in length. In certain embodiments, the 5’ UTR is at least about 10 nucleotides in length, about 20 nucleotides in length, about 30 nucleotides in length, about 40 nucleotides in length, about 50 nucleotides in length, about 100 nucleotides in length, about 150 nucleotides in length, about 200 nucleotides in length, about 250 nucleotides inlength, about 300 nucleotides in length, about 350 nucleotides in length, about 400 nucleotides in length, about 450 nucleotides in length, about 500 nucleotides in length, about 550 nucleotides in length, about 600 nucleotides in length, about 650 nucleotides in length, about 700 nucleotides in length, about 750 nucleotides in length, about 800 nucleotides in length, about 850 nucleotides in length, about 900 nucleotides in length, about 950 nucleotides in length, about 1 ,000 nucleotides in length, about 1 ,500 nucleotides in length, about 2,000 nucleotides in length, about 2,500 nucleotides in length, about 3,000 nucleotides in length, about 3,500 nucleotides in length, about 4,000 nucleotides in length, about 4,500 nucleotides in length, or about 5,000 nucleotides in length.

[0147] In various embodiments, the mRNA disclosed herein comprise a 3’ UTR comprising one or more of a polyadenylation signal, a binding site for proteins that affect an mRNA’s stability of location in a cell, or one or more binding sites for miRNAs. In some embodiments, a 3’ UTR may be about 50 to 5,000 nucleotides in length or longer. In certain embodiments, a 3’ UTR may be about 50 to 1 ,000 nucleotides in length or longer. In various embodiments, the 3’ UTR is at least about 50 nucleotides in length, about 100 nucleotides in length, about 150 nucleotides in length, about 200 nucleotides in length, about 250 nucleotides in length, about 300 nucleotides in length, about 350 nucleotides in length, about 400 nucleotides in length, about 450 nucleotides in length, about 500 nucleotides in length, about 550 nucleotides in length, about 600 nucleotides in length, about 650 nucleotides in length, about 700 nucleotides in length, about 750 nucleotides in length, about 800 nucleotides in length, about 850 nucleotides in length, about 900 nucleotides in length, about 950 nucleotides in length, about 1 ,000 nucleotides in length, about 1 ,500 nucleotides in length, about 2,000 nucleotides in length, about 2,500 nucleotides in length, about 3,000 nucleotides in length, about 3,500 nucleotides in length, about 4,000 nucleotides in length, about 4,500 nucleotides in length, or about 5,000 nucleotides in length. In some embodiments, the mRNA disclosed herein may comprise a 5’ or 3’ UTR that is derived from a gene distinct from the one encoded by the mRNA transcript (i.e., the UTR is a heterologous UTR).

[0148] In certain embodiments, the 5’ and / or 3’ UTR sequences are derived from mRNA which are stable (e.g., globin, actin, GAPDH, tubulin, histone, or citric acid cycleenzymes) to increase the stability of the mRNA. For example, a 5’ UTR sequence may include a partial sequence of a CMV immediate-early 1 (IE1 ) gene, or a fragment thereof, to improve the nuclease resistance and / or improve the half-life of the mRNA. Also contemplated is the inclusion of a sequence encoding human growth hormone (hGH), or a fragment thereof, to the 3’ end or untranslated region of the mRNA. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the mRNA relative to their unmodified counterparts, and include, for example, modifications made to improve such mRNA resistance to in vivo nuclease digestion.

[0149] Exemplary 5’ UTRs include a sequence derived from a CMV immediate-early 1 (IE1 ) gene (U.S. Publication Nos. 2014 / 0206753 and 2015 / 0157565, each of which is incorporated herein by reference), or the sequence GGGAUCCUACC (SEQ ID NO: 1 ) (U.S. Publication No. 2016 / 0151409, incorporated herein by reference).

[0150] In various embodiments, the 5’ UTR is derived from the 5’ UTR of a TOP gene. TOP genes are typically characterized by the presence of a 5’-terminal oligopyrimidine (TOP) tract. Furthermore, most TOP genes are characterized by growth-associated translational regulation. However, TOP genes with a tissue specific translational regulation can also be used. In certain embodiments, the 5’ UTR derived from the 5’ UTR of a TOP gene lacks the 5’ TOP motif (the oligopyrimidine tract) (e.g., U.S. Publication Nos. 2017 / 0029847, 2016 / 0304883, 2016 / 0235864, and 2016 / 0166710, each of which is incorporated herein by reference).

[0151] In certain embodiments, the 5’ UTR is derived from a ribosomal protein large 32 (L32) gene (U.S. Publication No. 2017 / 0029847, supra).

[0152] In various embodiments, the 5’ UTR is derived from the 5’ UTR of an hydroxysteroid (17-b) dehydrogenase 4 gene (HSD17B4) (U.S. Publication No. 2016 / 0166710, supra).

[0153] In some embodiments, the 5’ UTR is derived from the 5’ UTR of an ATP5A1 gene (U.S. Publication No. 2016 / 0166710, supra).

[0154] In certain embodiments, an internal ribosome entry site (IRES) is used instead of a 5’ UTR.

[0155] In various embodiments, the 5’ UTR comprises a nucleic acid sequence set forth in SEQ ID NO: 2 and is reproduced below:

[0156] GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAA GACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAAC GCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG.

[0157] In some embodiments, the 3’ UTR comprises a nucleic acid sequence set forth in SEQ ID NO: 3 and is reproduced below:

[0158] CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAA GUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAU C.

[0159] The 5’ UTR and 3’ UTR are described in further detail in International Publication No. WO 2012 / 075040, incorporated herein by reference.II. C. Polyadenylated Tail

[0160] As used herein, the terms “poly(A) sequence,” “poly(A) tail,” or “poly(A) region” are a sequence of adenosine nucleotides at the 3’ end of the mRNA molecule. The poly(A) tail may confer stability to the mRNA and protect it from exonuclease degradation and is also thought to enhance translation. In some embodiments, the poly(A) tail is essentially homopolymeric, e.g., a poly(A) tail of 100 adenosine nucleotides has essentially the length of 100 nucleotides. In some embodiments, the poly(A) tail may be interrupted by at least one nucleotide different from an adenosine nucleotide, e.g., a poly(A) tail of 100 adenosine nucleotides may have a length of more than 100 nucleotides (comprising 100 adenosine nucleotides and, in addition, at least one nucleotide, or a stretch of nucleotides, different from an adenosine nucleotide).

[0161] The “poly(A) tail,” as defined herein, typically relates to RNA, however, in the context of the disclosure, the term likewise relates to corresponding sequences in a DNA molecule (e.g., a “poly(T) sequence”).

[0162] The poly(A) tail may comprise about 10 to about 500 adenosine nucleotides, about 10 to about 200 adenosine nucleotides, about 40 to about 200 adenosine nucleotides, or about 40 to about 150 adenosine nucleotides. The length of the poly(A) tail may be at least about 10, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, or 500 adenosine nucleotides.

[0163] In some embodiments where the nucleic acid is an RNA, the poly(A) tail of the nucleic acid is obtained from a DNA template during RNA in vitro transcription. Invarious embodiments, the poly(A) tail is obtained in vitro by common methods of chemical synthesis without being transcribed from a DNA template. In certain embodiments, poly(A) tails are generated by enzymatic polyadenylation of the RNA (after RNA in vitro transcription) using commercially available polyadenylation kits and corresponding protocols, or alternatively, by using immobilized poly(A) polymerases, e.g., using methods and means as described in International Publication No. WO 2016 / 174271. Other suitable methods of generating or obtaining a poly(A) tail are also within the scope of the present disclosure.

[0164] The nucleic acid may comprise a poly(A) tail obtained by enzymatic polyadenylation, wherein the majority of nucleic acid molecules comprise about 100 (+ / -20) to about 500 (+ / -50), or about 250 (+ / -20) adenosine nucleotides.

[0165] In some embodiments, the nucleic acid may comprise a poly(A) tail derived from a template DNA and may additionally comprise at least one additional poly(A) tail generated by enzymatic polyadenylation, e.g., as described in International Publication No. WO 2016 / 091391.

[0166] In further embodiments, the nucleic acid comprises at least one polyadenylation signal.

[0167] In certain embodiments, the nucleic acid may comprise at least one poly(C) sequence.

[0168] The term “poly(C) sequence,” as used herein, is intended to be a sequence of cytosine nucleotides of up to about 200 cytosine nucleotides. In some embodiments, the poly(C) sequence comprises about 10 to about 200 cytosine nucleotides, about 10 to about 100 cytosine nucleotides, about 20 to about 70 cytosine nucleotides, about 20 to about 60 cytosine nucleotides, or about 10 to about 40 cytosine nucleotides. In an exemplary embodiment, the poly(C) sequence comprises about 30 cytosine nucleotides.II. D. Chemical Modification

[0169] The mRNA disclosed herein may be modified or unmodified. In some embodiments, the mRNA disclosed herein may contain one or more modifications that typically enhance RNA stability. Exemplary modifications include backbone modifications, sugar modifications, or base modifications. In some embodiments, the disclosed mRNA may be synthesized from naturally occurring nucleotidesand / or nucleotide analogues (modified nucleotides) including, but not limited to, purines (adenine (A) or guanine (G)) or pyrimidines (thymine (T), cytosine (C), or uracil (U)), and as modified nucleotides analogues or derivatives of purines and pyrimidines, such as, e.g., 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6- isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio- cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6- diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7- methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2 -thio-uracil, 5- (carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5- carboxymethylaminomethyl-uracil, 5-methyl-2 -thio-uracil, 5-methyl-uracil, N-uracil- 5-oxy acetic acid methyl ester, 5-methylaminomethyl-uracil, 5- methoxyaminomethyl-2 -thio-uracil, 5’-methoxycarbonylmethyl-uracil, 5-methoxy- uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl- pseudouracil, queosine, [3-D-mannosyl-queosine, phosphoram idates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine.

[0170] In certain embodiments, the disclosed mRNA comprises at least one chemical modification including, but not limited to, pseudouridine, N1 -methylpseudoundine, 2-thiouridine, 4’-thiouridine, 5-methylcytosine, 2-thio-l-methyl-1-deaza- pseudouridine, 2-thio-l-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio- dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2- thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-l-methyl-pseudouridine, 4- thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5- methyluridine, 5-methoxyuridine, and 2’-O-methyl uridine.

[0171] In various embodiments, the chemical modification is selected from the group consisting of pseudouridine, N1 -methylpseudouridine, 5-methylcytosine, 5- methoxyuridine, and a combination thereof.

[0172] In some embodiments, the chemical modification comprises N1- methylpseudouridine.

[0173] The preparation of such analogues may be as provided in U.S. Pat. No. 4,373,071 , U.S. Pat. No. 4,401 ,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat.No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530, and U.S. Pat. No. 5,700,642.II. E. mRNA Synthesis

[0174] The mRNAs disclosed herein may be synthesized according to any of a variety of suitable methods. For example, mRNAs according to the present disclosure may be synthesized via in vitro transcription (IVT). Methods for IVT are known (see, e.g., Geall et al. (2013) Semin. Immunol. 25(2): 152-159 and Brunelle et al. (2013) Methods Enzymol. 530:101 -14). Briefly, IVT is typically performed with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNase I, pyrophosphatase, and / or RNase inhibitor. The exact conditions will vary according to the specific application. The presence of these reagents may be undesirable in a final mRNA product and, accordingly, may be considered impurities or contaminants which must be purified (e.g., removed) to provide a clean and homogeneous mRNA that is suitable for therapeutic use. While mRNA provided from in vitro transcription reactions may be desirable in some embodiments, other sources of mRNA can be used according to the instant disclosure, including wildtype mRNA produced from bacteria, fungi, plants, and / or animals.IV. Lipid Nanoparticle (LNP)

[0175] The LNPs of the disclosure may comprise four categories of lipids: (i) an ionizable lipid (e.g., cationic lipid); (ii) a PEGylated lipid; (iii) a cholesterol-based lipid (e.g., cholesterol), and (iv) a helper lipid.A. Cationic Lipid

[0176] An ionizable lipid can facilitate mRNA encapsulation and may be a cationic lipid. A cationic lipid affords a positively charged environment at low pH to facilitate efficient encapsulation of the negatively charged mRNA drug substance. Exemplary cationic lipids are shown below in Table 1.

