Method for the treatment of heart diseases
FGF10 overexpression addresses the inefficacy of current treatments for genetic-related cardiomyopathies by promoting cardiac regeneration and restoring cardiac function, particularly in dilated cardiomyopathies, through gene expression modifications.
Patent Information
- Application Number
- PCT/EP2025/059484
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-08
- Filing Date
- 2025-04-07
- Publication Date
- 2025-10-16
AI Technical Summary
Current treatments for genetic-related cardiomyopathies, particularly those caused by mutations in genes encoding sarcomeric, cytoskeleton, or ion channel proteins, fail to effectively restore cardiac muscle function and are not targeted at the genetic defects, leading to impaired cardiac structure and function.
The use of FGF10 protein or a vector encoding FGF10 to promote cardiac regeneration and repair in genetic-related cardiomyopathies, specifically through overexpression to induce gene expression modifications and restore cardiac function, without targeting the mutated gene.
FGF10 overexpression restores cardiac function and promotes long-term cardiac muscle restoration in subjects with genetic-related cardiomyopathies, including dilated cardiomyopathies, by inducing transcriptional regulation of major regenerative pathways.
Smart Images

Figure IMGF000004_0001 
Figure IMGF000004_0002 
Figure IMGF000005_0001
Abstract
Description
[0001] METHOD FOR THE TREATMENT OF HEART DISEASES FIELD OF THE INVENTION The present invention relates to FGF10 for use in the treatment of heart diseases. BACKGROUND OF THE INVENTION Cardiovascular diseases are the leading cause of mortality in industrialized countries1. Cardiac pathologies, characterized by the destruction of cardiomyocytes and fibrosis infiltration, lead to impaired cardiac function and ultimately to congestive heart failure. The stimulation of terminally differentiated cardiomyocyte proliferation represents one of the main therapeutic approaches for heart regeneration2,3. In the case of genetic-related cardiomyopathies, disorders of the cardiac muscle caused by mutations in genes encoding sarcomeric, cytoskeleton, or ion channel proteins, genetically impaired cardiomyocytes result in impaired cardiac structure and function, and conventional treatments which do not correct the genetic defects occurring in cardiac muscle cells and may not efficiently restore cardiac muscle function. Current efforts are mainly focused on the development of gene therapies which target the mutated gene involved in the development of the cardiomyopathy. However, up to date, no efficient treatment of genetic-related cardiomyopathies is available. Thus, there is still a need to develop new therapeutic approaches for the treatment of genetic- related cardiomyopathies. SUMMARY OF THE INVENTION The inventors have previously uncovered the role of FGF10 in promoting fetal and adult cardiomyocyte proliferation4and recently identified FGF10 as a clinically relevant drug to promote cardiac regeneration and repair in myocardial infarction and / or ischemic heart diseases5. However, due to the fact that cardiomyocyte death in genetic-related cardiomyopathies is due to an abnormal cardiomyocyte morphology and function, there is no evidence to support that the promotion of cardiomyocyte proliferation may be beneficial in the case of genetic-related cardiomyopathies. On the contrary, in view of the fact that replication of cells comprising a mutated gene result in additional cells comprising the mutated gene, there is an expectation that promotion of cardiomyocyte proliferation would be of no benefit. Unexpectedly, it is herein shown, using a Lmna-related dilated cardiomyopathy mouse model which contains a Lmna knockout allele, that overexpressed FGF10 allows to restore cardiac function in a subject suffering from a Lmna-related dilated cardiomyopathy. Indeed, against all odds, the inventors observed that FGF10 overexpression can induce an important gene expression modification in Lmna-related dilated cardiomyopathies, which includes genes relating to extracellular matrix, activation of immune process, metabolism, proliferation and developmental process. In one word, FGF10 overexpression induces transcriptional regulation of major regenerative pathway in Lmna-related dilated cardiomyopathies. This gene remodeling allows to restore cardiac function in a subject suffering from a Lmna-related dilated cardiomyopathy. Most surprisingly, despite their structural defect and inheritance of the defective gene, cardiac myocytes treated according to the present invention allow long-term restoration of cardiac function. Accordingly, the present invention relates to a substance which is selected from the group consisting of a FGF10 protein and a vector encoding FGF10, for use in the treatment of a genetic-related cardiomyopathy, in particular an inherited cardiomyopathy, in a subject in need thereof. In particular embodiment, the treatment does not comprise a concomitant therapy targeting the mutated gene involved in the development of the cardiomyopathy. In a more particular embodiment, the genetic-related cardiomyopathy is selected from a genetic-related dilated cardiomyopathy, a genetic-related restrictive cardiomyopathy, and a genetic-related hypertrophic cardiomyopathy. In a still more particular embodiment, the genetic-related cardiomyopathy is a genetic-related dilated cardiomyopathy. In another still more particular embodiment, the subject suffers from a laminopathy. The present invention also relates to a pharmaceutical composition comprising a substance selected from the group consisting of a FGF10 protein and a vector encoding FGF10 and a pharmaceutically acceptable carrier for use in the treatment of a genetic-related cardiomyopathy, in particular an inherited cardiomyopathy, in a subject in need thereof. In a particular embodiment, the pharmaceutical composition for use according to the invention comprises from 1x1010to 1x1015vg of an AAV vector encoding FGF10. The present invention also relates to the use of a substance selected from the group consisting of a FGF10 protein and a vector encoding FGF10 in the manufacture of a medicament for the treatment of a genetic-related cardiomyopathy. LEGENDS OF THE FIGURES Figure 1: Up-regulation of Fgf10 levels in related dilated cardiomyopathies preserves cardiac function and remodeling. (A) Schematic of the experimental plan. Cardiomyocyte-specific deletion has been achieved through tamoxifen (TAM) injection in postnatal mice (between P1-P3) and the animals were fed with normal (No Dox) or doxycycline-supplemented (Dox) food required to overexpress Fgf10. (Ctrl) and R26RTTA / RTTA;Tet(o)Fgf10 / +;αMHCMCMLmnaFlox / Flox(Del) were followed once a week, between 4 to 8 weeks post-injection by echocardiography. (B) Survival analysis. Ctrl + No Dox, n=8; Ctrl + Dox, n=7; Del + No Dox, n=10; Del + Dox, n=11. (C) M-mode images of echocardiographic experiments (scale bars, x=0.1s; y: 1mm). (D) Ejection Fraction. (E) Fractional shortening. (4 weeks post-injection, Ctrl + No Dox, n=7; Del + No Dox, n=9; Ctrl + Dox, n=8; Del + Dox; n=11; 5 weeks post-injection, Ctrl + No Dox, n=7; Del + No Dox, n=8; Ctrl + Dox, n=8; Del + Dox; n=11; 6 weeks post-injection, Ctrl + No Dox, n=7; Del + No Dox, n=7; Ctrl + Dox, n=8; Del + Dox; n=11; 7 weeks post-injection, Ctrl + No Dox, n=7; Del + No Dox, n=6; Ctrl + Dox, n=8; Del + Dox; n=10; 8 weeks post-injection, Ctrl + No Dox, n=7; Del + No Dox, n=5; Ctrl + Dox, n=8; Del + Dox; n=10). Statistics: *, p<0.05; **,0.001<p<0.01; ***, p<0.001; Student’s t-test panel E and F between Ctrl and Del + No Dox. *, p<0.05; **,0.001<p<0.01; ***, p<0.001; Student’s t-test panel E and F between Del + No Dox and Del + Dox. Figure 2: Up-regulation of Fgf10 levels in Lmna-related dilated cardiomyopathies prevents fibrosis. Cardiomyocyte-specific deletion has been achieved through tamoxifen (TAM) injection in postnatal mice (between P1-P3) and the animals were fed with normal (No Dox) or doxycycline-supplemented (Dox) food required to overexpress Fgf10. (A-B) Fibrosis in R26RTTA / RTTATet(o)Fgf10 / +αMHCWTLmnaFlox / Flox(Ctrl) and R26RTTA / RTTATet(o)Fgf10 / +αMHCMCMLmnaFlox / Flox(Del) mice heart was investigated 8 weeks post- injection using histological Sirius red staining. Scale bars, 1000 µm. (Ctrl + No Dox, n=6; Del + No Dox, n=4; Ctrl + Dox, n=3; Del + Dox, n=3 for each condition). (C) qRT-PCR analysis of Col1a1 and Col3a1 (Ctrl + No Dox, n=6; Del + No Dox, n=5; Ctrl + Dox, n=6; Del + Dox, n=5) in the heart. LV, Left Ventricle ; RV, Right Ventricle ; ns, non-significant. Statistics: *, p<0.05; **,0.001<p<0.01; ***p<0.001; Mann-Whitney U test. Figure 3: Up-regulation of Fgf10 levels in Lmna-related dilated cardiomyopathies prevents cardiomyocyte hypertrophy. Cardiomyocyte-specific deletion has been achieved through tamoxifen (TAM) injection in postnatal mice (between