Method for preparing hydrogel carrying mscs with high HGF expression and use thereof

Abstract

Disclosed is a method for preparing a hydrogel carrying MSCs with high HGF expression and use thereof. The nucleotide sequence of the HGF gene is set forth in SEQ ID NO: 1. The method comprises: constructing a recombinant vector overexpressing HGF; preparing MSC cells overexpressing HGF; and preparing the hydrogel carrying MSCs overexpressing HGF. The prepared hydrogel carrying MSCs overexpressing HGF can promote wound healing and thus possesses great clinical prospects.

Description

Preparation method and application of MSCs hydrogel loaded with high expression of HGF TECHNICAL FIELD

[0001] The present application relates to the technical field of biological materials, in particular to a preparation method and application of MSCs hydrogel loaded with high expression of HGF. BACKGROUND

[0002] Refractory wound (RWs) is the most destructive and common complication of uncontrolled diseases such as metabolic diseases and autoimmune diseases. RWs are characterized by denaturation and necrosis of blood vessel walls, inflammatory cell infiltration and tissue ulceration, which easily lead to vascular injury and tissue necrosis and cause physical and mental pain to patients. Based on the mechanism of wound healing stages (hemostasis, inflammation, proliferation, remodeling), various treatment approaches have been developed, including dressing products, bioengineered skin grafts, cell therapy, etc. Although these treatment methods have made some progress in general wounds, they have rarely been applied in clinical practice. Individual differences in patients with different underlying diseases may be the reason for the unsatisfactory treatment effect. Especially in autoimmune diseases such as systemic lupus erythematosus (SLE), vasculitis (VS), dermatomyositis (DM), Sjogren's syndrome (SS), rheumatoid arthritis (RA) and systemic sclerosis (SSc), the wound healing process under the interaction of immune cells and resident cells is less studied. Therefore, there is currently a lack of effective treatment strategies targeting the molecular mechanisms of these diseases.

[0003] Mesenchymal stem cells (MSCs) belong to multipotent stem cells and exist in many tissues during human development and development. They are the most widely studied stem cells in the field of regenerative medicine and can be derived from bone marrow, umbilical cord, fat, placenta and other tissues.

[0004] HGF is a paracrine multifunctional cell growth factor and is the most effective stimulator of hepatocyte growth and DNA synthesis. It regulates cell mitosis and plays an anti-fibrotic role by inhibiting the expression of transforming growth factor (TGF)-β. It is one of the key factors for angiogenesis and liver regeneration after liver resection or liver injury. SUMMARY

[0005] The purpose of the present application is to overcome the above technical defects and provide a preparation method and application of MSCs hydrogel loaded with high expression of HGF.

[0006] In one aspect, the present application relates to a preparation method of MSCs (MSC HGF ) hydrogel loaded with high expression of HGF, comprising:

[0007] S1, constructing a recombinant vector overexpressing HGF: a recombinant HGF vector is constructed using molecular biology techniques, and the nucleotide sequence of the HGF gene is shown in SEQ ID NO: 1;

[0008] S2, preparing MSCs cells overexpressing HGF: the recombinant plasmid is transformed into MSCs using electroporation, and the cells are screened and expanded in culture by using the corresponding antibiotics to obtain a cell cluster expressing HGF;

[0009] S3, preparing a hydrogel loaded with MSCs HGF : a certain amount of cells is scraped and mixed with the hydrogel;

[0010] In another aspect, the present application relates to the use of a hydrogel loaded with engineered MSCs (MSC HGF ) overexpressing HGF.

[0011] Further, the present application compares the expression of HGF in plasma samples of clinical autoimmune patients and healthy controls by enzyme-linked immunosorbent assay (ELISA). The results show that there is no significant difference in HGF between the healthy control group and the VS patients, SSC, RA and DM. However, the HGF in SS and SLE patients is significantly lower than that in the healthy control group. These results indicate that HGF is involved in the progression of autoimmune diseases and shows disease-specific characteristics. At the same time, the difference in the expression of HGF in SLE patients with and without skin lesions is further compared, and the results show that the expression of HGF in patients with skin lesions is significantly reduced, which indicates that HGF is involved in the healing of skin damage in SLE patients.