[0177] Table 1: Cationic lipids

[0178] The cationic lipid may be selected from the group comprising [ckkE10] I [OF-02], [(6Z,9Z,28Z,31 Z)-heptatriaconta-6,9,28,31 -tetraen-19-yl] 4-(dimethylamino)butanoate (D-Lin-MC3-DMA); 2,2-dilinoleyl-4- dimethylaminoethyl-[1 ,3]-dioxolane (DLin-KC2-DMA); 1 ,2-dilinoleyloxy-N,N- dimethyl-3-aminopropane (DLin-DMA); di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319); 9-heptadecanyl 8-{(2- hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate (SM-102); [(4- hydroxybutyl)azanediyl]di(hexane-6,1-diyl) bis(2-hexyldecanoate) (ALC-0315); [3- (dimethylamino)-2-[(Z)-octadec-9-enoyl]oxypropyl] (Z)-octadec-9-enoate(DODAP); 2,5-bis(3-aminopropylamino)-N-[2-[di(heptadecyl)amino]-2- oxoethyl]pentanamide (DOGS); [(3S,8S,9S, 10R, 13R, 14S, 17R)-10, 13-dimethyl- 17-[(2R)-6-methylheptan-2-yl]-2,3,4,7,8,9, 11 ,12,14,15,16,17-dodecahydro-1 H- cyclopenta[a]phenanthren-3-yl] N-[2-(dimethylamino)ethyl]carbamate (DC-Chol); tetrakis(8-methylnonyl) 3,3',3",3'"-(((methylazanediyl) bis(propane-3,1 diyl))bis (azanetriyl))tetrapropionate (3060i10); decyl (2-(dioctylammonio)ethyl) phosphate (9A1 P9); ethyl 5,5-di((Z)-heptadec-8-en-1 -y l)-1 -(3-(pyrro lid in-1 -y l)propy l)-2 , 5- dihydro-1 H-imidazole-2-carboxylate (A2-lso5-2DC18); bis(2-(dodecyldisulfanyl)ethyl) 3,3'-((3-methyl-9-oxo-10-oxa-13, 14-d ith ia-3, 6-diazahexacosyl)azanediyl)dipropionate (BAME-016B); 1 , 1 '-((2-(4-(2-((2-(bis(2- hydroxydodecyl)amino)ethyl) (2-hydroxydodecyl)amino)ethyl) piperazin-1 - yl)ethyl)azanediyl) bis(dodecan-2-ol) (C12-200); 3,6-bis(4-(bis(2- hydroxydodecyl)amino)butyl)piperazine-2, 5-dione (cKK-E12); hexa(octan-3-yl) 9,9',9",9m,9"",9m"-((((benzene-1 ,3,5-tricarbonyl)yris(azanediyl)) tris (propane-3,1 - diyl)) tris(azanetriyl))hexanonanoate (FTT5); (((3,6-dioxopiperazine-2,5- diyl)bis(butane-4, 1 -diyl))bis(azanetriyl))tetrakis(ethane-2, 1 -diyl)(9Z,9'Z,9"Z,9'"Z, 12Z, 12'Z, 12"Z, 12"'Z)-tetrakis (octadeca-9, 12-dienoate) (OF-Deg- Lin); TT3; N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1 ,3,5-tricarboxamide; N1 -[2-((1 S)-1 -[(3-aminopropyl)amino]-4-[di(3- am inopropyl)am ino]butylcarboxam ido)ethyl]-3,4-di[oleyloxy]-benzam ide (MVL5); heptadecan-9-yl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (Lipid 5); and combinations thereof.

[0179] In certain embodiments, the cationic lipid is biodegradable. In some embodiments, the cationic lipid is not biodegradable. In various embodiments, the cationic lipid is cleavable. In certain embodiments, the cationic lipid is not cleavable.

[0180] Cationic lipids are described in further detail in Dong et al. (PNAS. 111 (11 ): 3955- 60. 2014); Fenton et al. (Adv Mater. 28:2939. 2016); WO2016205691 ; U.S. Pat. No. 9,512,073; and U.S. Pat. No. 10,201 ,618, each of which is incorporated herein by reference. Exemplary cationic lipids disclosed in Fenton 2016 and WO201 6205691 include CKK-E18-1 (also designated as OF-00) and CKK-E18-3 (also designated as OF-03). Exemplary cationic lipid CKK-E12 is further described in U.S. Pat. No. 9,512,073. Exemplary cationic lipid cOrn-EE1 is disclosed in WO20231 11262 and WO2023102373, each of which is incorporated herein by reference.B. PEGylated Lipid

[0181] The PEGylated lipid component may provide control over particle size and stability of the nanoparticle. The addition of such components may prevent complex aggregation and provide a means for increasing circulation lifetime and increasing the delivery of the lipid-nucleic acid pharmaceutical composition to target tissues (Klibanov et al. FEBS Letters 268(1 ):235-7. 1990). These components may beselected to rapidly exchange out of the pharmaceutical composition in vivo (see, e.g., U.S. Pat. No. 5,885,613).

[0182] Contemplated PEGylated lipids include, but are not limited to, a polyethylene glycol (PEG) chain of up to 5 kDa in length covalently attached to a lipid with alkyl chain(s) of C6-C20 (e.g., Cs, C10, C12, Ci 4, C , or Cis) length, such as a derivatized ceramide (e.g., N-octanoyl-sphingosine-1 -[succinyl(methoxypolyethylene glycol)] (C8 PEG ceramide)). In some embodiments, the PEGylated lipid is 1 ,2-dimyristoyl-rac- glycero-3-methoxypolyethylene glycol (DMG-PEG); 1 ,2-distearoyl-sn-glycero-3- phosphoethanolamine-polyethylene glycol (DSPE-PEG); 1 ,2-dilauroyl-sn-glycero- 3-phosphoethanolamine-polyethylene glycol (DLPE-PEG); 1 ,2-distearoyl-rac- glycero-polyethelene glycol (DSG-PEG), PEG-DAG; PEG-PE; PEG-S-DAG; PEG- S-DMG; PEG-cer; a PEG-dialkyoxypropylcarbamate; 2-[(polyethylene glycol)- 2000]-N,N-ditetradecylacetamide (ALC-0159); and combinations thereof.

[0183] In certain embodiments, the PEG has a high molecular weight, e.g., 2000-2400 g / mol. In certain embodiments, the PEG is PEG2000 (or PEG-2K). In certain embodiments, the PEGylated lipid herein is DMG-PEG2000, DSPE-PEG2000, DLPE-PEG2000, DSG-PEG2000, or C8 PEG2000.C. Cholesterol-Based Lipid

[0184] The cholesterol component can provide stability to the lipid bilayer structure within the nanoparticle. In some embodiments, the LNPs comprise one or more cholesterol-based lipids. Suitable cholesterol-based lipids include, for example: DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), l,4-bis(3-N-oleylamino- propyl)piperazine (Gao et al., Biochem Biophys Res Comm. (1991 ) 179:280; Wolf et al., BioTechniques (1997) 23:139; U.S. Pat. 5,744,335), imidazole cholesterol ester (“ICE”; WO 2011 / 068810), sitosterol (22,23-dihydrostigmasterol), [3- sitosterol, sitostanol, fucosterol, stigmasterol (stigmasta-5,22-dien-3-ol), ergosterol; desmosterol (3[3-hydroxy-5,24-cholestadiene); lanosterol (8,24- lanostadien-3b-ol); 7-dehydrocholesterol (A5,7-cholesterol); dihydrolanosterol (24,25-dihydrolanosterol); zymosterol (5a-cholesta-8,24-dien-3[3-ol); lathosterol (5a-cholest-7-en-3[3-ol); diosgenin ((3[3,25R)-spirost-5-en-3-ol); campesterol (campest-5-en-3[3-ol); campestanol (5a-campestan-3[3-ol); 24-methylene cholesterol (5,24(28)-cholestadien-24-methylen-3[3-ol); cholesteryl margarate(cholest-5-en-3[3-yl heptadecanoate); cholesteryl oleate; cholesteryl stearate; and other modified forms of cholesterol. In some embodiments, the cholesterol-based lipid used in the LNPs is cholesterol.D. Helper Lipid

[0185] A helper lipid can enhance the structural stability of the LNP and help the LNP in endosome escape. A helper lipid can improve uptake and release of the mRNA drug payload. In some embodiments, the helper lipid is a zwitterionic lipid, which has fusogenic properties for enhancing uptake and release of the drug payload. Examples of helper lipids are 1 ,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE); 1 ,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); 1 ,2-dioleoyl-sn- glycero-3-phospho-L-serine (DOPS); 1 ,2-dielaidoyl-sn-glycero-3- phosphoethanolamine (DEPE); and 1 ,2-dioleoyl-sn-glycero-3-phosphocholine (DPOC), dipalmitoylphosphatidylcholine (DPPC), DMPC, 1 ,2-dilauroyl-sn-glycero- 3-phosphocholine (DLPC), 1 ,2-distearoylphosphatidylethanolamine (DSPE), and 1 ,2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE).

[0186] Other exemplary helper lipids are dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N- maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), phosphatidylserine, sphingolipids, sphingomyelins, ceramides, cerebrosides, gangliosides, 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1 -trans PE, l-stearoyl- 2-oleoyl-phosphatidyethanolamine (SOPE), or a combination thereof. In certain embodiments, the helper lipid is DOPE.E. Molar Ratios of the Lipid Components

[0187] The molar ratios of the above components can play a role in the effectiveness of the LNPs in delivering mRNA. The molar ratio of the cationic lipid, the PEGylated lipid, the cholesterol-based lipid, and the helper lipid is A: B: C: D, where A + B + C + D = 100%. In some embodiments, the molar ratio of the cationic lipid in the LNPs relative to the total lipids (i.e., A) is 35-55%, such as 35-50% (e.g., 38-42%such as 40%, or 45-50%). In some embodiments, the molar ratio of the PEGylated lipid component relative to the total lipids (i.e., B) is 0.25-2.75% (e.g., 1 -2% such as 1.5%). In some embodiments, the molar ratio of the cholesterol-based lipid relative to the total lipids (i.e., C) is 20-50% (e.g., 27-30% such as 28.5%, or 38- 43%). In some embodiments, the molar ratio of the helper lipid relative to the total lipids (i.e., D) is 5-35% (e.g., 28-32% such as 30%, or 8-12% such as 10%). In some embodiments, the (PEGylated lipid + cholesterol) components have the same molar amount as the helper lipid. In some embodiments, the LNPs contain a molar ratio of the cationic lipid to the helper lipid that is more than 1 .

[0188] In certain embodiments, the LNP of the disclosure comprises:

[0189] a cationic lipid at a molar ratio of 35% to 55% or 40% to 50% (e.g., a cationic lipid at a molar ratio of 35%, 36%, 37%, 38%, 39%, 40%, 41 % 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, or 55%);

[0190] a polyethylene glycol (PEG) conjugated (PEGylated) lipid at a molar ratio of 0.25% to 2.75% or 1.00% to 2.00% (e.g., a PEGylated lipid at a molar ratio of 0.25%, 0.50%, 0.75%, 1.00%, 1.25%, 1.50%, 1.75%, 2.00%, 2.25%, 2.50%, or 2.75%);

[0191] a cholesterol-based lipid at a molar ratio of 20% to 50%, 25% to 45%, or 28.5% to 43% (e.g., a cholesterol-based lipid at a molar ratio of 20%, 21 %, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or 50%); and

[0192] a helper lipid at a molar ratio of 5% to 35%, 8% to 30%, or 10% to 30% (e.g., a helper lipid at a molar ratio of 5%, 6%, 7%, 8%, 9%, 10%, 11 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21 %, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, or 35%),

[0193] wherein all of the molar ratios are relative to the total lipid content of the LNP.

[0194] In certain embodiments, the LNP comprises: a cationic lipid at a molar ratio of 40%; a PEGylated lipid at a molar ratio of 1 .5%; a cholesterol-based lipid at a molar ratio of 28.5%; and a helper lipid at a molar ratio of 30%.

[0195] In various embodiments, the PEGylated lipid is dimyristoyl-PEG2000 (DMG- PEG2000).

[0196] In some embodiments, the cholesterol-based lipid is cholesterol.

[0197] In certain embodiments, the helper lipid is 1 ,2-dioleoyl-SN-glycero-3- phosphoethanolamine (DOPE).

[0198] In certain embodiments, the LNP comprises: GL-HEPES-E3-E12-DS-4-E10 at a molar ratio of 35% to 55%; DMG-PEG2000 at a molar ratio of 0.25% to 2.75%; cholesterol at a molar ratio of 20% to 50%; and DOPE at a molar ratio of 5% to 35%.

[0199] In various embodiments, the LNP comprises: cKK-E10 at a molar ratio of 35% to 55%; DMG-PEG2000 at a molar ratio of 0.25% to 2.75%; cholesterol at a molar ratio of 20% to 50%; and DOPE at a molar ratio of 5% to 35%.

[0200] In some embodiments, the LNP comprises: SM-102 at a molar ratio of 35% to 55%; DMG-PEG2000 at a molar ratio of 0.25% to 2.75%; cholesterol at a molar ratio of 20% to 50%; and DSPC at a molar ratio of 5% to 35%.

[0201] In certain embodiments, the LNP comprises: ALC-0315 at a molar ratio of 35% to 55%; ALC-0159 at a molar ratio of 0.25% to 2.75%; cholesterol at a molar ratio of 20% to 50%; and DSPC at a molar ratio of 5% to 35%.

[0202] In various embodiments, the LNP comprises: GL-HEPES-E3-E12-DS-4-E10 at a molar ratio of 40%; DMG-PEG2000 at a molar ratio of 1 .5%; cholesterol at a molar ratio of 28.5%; and DOPE at a molar ratio of 30%.