P1-P3) and mice were fed with normal (No Dox) or doxycycline- supplemented (Dox) food required to overexpress Fgf10. (A-D) Immunofluorescence experiments were performed 8 weeks post-injection to evaluated cardiomyocytes cross- sectional area frequency in left ventricle. Ctrl + No Dox n=5; Del + No Dox; n=7; Ctrl + Dox, n=4; Del + Dox, n=3; compered using Fisher statistical test. Scale bars, 25µm. ns; non significant. Statistics: *, p<0.05; **,0.001<p<0.01; ***, p<0.001. Figure 4: Specificity of the protective effect of Fgf10 up-regulation on cardiac function and remodeling in Lmna-related dilated cardiomyopathies. (A) Schematic of the experimental plan. Cardiomyocyte-specific deletion has been achieved through tamoxifen (TAM) injection in postnatal (between P1-P3) and mice were fed with normal (No Dox) or doxycycline-supplemented (Dox) food required to overexpress Fgf10. (Ctrl) and R26RTTA / RTTA;Tet(o)WT;αMHCMCM;LmnaFlox / Flox(Del) were followed once a week, between 4 to 8 weeks post-injection by echocardiography. (B) Survival analysis. Ctrl + No Dox, n=4; Ctrl + Dox, n=6; Del + No Dox, n=9; Del + Dox, n=12. (C) Ejection Fraction. (D) Fractional shortening. (E) Left ventricular systolic volume. (4 weeks post-injection, Ctrl + No Dox, n=4; Del + No Dox, n=6; Ctrl + Dox, n=6; Del + Dox; n=11; 5 weeks post-injection, Ctrl + No Dox, n=4; Del + No Dox, n=6; Ctrl + Dox, n=6; Del + Dox; n=9; 6 weeks post-injection, Ctrl + No Dox, n=4; Del + No Dox, n=6; Ctrl + Dox, n=6; Del + Dox; n=9; 7 weeks post-injection, Ctrl + No Dox, n=4; Del + No Dox, n=5; Ctrl + Dox, n=6; Del + Dox; n=7; 8 weeks post-injection, Ctrl + No Dox, n=4; Del + No Dox, n=5; Ctrl + Dox, n=6; Del + Dox; n=7). Statistics: *, p<0.05; Kaplan Meier panel B and *, p<0.05; **,0.001<p<0.01; ***p<0.001; Student’s t-test; panel D-F, analysis between Ctrl and Del + No Dox. $, p<0.05; $$,0.001<p<0.01; $$$p<0.001; Student’s t-test; panel D-F, analysis between Ctrl and Del + Dox. Figure 5: Analysis of Lmna deletion, FGF10 up-regulation and viral expression in mice heart following tamoxifen injection and AAV9 treatment. Adult αMHCMCM;LmnaFlox / Floxmice were injected with tamoxifen (1mg / 20g) to delete Lmna in cardiomyocytes and with a saline solution containing 1.1011particles of either AAV9-CMV- GFP (AAV9-GFP) or AAV9-CMV-FGF10 (AAV9-FGF10) vectors. Results were compared to αMHCWT;LmnaFlox / Floxinjected with tamoxifen (Ctrl) and analysis were performed 4 weeks post-injection. qRT-PCR analysis of (A) Lmna (Ctrl, n=6; AAV9-GFP, n=12; AAV9-FGF10, n=7), (B) FGF10 (Ctrl, n=6; AAV9-GFP, n=12; AAV9-FGF10, n=7), and (C) CMV (Ctrl, n=6; AAV9-GFP, n=12; AAV9-FGF10, n=6) expression in left ventricle. Statistics: *, p<0.05; **,0.001<p<0.01; ***, p<0.001; Student’s t-test Figure 6: Up-regulation of FGF10 levels using AAV9 gene transfer therapy in Lmna- related dilated cardiomyopathies preserves cardiac function and remodeling. (A) Schematic of the experimental plan. αMHCMCM;LmnaFlox / Floxmice were injected with tamoxifen (1mg / 20g) to delete Lmna in cardiomyocytes and with a saline solution containing 1.1011particles of either AAV9-CMV-GFP (AAV9-GFP) or AAV9-CMV-FGF10 (AAV9- FGF10) vectors. Mice were followed once a week during 4 weeks post-injection by echocardiography. (B) M-mode images of echocardiographic experiments (scale bars, x=0.1s; y: 1mm). (C) Fibrosis was investigated 4 weeks post-injection using histological Sirius red staining; scale bars, 1000 µm. (D) qRT-PCR analysis of Col1a1, Col3a1, and Postn (Ctrl, n=13; AAV9-GFP, n=12; AAV9-FGF10, n=7) expression in the left ventricle. Results were compared to αMHCWT;LmnaFlox / Floxmice injected with tamoxifen and saline solution (Ctrl) and analysis were performed 4 weeks post-injection. Statistics: *, p<0.05; **,0.001<p<0.01; ***, p<0.001; Student’s t-test Figure 7: Up-regulation of FGF10 levels using AAV9 gene transfer therapy in Lmna- related dilated cardiomyopathies promotes cardiomyocyte cell cycle re-entry and prevents cardiomyocyte cell death. (A) Schematic of the experimental plan. αMHCMCM;LmnaFlox / Floxmice were injected with tamoxifen (1mg / 20g) to delete Lmna in cardiomyocytes and with a saline solution containing 1.1011particles of either AAV9-CMV-GFP (AAV9-GFP) or AAV9-CMV-FGF10 (AAV9- FGF10) vectors. Mice were analyzed 4 weeks later. (B) Western blot experiment revealing reduced cardiac Troponin I (cTnI) serum levels in control-deleted (AAV9-CMV-GFP) compared to deleted-treated mice (AAV9-CMV-FGF10) (n=5 for each condition). (C-E) Immunofluorescence experiments were performed 4 weeks post-injection to evaluated cardiomyocytes (MF20+; Ki67+; white arrowheads) (D) and non-cardiomyocytes (MF20-; WGA+; Ki67+; yellow arrowheads) (E) (n=6 per group for each condition). Scale bars, 50µm. (F) Cardiomyocyte cross-sectional area frequency (n=6 per group for each condition; compered using Fisher statistical test). Scale bars, 25µm. LV, Left Ventricle; RV, Right Ventricle. Statistics: *, p<0.05; **,0.001<p<0.01; ***, p<0.001; Student’s t-test; panel C and D. **,0.001<p<0.01; Mann-Whitney U test; panel F. Figure 8: Evaluation of potential AAV9-FGF10 treatment alternative toxicity. αMHCMCM;LmnaFlox / Floxmice were injected with tamoxifen (1mg / 20g) to delete Lmna in cardiomyocytes and with a saline solution containing 1.1011particles of either AAV9-CMV- GFP (AAV9-GFP) or AAV9-CMV-FGF10 (AAV9-FGF10) vectors. (A) qRT-PCR of CMV relative expression 4 weeks post-injection in different organs (LV and RV Ctrl, n=6; AAV9- GFP, n=12; AAV9-FGF10, n=7; liver; CTRL, n=3; AAV9-GFP and AAV9-FGF10, n=6; brain, kidney, and lung n=5 per group and spleen AAV9-GFP, n=3; AAV9-FGF10, n=5). (B) qRT-PCR of FGF10 relative expression 4 weeks post-injection in different organs (LV, RV, and liver AAV9-FGF10, n=7; lung, spleen, brain, and kidney n=5 per condition). (C) Liver, lung, spleen, kidney, and brain section counterstained with hematoxylin-eosin showing that 4 weeks post-injection, AAV9-FGF10 injection does not alter organ morphology. (Liver, AAV9- GFP, n=10; AAV9-FGF10, n=7; brain, spleen, kidney and lung, n=5 per group). Scale bars, 50µm. LV, Left Ventricle; RV, Right Ventricle. Statistics: *, p<0.05; **,0.001<p<0.01; ***, p<0.001; ns, non-significant; Student’s t-test. Figure 9: RNA-seq analysis reveals that AAV9-FGF10 treatment induces transcriptional regulation of major regenerative pathways in Lmna-related dilated cardiomyopathies. αMHCMCM;LmnaFlox / Floxmice were injected with tamoxifen (1mg / 20g) to delete Lmna in cardiomyocytes and with a saline solution containing 1.1011particles of either AAV9-CMV- GFP (AAV9-GFP) or AAV9-CMV-FGF10 (AAV9-FGF10) vectors. (A) Heatmap showing hierarchical clustering of differentially expressed genes in biological replicates (n=4 for each condition). (B) Principal component (PC) analysis of RNA-sequencing. (C) Gene ontology enrichment of RNA-seq in in deleted-treated mice heart (AAV9-CMV-FGF10) compared to control-deleted mice heart (AAV9-CMV-GFP) (n=4 for each condition). Figure 10: Identification of major genes modified by AAV9-FGF10 treatment in Lmna- related dilated cardiomyopathies. Violin plot analyses of genes that were identified in bulk RNA sequencing shown in Figure 9 (n=4 for each condition). Figure 11: Elevated myocardial FGF10 levels in human failing hearts correlates with increased cardiomyocyte proliferation, reduced cardiomyocyte size and reduced fibrosis. Human explanted failing heart samples were collected from 10 patients displaying dilated cardiomyopathy from non-ischemic origins. Cardiomyocyte proliferation was evaluated using immunofluorescence experiments and the cell cycle marker Ki67 and correlated with FGF10 (A) and PCNA (B) expression levels measured by qRT-PCR. (C) Cardiomyocyte cross- sectional area (CSA) was measured using the cell membrane marker WGA. Elevated FGF10 levels correlate with high frequency of small cardiomyocytes. (D) Cardiac fibrosis was assessed using histological Sirius red staining. (E) Elevated FGF10 levels correlate with reduced fibrosis. (F-H) Elevated FGF10 levels correlate with reduced fibrotic gene marker expression (COL1A2, POSTN, COL3A1). Statistical significance (p) was determined using Student’s t- distribution. DETAILED DESCRIPTION OF THE INVENTION The present invention provides a novel strategy for the treatment of a genetic-related cardiomyopathy, in particular an inherited cardiomyopathy. It is based on the unexpected finding that FGF10 is able to restore cardiac function of mice which bear a deletion mutation in LMNA gene. The present invention relates to a substance which is selected from FGF10 protein or a vector encoding FGF10, for use in the treatment of a genetic-related cardiomyopathy in a subject in need thereof. Fibroblast Growth Factor 10 (FGF10) is a protein that plays an important role in the regulation of embryonic development, cell proliferation and cell differentiation. Notably, it is required for normal branching