Ultra-compact gene scissors cas12j-based nucleic acid biomarker detection technology
The integration of Cas12j/CRISPR complex with EXPAR addresses the limitations of PCR and EXPAR, providing a stable and specific nucleic acid detection method suitable for point-of-care diagnostics and disease diagnosis.
Patent Information
- Application Number
- PCT/KR2025/004867
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-12
- Filing Date
- 2025-04-10
- Publication Date
- 2025-10-16
AI Technical Summary
Existing nucleic acid amplification techniques, such as PCR, are costly and difficult to use in point-of-care diagnosis due to the need for temperature-controlled equipment, while EXPAR suffers from nonspecific amplification, leading to low specificity and reproducibility. Cas12j protein's potential for nucleic acid detection has not been fully utilized due to limited understanding of its function.
A composition integrating Cas12j/CRISPR complex with EXPAR for nucleic acid detection, using a converter, repeater, and reporter probe to amplify and detect nucleic acids through trans-cleavage, generating a detectable signal.
The composition achieves stable and specific nucleic acid detection, suitable for clinical samples, with improved sensitivity and reproducibility, enabling applications in diagnostic platforms for diseases like lung cancer.
Smart Images

Figure KR2025004867_16102025_PF_FP_ABST
Abstract
Description
Nucleic acid biomarker detection technology based on the ultra-small gene scissors CAS12J
[0001] The present invention relates to a composition for detecting nucleic acids using Cas12j protein and exponential amplification reaction (EXPAR) and its use.
[0002] When extracting nucleic acids from biological samples such as blood for nucleic acid analysis within a living organism, the amount extracted is typically too small to be used directly for various analyses. Therefore, amplification of the extracted nucleic acids is necessary for accurate analysis. Various nucleic acid amplification techniques have been developed to date, and in particular, PCR (Polymerase Chain Reaction), a representative method for DNA amplification, is a highly efficient amplification technique that selectively amplifies target genes in large quantities, and is widely used in various fields. However, PCR requires PCR equipment that precisely controls the temperature of the reaction solution, which is expensive and difficult to use in areas such as point-of-care diagnosis.
[0003] To improve this, exponential amplification reaction (EXPAR), an isothermal nucleic acid amplification technique, has been developed. EXPAR boasts high amplification efficiency and a short reaction time of approximately 30 minutes, making it suitable for a variety of biomolecular analyses, including target nucleic acid analysis. It is particularly effective for miRNA analysis. However, EXPAR suffers from nonspecific amplification, which occurs even in the absence of target nucleic acids, resulting in low specificity and reproducibility.
[0004] Meanwhile, since its discovery in 1987, the CRISPR / Cas system has been widely utilized in gene editing, gene expression regulation, and cell imaging. In particular, in recent years, the CRISPR / Cas system has also been used for the detection of nucleic acid biomarkers based on its specific recognition and cleavage functions. A representative example is the CRISPR / Cas12a system, which is known to detect nucleic acids by cleaving dsDNA through a single RuvC catalytic domain when complexed with crRNA. However, despite being an ultra-small and efficient Cas protein, Cas12j has not been used in the design of compositions for nucleic acid detection because little is known about its function, particularly its trans-cleavage activity.
[0005] Accordingly, the present inventors designed a novel nucleic acid detection composition by integrating the function of the Cas12j / CRISPR complex and the exponential amplification reaction (EXPAR), and confirmed that the system has excellent nucleic acid detection ability, thereby completing the present invention.
[0006] One object of the present invention is to provide a composition for detecting a nucleic acid, comprising (a) a template including a converter and a repeater; (b) a composition for an exponential amplification reaction (EXPAR); and (c) a reporter probe and a Cas12j / CRISPR complex.
[0007] Another object of the present invention is to provide a method for detecting a target nucleic acid using the composition for detecting a nucleic acid.
[0008] Another object of the present invention is to provide a method for providing information on cancer using the composition for detecting nucleic acid.
[0009] To avoid confusion due to overlapping content, the description of redundant content will be omitted below. In other words, the content of the invention is not limited to the content described below, and the content of the invention should be interpreted based on the overall content of the invention.
[0010] Hereinafter, the present invention will be described in detail.
[0011] The present invention provides a composition for detecting a nucleic acid, comprising: (a) a template including a converter and a repeater; (b) a composition for an exponential amplification reaction (EXPAR); and (c) a reporter probe and a Cas12j / CRISPR complex.
[0012] The composition for detecting nucleic acids of the present invention integrates the function of a Cas12j / CRISPR complex and an exponential amplification reaction (EXPAR). The "exponential amplification reaction (EXPAR)" refers to a technology for exponentially amplifying short-length nucleic acids under isothermal reaction conditions using a DNA polymerase and a cleavage enzyme.