[0203] In some embodiments, the LNP comprises: cKK-E10 at a molar ratio of 40%; DMG- PEG2000 at a molar ratio of 1 .5%; cholesterol at a molar ratio of 28.5%; and DOPE at a molar ratio of 30%.

[0204] In certain embodiments, the LNP comprises: 9-heptadecanyl 8-{(2- hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate (SM-102) at a molar ratio of 50%; 1 ,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) at a molar ratio of 10%; cholesterol at a molar ratio of 38.5%; and 1 ,2-dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG2000) at a molar ratio of 1 .5%.

[0205] In various embodiments, the LNP comprises: (4- hydroxybutyl)azanediyl]di(hexane-6,1 -diyl) bis(2-hexyldecanoate) (ALC-0315) at a molar ratio of 46.3%; 1 ,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) at a molar ratio of 9.4%; cholesterol at a molar ratio of 42.7%; and 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159) at a molar ratio of 1.6%.

[0206] In some embodiments, the LNP comprises: (4-hydroxybutyl)azanediyl]di(hexane- 6,1 -diyl) bis(2-hexyldecanoate) (ALC-0315) at a molar ratio of 47.4%; 1 ,2- distearoyl-sn-glycero-3-phosphocholine (DSPC) at a molar ratio of 10%;cholesterol at a molar ratio of 40.9%; and 2-[(polyethylene glycol)-2000]-N,N- ditetradecylacetamide (ALC-0159) at a molar ratio of 1 .7%.

[0207] In certain embodiments, to calculate the actual amount of each lipid to be put into an LNP formulation, the molar amount of the cationic lipid is first determined based on a desired N / P ratio, where N is the number of nitrogen atoms in the cationic lipid and P is the number of phosphate groups in the mRNA to be transported by the LNP. Next, the molar amount of each of the other lipids is calculated based on the molar amount of the cationic lipid and the molar ratio selected. These molar amounts are then converted to weights using the molecular weight of each lipid.F. Buffer and Other Components

[0208] To stabilize the nucleic acid and / or LNPs (e.g., to prolong the shelf-life of the vaccine product), to facilitate administration of the LNP pharmaceutical composition, and / or to enhance in vivo expression of the nucleic acid, the nucleic acid and / or LNP can be formulated in combination with one or more carriers, targeting ligands, stabilizing reagents (e.g., preservatives and antioxidants), and / or other pharmaceutically acceptable excipients. Examples of such excipients are parabens, thimerosal, thiomersal, chlorobutanol, bezalkonium chloride, and chelators (e.g., EDTA).

[0209] The LNP compositions of the present disclosure can be provided as a frozen liquid form or a lyophilized form. A variety of cryoprotectants may be used, including, without limitation, sucrose, trehalose, glucose, mannitol, mannose, dextrose, and the like. The cryoprotectant may constitute 5-30% (w / v) of the LNP composition. In some embodiments, the LNP composition may comprise trehalose, e.g., at 5- 30% (e.g., 10%) (w / v). Once formulated with the cryoprotectant, the LNP compositions may be frozen (or lyophilized and cryopreserved) at -20°C to -80°C.

[0210] The LNP compositions may be provided to a patient in an aqueous buffered solution - thawed if previously frozen, or if previously lyophilized, reconstituted in an aqueous buffered solution at bedside. The buffered solution typically is isotonic and suitable for, e.g., intramuscular or intradermal injection. In some embodiments, the buffered solution is a phosphate-buffered saline (PBS).V. Processes for Making LNP Vaccines

[0211] The present LNPs can be prepared by various techniques. For example, multilamellar vesicles (MLV) may be prepared according to conventional techniques, such as by depositing a selected lipid on the inside wall of a suitable container or vessel by dissolving the lipid in an appropriate solvent, and then evaporating the solvent to leave a thin film on the inside of the vessel or by spray drying. An aqueous phase may then be added to the vessel with a vortexing motion that results in the formation of MLVs. Unilamellar vesicles (ULV) can then be formed by homogenization, sonication, or extrusion of the multilamellar vesicles. In addition, unilamellar vesicles can be formed by detergent removal techniques.

[0212] Various methods are described in US Patent Application Publication Nos. US 2011 / 0244026, US 2016 / 0038432, US 2018 / 0153822, US 2018 / 0125989, and US 2021 / 0046192 and can be used to practice the present disclosure. One exemplary process entails encapsulating mRNA by mixing it with a mixture of lipids, without first pre-forming the lipids into lipid nanoparticles, as described in US 2016 / 0038432. Another exemplary process entails encapsulating mRNA by mixing pre-formed LNPs with mRNA, as described in US 2018 / 0153822.

[0213] In some embodiments, the process of preparing mRNA-loaded LNPs includes a step of heating one or more of the solutions to a temperature greater than ambient temperature, the one or more solutions being the solution comprising the preformed lipid nanoparticles, the solution comprising the mRNA, and the mixed solution comprising the LNP-encapsulated mRNA. In certain embodiments, the process includes the step of heating one or both of the mRNA solution and the preformed LNP solution prior to the mixing step. In various embodiments, the process includes heating one or more of the solutions comprising the pre-formed LNPs, the solution comprising the mRNA, and the solution comprising the LNP-encapsulated mRNA during the mixing step. In some embodiments, the process includes the step of heating the LNP-encapsulated mRNA after the mixing step. In certain embodiments, the temperature to which one or more of the solutions is heated is, or is greater than, about 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C. In various embodiments, the temperature to which one or more of the solutions is heated ranges from about 25-70°C, about 30-70°C, about 35-70°C, about 40-70°C,about 45-70°C, about 50-70°C, or about 60-70°C. In some embodiments, the temperature is about 65°C.

[0214] Various methods may be used to prepare an mRNA solution suitable for the present disclosure. In some embodiments, mRNA may be directly dissolved in a buffer solution described herein. In some embodiments, an mRNA solution may be generated by mixing an mRNA stock solution with a buffer solution prior to mixing with a lipid solution for encapsulation. In certain embodiments, an mRNA solution may be generated by mixing an mRNA stock solution with a buffer solution immediately before mixing with a lipid solution for encapsulation. In various embodiments, a suitable mRNA stock solution may contain mRNA in water or a buffer at a concentration at or greater than about 0.2 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.8 mg / ml, 1.0 mg / ml, 1.2 mg / ml, 1.4 mg / ml, 1.5 mg / ml, 1.6 mg / ml, 2.0 mg / ml, 2.5 mg / ml, 3.0 mg / ml, 3.5 mg / ml, 4.0 mg / ml, 4.5 mg / ml, or 5.0 mg / ml.

[0215] In some embodiments, an mRNA stock solution is mixed with a buffer solution using a pump. Exemplary pumps include, but are not limited to, gear pumps, peristaltic pumps, and centrifugal pumps. Typically, the buffer solution is mixed at a rate greater than that of the mRNA stock solution. For example, the buffer solution may be mixed at a rate at least 1X, 2X, 3X, 4X, 5X, 6X, 7X, 8X, 9X, 10X, 15X, or 20X greater than the rate of the mRNA stock solution. In some embodiments, a buffer solution is mixed at a flow rate ranging from about 60-6000 ml / minute (e.g., about 100-300 ml / minute, 300-600 ml / minute, 600-1200 ml / m inute, 1200-2400 ml / minute, 2400-3600 ml / minute, 3600-4800 ml / minute, 4800-6000 ml / minute, or 60-420 ml / minute). In some embodiments, a buffer solution is mixed at a flow rate of, or greater than, about 60 ml / minute, 100 ml / minute, 140 ml / minute, 180 ml / minute, 220 ml / minute, 260 ml / minute, 300 ml / minute, 340 ml / minute, 380 ml / minute, 420 ml / minute, 480 ml / minute, 540 ml / minute, 600 ml / minute, 1200 ml / minute, 2400 ml / minute, 3600 ml / minute, 4800 ml / minute, or 6000 ml / minute.

[0216] In certain embodiments, an mRNA stock solution is mixed at a flow rate ranging from about 10-600 ml / minute (e.g., about 5-50 ml / minute, about 10-30 ml / minute, about 30-60 ml / minute, about 60-120 ml / minute, about 120-240 ml / minute, about 240-360 ml / minute, about 360-480 ml / minute, or about 480-600 ml / minute). In some embodiments, an mRNA stock solution is mixed at a flow rate of or greaterthan about 5 ml / minute, 10 ml / minute, 15 ml / minute, 20 ml / minute, 25 ml / minute, 30 ml / minute, 35 ml / minute, 40 ml / minute, 45 ml / minute, 50 ml / minute, 60 ml / minute, 80 ml / minute, 100 ml / minute, 200 ml / minute, 300 ml / minute, 400 ml / minute, 500 ml / minute, or 600 ml / minute.

[0217] The process of incorporation of a desired mRNA into a lipid nanoparticle is referred to as “loading.” Exemplary methods are described in Lasic et al. , FEBS Lett. (1992) 312:255-8. The LNP-incorporated nucleic acids may be completely or partially located in the interior space of the lipid nanoparticle, within the bilayer membrane of the lipid nanoparticle, or associated with the exterior surface of the lipid nanoparticle membrane. The incorporation of an mRNA into lipid nanoparticles is also referred to herein as “encapsulation,” wherein the nucleic acid is entirely or substantially contained within the interior space of the lipid nanoparticle.

[0218] Suitable LNPs may be made in various sizes. In some embodiments, decreased size of lipid nanoparticles is associated with more efficient delivery of an mRNA. Selection of an appropriate LNP size may take into consideration the site of the target cell or tissue and to some extent the application for which the lipid nanoparticle is being made.

[0219] Suitable methods for sizing of a population of lipid nanoparticles can be used. Exemplary methods provided herein utilize Zetasizer Nano ZS (Malvern Panalytical) to measure LNP particle size. In one protocol, 10 pl of an LNP sample are mixed with 990 pl of 10% trehalose. This solution is loaded into a cuvette and then put into the Zetasizer machine. The z-average diameter (nm), or cumulants mean, is regarded as the average size for the LNPs in the sample. The Zetasizer machine can also be used to measure the polydispersity index (PDI) by using dynamic light scattering (DLS) and cumulant analysis of the autocorrelation function. Average LNP diameter may be reduced by sonication of formed LNP. Intermittent sonication cycles may be alternated with quasi-elastic light scattering (QELS) assessment to guide efficient lipid nanoparticle synthesis.

[0220] In some embodiments, the majority of purified LNPs, i.e., greater than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the LNPs have a size of about 70-150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm).In certain embodiments, substantially all (e.g., greater than 80% or 90%) of the purified lipid nanoparticles have a size of about 70-150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm).

[0221] In certain embodiments, the LNP has an average diameter of 30-200 nm. In various embodiments, the LNP has an average diameter of 80-150 nm. In some embodiments, the LNPs in the present composition have an average size of less than 150 nm, less than 120 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 30 nm, or less than 20 nm.

[0222] In some embodiments, greater than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the LNPs in the present composition have a size ranging from about 40-90 nm (e.g., about 45-85 nm, about 50-80 nm, about 55-75 nm, or about 60-70 nm), about 40-90 nm (e.g., about 45-85 nm, about 50-80 nm, about 55-75 nm, or about 60-70 nm), or about 50-70 nm (e.g., 55-65 nm). In some embodiments, the LNPs are suitable for pulmonary delivery via nebulization.

[0223] In certain embodiments, the dispersity, or measure of heterogeneity in size of molecules (PDI), of LNPs in a pharmaceutical composition provided by the present disclosure is less than about 0.5. In various embodiments, an LNP has a PDI of less than about 0.5, less than about 0.4, less than about 0.3, less than about 0.28, less than about 0.25, less than about 0.23, less than about 0.20, less than about 0.18, less than about 0.16, less than about 0.14, less than about 0.12, less than about 0.10, or less than about 0.08. The PDI may be measured by a Zetasizer machine as described herein.

[0224] In some embodiments, greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified LNPs in a pharmaceutical composition provided herein encapsulate an mRNA within each individual particle. In certain embodiments, substantially all (e.g., greater than 80% or 90%) of the purified lipid nanoparticles in a pharmaceutical composition encapsulate an mRNA within each individual particle. In various embodiments, a lipid nanoparticle has an encapsulation efficiency of 50% to 99%; or greater than about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 95%, 98%, or 99%. Typically, lipid nanoparticles for use herein havean encapsulation efficiency of at least 90% (e.g., at least 91 %, 92%, 93%, 94%, or 95%).

[0225] In some embodiments, an LNP has a N / P ratio of 1 to 10. In certain embodiments, a lipid nanoparticle has a N / P ratio above 1 , about 1 , about 2, about 3, about 4, about 5, about 6, about 7, or about 8. In further embodiments, a typical LNP herein has an N / P ratio of 4.

[0226] In various embodiments, a pharmaceutical composition according to the present disclosure contains at least about 0.5 pg, 1 pg, 5 pg, 10 pg, 100 pg, 500 pg, or 1000 pg of encapsulated mRNA. In some embodiments, a pharmaceutical composition contains about 0.1 pg to 1000 pg, at least about 0.5 pg, at least about 0.8 pg, at least about 1 pg, at least about 5 pg, at least about 8 pg, at least about 10 pg, at least about 50 pg, at least about 100 pg, at least about 500 pg, or at least about 1000 pg of encapsulated mRNA.