morphogenesis. According to the invention, FGF10 may be derived from any species. However, in a preferred embodiment, in particular for human therapy, FGF10 is derived from primates such as non- human primates or is human FGF10. In a particular embodiment, FGF10 is human FGF10 (such as FGF10 with Uniprot accession number O15520). In a particular embodiment of the invention, the substance is a FGF10 protein, which may be a natural, a recombinant or a synthetic protein, in particular a protein of sequence SEQ ID NO: 1, or having at least 85%, 90%, 95%, 97%, 98% or 99% identity to the full length amino acid sequence set forth in SEQ ID NO: 1. As used herein, the term “identity” refers to the number of matches (identical amino acid residues) between two protein sequences. The sequence identity is determined by comparing the sequences when aligned so as to maximize overlap and identity while minimizing sequence gaps. In particular, protein sequence identity may be determined using any mathematical global or local alignment algorithm. The choice of suitable algorithm may depend on the length of the two sequences or the purpose of sequence alignment. A skilled person can determine appropriate algorithm and parameters for measuring sequence identity. For instance, protein sequence alignment for purpose of determining sequence identity percentage may be achieved by using publicly available computer software available on internet web sites such as or https: / / blast.ncbi.nlm.nih.gov / Blast.cgi. In another particular embodiment of the invention, the substance is a vector encoding FGF10. According to the present invention, a "vector encoding FGF10" may be an expression vector comprising a nucleic acid sequence encoding FGF10. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. Preferably, said vector is an expression vector comprising a nucleic acid sequence encoding FGF10, typically a human FGF10 protein, such a FGF10 protein of SEQ ID NO:1, operably linked to a promoter. Relying on vectors, such as on viral vector, has the advantage of resulting in the constitutive expression of FGF10, from a cell or tissue of interest, in particular from cardiac cells. In a particular embodiment, the vector encoding FGF10 comprises a strong promoter which provides robust and high levels of transgene expression. Examples of strong promoter that can be sited are CMV (cytomegalovirus) promoter or synthetic CAG promoter In another particular embodiment, the promoter is a promoter functional in cardiac cells, such as an ubiquitous promoter (for example the CMV promoter) or a cardiac-specific promoter (such as the aMHC and TnT promoters). Viral vectors useful in the practice of the invention include, without limitation, adenoviral vectors, retroviral vectors, lentiviral vectors and adeno-associated virus (AAV) vectors. In a particular embodiment, the viral vector is a non-integrating viral vector, such as AAV vectors and adenovirus vectors. The term “non-integrating viral vector” refers to a group of viral vectors whose genetic material remains in the cytoplasm in an episomal form. In a more particular embodiment, the viral vector is an AAV vector. The capsid of said AAV vector may be the capsid of any serotype of AAV known in the art, e.g. serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVM41, or modified AAV capsid thereof. In a particular embodiment, the capsid of the AAV vector is selected from the group consisting of an AAV1, AAV6, AAV8, AAV9 and AAVM41 capsid. In a still particular embodiment, the capsid of the AAV vector is an AAV9 capsid. In a more particular embodiment, the substance for use according to the invention is an AAV vector comprising a nucleic acid of sequence SEQ ID NO: 2. According to the present invention, the above described substance is for use in the treatment of a genetic-related cardiomyopathy in a subject in need thereof. Within the context of the invention, a subject in need thereof is a mammal subject, such as a human subject, having a genetic-related cardiomyopathy. Genetic-related cardiomyopathies are a group of heart diseases which are caused by mutations in genes encoding proteins that affect heart muscle's structure and function. Such a mutation may be a substitution, a suppression or an insertion of one or more nucleotides in the gene. Such a mutation may be inherited or a de novo mutation. In particular, a genetic-related cardiomyopathy may be an inherited cardiomyopathy, meaning that it can be passed down through families. The inheritance pattern may be dominant or recessive. Genetic-related cardiomyopathies include various types such as hypertrophic cardiomyopathy (HCM), dilated cardiomyopathy (DCM), restrictive cardiomyopathy (RCM), arrhythmogenic right ventricular cardiomyopathy (ARVC), and left ventricular noncompaction (LVNC). These conditions can lead to symptoms like heart fibrosis, heart failure, arrhythmias, and in severe cases, sudden cardiac death. .For instance, mutations in LMNA (which encodes lamin A / C), DSC2 (which encodes desmocollin 2), DSG3 (which encodes desmoglein-3), DSP (which encodes desmoplakin), JUP (which encodes plakoglobin), PKP2 (which encodes plakophilin 2), MYBPC3 (which encodes myosin binding protein C), or MYH7 (which encodes a myosin heavy chain 7) may be involved in genetic-related dilated cardiomyopathies, genetic-related hypertrophic cardiomyopathies and genetic-related arrhythmogenic cardiomyopathies, respectively9. In a particular embodiment, the genetic-related cardiomyopathy is a cardiomyopathy related to one or more of the genes selected from the group consisting of ACTC (which encodes actin alpha cardiac muscle 1), ANKRD1 (which encodes ankyrin repeat domain 1), BAG3 (which encodes bcl2-associated athanogene 3), DMD (which encodes dystrophin), DES (which encodes desmin), EMD (which encodes emerin), EYA4 (which encodes EYA transcriptional coactivator and phosphatase 4), FKRP (which encodes fukutin related protein), LAMA4 (which encodes laminin subunit alpha 4), LDB3 (which encodes LIM domain binding 3), LMNA, DSC2, DSG3, DSP, JUP, PKP2, MYBPC3, MYH6(which encodes myosin heavy chain 7), MYH7, PLN (which encodes phospholamban), RBM20 (which encodes RNA binding motif protein 20), SCN5A (which encodes sodium voltage-gated channel alpha subunit 5), SYNE1 (which encodes spectrin repeat containing nuclear envelope protein 1), SYNE2 (which encodes spectrin repeat containing nuclear envelope protein 2), TNNC1 (which encodes slow skeletal and cardiac type troponin C1), TNNI3 (which encodes cardiac type troponin I3), TNNT2 (which encodes cardiac type troponin T2), TPM1 (which encodes tropomyosin 1), TMPO (which encodes thymopoietin) and TTN (which encodes titin). In a more particular embodiment, the genetic-related cardiomyopathy is a cardiomyopathy caused by one or more mutations of the gene LMNA. In another particular embodiment, the substance disclosed herein is for use in the treatment of a genetic-related cardiomyopathy selected from a genetic-related dilated cardiomyopathy, a genetic-related restrictive cardiomyopathy, and a genetic-related hypertrophic cardiomyopathy. In a more particular embodiment, said genetic-related cardiomyopathy is a genetic-related dilated cardiomyopathy. Dilated cardiomyopathies are characterized by cardiomyocyte necrosis and fibrotic infiltration associated with ventricular dilation and impaired cardiac function leading to severe heart failure6. In a still more particular embodiment, said genetic-related cardiomyopathy is LMNA-related dilated cardiomyopathy. The term “LMNA-related dilated cardiomyopathy” refers to a dilated cardiomyopathy which is caused by one or more mutations of the gene LMNA. In another particular embodiment, said genetic-related cardiomyopathy is a laminopathy involving cardiomyopathy. A laminopathy involving cardiomyopathy is a laminopathy with the development of cardiomyopathy. According to the invention, a subject in need of a substance of the invention may be a subject suffering from laminopathy. Laminopathies are a group of rare diseases caused by alterations in the gene encoding lamin A / C (LMNA gene). This protein is essential for the structure of cell nuclei. The mutations in said gene can affect various tissues such as skeletal and cardiac muscle, the peripheral nervous system, adipose tissue, and multiple organs simultaneously. Examples of laminopathies are Emery-Dreyfuss muscular dystrophy, limb-girdle dystrophy, Hutchinson Gilford Progeria, and congenital muscular dystrophy. In a particular embodiment, the above-described substance is for use in the treatment of an genetic-related cardiomyopathy in a subject in need thereof, wherein said treatment does not comprise a concomitant therapy targeting the mutated gene involved in the development of the cardiomyopathy. In a more particular embodiment, said concomitant therapy targeting one or more genes selected from the group consisting of ACTC, ANKRD1, BAG3, DMD, DES, EMD, EYA4, FKRP, LAMA4, LDB3, LMNA, DSC2, DSG3, DSP, JUP, PKP2, MYBPC3, MYH6, MYH7, PLN, RBM20, SCN5A, SYNE1, SYNE2, TNNC1, TNNI3, TNNT2, TPM1, TMPO and TTN. The present invention also relates to a pharmaceutical composition comprising a substance as described above for use in the treatment of a genetic-related cardiomyopathy. The substance for use according to the present invention may be in the form of an injectable composition comprising a therapeutically effective amount of the substance, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. or European Pharmacopeia or other generally recognized pharmacopeia for use in animals, and humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like. The pharmaceutical composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can also take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations and the like. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E. W. Martin. Such compositions contains a therapeutically effective amount of the substance, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the subject. In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravascular administration, such for intravenous or intra-arterial administration, to human beings. Typically, compositions for intravascular administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lidocaine to ease pain at the site of injection. The substance is used in a therapeutically effective amount. The amount of the therapeutic substance which is effective in the treatment of a genetic-related cardiomyopathy can be determined by standard clinical techniques. In addition, in vivo and / or in vitro assays may optionally be employed to help predict optimal dosage amounts. The precise amount to be employed will also depend on the route of administration, and the seriousness of the disease, and should be decided according to the judgment of the practitioner and each patient's circumstances. The amount of the therapeutic substance administered to the subject in need thereof will vary based on several factors including, without limitation, the route of administration, the specific disease treated, the subject’s age or the level of protein required, or the level of expression necessary to achieve the therapeutic effect. One skilled in the art can readily determine, based on its knowledge in this field, the dosage range required based on these factors and others. In a particular embodiment, the pharmaceutical composition of the invention comprises from 1x1010to 1x1015vg of an AAV vector encoding FGF10, in particular 5x1013vg. The present invention also relates to a method of treatment of a genetic-related cardiomyopathy, said method comprising the administration of a substance or a pharmaceutical composition as described above to a subject in need thereof. The term "treatment" is used herein to refer to any regimen that can benefit an animal, in particular a mammal, more particularly a human subject. Accordingly, a treatment may include therapeutic, curative, alleviation or prophylactic effects. Accordingly, therapeutic and prophylactic treatment include amelioration of the symptoms of a particular heart disease or preventing or otherwise reducing the risk of developing a particular heart disease. The term "prophylactic" may be considered as reducing the severity or the onset of a particular condition. "Prophylactic" also includes preventing reoccurrence of a particular condition in a patient previously diagnosed with the condition. "Therapeutic" may also include the reduction of the severity of an existing condition. The above-described substance or pharmaceutical composition for use according to the invention may be administrated through a number of routes, for example via the oral, intramuscular, subcutaneous or intraperitoneal route, or preferably intravascularly (such as intra-arterially or intravenously) or through injection into the heart of the subject, such as by intracardiac or intracoronary injection. The administration of the substance or the pharmaceutical composition is preferably done the earliest after onset or diagnosis of the genetic-related cardiomyopathy. In a particular embodiment, administration may be done up to normalization of cardiac physiological parameters, although administration may be conducted for a longer time. In a particular embodiment, the therapeutic agent is administered the earliest after onset or diagnosis of the genetic-related cardiomyopathy, and up to normalization of cardiac physiological parameters. The administration of the substance or the pharmaceutical composition may include single or multiple administrations. In particular, administration may be done, for example, once a day, once a week or once a month during a time sufficient for the treatment of the disease to be effective. In a further particular embodiment, therapeutic agent administration is done daily starting from the day of onset of a genetic-related cardiomyopathy (otherwise referred to as day 0) or from the day of medical care or diagnosis of the patient. In another embodiment, the administration of the substance is done daily starting from the day after the day of onset of a genetic-related cardiomyopathy (i.e. at day 1) or from the day after medical care or diagnosis of the patient, or starting from 2 days (i.e. at day 2) after the day of onset or after the day of medical care or diagnosis of the patient. In a variant of this embodiment, therapeutic administration is done daily starting from day 0, from day 1 or from day 2 after the onset of a genetic-related cardiomyopathy or from the day of medical care or diagnosis of the patient. In a particular embodiment, the administration is discontinuous, i.e. administration is not done daily. In a further particular embodiment, the administration is done daily during the treatment phase. In another embodiment, the treatment is an acute treatment, done for a short period of time (such as for several days, for example for no more than 30 days, 29, 28, 27, 26, 25, 24, 23, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or no more than 10 days). In another particular embodiment, the treatment is a chronic treatment, wherein administration of the therapeutic agent is done for at least several weeks, several months, or even several years. In a more particular embodiment, an AAV vector encoding FGF10 for use according to the invention is administrated in a subject in need thereof with a level of from 1012vg / kg to 1014vg / kg, in particular with a level of 4x1012vg / kg. In another particular embodiment, the administration of a substance or a pharmaceutical composition of the invention is not concomitant with a therapy targeting the mutated gene involved in the development of the cardiomyopathy. As used herein, the term “therapy targeting the mutated gene involved in the development of the cardiomyopathy” means any therapy capable of modulating or correcting the function or expression of the mutated gene known or suspected to be causative or contributory in the onset, progression, severity, or manifestations of the cardiomyopathy. Typically, the administration of the substance or the pharmaceutical composition of the invention is not concomitant with a therapy targeting the LMNA mutated gene. In yet another embodiment, the above-described substance is for use in combination with a second therapy for a genetic-related cardiomyopathy, wherein said second therapy does not target the mutated gene involved in the development of the cardiomyopathy. Within the context of the present invention, depending on the underlying disease, a therapy targeting the mutated gene involved in the development of the cardiomyopathy is a therapy targeting one or more of the genes selected from the group consisting of ACTC, ANKRD1, BAG3, DMD, DES, EMD, EYA4, FKRP, LAMA4, LDB3, LMNA, DSC2, DSG3, DSP, JUP, PKP2, MYBPC3, MYH6, MYH7, PLN, RBM20, SCN5A, SYNE1, SYNE2, TNNC1, TNNI3, TNNT2, TPM1, TMPO and TTN. The invention will now be described with reference to the following examples. EXAMPLES MATERIAL AND METHODS Mouse lines The following mouse lines were used: LmnaFlox / Flox, αMHC-MerCreMer7, Rosa26-rtTA ;Tet(O)-Fgf1010and CD1 (Charles River). LmnaFlox / Floxmice allowing conditional invalidation of the Lmna gene are phenotypically normal and fertile. The creation of a condition Lmna knockout allele is achieved by the introduction of 100bp loxp sites upstream and downstream of the exon 2. Specific Cre-driven recombination will then lead to the deletion of the exon 2 resulting in a premature stop codon and in the absence of any protein production. All animal care and procedures were approved by the Departmental Direction of Veterinary services of the Frech Ministry of Agriculture and local ethics committee (APAFIS #26541- 2020070912206899 v1, APAFIS #27075-2020090712103041 v2, APAFIS #19069- 2019021113531586 v3 and APAFIS #13031-2018011509582398 v3). Cardiomyocyte-specific