[0013] Specifically, the composition for detecting a nucleic acid of the present invention is designed to include a combined amplification template of a converter (T*-N*-X*) and a repeater (X*-N*-X*), as shown in FIG. 4a, so that when a target nucleic acid (T) is introduced, it binds to the converter and is extended by a DNA polymerase (DP) to form a double-stranded nicking sequence that serves as a substrate for a nicking enzyme (NE). Thereafter, the DP and NE react synergistically to generate a trigger (X), which is amplified by the repeater and produced in large quantities through an exponential cascade reaction. The trigger (X) can activate Cas12j to cleave an adjacent reporter probe (e.g., reporter DNA) through trans-cleavage and emit a strong signal (e.g., a fluorescent signal) indicating the presence of the target nucleic acid (T) (T* and X* represent complementary sequences).
[0014] In the present invention, “converter” means a template including a sequence complementary to a target nucleic acid, and “repeater” means a template including a sequence complementary to a trigger.
[0015] The converter may have a nucleic acid sequence represented by the general formula T*-N*-X*. T* is a sequence complementary to a target nucleic acid (T), N* is an arbitrary cleavage sequence that a nicking enzyme (NE) can act on, and X* represents a sequence complementary to a trigger. The converter sequence complementarily binds to the target nucleic acid when present, thereby releasing the trigger sequence.
[0016] The above repeater may have a nucleic acid sequence represented by the general formula X*-N*-X*. X* is a complementary sequence to the trigger, and N* is any cleavage sequence that can be acted on by a nicking enzyme (NE). The repeater complementarily binds to the released trigger, amplifies it, and produces a large amount of trigger through an exponential cascade reaction.
[0017] The term "target nucleic acid" in the present invention refers to a nucleic acid sequence to be detected, and is used interchangeably with "target nucleic acid" or "target sequence." The target nucleic acid may be any one selected from the group consisting of DNA, RNA, genomic DNA, cDNA, circular RNA, siRNA, mRNA, tRNA, rRNA, miRNA, snoRNA, piRNA, and ncRNA, but is not limited thereto. Preferably, it may be miRNA.
[0018] A composition for exponential amplification reaction (EXPAR) comprises a DNA polymerase and a nicking enzyme.
[0019] The term "nicking enzyme (NE)" of the present invention refers to an endonuclease that recognizes a partially double-stranded nucleotide sequence and cleaves only one strand at a specific location relative to the recognition sequence. The recognition sequence varies depending on the nicking enzyme, and for example, Nt.BstNBI is known to recognize the sequence 5'-GAGTCNNNN / N-3' (N is any base, / is a cleavage site). The nicking enzyme may be Nb.BtsI, Nt.BstNBI, Nb.BbvCI, Nt.BbvCI or Nt.AlwI, but is not limited thereto and any DNA nicking enzyme may be used. According to one embodiment, the nicking enzyme may be Nt.BstNBI.
[0020] The sequence information of the above Nb.BtsI, Nt.BstNBI, Nb.BbvCI, Nt.BbvCI and Nt.AlwI is as shown in Table 1 below.
[0021] Nicking Enzyme Sequence Nb.BtsIGCAGTGNN (SEQ ID NO: 1) Nt.BstNBIGAGTCNNNNN (SEQ ID NO: 2) Nb.BbvCICCTCAGC (SEQ ID NO: 3) Nt.BbvCICCTCAGC (SEQ ID NO: 4) Nt.AlwIGGATCNNNNN (SEQ ID NO: 5)
[0022] In addition, the term "DNA polymerase (DP)" of the present invention is an enzyme that assists DNA replication and can catalyze the synthesis of deoxyribonucleotides along a DNA strand read as a template. The DNA polymerase may be Klenow DNA polymerase, Bsu DNA polymerase, Vent DNA polymerase, or Bst DNA polymerase, but is not limited thereto, and any nucleic acid polymerase having polymerization activity and displacement activity may be used. According to one embodiment, the DNA polymerase may be Vent DNA polymerase.
[0023] The EXPAR reaction according to the present invention can be optimized when the temperature is 50 to 60°C, the trigger length is 16 to 19 nt, the converter concentration is 0.5 to 5 nM, the repeater concentration is 5 to 20 nM, 0.1 to 0.4 x rNEbuffer 3.1 is used, and the Cas12j / crRNA concentration is 100 to 200 nM.
[0024] According to one embodiment, the EXPAR reaction according to the present invention is optimized when the temperature is 55°C, the trigger length is 19 nt, the converter concentration is 5 nM, the repeater concentration is 10 nM, 0.2X rNEbuffer 3.1 is used, and the Cas12j / crRNA concentration is 100 nM, and under these conditions, the nucleic acid detection composition of the present invention exhibits the highest efficiency.