[0227] In certain embodiments, mRNA can be made by chemical synthesis or by in vitro transcription (IVT) of a DNA template. An exemplary process for making and purifying mRNA is described in Example 1. In this process, in an IVT process, a cDNA template is used to produce an mRNA transcript and the DNA template is degraded by a DNase. The transcript is purified by depth filtration and tangential flow filtration (TFF). The purified transcript is further modified by adding a cap and a tail, and the modified RNA is purified again by depth filtration and TFF.

[0228] The mRNA is then prepared in an aqueous buffer and mixed with an amphiphilic solution containing the lipid components of the LNPs. An amphiphilic solution for dissolving the four lipid components of the LNPs may be an alcohol solution. In some embodiments, the alcohol is ethanol. The aqueous buffer may be, for example, a citrate, phosphate, acetate, or succinate buffer and may have a pH of about 3.0-7.0, e.g., about 3.5, about 4.0, about 4.5, about 5.0, about 5.5, about 6.0, or about 6.5. The buffer may contain other components such as a salt (e.g., sodium, potassium, and / or calcium salts). In certain embodiments, the aqueous buffer has 1 mM citrate and 150 mM NaCI at pH 4.5.

[0229] An exemplary, nonlimiting process for making an mRNA-LNP composition involves mixing of a buffered mRNA solution with a solution of lipids in ethanol in a controlled homogeneous manner, where the ratio of lipids:mRNA is maintained throughout the mixing process. In this illustrative example, the mRNA is presented in anaqueous buffer containing citric acid monohydrate, tri-sodium citrate dihydrate, and sodium chloride. The mRNA solution is added to the solution (1 mM citrate buffer, 150 mM NaCI, pH 4.5). The lipid mixture of four lipids (e.g., a cationic lipid, a PEGylated lipid, a cholesterol-based lipid, and a helper lipid) is dissolved in ethanol. The aqueous mRNA solution and the ethanol lipid solution are mixed at a volume ratio of 4:1 in a “T” mixer with a near “pulseless” pump system. The resultant mixture is then subjected for downstream purification and buffer exchange. The buffer exchange may be achieved using dialysis cassettes or a TFF system. TFF may be used to concentrate and buffer-exchange the resulting nascent LNP immediately after formation via the T-mix process. The diafiltration process is a continuous operation, keeping the volume constant by adding appropriate buffer at the same rate as the permeate flow.VI. Packaging and Use of the mRNA-LNP Vaccine

[0230] The mRNA-LNP vaccines can be formulated or packaged for parenteral (e.g., intramuscular, intradermal, or subcutaneous) administration or nasopharyngeal (e.g., intranasal) administration. The vaccine compositions may be in the form of an extemporaneous formulation, where the LNP composition is lyophilized and reconstituted with a physiological buffer (e.g., PBS) just before use. The vaccine compositions also may be shipped and provided in the form of an aqueous solution or a frozen aqueous solution and can be directly administered to subjects without reconstitution (after thawing, if previously frozen).

[0231] Accordingly, the present disclosure provides an article of manufacture, such as a kit, that provides the mRNA-LNP vaccine in a single container or provides the mRNA-LNP vaccine in one container (e.g., a first container) and a physiological buffer for reconstitution in another container (e.g., a second container). The container(s) may contain a single-use dosage or multi-use dosage. The containers may be pre-treated glass vials or ampules. The article of manufacture may include instructions for use as well.

[0232] In certain embodiments, the mRNA-LNP vaccine is provided for use in intramuscular (IM) injection. The vaccine can be injected to a subject at, e.g., his / her deltoid muscle in the upper arm. In some embodiments, the vaccine is provided in a pre-filled syringe or injector (e.g., single-chambered or multi-chambered). In some embodiments, the vaccine is provided for use in inhalation and is provided in a pre-filled pump, aerosolizer, or inhaler.

[0233] The mRNA-LNP vaccines can be administered to subjects in need thereof in a prophylactically effective amount, i.e. , an amount that provides sufficient immune protection against a target pathogen for a sufficient amount of time (e.g., one year, two years, five years, ten years, or lifetime). Sufficient immune protection may be, for example, prevention or alleviation of symptoms associated with infections by the pathogen. In some embodiments, multiple doses (e.g., two doses) of the vaccine are administered (e.g., injected) to subjects in need thereof to achieve the desired prophylactic effects. The doses (e.g., prime and booster doses) may be separated by an interval of, e.g., 2 weeks, 3 weeks, 4 weeks, one month, two months, three months, four months, five months, six months, nine months, one year, two years, three years, five years, or ten years.

[0234] In some embodiments, a single dose of the mRNA-LNP vaccine contains 1 -50 pg of mRNA (e.g., monovalent or multivalent). For example, a single dose may contain about 2.5 pg, about 5 pg, about 7.5 pg, about 10 pg, about 12.5 pg, or about 15 pg of the mRNA for intramuscular (IM) injection. In further embodiments, a multi-valent single dose of an LNP vaccine contains multiple (e.g., 2, 3, or 4) kinds of LNPs, each for a different antigen, and each kind of LNP has an mRNA amount of, e.g., about 2.5 pg, about 5 pg, about 7.5 pg, about 10 pg, about 12.5 pg, or about 15 pg.VII. Vectors

[0235] In one aspect, provided herein are vectors comprising the mRNA compositions disclosed herein. The RNA sequences encoding a protein of interest can be cloned into a number of types of vectors. For example, the nucleic acids can be cloned into a vector including, but not limited to, a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Vectors include expression vectors, replication vectors, probe generation vectors, sequencing vectors, and vectors optimized for in vitro transcription.

[0236] In certain embodiments, the vector can be used to express mRNA in a host cell. In various embodiments, the vector is used as a template for IVT. The constructionof optimally translated IVT mRNA suitable for therapeutic use is disclosed in detail in Sahin, et al. (2014). Nat. Rev. Drug Discov. 13, 759-780; Weissman (2015). Expert Rev. Vaccines 14, 265-281.

[0237] In some embodiments, the vectors disclosed herein can comprise at least the following, from 5’ to 3’: an RNA polymerase promoter; a polynucleotide sequence encoding a 5’ UTR; a polynucleotide sequence encoding an ORF; a polynucleotide sequence encoding a 3’ UTR; and a polynucleotide sequence encoding at least one RNA aptamer. In some embodiments, the vectors disclosed herein may also comprise a polynucleotide sequence encoding a poly(A) sequence and / or a polyadenylation signal.

[0238] A variety of RNA polymerase promoters are known. In some embodiments, the promoter can be a T7 RNA polymerase promoter. Other useful promoters include, but are not limited to, T3 and SP6 RNA polymerase promoters. Consensus nucleotide sequences for T7, T3, and SP6 promoters are known.

[0239] Also disclosed herein are host cells (e.g., mammalian cells, such as, e.g., human cells) comprising the vectors or RNA compositions disclosed herein.

[0240] Polynucleotides can be introduced into target cells using any of a number of different methods, for instance, commercially available methods which include, but are not limited to, electroporation (Amaxa Nucleofector-ll (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or the Gene Pulser II (BioRad, Denver, Colo.), Multiporator (Eppendorf, Hamburg Germany), cationic liposome mediated transfection using lipofection, polymer encapsulation, peptide mediated transfection, biolistic particle delivery systems such as “gene guns” (see, for example, Nishikawa, et al. (2001 ). Hum Gene Then 12(8):861 -70, or the TransIT-RNA transfection Kit (Mirus, Madison Wl).

[0241] Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0242] Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose a cell to the inhibitor of the present disclosure, in order toconfirm the presence of the mRNA sequence in the host cell, a variety of assays may be performed.VIII. Pharmaceutical Compositions

[0243] RNA purified according to this disclosure can be useful as a component in pharmaceutical compositions, for example, for use as a vaccine. These compositions can include RNA and a pharmaceutically acceptable carrier. A pharmaceutical composition of the disclosure can also include one or more additional components such as small molecule immunopotentiators (e.g., TLR agonists). A pharmaceutical composition of the disclosure can also include a delivery system for the RNA, such as a liposome, an oil-in-water emulsion, or a microparticle. In some embodiments, the pharmaceutical composition comprises a lipid nanoparticle (LNP). In one embodiment, the composition comprises an antigen-encoding nucleic acid molecule encapsulated within an LNP.

[0244] Embodiments of the Disclosure

[0245] Embodiment 1. An in vitro system comprising: a plurality of isolated human muscle cells; and a plurality of lipid-nanoparticle (LNP)-encapsulated messenger RNA (mRNA), wherein the plurality of isolated LNP-encapsulated mRNA contact the plurality of isolated human muscle cells in vitro and transfect the plurality of isolated human muscle cells.

[0246] Embodiment 2. The in vitro system of embodiment 1 , each of the plurality of LNP-encapsulated mRNA comprising an mRNA, wherein the mRNA encodes an antigen.

[0247] Embodiment 3. The in vitro system of embodiment 2, wherein the antigen is membrane localized on the plurality of isolated human muscle cells.

[0248] Embodiment 4. The in vitro system of embodiment 3, further comprising an antigen binding protein that specifically binds to the antigen.

[0249] Embodiment 5. The in vitro system of embodiment 4, wherein the antigen binding protein comprises a detectable moiety.

[0250] Embodiment 6. The in vitro system of embodiment 2, wherein the antigen is linked to a detectable protein.

[0251] Embodiment 7. The in vitro system of embodiment 6, wherein the detectable protein comprises a fluorescent protein.

[0252] Embodiment 8. The in vitro system of embodiment 7, wherein the fluorescent protein is GFP, RFP, YFP, or dsRed.

[0253] Embodiment 9. The in vitro system of embodiment 2, wherein the antigen is secreted from the plurality of isolated human muscle cells.

[0254] Embodiment 10. The in vitro system of any one of embodiments 1 -9, wherein the plurality of isolated human muscle cells are skeletal muscle cells.

[0255] Embodiment 11. The in vitro system of embodiment 10, wherein the skeletal muscle cells are myocytes, myosatellite cells, or myoblasts.

[0256] Embodiment 12. The in vitro system of embodiment 10 or 11 , wherein the skeletal muscle cells are primary skeletal muscle cells.

[0257] Embodiment 13. The in vitro system of embodiment 10 or 11 , wherein the skeletal muscle cells are immortalized skeletal muscle cells.

[0258] Embodiment 14. The in vitro system of embodiment 13, wherein the immortalized skeletal muscle cells exhibit SV40 large T antigen expression, hTERT expression, HPV16 E6 / E7 expression, adenovirus E1A / E1 B expression, tumor suppressor gene inactivation, or fusion with one or more immortalized cell line.

[0259] Embodiment 15. The in vitro system of embodiment 13, wherein the immortalized skeletal muscle cells express one or more of cyclin D1 (CCND1 ), cyclin-dependent kinase 4 (CDK4), telomerase (TERT), HPV16 E6 / E7, or adenovirus E1A / E1 B.

[0260] Embodiment 16. The in vitro system of embodiment 13, wherein the immortalized skeletal muscle cells express cyclin D1 (CCND1 ), cyclin-dependent kinase 4 (CDK4), and telomerase (TERT).

[0261] Embodiment 17. The in vitro system of any one of embodiments 1 -16, wherein the LNP comprises at least one cationic lipid.

[0262] Embodiment 18. The in vitro system of embodiment 17, wherein the LNP further comprises at least one polyethylene glycol (PEG) conjugated (PEGylated) lipid, at least one cholesterol-based lipid, and at least one helper lipid.

[0263] Embodiment 19. A multi-vessel in vitro system comprising a plurality of isolated human muscle cells contained within at least two separate vessels, wherein each of the at least two separate vessels comprises a plurality of lipid-nanoparticle(LNP)-encapsulated messenger RNA (mRNA), the plurality of LNP-encapsulated mRNA comprising an LNP, and wherein the LNP comprises a unique composition of lipids in each vessel.

[0264] Embodiment 20. The multi-vessel in vitro system of embodiment 19, wherein the LNP comprises at least one cationic lipid and wherein each of the at least two separate vessels comprises an LNP with a different cationic lipid.

[0265] Embodiment 21. The multi-vessel in vitro system of embodiment 20, wherein the LNP further comprises at least one polyethylene glycol (PEG) conjugated (PEGylated) lipid, at least one cholesterol-based lipid, and at least one helper lipid.

[0266] Embodiment 22. The multi-vessel in vitro system of embodiment 19, wherein the LNP comprises at least one PEGylated lipid and wherein each of the at least two separate vessels comprises an LNP with a different PEGylated lipid.

[0267] Embodiment 23. The multi-vessel in vitro system of embodiment 22, wherein the LNP further comprises at least one cationic lipid, at least one a cholesterol- based lipid, and at least one helper lipid.