Lmna deletion has been achieved through tamoxifen (TAM) injection in postnatal (between P1- P3; one intraperitoneal injection 1mg / 20g) or adult (10–15-week-old; one intraperitoneal injection 1mg / 20g) heart. Rosa26-rtTA mice were crossed with Tet(O)-Fgf10 mice to generate double transgenic mice. Conditional Fgf10 overexpression is achieved thought doxycycline administration by food (625 mg / kg DOX; Altromin special feed GmbH & Co. KG, Germany). Postnatal and adult mouse were euthanized using cervical dislocation. For each mice the chest was opened, and blood was collected. The blood was coagulated at RT, the homogenate was centrifugated (1000 g, 20 minutes, RT) and the supernatant was collected and stored at -20°C. The heart was removed, dissected in cold 1X Phosphate buffer saline (PBS) and separated in two parts (dorsal and ventral). For histological experiments, the ventral part was collected and fixed in 4% paraformaldehyde solution (PFA) overnight at 4°C. For qRT-PCR, the dorsal part was collected, left and right ventricles separated, frozen in liquid nitrogen and stored at - 80°C. Other organs (liver, lung, liver, kidney, and brain) were also collected for qRT-PCR blot and histology. Genotyping Genomic DNA from tail or ear biopsies was genotyped by polymerase chain reaction using the Phire Animal Tissue PCR Kit (Life Technologies). Specific primers used are listed in Table 1. The conditions of experiment used were pre-denaturation at 94°C for 5 minutes, 30 or 35 cycles of denaturation at 94°C for 45 seconds (in function of gene analyzed), annealing at 60°C for 45 seconds, elongation at 72℃ for 45 seconds and a final elongation at 72°C for 7 minutes. PCR products were separated using agarose gel electrophoresis to detect specific amplified fragments. Table 1: PCR primers for genotyping: Mouse line Primers Sequence 5’-3’ Product size CRE- AGGTTCGTTCACTCATGGA For (SEQ ID NO: 3) CRE 200 bp CRE- TCGACCAGTTTAGTTACCC Rev (SEQ ID NO: 4) Lmna- GGGAGGATTCCTCTGTTGTGTGG For(SEQ ID NO: 5)Flox / FloWT: 178 bpLmnaxLmna-GCCCCATCTCCATCTCCAGTTGGAGTTTCFlox: 337bpRev (SEQ ID NO: 6) AAGTCGCTCTGAGTTGTTATCAG Rtta-For (SEQ ID NO: 7) WT: 600 bp R26R-rtTA Rtta- GGAGCGGGAGAAATGGATATGA Mut: 600 bp WT- (SEQ ID NO: 8) Rev Rtta- CGGGTTGTTAAACCTTCGATTCCG Mut- (SEQ ID NO: 9) Rev Tet(o)- GACGCCATCCACGCTGT Tet(o)- For (SEQ ID NO: 10) 700 bp Fgf10 Tet(o)- TGCTGCCAGTTAAAAGATGC Rev (SEQ ID NO: 11) Echocardiography Heart function was evaluated by echocardiography performed on isoflurane-sedated mice using a Vevo 2100 VisualSonics at CERIMED-Marseille. All echocardiography measurements were performed in a blinded manner using Vevo Lab 7.7.1 Software. Thanks to echocardiography, left ventricular systolic function is analyzed by calculating different parameters including Ejection fraction (EF) and Fractional Shortening (FS). Ejection fraction (EF) correspond to the percentage of blood ejected during systole in relation to the total end-diastolic volume. EF is calculated by dividing the stroke volume (SV) by the left ventricular diastolic volume (LVVd). EF (%) = (SV / LVVd)*100. Stroke volume correspond to the volume of blood ejected during heartbeat. SV is calculated by subtracting the left ventricular diastolic volume (LVVd) by the left ventricular systolic volume (LVVs). SV= LVVd-LVVs. Fractional shortening (FS) refers to the fraction the left ventricle shortens during a cardiac cycle. FS is calculated by measuring the percentage change in left ventricular diameter during systole. FS (%) = (LVIDd- LVIDs) / LVIDd*100. Paraffin embedding and histological sections Paraffin embedding were performed after PFA fixation and PBS 1X washes. Hearts, and organs were dehydrated in ethanol series (70, 90 and 100%, 2-3 times 2 hours, 4°C, agitation), incubated in xylene (2 times 1 hour, room temperature (RT), agitation) and embedded in three paraffin baths (1 hour, 45 and 15 minutes) (Paraplast Xtra, Sigma P3808). Hearts were oriented in the dorsal side to perform transversal four chambers’ sections. Paraffin blocks were stored at 4°C. Serial sections for adult hearts (10-12 μm) and other organs including liver, lung, kidney, and spleen (5-10 μm) were performed and mounted on slides. Paraffin sections were dried at 37°C and stored at 4°C. Immunofluorescence on paraffin sections Sections were dewaxed (xylene, 2 times 5 minutes, room temperature (RT)), rehydrated in ethanol series (100%, 2 times 3 minutes and 95% 1 minute, RT) and washed in distilled water. Slides were incubated in the boiling antigen unmasking solution (Vector Laboratories, ABSCYS H3300) 15 minutes and let to cool down to room temperature 20 minutes. Then, slides were washed in PBS-Tween 0.05% (3 times 5 minutes, RT), incubated in 3% H2O2 in PBS (10 minutes, RT) and washed in PBS-Tween 0.05% (PBST) (3 times 5 minutes, RT). Bloking step was performed through incubation in TNB (0.1 M Tris-HCL pH=7.5, 0.15 M NaCl, 0.5% blocking reagent) (at least 1 hour, humid chamber, RT) before primary antibodies (Table 2) incubation in TNB (overnight, humid chamber, 4°C). After three PBST washes (5 minutes each), secondary antibodies (Table 2) were incubated in TNB (1 hour, humid chamber, RT) and washed in PBST (3 times 5 minutes). Nuclei were stained with Hoechst (1 / 10000 in PBS, 10 minutes, RT). Then, sections were washed in PBS and mounted using Fluoromount (Southern Biotech). Sections were imaged and analyzed Z1 / M Apotome or LSM 800 Confocal (Zeiss) and Zeiss software. Primary and secondary antibodies used, dilution and suppliers are listed in Table 2. Table 2:
[0002] Sirius Red staining Sections were dewaxed in xylene (2 times 5 minutes, room temperature (RT)), rehydrated in ethanol series (100% 2 times 3 minutes, 95% and 70% 3 minutes, RT) and washed three times in distilled water. Sections were incubated in Pico Sirius Red solution (0.1% Sirius Red (DirectRed 80 Sigma), 1.3% picric acid (Sigma P6744-1GA), 1 hour, RT), washed in acidified water (0.5% acetic acid, 3 times 5 minutes), dehydrated in ethanol series (70% and 95% 3 minutes and 100% 2 times 3 minutes, RT), cleared in in xylene (2 times 5 minutes, RT) and mounted using a resinous medium (Entellan). Sections were analyzed using AxioScan Z1 (Zeiss) and fibrosis quantification was performed using ImageJ software. Eosin-Hematoxylin staining Sections were dewaxed in xylene (2 times 5 minutes, room temperature (RT)), rehydrated in ethanol series (100% 2 times 3 minutes, 95% and 70% 1 minute, RT), washed in tap water, incubated 2 minutes in Harris hematoxylin solution (Sigma HHS32), washed in tap water and incubated 30 seconds in differentiation solution (Sigma A3179). After one wash in tap water, sections were incubated into aqueous Eosin solution (Sigma HT110232) (around 2 minutes), dehydrated in ethanol series (70% and 95% 3 minutes and 100% 2 times 3 minutes, RT), cleared in in xylene (2 times 5 minutes and mounted using a resinous medium (Entellan). Sections were analyzed using AxioScan Z1 (Zeiss). RNA extraction and RT-qPCR Tissues and cells samples were homogenized in 0.5 or 1 mL Trizol (Gibco Thermo Fisher Scientific). Tissues were homogenized with mechanical homogenizer (FastPrep, MP Biomedicals or Turrax) and cells with mechanical scraping or “up and down pipetting” at 4°C and left 5 minutes at room temperature (RT). Chloroform was added to homogenate (200 µL / 1mL Trizol), samples were vortexed, left 3 minutes at RT and centrifugated (15 minutes, 4°C, 10000 g). The aqueous phase containing RNA was conserved and precipitated overnight at -20°C with isopropanol (0.5 mL / ml trizol). Then samples were centrifugated (15 minutes, 4°C,12 000 g), RNA pellets were washed twice (75% ethanol), dried on ice, resuspended in RNAse free water, and stored at -80°C. RNA concentrations were determined using Nano Drop 1000 (Thermo Fisher Scientific) by measuring DO 280 / 260nm. Using Maxima enzyme kit (Thermo Fisher Scientific, K1642), 400 or 1000 ng of RNA previously extracted were retrotranscribed. Mix was incubated: 10 minutes 25°C, 15 minutes 50°C and 5 minutes 85°C. cDNA synthetized were kept at -20°C. qRT-PCR reaction was performed using specifics oligonucleotides 0.5 µM, Syber green (Luminaris 1X, Color HiGreen qPCR Master Mix, Thermo Fisher Scientific) on LightCycler QuantStudio (Roche). The conditions of experiment used over 45 cycles were denaturation at 95°C for 10 seconds, annealing at 95°C for 10 seconds and elongation step at 60℃ for 60 seconds. Each reaction was performed in duplicates and normalized with housekeeping genes. Different housekeeping genes were used: Hprt, Ywhaz and Rpl32. Primers used to amplify specific genes are listed in Table 3. Relative gene expression levels were analyzed using 2-∆∆Ct method as described in (Schmittgen and Livak, 2008). Table 3 : qRT-PCR primers Gene Species Primers Sequence 5’-3’ CMV-For TTCCTACTTGGCAGTACATCTACG (SEQ ID NO: 12) CMV Mouse CMV-Rev GTCAATGGGGTGGAGACTTGG (SEQ ID NO: 13) Col1a1-For