[0012] Further, the present application detects the successful transfection of recombinant HGF plasmid into MSCs. Q-RT-PCR results show that the expression of HGF in MSC Vector is significantly increased compared with MSC HGF ; ELISA results show that MSC HGF secretes about 20 ng of HGF into the conditioned medium within 4 days. The results show that the recombinant HGF plasmid is successfully transfected into MSCs, and MSC HGF can effectively overexpress HGF.

[0013] Further, the present application detects the effects of free HGF and MSC HGF on cells. EdU results show that HGF can significantly promote the proliferation of MSCs in a concentration-dependent manner; cell scratch test results show that MSC Vector cells with added HGF and MSC Vector cells show higher cell migration ability compared with MSC HGF cells; apoptosis results show that MSC HGFand HGF pretreated MSCs Vector The resistance to apoptosis induced by oxidative stress is higher. These results show that both HGF gene modification and free HGF can improve the in vitro proliferation, migration and anti-apoptosis ability of MSCs.

[0014] Further, the present application carries out a mouse wound healing test. The results show that, compared with the untreated group, the Hy-MSC Vector group and the Hy-MSC HGF group have better wound healing appearance, and the Hy-MSC HGF group has the fastest healing speed.

[0015] Further, the present application carries out a wound healing test in clinic. The treatment results show that, after 37 days of using MSC HGF loaded hydrogel, the long-term non-healing wound is completely healed, which confirms the ability of MSC HGF loaded hydrogel to promote wound healing.

[0016] Compared with the prior art, the present application has the following beneficial effects:

[0017] The constructed MSC HGF vector has stable HGF expression and secretion ability, and the treatment effect is better than that of the control.

[0018] The MSC HGF can improve the in vitro proliferation, migration and anti-apoptosis ability of cells, and further promote wound healing.

[0019] The MSC HGF loaded hydrogel is more convenient to use, can prolong the retention time of cells in vivo, improve the treatment effect, and promote wound healing of patients. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 is the expression level of HGF in the plasma samples of clinical VS, SSC, RA and DM patients in Example 3.

[0021] Figure 2 is the expression level of HGF in the plasma samples of SS and SLE patients in Example 3.

[0022] Figure 3 is the expression level of HGF in SLE patients with skin lesions compared with SLE patients without skin lesions in Example 3.

[0023] Figure 4 is a Q-RT-PCR result graph of MSC HGF in Example 4.

[0024] Figure 5 is an ELISA result graph of detecting the secreted protein of MSC HGF in Example 4.

[0025] Figure 6 is a graph of EdU staining results for MSCs HGF and HGF, with three parallel repeat tests, scale bar = 150 μm;

[0026] Figure 7 is a graph of wound healing analysis results for HGF in Example 5, with three parallel repeat tests, scale bar = 200 μm.

[0027] Figure 8 is a graph of apoptosis assay results for MSCs in Example 5, with three parallel repeat tests;

[0028] Figure 9 is a graph of wound observation at different time points in the wound healing process within 8 days in Example 6;

[0029] Figure 10 is a graph of wound healing observation in Example 7 using MSC HGF Hydrogel treatment schedule and results for clinical RWs. Wound healing process for SLE patients based on MSC HGF Wound size decreased to complete healing during treatment with MSC DETAILED DESCRIPTION

[0030] The technical solutions of the present application are described below in conjunction with examples, but the present application is not limited to the following examples. The experimental methods and detection methods described in the examples are all conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0031] Example 1 Preparation of MSCs cells overexpressing HGF

[0032] 1. Construction of recombinant vector for MSCs cells overexpressing HGF:

[0033] A recombinant vector overexpressing HGF was constructed using molecular biology techniques. The vector used was pLV-CMV-puro, and the HGF sequence (as shown in SEQ ID NO: 1), three repeated FLAG tag sequences, EGFP sequence and puromycin resistance sequence were inserted into the open reading frame.