[0268] Embodiment 24. The multi-vessel in vitro system of embodiment 19, wherein the LNP comprises at least one cholesterol-based lipid and wherein each of the at least two separate vessels comprises an LNP with a different cholesterol-based lipid.

[0269] Embodiment 25. The multi-vessel in vitro system of embodiment 24, wherein the LNP further comprises at least one cationic lipid, at least one PEGylated lipid, and at least one helper lipid.

[0270] Embodiment 26. The multi-vessel in vitro system of embodiment 19, wherein the LNP comprises at least one helper lipid and wherein each of the at least two separate vessels comprises an LNP with a different helper lipid.

[0271] Embodiment 27. The multi-vessel in vitro system of embodiment 26, wherein the LNP further comprises at least one cationic lipid, at least one PEGylated lipid, and at least one cholesterol-based lipid.

[0272] Embodiment 28. The multi-vessel in vitro system of any one of embodiments 19-27, wherein the plurality of isolated human muscle cells are skeletal muscle cells.

[0273] Embodiment 29. A method of screening LNP-encapsulated mRNA for polypeptide expression, the method comprising: a) contacting a plurality of isolatedhuman muscle cells with a plurality of lipid-nanoparticle (LNP)-encapsulated messenger RNA (mRNA), wherein the plurality of LNP-encapsulated mRNA contact the plurality of isolated human muscle cells in vitro and transfect the plurality of isolated human muscle cells; and b) detecting polypeptide expression.

[0274] Embodiment 30. The method of embodiment 29, wherein each of the plurality of LNP-encapsulated mRNA comprises mRNA, wherein the mRNA encodes an antigen.

[0275] Embodiment 31. The method of embodiment 30, wherein the antigen is membrane localized on the plurality of isolated human muscle cells.

[0276] Embodiment 32. The method of embodiment 31 , further comprising an antigen binding protein that specifically binds to the antigen.

[0277] Embodiment 33. The method of embodiment 32, wherein the antigen binding protein comprises a detectable moiety.

[0278] Embodiment 34. The method of embodiment 33, wherein step b) comprises detecting the antigen binding protein comprising the detectable moiety.

[0279] Embodiment 35. The method of embodiment 30, wherein the antigen is linked to a detectable protein.

[0280] Embodiment 36. The method of embodiment 35, wherein the detectable protein comprises a fluorescent protein.

[0281] Embodiment 37. The method of embodiment 36, wherein the fluorescent protein is GFP, RFP, YFP, or dsRed.

[0282] Embodiment 38. The method of any one of embodiments 35-37, wherein step b) comprises detecting the antigen linked to the detectable protein.

[0283] Embodiment 39. The method of embodiment 38, wherein step b) is performed by fluorescence-activated cell sorting (FACS).

[0284] Embodiment 40. The method of embodiment 30, wherein the antigen is secreted from the isolated human muscle cells into cell culture media.

[0285] Embodiment 41. The method of embodiment 40, wherein step b) comprises detecting the antigen in the cell culture media.

[0286] Embodiment 42. The method of any one of embodiments 29-41 , wherein the plurality of isolated human muscle cells are skeletal muscle cells or skeletal muscle myoblasts.

[0287] Embodiment 43. A method of producing a validated lipid-nanoparticle (LNP)- encapsulated messenger RNA (mRNA), the method comprising: a) mixing LNPs with mRNAs, thereby forming the LNP-encapsulated mRNA; b) contacting a plurality of isolated human muscle cells with the LNP-encapsulated mRNA; andc) detecting polypeptide expression from the plurality of isolated human muscle cells to validate quality of the LNP-encapsulated mRNA, wherein the quality is validated if expression of the mRNA is detected above a baseline value.

[0288] Embodiment 44. The method of embodiment 43, wherein the mRNA encodes an antigen.

[0289] Embodiment 45. The method of embodiment 44, wherein the antigen is membrane localized on the plurality of isolated human muscle cells.

[0290] Embodiment 46. The method of embodiment 45, further comprising an antigen binding protein that specifically binds to the antigen.

[0291] Embodiment 47. The method of embodiment 46, wherein the antigen binding protein comprises a detectable moiety.

[0292] Embodiment 48. The method of embodiment 47, wherein step b) comprises detecting the antigen binding protein comprising the detectable moiety.

[0293] Embodiment 49. The method of embodiment 44, wherein the antigen is linked to a detectable protein.

[0294] Embodiment 50. The method of embodiment 49, wherein the detectable protein comprises a fluorescent protein.

[0295] Embodiment 51. The method of embodiment 50, wherein the fluorescent protein is GFP, RFP, YFP, or dsRed.

[0296] Embodiment 52. The method of any one of embodiments 49-51 , wherein step b) comprises detecting the antigen linked to the detectable protein.

[0297] Embodiment 53. The method of embodiment 52, wherein step b) is performed by fluorescence-activated cell sorting (FACS).

[0298] Embodiment 54. The method of embodiment 44, wherein the antigen is secreted from the isolated human muscle cells into cell culture media.

[0299] Embodiment 55. The method of embodiment 54, wherein step b) comprises detecting the antigen in the cell culture media.

[0300] Embodiment 56. The method of any one of embodiments 43-55, wherein the plurality of isolated human muscle cells are skeletal muscle cells.

[0301] Embodiment 57. The method of any one of embodiments 43-56, wherein the baseline value is a value from a plurality of isolated human muscle cells transfected with an empty LNP.

[0302] Embodiment 58. The method of any one of embodiments 43-56, wherein the baseline value is a value from a plurality of isolated human muscle cells transfected with an LNP encapsulated with an mRNA encoding a polypeptide that is not detected.

[0303] Embodiment 59. An LNP-encapsulated mRNA produced by the method of any one of embodiments 43-58.

[0304] Embodiment 60. A method of screening lipid-nanoparticle (LNP)-encapsulated messenger mRNA (mRNA) to predict in vivo polypeptide expression or antibody response, the method comprising: a) contacting a plurality of isolated human muscle cells or myoblasts with a plurality of LNP-encapsulated mRNA, wherein the plurality of LNP-encapsulated mRNA contact the plurality of isolated human muscle cells or myoblasts in vitro and transfect the plurality of isolated human muscle cells or myoblasts; and one or both of: b) detecting the presence of the mRNA in the plurality of isolated human muscle cells or myoblasts; and c) detecting in vitro polypeptide expression.

[0305] Embodiment 61. The method of embodiment 60, comprising b) detecting the presence of the mRNA in the plurality of human muscle cells or myoblasts and d) correlating the in vitro mRNA accumulation and / or the mRNA uptake with in vivo polypeptide expression or antibody response.

[0306] Embodiment 62. The method of embodiment 60 or embodiment 61 , comprising c) detecting in vitro polypeptide expression and e) correlating the in vitro polypeptide expression with in vivo polypeptide expression or antibody response.

[0307] Embodiment 63. The method of any one of embodiments 60-62, wherein the antibody response corresponds to an antibody titer.

[0308] In order that this disclosure may be better understood, the following examples are set forth. These examples are for purposes of illustration only and are not to be construed as limiting the scope of the disclosure in any manner.EXAMPLES

[0309] The foregoing description of the specific embodiments will so fully reveal the general nature of the disclosure that others can, by applying knowledge within the skill of the art, readily modify and / or adapt for various applications such specific embodiments, without undue experimentation, without departing from the general concept of the present disclosure. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance.

[0310] Example 1 : Measurement of Autofluorescence Background of HSkMCs and HeLa Cells

[0311] HeLa cells and HSkMCs were seeded, respectively, at 8000 and 6000 cells per well in a Greiner pCIear FlatBottom 96-well plate and incubated at 37°C with 5% CO2 for 72 hours. Both cells were stained for 30 minutes with H33342 nuclear stain at 1 pM. Cells were then imaged using the same setting on a Cytation 7 imaging system at 469 nm excitation and 525 nm emission bandwidth. After image segmentation based on nuclei staining, mean fluorescence intensity per cell was determined for each cell imaged. Data is represented as mean ± SD (A / = 12 independent experiments with > 4000 cells sampled for each experiment). HSkMCs displayed a lower autofluorescence background compared to HeLa cells (FIG. 1).

[0312] LNP mRNA Transfection Reagents

[0313] Table 2: List of Reagents Used for the LNP mRNA Transfection

[0314] Example 2: Measurements for Reproducibility of Expression of Proteinencoding mRNA in HSkMCs

[0315] HSkMCs were seeded at 6000 cells per well in a Greiner pCIear FlatBottom 96- well plate and incubated at 37°C with 5% CO2 for 24 hours. Cells were transfected 24 hours after seeding with 50 ng of GFP mRNA per well using Mirus TransIT lipofection reagents. Nuclei staining was performed for 30 minutes with H33342 nuclear stain at 1 pM just before image acquisition. Cells were then imaged on a Cytation 7 imaging system at 469 nm excitation and 525 nm emission bandwidth. After image segmentation based on nuclei staining, mean fluorescence intensity per cell was determined for each cell imaged. Percentage of positivity for GFP staining was determined using a threshold corresponding to the mean plus 3 times the standard deviation of the untransfected control cells (NT). Data is represented as mean ± SD ( / V = 6 independent experiments with 3 technical replicates each and > 4000 cells sampled for each experiment). No statistical differences wereobserved between N1 to N6 groups (AN0VA1 pairwise comparison with Brown- Forsyth and Welsh correction). HSkMCs displayed a high reproducibility for expressing protein-encoding mRNA (FIG. 2).

[0316] Example 3: Use of HSkMCs in High-throughput Antigen Expression Assays

[0317] HSkMCs were seeded at 6000 cells per well in a Greiner pCIear FlatBottom 96- well plate and incubated at 37°C with 5% CO2 for 24 hours. Cells were incubated at various amounts of LNP-formulated HA-H3 mRNA (from 125 ng to 1000 ng per well) or not treated (NT) 24 hours after seeding. After 48 hours of incubation with LNP mRNA, cells were fixed for 20 minutes in 4% PFA solution. HA-H3 immunostaining was performed using a mouse anti HA-H3 primary antibody diluted to 1 / 1000 and anti-mouse AlexaFluor 568 secondary antibody diluted to 1 / 2000 (a- HA-H3) or with the secondary antibody only (CTRL) to assess primary antibody specificity. Nuclei were stained using Hoechst H33342 in the secondary antibody solution at 1 pM. Cells were then imaged on a Cytation 7 imaging system at 586 nm excitation and 647 nm emission bandwidth. After image segmentation based on nuclei staining, mean fluorescence intensity (MFI) per cell was determined for each cell imaged. Percentage of positivity for GFP staining was determined using a threshold corresponding to the mean plus 3 times the standard deviation of the untransfected control cells (NT). Data is represented as mean MFI per cell for each condition ( / V = 1 experiment with > 10000 cells sampled for each experimental condition). Results from these assays demonstrated that HSkMCs can be used for high-throughput antigen expression assays, as only the HA-H3 mRNA-transfected cells produced detectable HA-H3 protein (FIG. 3).

[0318] Example 4: High-throughput Immunofluorescence Antigen Detection Method on hSKMCs Using Image Cytometry

[0319] HSkMC Plating (96-well Plate)

[0320] Media and PBS 1X were taken out of the fridge 10-30 minutes before use. The media in a T175 flask was aspirated at about 80% confluence. The cells were washed with 5 mL PBS, then TrypLE Express reagent (4 mL) was added to detach the cells. The flask was placed in the incubator at 37°C and 5% CO2 for 3 to 5 minutes. While the cells were incubating with the TrypLE Express, 200 pL of sterilePBS was added to the 36 outer wells of a 96-well plate (Greiner pCIear). The flask was removed from the incubator and complete HSkMC medium (5 mL) was added to the flask. A small aliquot (200 pL) of the cells was used for counting on a cell counter (Chemometec NC-200 was used with the standard protocol, however, any cell counter or a Kova or Malassez counter slide may be used).

[0321] The cells were centrifuged at 250 g for 3 minutes and the supernatant was discarded carefully without detaching the cell pellet. The cell pellet was resuspended in 9 mL of M199 complete medium and diluted in a new Falcon 50 tube to 30,000 cells / mL for HSkMC. The 30,000 cells / mL suspension (200 pL) was added to each empty well in the plate (60 wells). Manual orbital shaking of the plate was performed for 10 seconds, and the cells were left to stand on a bench (outside of the cell culture hood) for 20 to 30 minutes at room temperature and protected from light, then the flask was placed back in the incubator at 37°C and 5% CO2.

[0322] HSkMC LNP Transfection (96-well Plate)

[0323] Media and PBS 1X were taken out of the fridge 10-30 minutes before use. LNP were thawed from the -80°C stock and kept at room temperature. The transfection mix was prepared in M199 complete medium for each well, according to the plate map. The media in each well were aspirated and replaced with 100 pL of transfection mix per well. When all of the mixes were dispensed, M199 complete media (100 pL) was added. The flask was put back in the incubator at 37°C and 5% CO2 for 48 hours.