[0025] The EXPAR reaction according to the present invention can expand the range of target nucleic acids by changing the complementary sequence of the converter to the target nucleic acid, and even when targeting other nucleic acids, the same trigger (X) is generated regardless of the target nucleic acid sequence, so Cas12j / crRNA is not changed in other EXPAR reactions. Due to these features, the nucleic acid detection composition of the present invention can stably detect various target nucleic acids.
[0026] In the present invention, the "CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system" or "CRISPR-associated proteins (Cas) system" are used interchangeably and collectively refer to transcripts and other components involved in inducing expression or activity of a CRISPR-associated (Cas) gene, including a sequence encoding a Cas gene, a tracr (transcriptionally activating CRISPR) sequence (e.g., tracrRNA or partially activating tracrRNA), a tracr-mate sequence, a guide sequence and / or other sequences and transcripts of the CRISPR locus.
[0027] The CRISPR system can be divided into Class 1 and Class 2, where Class 1 is subdivided into Types Ⅰ, Ⅲ, and Ⅳ, while Class 2 is subdivided into Types Ⅱ, Ⅴ, and Ⅵ. Class 1 systems function by multi-protein complexes, while Class 2 systems use a single effector protein together with CRISPR RNA (crRNA) to form a ribonucleoprotein (RNP) complex that can recognize and cleave a specific base sequence. The single effector protein of the Class 2 system includes Cas12a, Cas12b, Cas12f, Cas12j, or Cas13a, and causes a secondary cleavage called trans-cleavage.
[0028] In the present invention, "Cas12j" is one of the effector proteins of the Type V CRISPR system, also referred to as "CasΦ." This protein is encoded in the Biggiephage clade and has a C-terminal RuvC domain that has distant homology to domains of the TnpB nuclease superfamily. It recognizes a protospacer adjacent motif (PAM) at the 3' end of a target sequence and can initiate staggered cuts in both target and non-target nucleic acid strands. Furthermore, compared to other Cas proteins, it is small in size with only 700-800 residues, making it an effective effector protein.
[0029] The above Cas12j protein may be a Cas12j variant selected from the group consisting of Cas12j1, Cas12j2, and Cas12j3, preferably Cas12j3. These Cas12j variants share structural features such as an N-terminal PAM interacting (PI) domain and a unique C-terminal RuvC nuclease domain, and have 38-45% sequence homology.
[0030] "crRNA (CRISPR RNA)" refers to a polynucleotide that recognizes a target nucleic acid through genome editing and cleaves, inserts, or connects the target nucleic acid. In the present invention, it may be RNA specific for the target DNA. More specifically, crRNA is an RNA that is expressed through transcription of linear double-stranded DNA (dsDNA) delivered into a cell, recognizes a target gene sequence, forms a complex with the Cas 12j protein, and brings the Cas 12j protein to the target DNA. The crRNA may include a sequence complementary to the target nucleic acid. For example, it may include a polynucleotide (spacer) complementary to a continuous nucleotide sequence of 2 to 24 nt in the 5' or 3' direction of the PAM in the target nucleic acid, and preferably, it may include a spacer of 15 to 20 nt. The length of the crRNA may be 10 nt to 100 nt, 10 nt to 90 nt, 10 nt to 80 nt, 10 nt to 70 nt, 10 nt to 60 nt, 10 nt to 50 nt, 15 nt to 50 nt, 20 nt to 50 nt, 25 nt to 50 nt, 30 nt to 50 nt, 35 nt to 50 nt, 40 nt to 50 nt, or 45 nt to 50 nt. Preferably, it may be 40 nt to 50 nt, and in one embodiment, it may be 45 nt.
[0031] "PAM sequence" refers to a 3 bp sized sequence located next to the target sequence, which is the target sequence recognized by the CRISPR / Cas complex. The CRISPR / Cas complex recognizes the PAM sequence and then cuts at a specific location.
[0032] In the present invention, “trans-cleavage” means that crRNA within the Cas protein binds to a target sequence, causing precise on-target cleavage (cis-cleavage) and then indiscriminately cleaves nearby single-stranded nucleic acids.
[0033] In the present invention, the trans-cleavage activity of the Cas12j protein varies depending on buffer conditions and reaction conditions. Specifically, an excipient that stabilizes the Cas12j protein may be further included. Any excipient known to stabilize the CRISPR / Cas12j complex may be used.