CATGTTCAGCTTTGTGGACCT (SEQ ID NO: 14) Col1a1 Mouse Col1a1-Rev GCAGCTGACTTCAGGGATGT (SEQ ID NO: 15) COL1A2-FOR CTCGCTCAGCACCTTCTCTC (SEQ ID NO: 16) COL1A2 Human COL1A2-REV CACTCTGGGTGGCTGAGTC (SEQ ID NO: 17) Col3a1-For CATACCTGGTACCGGTGGTC (SEQ ID NO: 18) Col3a1 Mouse Col3a1-Rev CCGACTTCACCCTTTGGA (SEQ ID NO: 19) COL3A1-FOR CTTCTCTCCAGCCGAGCTTC (SEQ ID NO: 20) COL3A1 Human COL3A1-REV GACCCCATCAGCTTCAGG (SEQ ID NO: 21) Col6a5-For CCTCCTGGTCGGAGAGGT (SEQ ID NO: 22) Col6a5 Mouse Col6a5-Rev TTCACAGGGGGAATATATAGGTTG (SEQ ID NO: 23) FGF10-For AGCCATGAACAAGAAGGGGAAA (SEQ ID NO: 24) FGF10 Mouse FGF10-Rev TGCCACATACATTTGCCTGC (SEQ ID NO: 25) FGF10-For GAAGGAGAACTGCCCGTACA (SEQ ID NO: 26) FGF10 Human FGF10-Rev GGCAACAACTCCGATTTCTACT (SEQ ID NO: 27) HPRT Mouse HPRT-For CTGGTGAAAAGGACCTCTCG (SEQ ID NO: 28) HPRT-Rev TGGCAACATCAACAGGACTC (SEQ ID NO: 29) Lmna-For CTCAGTGAGAAGCGCACATT (SEQ ID NO: 30) Lmna Mouse Lmna-Rev TCAGCATCTCATCCTGAAGC (SEQ ID NO: 31) Lmna-For AGGACCCTGTGACAATGGTG (SEQ ID NO: 32) Lmna Mouse Lmna-Rev GGAGGAGGCTGGTGAAGAG (SEQ ID NO: 33) POSTN-For GCAGTTTTGCCCATTGACCAT (SEQ ID NO: 34) POSTN Human POSTN-Rev GTCAGAATAGCGCTGCGTTG (SEQ ID NO: 35) RPL32-For GCTGCTGATGTGCAACAAA (SEQ ID NO: 36) RPL32 Human RPL32-Rev GGGATTGGTGACTCTGATGG (SEQ ID NO: 37) YWHAZ-for AGACGGAAGGTGCTGAGAAA (SEQ ID NO: 38) YWHAZ Human YWHAZ-Rev GAAGCATTGGGGATCAAGAA (SEQ ID NO: 39) Statistical analysis Presented results correspond to biological replicates. Data are expressed as the mean ± SEM. For groups with N>6, normality was tested by the Shapiro-Wilk test (http: / / www.sthda.com / english / rsthda / shapiro-wilk.php). All samples were normally distributed and thus analyzed using an unpaired, 2-tailed Student t-test (Microsoft Excel). Non- parametric Mann-Whitney U test or Kolmogorov-Smirnov test were used to determine the statistical significance between the experimental and control groups for samples with N<6 (https: / / www.statskingdom.com). P values less than 0.05 were considered statistically significant. Experiment-wide multiple corrections were not applied. Results Up-regulation of Fgf10 levels in Lmna-related dilated cardiomyopathies preserves cardiac function and remodeling To investigate the impact of Fgf10 overexpression in the progression of genetic-related dilated cardiomyopathy and particularly Lmna-related dilated cardiomyopathy, the Inventors used the Rosa26-rtTA;Tet(O)-Fgf10 mouse model10, allowing conditional Fgf10 overexpression, in combination with Lmna-DCM mouse model αMHCMCM;LmnaFlox / Floxmice. Lmna deletion has been achieved specifically in postnatal cardiomyocytes through tamoxifen (TAM) injection in postnatal mice (between postnatal day P1-P3). Doxycycline (Dox) administered by food, induces the binding of the tetracycline transactivator protein rtTA to the tetracycline element (Tet(O)), located at the Fgf10 transcription start site thus leading to an increased Fgf10 expression. In order to evaluate the impact of Fgf10 overexpression, R26RTTA / RTTA;Tet(o)Fgf10 / +;αMHCWTLmnaFlox / Floxand R26RTTA / RTTA;Tet(o)Fgf10 / +;αMHCMCM;LmnaFlox / Floxmouse lines have been used. In vivo cardiac function has been explored using echocardiography once a week between 4 to 8 weeks post- TAM injection (Figure 1A). All results were compared between R26RTTA / RTTA;Tet(o)Fgf10 / +;αMHCWT;LmnaFlox / Flox(control group without (Ctrl + No Dox) or with doxycycline (Ctrl + Dox)) and R26RTTA / RTTA;Tet(o)Fgf10 / +;αMHCMCM;LmnaFlox / Flox(Lmna- deleted group without (Del + No Dox) or with doxycycline (Del + Dox)). Analysis of mouse survival reveals that Lmna deletion in postnatal cardiomyocytes (Del + No Dox) leads to a rapid evolution of the pathology with an increased mortality of deleted mice, starting at 6 weeks post- injection to end up with 40% mortality 8 weeks after injection. Interestingly, the results reveal an improvement of survival for deleted mice overexpressing Fgf10 (Del + Dox) compare to deleted mice (Del + No Dox) (Figure 1B). In vivo cardiac function has been explored weekly using echocardiography 4 to 8 weeks post-TAM injection (Figure 1C). This non-invasive technique allows to monitor and quantify in real time the physiological parameters of cardiac function, including quantification of ejection fraction, fractional shortening, cardiac output and standard measurements of heart dimensions and volume. Echocardiographic analysis shows that Tam-injected deleted mice (Del + No Dox) display impaired cardiac function associated with decreased ejection fraction and fractional shortening. Compare to deleted mice that do not overexpress Fgf10, Dox-treated R26RTTA / RTTA;Tet(o)Fgf10 / +;αMHCMCM;LmnaFlox / Floxdeleted mice (Del + Dox) display a preserved cardiac function depicted by ejection fraction and fractional shortening parameters (Figure 1D-E). Together, these results suggest that Fgf10 overexpression preserves cardiac function in mouse displaying Lmna-DCM. Up-regulation of Fgf10 levels in Lmna-related dilated cardiomyopathies prevents fibrosis and prevents cardiomyocyte hypertrophy Dilated cardiomyopathies are characterized by massive fibrosis (Nikolova et al., 2004). It was recently identified that Fgf10 overexpression, in ischemic dilated cardiomyopathy, directly prevents fibrosis infiltration5. The impact of Fgf10 up-regulation in Lmna-DCM on cardiac fibrosis is investigated in the present invention. To this end, histological analysis using Sirius red staining and qRT-PCR of collagen genes (Col1a1 and Col3a1) have been performed 8 weeks post-Lmna deletion. Histological analysis using Sirius red staining first confirmed that conditional deletion of Lmna in postnatal cardiomyocytes leads to cardiac remodelling including ventricular chamber dilation and revealed a massive fibrosis infiltration (Figure 2A and B), which was supported by the increase in collagen gene expression (Col1a1 and Col3a1) (Figure 2C). Interestingly, a decreased fibrosis was observed in Dox-treated R26RTTA / RTTA;Tet(o)Fgf10 / +;αMHCMCM;LmnaFlox / Floxdeleted hearts 8 weeks post-TAM injection, compared to deleted mice without doxycycline (Figure 2A and B). These results were accompanied by the downregulation of collagen gene expression (Col1a1 and Col3a1) (Figure 2C). Finally, analysis of cardiomyocyte cross-sectional area frequency in the left ventricle revealed a significant up-regulation of large cardiomyocyte numbers in Tam-injected deleted mice (Del + No Dox) compare to control mice (Ctrl + No Dox) (Figure 3A and B). Compare to deleted mice that do not overexpress Fgf10 (Del + No Dox), Dox-treated R26RTTA / RTTA;Tet(o)Fgf10 / +;αMHCMCM;LmnaFlox / Floxdeleted mice (Del + Dox) display a up- regulation of small cardiomyocyte numbers (Figure 3A and C). Interestingly, no cardiomyocytes size difference is observed between Lmna-deleted mice treated with FGF10 (Del + Dox) compare to control mice (Ctrl + Dox) overexpressing Fgf10 (Figure 3A and D). These observations are consistent with the presence of newly formed cardiomyocytes following up-regulation of Fgf10. Thus, altogether these results support that FGF10 preserves cardiac function and remodelling in Lmna-related DCM. Improvement of survival, cardiac function and remodeling is due to Fgf10 overexpression To statistically complete this analysis of the impact of Fgf10 expression up-regulation in Lmna- related dilated cardiomyopathy and to confirm that cardiac improvement is due to Fgf10 overexpression and not only to doxycycline administration, the same experiments as previously described were performed using R26RTTA / RTTA;Tet(o)WT;αMHCMCM;LmnaFlox / Floxand R26RTTA / RTTA;Tet(o)WT;αMHCWT;LmnaFlox / Floxmice which are unable to overexpress Fgf10 (Tet(o)WT). Cardiomyocyte-specific deletion has been achieved through tamoxifen (TAM) injection in postnatal mice (between P1-P3) and doxycycline was administered by food (Figure 4A). Results were compared between R26RTTA / RTTA;Tet(o)WT;αMHCMCM;LmnaFlox / Flox(control group without (Ctrl + No Dox) or with doxycycline (Ctrl + Dox)) and R26RTTA / RTTA;Tet(o)WT;αMHCMCM;LmnaFlox / Flox(deleted group without (Del + No Dox) or with doxycycline (Del + Dox)). Survival curve analysis revealed an important mortality for deleted mice without doxycycline leading to 40% of mortality 8 weeks post-injection. Interestingly, the same mortality rate was obtained for Dox- R26RTTA / RTTA;Tet(o)WT;αMHCMCM;LmnaFlox / Floxdeleted mice (Figure 4B). In vivo cardiac function has been explored using echocardiography 4 to 8 weeks post-injection. Echocardiographic analysis shows that Tam-injected mice with or without doxycycline display the same impaired cardiac function associated with left ventricular dilation, characteristic of dilated cardiomyopathies (Figure 4C-E). These results thus confirmed that improvement of survival, cardiac function, remodelling, and fibrosis infiltration in Lmna-related DCM is due to Fgf10 overexpression. Altogether our results strongly demonstrate the clinical