[0324] Cell Fixation

[0325] Media and PBS 1X were taken out of the fridge 10-30 minutes before use. A 4% PFA solution was prepared just before use by mixing 8% PFA in PBS 1X (8 mL) with M199 complete media (8 mL). The media in each well was aspirated and 200 pL of the 4% PFA solution was added. The plate was put back into the incubator at 37°C and 5% CO2 for 20 minutes. The cells were gently washed 3 times with 200 pL PBS 1X, and 200 pL PBS 1X was added to each well. At this step, the plate may be stored at 4°C protected from light for up to two weeks.

[0326] Immunofluorescence Staining

[0327] Table 3: Reagents to Prepare (for 30 Wells)

[0328] Table 4: Primary Antibody Dilution

[0329] Saturation / Permeabilization

[0330] The liquid was aspirated from each well and 200 pL of PBS, 0.1% Triton X-100, and 5% BSA was added. The plate was incubated for 30 minutes at room temperature and protected from light.

[0331] Primary Antibody Incubation

[0332] The liquid was aspirated from each well and 100 pL primary antibody dilution in PBS (0.1 % Triton X-100 and 5% BSA) or 100 pL of PBS (0.1 % Triton X-100 and 5% BSA; for the secondary antibody only control) was added. The plate was incubated for 60 minutes at room temperature and protected from light. The liquid was aspirated from each well and each well was washed three times with 200 pLof PBS (0.1 % Triton X-100) with the following protocol: a quick wash first then two 5-m inute washes.

[0333] Secondary Antibody Incubation

[0334] The liquid in each well was aspirated and 100 pL of secondary antibody dilution (at 1 / 2000) in PBS (0.1 % Triton X-100 and 5% BSA) containing Hoechst 33342 was added. The plate was incubated for 60 minutes at room temperature and protected from light. The liquid in each well was aspirated and the wells were washed 3 times with 200 pL of PBS (0.1 % Triton X-100) with the following pattern: a quick wash first then two 5-minute washes. The plate was read immediately or within a few days.

[0335] Image Acquisition on the Cytation 7

[0336] Table 5: Acquisition Parameter Used on the Cytation 7

[0337] The following analysis parameters were used on Gen5: 1 ) Primary mask on nuclei (Hoechst 33342) staining; 2) Secondary mask on primary mask + 30 pm expansion for HSkMC; 3) Measurement of Mean fluorescence intensity for each ROI based on secondary mask; and 4) Export as a text file for subsequent analysis.

[0338] Data Analysis on PythonGen5 data formatting was used, cell by cell analysis of mean fluorescence intensity was used, and the determination of cell positivity for AF568 staining was performedby two methods: 1 ) Threshold = Mean(NT) + 3x SD(NT) and 2) Adaptative thresholding algorithm from NT (background) and positive control well.

[0339] Example 5: HSkMC mRNA Evaluation Platform - Materials and Methods

[0340] HSkMC Culture Procedure

[0341] HSkMCs were ordered from Lonza (SkMC, Catalog #: CC-2561 ).

[0342] 0.25% Trypsin-EDTA 1X and M199 were warmed in a water bath. Media were decanted from the T150 HSkMC culture flask, then 10 mL PBS was added to the flask, and the flask was tilted gently a couple of times. PBS was decanted, then another 10 mL PBS was added to the flask, and the flask was tilted gently a couple of times. PBS was decanted, and 5 mL 0.25% Trypsin-EDTA 1X was added to the flask. Cells were incubated in a 37°C incubator for up to 5 minutes (until the cells were detached). Cells were washed off of the flask bottom with 10 mL warm M199 and were transferred to a 50 mL tube. Cells were spun at 1400 rpm for 7 minutes at 4°C. The supernatant was aspirated, and the cell pellet was resuspended in 5 mL M199 per flask harvested. A 10 pL sample was taken for counting at 1 :2 dilution, the number of cells were calculated, and the volume was brought up to 1 ,000,000 cells per mL. Typically, 450,000 cells were seeded weekly on T 150, and media were replaced once in the middle of the week. At the end of the week, the cells were harvested and seeded again. Cells were maintained until 10-12 passages.

[0343] HSkMC Nucleofection Procedure

[0344] 0.25% Trypsin-EDTA 1X and M199 were warmed in a water bath. Media were decanted from the T150 HSkMC culture flask, then 10 mL PBS was added to the flask, and the flask was tilted gently a couple of times. PBS was decanted, then another 10 mL PBS was added to the flask, and the flask was tilted gently a couple of times. PBS was decanted, and 5 mL 0.25% Trypsin-EDTA 1X was added to the flask. Cells were incubated in a 37°C incubator for up to 5 minutes (until the cells are detached). Cells were washed with 15 mL warm M199 and were transferred to a 50 mL tube. The flask was washed again with 10 mL warm M199 and transferred to the 50 mL tube. The cells were spun at 90 g for 20 minutes at room temperature. The 50 mL tube was aspirated, and the cell pellet was resuspended in 10 mL PBS. A 10 pL sample was taken for counting at 1 :2 - 1 : 10 dilution with trypan blue.

[0345] Cells were transferred (1 million cells / cuvette) and tubes were spun at 90 g for 20 minutes at room temperature. While the cells were spun, the Amaxa Nucleofector ll / llb Device was set to the D-033 program. The Nucleofector solution was prepared by mixing with supplement before adding to the cells.

[0346] After the cells were spun, media were aspirated from the tube using a vacuum trap aspirator and cells were resuspended in Basic Nucleofector Solution (100 pL / million cells spun) provided in the kit and pre-warmed to room temperature. 100 pL was added to each cuvette, and 5 pL - 25 pL of each treatment (mRNA or DNA) was added to each cuvette, respectively, while carefully avoiding bubbles. Optimal mRNA concentration may vary and may need adjustment. Typically, 12 pg / cuvette / million cells were used. The cells were not exposed to the mixture for more than 10 minutes.

[0347] The cuvettes were tapped to even out the layer before inserting into the Amaxa Nucleofector ll / llb Device. Once the cuvette was out of the Amaxa Nucleofector ll / llb Device, 900 pL of warm M 199 was added to the cuvette and was mixed gently using a p1000 pipette. 1 mL was transferred to a well in a culture plate using a disposable pipette from the kit. Typically, all cells were added into 2 wells of a 6- well plate with 3 mL culture media each. A 12-, 24-, or 48-well plate may be used with adjustments to the number of cells and volume of media used. The culture was incubated in a CO2 incubator at 37°C.

[0348] HSkMC Transfection with mRNA / LNP Procedure

[0349] 0.25% Trypsin-EDTA 1X and M199 were warmed in a water bath. Media were decanted from the T150 HSkMC culture flask, then 10 mL PBS was added to the flask, and the flask was tilted gently a couple of times. PBS was decanted, then another 10 mL PBS was added to the flask, and the flask was tilted gently a couple of times. PBS was decanted, and 5 mL 0.25% Trypsin-EDTA 1X was added to the flask. Cells were incubated in a 37°C incubator for up to 5 minutes (until the cells are detached). Cells were washed with 15 mL warm M199 and were transferred to a 50 mL tube. The flask was washed again with 10 mL warm M199 and transferred to the 50 mL tube. The cells were spun at 1400 rpm at 4°C for 20 minutes. The supernatant was aspirated, and cells were resuspended in 5 mL of M199 per flask harvested. A 10 pL sample was taken for counting at 1 :2 - 1 :5 dilution with trypanblue, the number of cells were calculated, and the volume was brought up to 1 ,000,000 cells per mL.

[0350] HSkMCs were added into each well (100 pL, 100,000 cells per well in a 24-well plate), 900 pL of culture media was added to each well, and the cells were incubated at 37°C. The cell number may be adjusted if other formats of cell culture plates are used. The next day, LNP formulated mRNA was added to each well and the culture plate was swirled gently to evenly spread the LNP. Too much LNP can reduce transfectivity or cell survival (i.e. , 1 pg or 0.5 pg of MC3 or OF-02 is optimal for the transfection of 100,000 HSkMC in a 24-well plate), thus the dose of LNP is adjusted and / or optimized accordingly. The cells were incubated in a CO2 incubator at 37°C.

[0351] Sample Harvest and Expression Analysis of Secreted Protein (HEPO)

[0352] The supernatant from the culture (50 pL - 100 pL) was harvested at desired time points and was stored at 4°C until analysis by ELISA. ELISA was performed (Human Erythropoietin Quantikine IVD ELISA Kit, Cat. DEP00, www.rndsystems.com / products / human-erythropoietin-quantikine-ivd-elisa- kit_dep00) according to the manufacturer’s protocol. Typically, a 1 :100 dilution was used for low expression samples and a 1 :5,000 dilution was used for high expression samples, but the dilution factors may be optimized and / or adjusted.

[0353] Sample Harvest and Expression Analysis of Intracellular Protein (EGFP)

[0354] The media was aspirated from the cells, then 1 mL PBS was gently added to each well and the plate was tilted a couple of times. The PBS was aspirated and 0.5 mL TrypLE (12-well plate) was added to each well. Cells were incubated in a 37°C incubator for up to 5 minutes (until the cells are detached). Cells were resuspended with 0.5 mL PBS and 10 pL was transferred to a Countess slide. The Countess slide was inserted into the Countess 3 FL and the number of GFP positive cells was quantified - this was conducted for all wells.

[0355] Sample Harvest and Expression Analysis of Surface Bound Protein by Imaging and Flow Cytometry (HA, NA)

[0356] At the desired time after incubation, the expression of transfected antigen (Ag) was evaluated. Fluorescence imaging or flow cytometry was used to detect the expression of HA and NA.

[0357] Media was aspirated and the cells were washed with 1 mL PBS. 250 pL (12-well plate) Accutase was added to each well. The plate was incubated at room temperature, and the plates were checked by gentle tapping until the cells started to dissociate. Once the cells started to dissociate, 250 pL (12-well plate) PBS was added into each well. The plates were immediately moved onto ice to avoid further digestion. Cells were harvested and transferred to tubes on ice to avoid further digestion for analysis. The tubes were spun at 600 x g for 5 minutes at 4°C (all subsequent staining spins used these parameters). The supernatant was removed, and the tubes were lightly vortexed. 1 mL PBS was added to each tube, the tubes were spun, and the supernatant was removed.

[0358] The cells were lightly vortexed then 250 pL Cytofix / Cytoperm was added to each tube, the tubes were incubated in the dark for 15 minutes at 4°C. MACS buffer (1 mL) was added to each tube, the tubes were spun, buffer / Cytofix were removed, the tubes were vortexed, and MACS buffer (1 mL) was added to each well. The tubes were spun, MACS buffer was removed, the tubes were vortexed and 100 pL antibody cocktail (containing 1 pg antibody), diluted in cell staining buffer was added to appropriate tubes and incubated for 1 hour at 4°C in the dark.

[0359] The samples were washed twice in MACS buffer, and an appropriate secondary antibody (Ab) conjugated with a fluorochrome was added (0.5 pg / sample was used). The plates were incubated at 4°C in the dark for 30 minutes, then the samples were washed twice with MACS buffer. The samples were resuspended in 250 pL MACS buffer. The cells were then acquired by flow cytometry or imaged on the Countess 3 FL.

[0360] Table 6: List of Reagents Used for Surface Staining of Cells

[0361] Sample Harvest and Expression Analysis by Flow Cytometry (HA, NA, RSV F, and RSV G) - ICCS (Intracellular Staining)

[0362] At the desired time after incubation, the expression of transfected Ag was evaluated. Flow cytometry was used to detect the expression of HA, RSV F, and RSV G.

[0363] Media was aspirated and the cells were washed twice with PBS. 100 pL (24-well plate) or 250 pL (6-well plate) of 0.25% Trypsin-EDTA 1X was added to each well. The plate was incubated at room temperature, and the plates were checked by gentle tapping until the cells started to dissociate. Once the cells started to dissociate, 200 pL (24-well plate) or 750 pL (6-well plate) of culture media was added into each well. The plates were immediately moved onto ice to avoid further digestion. Cells were harvested and transferred to tubes or 96-well plates on ice to avoid further digestion for analysis by flow cytometry. The tubes or plates were spun down at 1400 rpm for 4 minutes (all subsequent staining spins used these parameters). The supernatant was removed, and the plates / tubes were lightly vortexed. 200 pL PBS was added to each well / tube, the plates / tubes spun, and the supernatant removed.

[0364] A solution of 1 :500 Live Dead Aqua (LDA) in PBS was prepared. 100 pL LDA solution was added to all of the sample wells and the LDA single color compensation control. The plates were placed on ice or at 4°C in the dark for 20 to 30 minutes or at room temperature for 10 minutes. 100 pL of PBS was added to the unstained wells. The cells were washed by adding 100 pL PBS to each well, then the plates were spun, PBS was removed, and the plates were vortexed. 200pL FACS buffer was added to each well, then the plates were spun, FACS buffer was removed, and the plates were vortexed. The cells were fixed by adding 100 pL of 2% paraformaldehyde (PFA) to each well (all of the sample wells, the unstained wells, and the LDA wells) and the plates were incubated in the dark for 15 minutes on ice or at 4°C. FACS buffer (100 pL) was added to each well so that each well had a total volume of 200 pL. The plates were spun, buffer / PFA were removed, the plates were vortexed, and FACS buffer (200 pL) was added to each well. The plates were centrifuged and the cells were stored as pellets in FACS buffer at 4°C overnight.