[0034] SEQ ID NO: 1 (HGF nucleotide sequence) is as follows:

[0035] atgtgggtgaccaaactcctgccagccctgctgctgcagcatgtcctcctgcatctcctcctgctccccatcgccatcccctatgcagagggacaaaggaaaagaagaaatacaattcatgaattcaaaaaatcagcaaagactaccctaatcaaaatagatccagcactgaagataaaaaccaaaaaagtgaatactgcagaccaatgtgctaatagatgtactaggaataaaggacttccattcacttgcaaggcttttgtttttgataaagcaagaaaacaatgcctctggttccccttcaatagcatgtcaagtggagtgaaaaaagaatttggccatgaatttgacctctatgaaaacaaagactacattagaaactgcatcattggtaaaggacgcagctacaagggaacagtatctatcactaagagtggcatcaaatgtcagccctggagttccatgataccacacgaacacagctttttgccttcgagctatcggggtaaagacctacaggaaaactactgtcgaaatcctcgaggggaagaagggggaccctggtgtttcacaagcaatccagaggtacgctacgaagtctgtgacattcctcagtgttcagaagttgaatgcatgacctgcaatggggagagttatcgaggtctcatggatcatacagaatcaggcaagatttgtcagcgctgggatcatcagacaccacaccggcacaaattcttgcctgaaagatatcccgacaagggctttgatgataattattgccgcaatcccgatggccagccgaggccatggtgctatactcttgaccctcacacc cgctgggagtactgtgcaattaaaacatgcgagacataa (including start codon atg and stop codon taa)

[0036] SEQ ID NO: 2 (amino acid sequence encoded by HGF) is as follows:

[0037] MWVTKLLPALLLQHVLLHLLLLPIAIPYAEGQRKRRNTIHEFKKSAKTTLIKIDPALKIKTKKVNTADQCANRCTRNKGLPFTCKAFVFDKARKQCLWFPFNSMSSGVKKEFGHEFDLYENKDYIRNCIIGKGRSYKGTVSITKSGIKCQPWSSMIPHEHSFLPSSYRGKDLQENYCRNPRGEEGGPWCFTSNPEVRYEVCDIPQCSEVECMTCNGESYRGLMDHTESGKICQRWDHQTPHRHKFLPERYPDKGFDDNYCRNPDGQPRPWCYTLDPHTRWEYCAIKTCET

[0038] 2. Electroporation of recombinant plasmid into MSCs:

[0039] The HGF recombinant plasmid was introduced into MSCs under the conditions of cell concentration 1 x 10 6 / ml, plasmid concentration 5 μg / ml, electric field strength 500 V / cm, and 4 times of electric shock with 1 min interval, and the cells were screened using the antibiotic puromycin tag carried on the plasmid vector to obtain MSCs cells expressing HGF.

[0040] Expansion culture of target cells:

[0041] The electroporated cells were transferred to DMEM / F12 medium added with 10% FBS and 1% double antibiotics (penicillin and streptomycin) and cultured in a 5% CO2, 37°C cell incubator. The above concentrations are all volume percentage concentrations.

[0042] 5. Screening of MSC HGF cells.

[0043] The cells were screened using the antibiotic puromycin tag carried on the recombinant plasmid vector, and the MSCs cells expressing HGF were screened by adding 100 μg / ml of puromycin to the above cell culture medium, and the cells that continued to survive under the condition of adding puromycin were positive cells overexpressing HGF, i.e., MSC HGF cells.

[0044] Example 2 Preparation of hydrogel loaded with MSC HGF s

[0045] The amount of hydrogel used per cm2 of skin lesion area was 1 ml, and the cell count was 10 6 cells using a cell counting plate, and the MSC HGFHydrogel. Hydrogel is a registered hydrogel product of the National Medical Products Administration: Hyaluronic Acid Gel (Nanjing Tianlong Yikang Biotechnology Co., Ltd., Catalog No.: YFG-30). MSCs HGF Cells are cells prepared in Example 1.