relevance of FGF10 treatment in genetic related-DCM. AAV9-FGF10 gene transfer therapy in Lmna-related dilated cardiomyopathies In more translational perspectives toward the development of a treatment, the clinical relevance of an AAV9-CMV-FGF10 gene transfer therapy in Lmna-related DCM is evaluated. Adult male transgenic αMHCMCM;LmnaFlox / Floxmice were injected with tamoxifen (1mg / 20g) to delete Lmna specifically in adult cardiomyocytes and injected with AAV9-CMV-GFP (AAV9-GFP) or AAV9-CMV-FGF10 (AAV9-FGF10) the same day. Another group of mice have been also generated: it is a control group with αMHCWT;LmnaFlox / Floxmice injected with tamoxifen but without AAV9 injection (CTRL). This control group accounts for the negative control and then, provides basis to validate our model. In vivo cardiac function has been explored using echocardiography once a week during 4 weeks post-injection. To evaluate the efficacy of Lmna deletion, qRT-PCR experiments have been performed in left ventricle of Tam-injected mice treated with AAV9-GFP or AAV9-FGF10 and in CTRL mice. The results demonstrate that TAM injection leads to a reduction of Lmna relative expression levels by 60%. The same percentage of deletion is observed for the two deleted groups (AAV9- FGF10 or AAV9-GFP) (Figure 5A). These results thus support the possibility to compare FGF10 therapeutic effect, and to perform toxicity analysis of the gene transfer therapy between AAV9-GFP and AAV9-FGF10 mice. The efficacy of the AAV9 vector to overexpress human FGF10 in the heart is also evaluated. To do so, qRT-PCR experiments have been performed in Tam-injected deleted mice with AAV9-GFP or AAV9-FGF10 and in CTRL mice. Our results demonstrate that AAV9-FGF10 injection in deleted mice leads to an important cardiac expression of FGF10. No increased FGF10 expression has been detected in AAV9-GFP compare to control mice (Figure 5B). Finally, since the used AAV9 vector is composed of a CMV promotor upstream of FGF10 or GFP. CMV is detectable specifically if viral particles are present. So, CMV expression in heart has been also analyzed by qRT-PCR experiment in Tam-injected deleted mice with AAV9- GFP or AAV9-FGF10 and in CTRL mice. The results demonstrate that AAV9-GFP or AAV9- FGF10 retro-orbital injection led to the cardiac detection of CMV which is absent in CTRL mice. These results confirmed the efficacy of AAV9 injection and also the efficacy of the AAV9 vector to target the heart. Moreover, CMV expression is identical between AAV9-GFP and AAV9-FGF10 (Figure 5C). Taken together, these results confirm the relevance of αMHCMCM;LmnaFlox / Floxmice model to study Lmna-related DCM. They also confirm the relevance of AAV9-FGF10 as a vehicle to make FGF10 a therapeutic drug in genetic-related cardiomyopathy. αMHCMCM;LmnaFlox / Flox+ AAV9-GFP, αMHCMCM;LmnaFlox / Flox+ AAV9-FGF10 and CTRL mice have been followed in vivo by echocardiography once a week 4 weeks post-injection (Figure 6A). Cardiac function analysis reveals that αMHCMCM;LmnaFlox / Floxtreated with AAV9-GFP mice compared to CTRL present an impaired cardiac function associated with left ventricular dilation, characteristic of dilated cardiomyopathies 4 weeks post-injection. This can be visualized by virtually identical diastole and systole phases and confirmed the efficacy of our model of DCM. Our results also show, 4 weeks post-injection, an improvement of cardiac function for deleted mice treated with AAV9-FGF10. In fact, 4 weeks post-injected Lmna- deleted mice treated with AAV9-FGF10 seem to have similar cardiac parameters observed in CTRL mice (Figure 6B). Dilated cardiomyopathies are characterized by massive fibrosis8. We then investigated the impact of AAV9-FGF10 treatment in Lmna-DCM on cardiac fibrosis. To do so, histological analysis using Sirius red staining and qRT-PCR of fibrotic gene markers (Col1a1, Col3a1, Postn) have been performed 4 weeks post-injection (Figure 6C and D). Sirius red staining reveals a pathological remodeling and a massive fibrosis in Lmna-deleted +AAV9-GFP heart (Figure 6C). These results were confirmed by fibrotic gene expression analysis by qRT-PCR. In fact, qRT-PCR experiments for collagen gene and periostin expression confirm the massive fibrosis infiltration in Lmna-deleted + AAV9-GFP compared to CTRL mice. Once again, these results confirm the efficacy of our DCM mouse model. In addition, qRT-PCR experiments also confirmed the decreased of fibrosis observed in Lmna- deleted heart treated with AAV9-FGF10 by a down-regulation of the collagen / periostin genes expression (Figure 6D). Altogether, these results confirm that up-regulation of Fgf10 levels using AAV9 gene transfer therapy in Lmna-related dilated cardiomyopathies improves cardiac function and remodeling. Genetic-related DCM result in a massive cardiomyocyte necrosis that leads to the release of myocardial biochemical markers, including troponin T and I, in circulating blood11To address whether AAV9-FGF10 therapy reduces cardiomyocyte necrosis, cardiac troponin I (cTnI) serum contents were determined in Lmna-deleted + AAV9-GFP and Lmna-deleted + AAV9- FGF10 mice (Figure 7A). Western blot analysis revealed that cTnI serum levels were significantly reduced in Lmna-deleted + AAV9-FGF10 mice compare to Lmna-deleted + AAV9-GFP mice suggesting that, AAV9-FGF10 therapy prevents cardiomyocyte necrosis in Lmna-related DCM (Figure 7B). Our lab recently identified, in ischemic cardiomyopathy, that Fgf10 overexpression is able to specifically increase cardiomyocyte proliferation5. Therefore, we analyzed the impact of AAV9-FGF10 treatment on cardiomyocyte proliferation (Figure 7C-E). Immunofluorescence analysis of the proliferative capacities using Ki67 antibody demonstrated that up-regulation of Fgf10 levels using AAV9-FGF10 leads to an increase in cardiomyocyte proliferation compared to Lmna-deleted+AAV9-GFP mice (Figure 7D). Interestingly, a decrease in non-myocytes proliferation was also observed in Lmna-deleted + AAV9-FGF10 mice compared to Lmna-deleted + AAV9-GFP mice (Figure 7E). This result was in accordance with the previous results on fibrosis analysis revealing a decreased fibrosis deposition in Lmna-deleted + AAV9-FGF10 mice. Finally, analysis of cardiomyocyte cross- sectional area frequency in the left ventricle revealed a significant up-regulation of small cardiomyocytes in Lmna-deleted mice treated with AAV9-FGF10 compared to Lmna-deleted mice treated with AAV9-GFP (Figure 7F). This observation is consistent with the presence of newly formed cardiomyocytes following up-regulation of FGF10. Our results thus demonstrate that AAV9-FGF10 therapy stimulates cardiomyocyte proliferation in Lmna-related DCM showing FGF10 as a therapeutic agent. Biodistribution and toxicologic analysis following AAV9 gene transfer therapy In order to evaluate AAV9 targeting of alternative organs including liver, brain, lung, spleen and kidney. These different organs were collected and biodistribution and toxicologic analysis were carried out. Our AAV9 vector is designed with a CMV promotor upstream of FGF10 or GFP. Thus, CMV is detectable specifically if AAV9 is expressed in the tissue. To quantify CMV expression in diverse organs, qRT-PCR experiments have been performed. As expected, CMV promotor was only detected in mice injected with the AAV9 vectors and not in control mice. CMV is predominantly expressed in liver, and then in decreasing order in heart, lung, spleen, kidney and brain (Figure 8A). Finally, FGF10 expression in these different organs has also been estimated using qRT-PCR in Lmna-deleted + AAV9-FGF10 mice. As well as for CMV expression, FGF10 appears to be express mainly in the liver and the heart (Figure 8B). In order to analyzed potential side effects of AAV9-FGF10 therapy side effect, we performed histological analysis including eosin-hematoxylin staining to observe any morphological alterations (Figure 8C). Paired comparisons of the different organs between Lmna-deleted + AAV9-GFP mice and Lmna-deleted + AAV9-FGF10 mice did not reveal any difference. Altogether, these results confirmed the cardiac overexpression of FGF10 in the heart induced by the AAV9 gene transfer strategy and unveiled that AAV9 overexpression and specifically FGF10 overexpression at different dosages in these organs do not appear to have any impact on their morphology. In conclusion, AAV9-FGF10 treatment does not seem to induce side effects. Identification of the molecular mechanisms by which AAV9-FGF10 induces cardiac regeneration and repair in Lmna-related dilated cardiomyopathies Our results strongly demonstrate that, in adult and postnatal hearts, FGF10 overexpression prevents cardiac remodeling and fibrotic infiltration in Lmna-related dilated cardiomyopathies. In order to identify molecular mechanisms by which AAV9-FGF10 treatment promotes cardiac regeneration and repair in Lmna-related DCM, a transcriptomic analysis using bulk RNA sequencing (RNAseq) has been performed on left ventricles from cardiac specific Lmna mutant mice treated with AAV9-FGF10 or AAV9-GFP. Gene expression profile comparison presented by the heat map of all differentially expressed genes identified in the left ventricles (Figure 9) of Lmna-deleted+AAV9-FGF10 compared to Lmna-deleted + AAV9-GFP mice reveals that AAV9-FGF10 therapy leads to an important gene expression modification. Principal Component Analysis representing our different samples shows significant segregation of two different group including a Lmna-deleted+AAV9-GFP mice group and the group of Lmna- deleted + AAV9-FGF10. Gene ontology enrichment analysis has been performed and identified the same categories we previously identified in the RNA-seq on infarcted area from CTRL- and DOX-treated mice 21 days post-MI, including extracellular matrix, activation of immune process, metabolism, proliferation, and developmental process have been identified5. Violin plots show the differential expression of selected genes from the RNAseq (Figure 10). Genes involved in extracellular matrix remodeling and key markers of cardiac fibroblasts including Col3a1, Col6a5 and Postn display reduced expression, consistent with the reduced fibrosis observed in Lmna-deleted treated with AAV9-FGF10 compared to AAV9-GFP treated hearts. Overexpression of genes involved in metabolic pathways such as Acot1, IGF1, mTOR, Vcp, Pparg, Ppargc1, Per2, in proliferation and development such as Notch, Mtor, Mef were also identified in Lmna-deleted treated with AAV9-FGF10 consistent with the increased of cardiomyocytes proliferation. Finally, genes involved in extracellular matrix organization like Pdpn, Fn1 and Efemp2 and inflammation like Tgfb3, Tgfbr2 and Cdk1 display reduced expression in Lmna-deleted treated with AAV9-FGF10 consistent with improvement of cardiac function. In failing human hearts from patients with dilated cardiomyopathy, elevated FGF10 expression correlates with high levels of cardiomyocyte proliferation and reduced cardiac fibrosis We then investigated FGF10 expression levels in failing explanted human heart samples arising from patients displaying dilated cardiomyopathy from a non-ischemic origin. Transcript levels were quantified by qRT-PCR in different microdissected regions of explanted hearts. We evaluated whether human ventricular FGF10 levels may influence cardiomyocyte renewal. Immunofluorescence experiments using Ki67 revealed that elevated FGF10 levels significantly correlate with enhanced Ki67+cardiomyocyte numbers (Figure 11A). Moreover, we demonstrated that enhanced Ki67+cardiomyocyte numbers correlate with elevated transcript levels of the cell cycle marker PCNA (Figure 10B). Cardiomyocyte cross-sectional area measurement using WGA staining revealed that elevated FGF10 levels correlate with decreased cardiomyocyte cell size (Figure 11C), characteristic of increased newly formed cardiomyocyte numbers. Consistent with our results in mice, higher FGF10 levels in human hearts favors cardiomyocyte renewal. To determine whether human myocardial FGF10 levels influence cardiac fibrosis, fibrosis was quantified using histological Sirius red staining (Figure 11D-E) and analysis of fibrotic gene transcript levels (Figure 11F-H). Our results demonstrated that elevated FGF10 levels strongly correlate with reduced fibrosis. These results obtained in non-ischemic human heart samples thus reinforce the conclusions of our mouse experiments and support the relevance for FGF10 in promoting cardiomyocyte renewal and preventing fibrosis in the heart of patients with dilated cardiomyopathy. Altogether our study identifies FG10 as clinically relevant drug for Lmna-related dilated cardiomyopathies and revealed that AAV9-FGF10 therapy drives cardiac repair and regeneration in Lmna-DCM. References 1 Benjamin, E. J. et al. Heart Disease and Stroke Statistics-2018 Update: A Report From the American Heart Association. Circulation 137, e67-e492, doi:10.1161 / CIR.0000000000000558 (2018). 2 Foglia, M. J. & Poss, K. D. Building and re-building the heart by cardiomyocyte proliferation. Development 143, 729-740, doi:10.1242 / dev.132910 (2016). 3 Tzahor, E. & Poss, K. D. Cardiac regeneration strategies: Staying young at heart. Science 356, 1035-1039, doi:10.1126 / science.aam5894 (2017). 4 Rochais, F. et al. FGF10 promotes regional foetal cardiomyocyte proliferation and adult cardiomyocyte cell-cycle re-entry. Cardiovasc Res 104, 432-442, doi:10.1093 / cvr / cvu232 (2014). 5 Hubert, F. et al. FGF10 promotes cardiac repair through a dual cellular mechanism increasing cardiomyocyte renewal and inhibiting fibrosis. Cardiovasc Res 118, 2625- 2637, doi:10.1093 / cvr / cvab340 (2022). 6 McNally, E. M. & Mestroni, L. Dilated Cardiomyopathy: Genetic Determinants and Mechanisms. Circ Res 121, 731-748, doi:10.1161 / CIRCRESAHA.116.309396 (2017). 7 Sohal, D. S. et al. Temporally regulated and tissue-specific gene manipulations in the adult and embryonic heart using a tamoxifen-inducible Cre protein. Circ Res 89, 20-25, doi:10.1161 / hh1301.092687 (2001). 8 Nikolova, V. et al. Defects in nuclear structure and function promote dilated cardiomyopathy in lamin A / C-deficient mice. J Clin Invest 113, 357-369, doi:10.1172 / JCI19448 (2004). 9 Miles C, Fanton Z, Tome M, Behr E R. Inherited cardiomyopathies BMJ 2019; 365 :l1570 doi:10.1136 / bmj.l1570 10 Clark, J.C., Tichelaar, J.W., Wert, S.E., Itoh, N., Perl, A.-K.T., Stahlman, M.T., and Whitsett, J.A. (2001) FGF-10 disrupts lung morphogenesis and causes pulmonary adenomas in vivo. American Journal of Physiology-Lung Cellular and Molecular Physiology 280(4):L705-15 doi: 10.1152 / ajplung.2001.280.4.L705. 11 Hong, B.K., Kwon, H.M., Byun, K.H., Kim, D., Choi, E.Y., Kang, T.S., et al. (2000) Apoptosis in dilated cardiomyopathy. Korean J Intern Med. 2000 Jan;15(1):56-64. doi: 10.3904 / kjim.2000.15.1.56.
Claims
Claims 1. A substance selected from the group consisting of a FGF10 protein and a vector encoding FGF10, for use in the treatment of a genetic-related cardiomyopathy in a subject in need thereof.
2. The substance for use according to claim 1, wherein said treatment does not comprise a concomitant therapy targeting the mutated gene involved in the development of the cardiomyopathy.
3. The substance for use according to claim 1 or 2, wherein the genetic-related cardiomyopathy is selected from a genetic-related dilated cardiomyopathy, a genetic-related restrictive cardiomyopathy, and a genetic-related hypertrophic cardiomyopathy, in particular a genetic-related dilated cardiomyopathy.
4. The substance for use according to any one of claims 1 to 3, wherein said genetic-related cardiomyopathy is LMNA-related dilated cardiomyopathy.
5. The substance for use according to any one of claims 1 to 3, wherein the subject suffers from a laminopathy.
6. The substance for use according to claim 4, wherein the subject suffers from a laminopathy which is selected from the group consisting of Emery-Dreyfuss muscular dystrophy, limb- girdle dystrophy, Hutchinson gilford Progeria, and congenital muscular dystrophy.
7. The substance for use according to any one of claims 1 to 3, wherein the genetic-related cardiomyopathy is a cardiomyopathy related to one or more of the genes selected from the group consisting of DSC2, DSG3, DSP, JUP, PKP2, ACTC, ANKRD1, BAG3, DMD, DES, EMD, EYA4, FKRP, LAMA4, LDB3, LMNA, MYBPC3, MYH6, MYH7, PLN, RBM20, SCN5A, SYNE1, SYNE2, TNNC1, TNNI3, TNNT2, TPM1, TMPO and TTN.
8. The substance for use according to claim 7, wherein the genetic-related cardiomyopathy is a cardiomyopathy caused by one or more mutations of the gene LMNA.
9. The substance for use according to any one of claims 1 to 8, wherein the vector encoding FGF10 is a viral vector.
10. The substance for use according to claim 9, wherein the viral vector is a nonintegrating viral vector.
11. The substance for use according to claim 9 or 10, wherein the viral vector is an adeno- associated virus (AAV) vector.
12. The substance for use according to claim 11, wherein the AAV vector comprises an AAV9 capsid.
13. A pharmaceutical composition comprising a substance selected from the group consisting of a FGF10 protein and a vector encoding FGF10 and a pharmaceutically acceptable carrier for use in the treatment of a genetic-related cardiomyopathy as defined in claims 1, 3, 4, 7 and 8 in a subject in need thereof.
14. The pharmaceutical composition for use according to claim 13, comprising from 1x1010to 1x1015vg of an AAV vector encoding FGF10.
15. The substance for use according to any one of claims 1 to 12 or the pharmaceutical composition according to claims 13 or 14, wherein the subject in need thereof is a mammal subject having a genetic-related cardiomyopathy, in particular a human having a genetic- related cardiomyopathy.
Citation Information
Patent Citations
Fibroblast Growth Factor-10
US20050019824A1
FGF10 for the treatment of heart diseases
WO2019097001A1