[0365] The plates were spun, FACS buffer was removed, and the plates were vortexed to ensure the removal of all residual liquids. Cytofix / Cytoperm (100 pL) was added to each well (sample wells, unstained wells, and LDA wells), and the plates were incubated in the dark for 20 minutes at 4°C. 1X Perm Wash (100 pL) was added to each well, the plates were spun, the supernatant was removed, the plates were vortexed, and this step was repeated. The primary antibody cocktail was diluted in Perm Wash, and 50 pL of this solution was added per sample well (generally 0.2 - 1 pg / sample is used, but the amount of antibody should generally be titrated). Primary antibodies used in this assay are listed in Table 7.

[0366] Table 7: List of Antibodies for Flow Cytometry

[0367] The plates were incubated on ice or at 4°C in the dark for 20 minutes. The samples were washed twice in PermWash, and an appropriate secondary Ab conjugated with a fluorochrome was added (generally 0.2 - 0.5 pg / sample is used, but the amount of antibody should generally be titrated). The plates were incubated on ice or at 4°C in the dark for 10 minutes, then the samples were washed twice with PermWash and once with FACS buffer. The samples were resuspended in 200 pL FACS buffer (or a different volume depending on the experimental conditions). Theplates were wrapped in foil until the cells were ready to be acquired on the cytometer. The fixed cells may be stored at 4°C for 2-3 days before acquisition on the cytometer; however, it is generally preferable to acquire them as quickly as possible. If the cells were sitting for more than 30 minutes before being placed on the cytometer, the cells were resuspended with a multi-channel pipet to decrease cell clumping.

[0368] In certain embodiments, other live, dead, or apoptotic markers can be used as a replacement for LDA. In various embodiments, the cells can be fixed and stained at a later time point without LDA. In some embodiments, the cells can be fixed and stained on the same day without LDA.

[0369] Sample Harvest and Expression Analysis by Flow Cytometry (HA, NA, RSV F, and RSV G) - Surface Staining Only

[0370] At the desired time after incubation, the expression of transfected Ag was evaluated (flow cytometry was used to detect the expression of HA, RSV F, and RSV G; detection methods may be adjusted for other needs). Media were aspirated and the cells were washed twice with PBS. 100 pL (24-well plate) or 250 pL (6-well plate) of 0.25% Trypsin-EDTA 1Xwas added to each well. The plate was incubated at room temperature, and the plates were checked by gentle tapping until the cells started to dissociate. Once the cells started to dissociate, 200 pL (24-well plate) or 750 pL (6-well plate) of culture media was added into each well. The plates were immediately moved onto ice to avoid further digestion. Cells were harvested and transferred to tubes or 96-well plates on ice to avoid further digestion for analysis by flow cytometry. The tubes or plates were spun down at 1400 rpm for 4 minutes (all subsequent staining spins used these parameters). The supernatant was removed, and the plates / tubes were lightly vortexed. 200 pL PBS was added to each well / tube, the plates / tubes were spun, and the supernatant was removed.

[0371] A solution of 1 :500 Live Dead Aqua (LDA) in PBS was prepared. 100 pL LDA solution was added to all of the sample wells and the LDA single color compensation control. The plates were placed on ice or at 4°C in the dark for 20 to 30 minutes or at room temperature for 10 minutes. 100 pL of PBS was added to the unstained wells. The cells were washed by adding 100 pL PBS to each well, then the plates were spun, PBS was removed, and the plates were vortexed. 200pL FACS buffer was added to each well, then the plates were spun, FACS buffer was removed, and the plates were vortexed.The primary antibody cocktail was diluted in FACS buffer, and 50 pL of this solution was added per sample well (generally 0.2 - 1 pg / sample is used, but the amount of antibody should generally be titrated). The plates were incubated on ice or at 4°C in the dark for 20 minutes. The samples were washed twice with FACS buffer, and an appropriate secondary Ab conjugated with a fluorochrome was added (generally 0.2 - 0.5 pg / sample is used, but the amount of antibody should generally be titrated). The plates were incubated on ice or at 4°C in the dark for 10 minutes, then the samples were washed twice with FACS buffer. The samples were resuspended in 200 pL FACS buffer (or a different volume depending on the experimental conditions). The plates were wrapped in foil until the cells were ready to be acquired on the cytometer. At this point, the cells may be fixed with 2% PFA, and the fixed cells may be stored at 4°C for 2-3 days before acquisition on the cytometer; however, it is generally preferable to acquire them as quickly as possible. If the cells were sitting for more than 30 minutes before being placed on the cytometer, the cells were resuspended with a multi-channel pipet to decrease cell clumping.

[0372] Example 6: HSkMC mRNA Evaluation Platform - Results

[0373] HSkMC Compared Against a Non-human Primate (NHP) Model

[0374] The gold standard for evaluating mRNA-LNP transfection efficiency for preclinical studies is through the use of intramuscular injection into a NHP model, which closely replicates human results. To demonstrate the utility of HSkMCs as an alternative to NHP, HSkMCs were transfected with several hEPO-expressing mRNA-LNP formulations, each formulation containing a different cationic lipid. The same formulations were administered to NHPs via intramuscular injection. EPO protein levels were then measured by ELISA at 6, 24, and 48 hours post transection or injection. As shown in FIG. 4A and FIG. 4B, the results were comparable between the two model systems.

[0375] HSkMC with mRNA Encoding Antigens

[0376] HSkMCs were used to evaluate expression of influenza antigens HA and NA, and RSV F protein. Numerous mRNA-LNP formulations with mRNA expressing HA or NA were transfected into HSkMCs at a range of doses (6 pg, 1 .5 pg, 375 ng, 93.75ng, 23.44 ng, and 5.86 ng). As shown in FIG. 5A, transfection of HSkMCs displayed a dose response effect, with decreasing HA expression levels with lower doses of mRNA. This result was comparable to NHP (FIGs. 5B and 5C). A similar effect was shown with NA-expressing mRNA and was also comparable to NHP (FIG. 6A and FIG. 6B). The data shows that mRNA-LNP formulation potency may be reliably tested in the HSkMC model.

[0377] HSkMCs were next transfected with mRNA expressing one of two different forms for the RSV F protein, FD1 , which may exist in either a pre-fusion or post-fusion form, and FD3, which has modifications that lock the protein in the pre-fusion form only (see FIG. 7A).

[0378] The HSkMCs were transfected with the mRNA-LNP formulations using an LNP formulation containing cationic lipid cOrn-EE1 and expression of the RSV F protein was measured with either the D25 antibody, which only recognizes the pre-fusion F protein, or the 5353C75 antibody, which recognizes both pre- and post-fusion forms of RSV F protein. As shown in FIG. 7B, HSkMCs were capable of expressing the RSV F protein in the proper conformation. This result demonstrates that HSkMCs are viable tools for discriminating between conformationally distinct antigens.

[0379] Antigen Expression Detection Methods with HSkMC

[0380] The utility of HSkMCs for screening LNP formulations and measuring potency of LNP formulations is extended with multiple protein measurement techniques. As shown in FIG. 8A, HSkMCs may be transfected with an mRNA encoding a fluorescently labeled antigen (such as GFP) and detected in the cytoplasm of the cells. The number of cells positive for the antigen and fluorescence intensity can be calculated to assess the potency of the mRNA-LNP formulations. As shown in FIG. 8B, the encoded antigen may be secreted into the cell culture media and detected there with antigen specific antibodies which allow direct protein quantitation. As shown in FIG. 8C, the antigen may also be membrane bound and detected on the cell surface by cell imaging and flow cytometry.

[0381] As shown in FIG. 9, HSkMCs were transfected with GFP-encoding mRNA-LNP formulations, with expression detected by FACS. The LNP formulations for the mRNA-LNP were as follows:

[0382] cOrn-EE1 : DMG-PEG:Cholesterol:DOPE:cOrn-EE1 at a ratio of 1 .5:38.5:20:40.

[0383] OF-02: DMG-PEG:Cholesterol:DOPE:OF-02 at a ratio of 1 .5:28.5:30:40.

[0384] MATE-Suc2-E12: DMG-PEG:Cholesterol:DOPE:MATE-Suc2-E12 at a ratio of 1.5:28.5:30:40.

[0385] SM 102: DMG-PEG:Cholesterol:DSPC:SM102 at a ratio of 1 .5:38.5:10:50.

[0386] MC3: DMG^EG: Cholesterol: DSPC:MC3 at a ratio of 1.5:38.5: 10:50.

[0387] cKK-E10: DMG-PEG:Cholesterol:DOPE: cKK-E10 at a ratio of 1 .5:40:28.5:30.

[0388] The HSkMCs yielded reproducible results across three separate experiments.

[0389] Example 7: Human Skeletal Muscle Myoblasts (HSMMs) as an In vitro Cell Model to Predict LNP Potency and Antibody Response In vivo

[0390] Human muscle myoblasts can be used to test the potency of mRNA-LNP formulations and / or predict antibody response in vivo. mRNA encoding the influenza HA antigen was formulated with LNPs (FIG. 10). 40 LNPs were screened in HSMM and protein expression was measured by immunofluorescence (IF). The same LNPs were dosed in mice at 0.4 pg and hemagglutinin-antibody inhibition (HAI) titers were measured. A strong, positive and significant correlation (p=0.62) was observed between HA protein expression in muscle myoblasts and HAI titers in mice.

[0391] Materials and Methods

[0392] For immunogenicity studies, groups of 8 female Balb / c mice (Mus musculus) per treatment group were immunized under isoflurane anesthesia with a dose of 0.05 mL of designated vaccine preparation or diluent via the IM route in the quadriceps, on day 0 in one hind leg and day 21 in the contralateral leg. Mice that lost more than 20% of their initial body weight and displayed severe clinical signs were euthanized after the veterinarian’s assessment of the animal’s health prior to the study termination. Blood was collected from mice via submandibular or orbital sinus bleeds (in-life bleed, pre-study and on study days 0, 21 (approximately 200 pL)) and cardiac puncture (terminal bleed, day 35) from all animals under sedation. Mice were bled on pre-study to obtain a base-line pre-immune serum sample and for pre-screening purposes. Blood samples were collected into SST tubes and allowed to clot for 30 minutes to 1 hour at room temperature. Samples were centrifuged 1000-1300 g for 5-10 minutes and sera was divided into two cryovials and stored at -80 °C. All bleeds were documented on specimen collection and processing logs, indicating the time of sample collection and the technicianresponsible for performing the procedure. Serum samples were evaluated by HAI for antibody titers.

[0393] HAI Assay - HAI assays were performed using the Tas20 H3N2 virus stocks (BIOQUAL, Inc.). Sera were treated with receptor-destroying enzyme (RDE) by diluting one part serum with five parts enzyme and incubated overnight in a 37°C water bath. Enzyme was inactivated by a 45-60-m inute incubation period at 56°C followed by addition of six parts PBS for a final dilution of 1 / 10. HAI assays were performed in V-bottom 96-well plates using four hemagglutinating units (HAU) of virus and 0.5% turkey RBC. The reference serum for each strain was included as a positive control on every assay plate. Each plate also included a back-titration to confirm the antigen dose (4 HAU / 25pl) as well as a negative control sample (PBS or naive control serum). The HAI titer was determined as the highest dilution of serum resulting in complete inhibition of hemagglutination. Results were only valid for plates with the appropriate back-titration result (verifying 4 HAU / 25 pl added) and a reference serum titer within 2-fold of the expected titer.

[0394] HSMM Cell Culture and Transfection - The day before transfection, 10,000 cells / well (Lonza HSMM, CC-2580) were plated in a 96-well plate (100 pL cell suspension / well) in SKGM complete media and incubated overnight at 37°C with 5% CO2. The following day, the cell media was replaced with 100 pl of fresh SKGM media. LNPs encapsulating mRNA encoding for the HA (H3) antigen were diluted to 5 ng / pl working stock in LNP storage buffer. LNPs were transfected at a dose of 10 ng / well and the plate was incubated at 37°C for 20-24 hours. Following incubation, IF imaging was performed to measure protein expression.

[0395] Immunofluorescence Imaging for Measuring Protein Expression - LNP transfected HSMM cells incubated for ~20 hours were washed twice with PBS (Coming; 21 -040-CV). Cells were then fixed in situ with 4% paraformaldehyde (Thermo Scientific; AAJ61899AK) for 10 minutes at room temperature, followed by permeabilization with 0.004% Digitonin (Thermo Scientific; AC407565000) in PBS for 20 minutes. The cells were washed three times with PBS, blocked with 10% goat serum (Gibco; 16210-072) for 1 hour and incubated with flu anti-H3 (H3N2) antibody (Immuno-Technology; IT-003-004M2, 1 :200 dilution) in 10% goat serum, at 4°C overnight.