[0046] Example 3 Detection of HGF expression in plasma

[0047] The expression of HGF in plasma samples of clinical autoimmune patients and healthy controls was compared by enzyme-linked immunosorbent assay (ELISA) (Human HGF ELISA Kit, purchased from Sino Biological Technology Co., Ltd., Catalog No.: CHE0069-096). The results showed that there was no significant difference in HGF in VS patients (n = 9; p = 0.2795), SSC (n = 30; p = 0.2356), RA (n = 47; p = 0.9004) and DM (n = 18; p = 0.718) compared with the healthy control group (n = 79) (Figure 1). But HGF in SS (n = 43; p = 0.0434) and SLE (n = 111; p = 0.018) patients was significantly lower than that in the healthy control group (Figure 2). These results indicate that HGF is involved in the progression of autoimmune diseases and shows disease-specific characteristics. At the same time we further compared the difference of HGF expression in SLE patients with and without skin lesions, the results showed that the expression of HGF in patients with skin lesions was significantly reduced (Figure 3), which indicated that HGF was involved in the healing of skin damage in SLE patients.

[0048] Example 4 Detection of successful transfection of recombinant HGF plasmid into MSCs

[0049] The recombinant HGF plasmid was transformed into MSCs by electroporation. The expression of HGF was detected by Q-RT-PCR, the method is as follows, total RNA of cultured cells was extracted from the culture medium by Trizol reagent, according to the amount of total RNA 1 μg, cDNA was synthesized by using HiScript II 1st Strand cDNA Synthesis Kit (Vazyme Biotech, Catalog No.: R211-01). The reaction was carried out in StepOne™ real-time fluorescent quantitative PCR instrument using FastStart Universal SYBR Green Master (Vazyme Biotech, Catalog No.: Q141-02). The reaction conditions are: 94℃, 15 seconds, 60℃ 30 seconds, 72℃ 30 seconds, cycle number is 20, the results show that compared with MSC Vector , the expression of HGF in MSCs HGFHGF expression was significantly increased (Figure 4). To verify whether MSCs cells can secrete the protein to the extracellular after expressing HGF, the secretion of HGF was detected using ELISA kit (SBI, Cat No: CHE0069-096). The results confirmed that MSCs HGF secreted about 20 ng of HGF in 4 days (Figure 5). The results showed that the recombinant HGF plasmid successfully transfected MSCs, MSCs HGF can effectively overexpress HGF.

[0050] Example 5 Free HGF and MSCs HGF Test on cell influence

[0051] The effect on cell proliferation was detected by 5-ethynyl-2'-deoxyuridine (EdU) staining (purchased from RiboBio, Cat No: C10310-1). MSCs Vector or MSCs HGF cells were cultured in 12-well plates, and after 48h of pre-treatment with HGF, the cells were stained with EdU-567 according to the kit instructions, and observed under a confocal microscope. The results showed that compared with the control group, the proliferation ability of MSCs Vector and MSCs HGF cells pre-treated with 5 and 20 ng / ml free HGF was significantly enhanced. The EdU positive rate of MSCs Vector pre-treated with 20 ng / ml HGF was higher than that of MSCs Vector pre-treated with 5 ng / ml HGF, indicating that HGF can significantly promote MSC proliferation, and is in a concentration-dependent manner (Figure 6).

[0052] MSCs Vector and MSCs HGF cells pre-treated with free HGF were then used for cell scratch test. MSCs Vector and MSCs HGF cells were cultured in six-well plates, and when the cell density reached 80%, a straight line was gently drawn in the cell layer with a 10μl white small gun head, and then the floating cells were washed away with PBS, and then HGF was added to MSCs Vector cells, and after 24 hours of culture, the scratch healing was observed under a microscope. The results showed that compared with MSCs Vector cells, MSCs Vector cells with added HGF and MSCs HGF cells showed higher cell migration ability (Figure 7).

[0053] MSCs Vector and MSCs HGF cells were cultured in 6-well plates, and MSCs VectorCells were incubated with HGF. Subsequently, the cells were treated with 5 mM H2O2 for 24 hours, stained with annexin V-fluoromethyl isothiocyanate and propidium iodide (PI) for 30 minutes (apoptosis detection kit, purchased from Yisen Bioscience, model number: 40302ES20), and detected using a flow cytometer. The results showed that MSCs HGF and HGF pretreated MSCs Vector were more resistant to oxidative stress-induced apoptosis (Figure 8).