[0396] Next day, the cells were washed three times with PBS and incubated with Goat- anti-mouse Alexa594 fluorochrome-conjugated secondary antibody (Abeam; ab150116, 1 :200 dilution), in 0.1 % BSA in PBS, supplemented with Hoechst (Invitrogen; R37165) counterstaining dye for 1 hour at room temperature. Secondary antibody mixture was washed with PBS and imaged in 200 pl PBS using an on the Operetta confocal microscope, 20x air objective, 4 fields per treatment. Fluorescence was quantitated using the Harmony imaging software as mean fluorescence intensity (MFI) of Alexa594 or puncta number (represented as H3 spots) of Alexa594 signal.

[0397] In vitro and in vivo Correlation Analysis - For each formulation at dosage of 2 ug, MFI was calculated as the mean of the background (buffer only) subtracted MFI. For the HAI measurements at D35, the geometric mean titer for each formulation was calculated, also adjusting values below LLOQ to 0.5*LLOQ. To assess the monotonic relationships among MFI, hEPO, and HAI, Spearman's rank correlation coefficients, along with their confidence intervals and p-values, were computed. Visualization was achieved using scatterplots combined with marginal histograms, fitted regression lines and statistical details, generated via the “ggstatsplots” package in R.

[0398] Example 8: HSMMs Can be Used to Assess the Potency of Modified and Unmodified mRNAs

[0399] HSMMs can also be used to compare between different mRNA constructs with various modifications or optimizations, such as sequence changes in the UTRs and coding sequences. For example, to assess the impact of mRNA modification on HA protein expression, modified or unmodified influenza HA mRNA formulated with different LNPs was transfected in primary human myoblast (HSMM) at different doses. Protein expression was measured by IF 24 hours following transfection. A significantly higher protein expression was observed with modified mRNA as compared with unmodified mRNA with all LNPs, especially at 50 ng dose and 100 ng dose (FIGs. 11A-11B).

[0400] Example 9: HSMM Can Be Used to Assess Endosomal Escape Efficiencies of Various LNPs

[0401] HSMMs can be used to understand the mechanism of action of LNP / mRNA formulations such as LNP / mRNA uptake, trafficking, and endosomal escape.Single-molecule fluorescence in situ hybridization (smFISH) was used for mRNA imaging to quantify the cellular uptake and endosomal escape of LNP-mRNA. A strong, positive and significant correlation was observed between mRNAs that escape the endosome (faint mRNA spots) and H3 protein expression (FIG. 12). LNPs can be screened for endosomal escape efficiencies by smFISH in HSMMs.

[0402] smFISH Method - HSMM cells were plated at a density of 10,000 cells per well in clear bottom 96-well plates and allowed to grow for 24 hours prior to transfection with mRNA-LNP. Cells were transfected with 5 ng mRNA per 10,000 cells for 4 hours at 37°C. Cells were fixed and permeabilized with methanol followed by overnight hybridization with 100 nM of Stellaris smFISH probes against mRNA encoding influenza H3 antigen, at 37°C. smFISH imaging was done on a spinningdisk confocal microscope using a 40x water-immersion objective. mRNA-LNP uptake by cells was quantified by smFISH analysis. Several images of the cells were acquired to create a z-stack, and the maximum intensity projection (MIP) image was used for object identification, thresholding, and spot-counting. smFISH spot intensities of unformulated mRNA in fixed and permeabilized cells were used for defining single LNP-released single-mRNAs (cytosolic faint spots) and intact LNPs (bright spots). Endosomal escape ratio (ER) is defined herein as the ratio of faint spots to bright spots, which is used to compare the relative endosomal escape efficiencies of different LNP-mRNAs.

[0403] Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the disclosure disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the disclosure being indicated by the following claims.

[0404] All patents and publications cited herein are incorporated by reference herein in their entirety.

Claims

CLAIMSWhat is claimed is:1 . An in vitro system comprising: a plurality of isolated human muscle cells; and a plurality of lipid-nanoparticle (LNP)-encapsulated messenger RNA (mRNA), wherein the plurality of isolated LNP-encapsulated mRNA contact the plurality of isolated human muscle cells in vitro and transfect the plurality of isolated human muscle cells, wherein the LNP comprises at least one cationic lipid, at least polyethylene glycol (PEG) conjugated (PEGylated) lipid, at least one cholesterol-based lipid, and at least one helper lipid.

2. The in vitro system of claim 1 , each of the plurality of LNP-encapsulated mRNA comprising an mRNA, wherein the mRNA encodes an antigen.

3. The in vitro system of claim 2, wherein the antigen is membrane localized on the plurality of isolated human muscle cells.

4. The in vitro system of claim 3, further comprising an antigen binding protein that specifically binds to the antigen.

5. The in vitro system of claim 4, wherein the antigen binding protein comprises a detectable moiety.

6. The in vitro system of claim 2, wherein the antigen is linked to a detectable protein.

7. The in vitro system of claim 6, wherein the detectable protein comprises a fluorescent protein.

8. The in vitro system of claim 7, wherein the fluorescent protein is GFP, RFP, YFP, or dsRed.

9. The in vitro system of claim 2, wherein the antigen is secreted from the plurality of isolated human muscle cells.

10. The in vitro system of any one of claims 1 -9, wherein the plurality of isolated human muscle cells are skeletal muscle cells.11 . The in vitro system of claim 10, wherein the skeletal muscle cells are myocytes, myosatellite cells, or myoblasts.

12. The in vitro system of claim 10 or 11 , wherein the skeletal muscle cells are primary skeletal muscle cells.

13. The in vitro system of claim 10 or 11 , wherein the skeletal muscle cells are immortalized skeletal muscle cells.

14. The in vitro system of claim 13, wherein the immortalized skeletal muscle cells exhibit SV40 large T antigen expression, hTERT expression, HPV16 E6 / E7 expression, adenovirus E1 A / E1 B expression, tumor suppressor gene inactivation, or fusion with one or more immortalized cell line.

15. The in vitro system of claim 13, wherein the immortalized skeletal muscle cells express one or more of cyclin D1 (CCND1 ), cyclin-dependent kinase 4 (CDK4), telomerase (TERT), HPV16 E6 / E7, or adenovirus E1A / E1 B.

16. The in vitro system of claim 13, wherein the immortalized skeletal muscle cells express cyclin D1 (CCND1 ), cyclin-dependent kinase 4 (CDK4), and telomerase (TERT).

17. A multi-vessel in vitro system comprising a plurality of isolated human muscle cells contained within at least two separate vessels, wherein each of the at least two separate vessels comprises a plurality of lipid-nanoparticle (LNP)-encapsulated messenger RNA (mRNA), the plurality of LNP-encapsulated mRNA comprising an LNP, and wherein the LNP comprises a unique composition of lipids in each vessel, wherein each LNP in the plurality of LNP-encapsulated mRNA comprises at least one cationiclipid, at least polyethylene glycol (PEG) conjugated (PEGylated) lipid, at least one cholesterol-based lipid, and at least one helper lipid.

18. The multi-vessel in vitro system of claim 17, wherein each of the at least two separate vessels comprises an LNP with a different cationic lipid.

19. The multi-vessel in vitro system of claim 17, wherein each of the at least two separate vessels comprises an LNP with a different PEGylated lipid.

20. The multi-vessel in vitro system of claim 17, wherein each of the at least two separate vessels comprises an LNP with a different cholesterol-based lipid.21 . The multi-vessel in vitro system of claim 17, wherein each of the at least two separate vessels comprises an LNP with a different helper lipid.

22. The multi-vessel in vitro system of any one of claims 17-21 , wherein the plurality of isolated human muscle cells are skeletal muscle cells.

23. A method of screening LNP-encapsulated mRNA for polypeptide expression, the method comprising: a) contacting a plurality of isolated human muscle cells with a plurality of lipid-nanoparticle (LNP)-encapsulated messenger RNA (mRNA), wherein the plurality of LNP-encapsulated mRNA contact the plurality of isolated human muscle cells in vitro and transfect the plurality of isolated human muscle cells; and b) detecting polypeptide expression, wherein each LNP in the plurality of LNP-encapsulated mRNA comprises at least one cationic lipid, at least polyethylene glycol (PEG) conjugated (PEGylated) lipid, at least one cholesterol-based lipid, and at least one helper lipid.

24. The method of claim 23, wherein each of the plurality of LNP-encapsulated mRNA comprises mRNA, wherein the mRNA encodes an antigen.

25. The method of claim 24, wherein the antigen is membrane localized on the plurality of isolated human muscle cells.

26. The method of claim 25, further comprising an antigen binding protein that specifically binds to the antigen.

27. The method of claim 26, wherein the antigen binding protein comprises a detectable moiety.

28. The method of claim 27, wherein step b) comprises detecting the antigen binding protein comprising the detectable moiety.

29. The method of claim 26, wherein the antigen is linked to a detectable protein.

30. The method of claim 29, wherein the detectable protein comprises a fluorescent protein.31 . The method of claim 30, wherein the fluorescent protein is GFP, RFP, YFP, or dsRed.

32. The method of any one of claims 29-31 , wherein step b) comprises detecting the antigen linked to the detectable protein.

33. The method of claim 32, wherein step b) is performed by fluorescence-activated cell sorting (FACS).

34. The method of claim 26, wherein the antigen is secreted from the isolated human muscle cells into cell culture media.

35. The method of claim 34, wherein step b) comprises detecting the antigen in the cell culture media.

36. The method of any one of claims 23-35, wherein the plurality of isolated human muscle cells are skeletal muscle cells or skeletal muscle myoblasts.

37. A method of producing a validated lipid-nanoparticle (LNP)-encapsulated messenger RNA (mRNA), the method comprising: a) mixing LNPs with mRNAs, thereby forming the LNP-encapsulated mRNA; b) contacting a plurality of isolated human muscle cells with the LNP-encapsulated mRNA; and c) detecting polypeptide expression from the plurality of isolated human muscle cells to validate quality of the LNP- encapsulated mRNA, wherein the quality is validated if expression of the mRNA is detected above a baseline value, wherein the LNP comprises at least one cationic lipid, at least polyethylene glycol (PEG) conjugated (PEGylated) lipid, at least one cholesterol-based lipid, and at least one helper lipid.

38. The method of claim 37, wherein the mRNA encodes an antigen.

39. The method of claim 38, wherein the antigen is membrane localized on the plurality of isolated human muscle cells.

40. The method of claim 39, further comprising an antigen binding protein that specifically binds to the antigen.41 . The method of claim 40, wherein the antigen binding protein comprises a detectable moiety.

42. The method of claim 41 , wherein step b) comprises detecting the antigen binding protein comprising the detectable moiety.

43. The method of claim 40, wherein the antigen is linked to a detectable protein.

44. The method of claim 43, wherein the detectable protein comprises a fluorescent protein.

45. The method of claim 44, wherein the fluorescent protein is GFP, RFP, YFP, or dsRed.

46. The method of any one of claims 43-45, wherein step b) comprises detecting the antigen linked to the detectable protein.

47. The method of claim 46, wherein step b) is performed by fluorescence-activated cell sorting (FACS).

48. The method of claim 38, wherein the antigen is secreted from the isolated human muscle cells into cell culture media.

49. The method of claim 48, wherein step b) comprises detecting the antigen in the cell culture media.

50. The method of any one of claims 37-49, wherein the plurality of isolated human muscle cells are skeletal muscle cells.51 . The method of any one of claims 37-50, wherein the baseline value is a value from a plurality of isolated human muscle cells transfected with an empty LNP.

52. The method of any one of claims 37-51 , wherein the baseline value is a value from a plurality of isolated human muscle cells transfected with an LNP encapsulated with an mRNA encoding a polypeptide that is not detected.

53. An LNP-encapsulated mRNA produced by the method of any one of claims 37- 52.

54. A method of screening lipid-nanoparticle (LNP)-encapsulated messenger mRNA (mRNA) to predict in vivo polypeptide expression or antibody response, the method comprising: a) contacting a plurality of isolated human muscle cells or myoblasts with a plurality of LNP-encapsulated mRNA, wherein the plurality of LNP-encapsulated mRNA contact the plurality of isolated human muscle cells or myoblasts in vitro and transfect the plurality of isolated human muscle cells or myoblasts; and one or both of: b) detecting the presence of the mRNA in the plurality of isolated human muscle cells or myoblasts; and c) detecting in vitro polypeptide expression, wherein each LNP in theplurality of LNP-encapsulated mRNA comprises at least one cationic lipid, at least polyethylene glycol (PEG) conjugated (PEGylated) lipid, at least one cholesterol-based lipid, and at least one helper lipid.

55. The method of claim 54, comprising b) detecting the presence of the mRNA in the plurality of human muscle cells or myoblasts and d) correlating the in vitro mRNA accumulation and / or the mRNA uptake with in vivo polypeptide expression or antibody response.

56. The method of claim 54 or claim 55, comprising c) detecting in vitro polypeptide expression and e) correlating the in vitro polypeptide expression with in vivo polypeptide expression or antibody response.

57. The method of any one of claims 54-56, wherein the antibody response corresponds to an antibody titer.

Images