[0054] Example 6 Mouse wound healing test

[0055] To test the wound healing function of MSC HGF loaded hydrogel in vivo, we used a chronic and difficult-to-heal SLE wound model for the study, and all animal care and routine operations met the ethical requirements (ethical number: 2020AE02014). The mice were anesthetized and shaved, and a full-thickness defect wound of about 1.5 × 1.5 cm was established on the back of the mice, and then the wound was injected with a hydrogel, MSC Vector loaded hydrogel (Hy-MSC Vector ), and MSC HGF loaded hydrogel (Hy-MSC HGF ) using a syringe without a needle, respectively; at the same time, the untreated group was used as a negative control (Untreated). During the healing process, the hydrogel was replaced every 48 hours, and the wound healing was recorded using a camera. The results showed that the wound healing appearance of the Hy-MSC Vector and Hy-MSC HGF groups was better than that of the untreated group, and the healing speed of the Hy-MSC HGF group was the fastest (Figure 9).

[0056] Example 7 MSC HGF loaded hydrogel clinically cured human difficult-to-heal wounds (RWs)

[0057] The plan was approved by the Nanjing Gulou Hospital Human Ethics Committee (ethical number: SC2022-006) and was carried out after communication with the patient and signing of the informed consent document. MSC HGF loaded hydrogel was applied to the wound, covered with a medical Vaseline gauze piece and fixed with a bandage, and treated twice a week. When changing the dressing, wound healing was recorded using a wound photo taken with a ruler. We treated a total of 4 patients, and all the wounds improved and healed. One typical patient was a 34-year-old female SLE. The patient had multiple ulcers on her legs, one of which had not healed for a long time after treatment in multiple hospitals. The wound size was 1 × 1 cm, the depth was 2 cm, and there was serous exudation. With the patient's consent, MSC HGFThe protocol for treatment of the hydrogel. Results show that the application of MSCs HGF The wound was completely healed after loading the hydrogel (Figure 10).

[0058] The embodiments of the present application are only intended to illustrate the specific implementation, not to limit the scope of protection. The skilled in the art can make certain modifications under the inspiration of the embodiments, and any equivalent changes or modifications made according to the scope of the present application are within the scope of the present application.

Claims

1. A method for preparing a MSCs hydrogel loaded with high HGF expression, characterized in that: Taking advantage of the stable expression of HGF in MSCs, MSCs expressing HGF were prepared by electroporation and then mixed with hydrogel to obtain MSCs. HGF hydrogel.

2. The method for preparing a MSCs hydrogel loaded with high HGF expression according to claim 1, characterized in that: The following steps are involved: S1. Construction of a recombinant vector for overexpressing HGF: A HGF recombinant vector was constructed using molecular biological techniques. The nucleotide sequence of the HGF gene is shown in SEQ ID NO:

1. S2. Preparation of HGF-overexpressing MSCs: Transform the recombinant plasmid into MSCs using electroporation, screen the cells with corresponding antibiotics, and expand the culture to obtain HGF-expressing MSCs; S3. Preparation of loaded MSCs HGF Hydrogel: scrape 10 6 MSCs cells prepared by step S2 were mixed with hydrogel to obtain loaded MSCs. HGF hydrogel.

3. The method for preparing a MSCs hydrogel loaded with high HGF expression according to claim 1, characterized in that: In step S2, the cell number is counted using a cell counting plate.

4. An application of a MSCs hydrogel loaded with high HGF expression, characterized in that: The amino acid sequence of the protein encoded by the HGF gene is shown in SEQ ID NO:

2.

5. The use of a MSCs hydrogel loaded with high HGF expression according to claim 2, characterized in that: MSC HGF Can effectively overexpress HGF.

6. The use of a MSCs hydrogel loaded with high HGF expression according to claim 2, characterized in that: Both HGF gene modification and free HGF were used to enhance the proliferation, migration and anti-apoptosis ability of MSCs in vitro.

7. The use of a MSCs hydrogel loaded with high HGF expression according to claim 2, characterized in that: The MSC HGF The hydrogel was used to promote wound healing in mice.

8. The use of a MSCs hydrogel loaded with high HGF expression according to claim 2, characterized in that: The MSC HGF Hydrogels are used to heal difficult-to-heal wounds.

Images