[0034] For example, the trans-cleavage activity ability of the Cas12j protein may vary depending on the pH of the buffer, salt concentration, type and concentration of the cofactor (metal ion), DTT concentration, BSA concentration, and glycerol concentration conditions. According to one embodiment, the pH of the buffer may be 8.0 to 9.0, preferably 8.5. The salt concentration may be 0 to 50 mM, preferably 0 mM. The type and concentration of the cofactor may be 5 to 15 mM. 2+ and / or Mg 2+ may be, preferably 10 to 15 mM Co 2+ and / or Mg 2+ The concentration of DTT in the buffer may be 0 to 5 mM, the concentration of BSA may be 100 to 400 μg / mL, and the concentration of glycerol may be 5 to 20%.
[0035] Additionally, for example, the trans-cleavage activity ability of the Cas12j protein may vary depending on the concentration of crRNA, the type and length of the target nucleic acid, and the temperature conditions during the CRISPR reaction. According to one embodiment, the crRNA may be present in a 1:1 ratio with respect to the Cas12j protein, the target nucleic acid may be, for example, ssDNA of 16 to 80 nt, preferably about 24 nt, or dsDNA of 16 to 20 nt, preferably about 50 bp, and the reaction temperature may be 25 to 35°C.
[0036] The trans-cleavage activity is preferably excellent at positions 18 to 19 away from PAM for ssDNA and 15 to 19 away from dsDNA.
[0037] The Cas12j / CRISPR complex according to the present invention comprises Cas12j and crRNA.
[0038] The reporter probe according to the present invention is capable of exhibiting a detectable signal.
[0039] In the present invention, a "detectable signal" refers to a signal that can be directly detected by the human eye or by means of a detection system. The characteristics of the signal vary depending on the characteristics of the label used. The signal may be, in particular, a colored, luminescent, fluorescent, phosphorescent, radioactive, or magnetic signal. Preferably, the signal is a colored signal.
[0040] In the present invention, the "reporter probe" is a single-stranded nucleic acid probe, which is a signal probe of the FRET (fluorescence resonance energy transfer) type in which, before being cleaved, the energy of a fluorescent dye is transferred to a quencher, thereby suppressing the emission of a fluorescent signal, and after being cleaved, no fluorescent signal transfer occurs. In addition, the base sequence included in the single-stranded nucleic acid probe has a base sequence that is non-complementary to the target nucleic acid and the probe.
[0041] The reporter probe may have a reporter attached to one end and a quencher attached to the other end. Specifically, the reporter probe is attached to one end and a quencher attached to the other end to indicate changes in fluorescence expression depending on the presence or absence of a target nucleic acid. Furthermore, although not limited thereto, a preferred embodiment of the present invention has a reporter attached to the 5' end and a quencher attached to the 3' end.
[0042] The reporter may independently have a fluorescent group. For example, it may have a fluorescent group such as ALEX-350, FAM, VIC, TET, CAL Fluor®Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and preferably has FAM or ROX.
[0043] Additionally, in the present invention, the quencher is a molecule or group capable of absorbing / quenching fluorescence. For example, groups such as DABCYL, BHQ (e.g., BHQ1 or BHQ2), ECLIPSE, and / or TAMRA may be used, and BHQ1 is preferably used.
[0044] According to one embodiment, the reporter probe may comprise a 5'-TTATT-3' sequence (SEQ ID NO: 97) or a 5'-TTTTTTTT-3' sequence (SEQ ID NO: 98), and may be conjugated with FAM or ROX at the 5' end and BHQ1 at the 3' end.
[0045] During a CRISPR reaction, the reporter probe is cleaved, which can then emit fluorescence, resulting in a detectable signal.
[0046] In addition, the present invention provides a method for detecting a target nucleic acid using the composition for detecting a nucleic acid.
[0047] Specifically, the target nucleic acid detection method of the present invention comprises the following steps:
[0048] (a) a step of performing a reaction using a template including a converter and a repeater; and a composition for exponential amplification reaction (EXPAR);
[0049] (b) a step in which the target nucleic acid generated through the reaction of step (a) reacts with the Cas12j / CRISPR complex; and
[0050] (c) A step in which the Cas12j / CRISPR complex recognizes the target nucleic acid and generates a detectable signal.
[0051] When the target nucleic acid and the Cas12j / CRISPR complex react according to the step (b) above, the adjacent reporter probe can be cleaved through trans-cleavage in the step (c) above, and a detectable signal indicating the presence of the target nucleic acid can be emitted.
[0052] The above detectable signal may be generated by cleavage of the reporter probe.
[0053] The target nucleic acid mentioned above may be present in a sample. Preferably, "biological sample" means any nucleic acid, such as RNA and / or any sample containing RNA. The biological sample may be any tissue or body fluid obtained from a subject.
[0054] The biological sample includes, but is not limited to, sputum, blood, serum, plasma, blood cells (e.g., white blood cells), tissue, biopsy sample, smear sample, wash sample, swab sample, cell-containing body fluid, nucleic acid fluid, urine, peritoneal fluid and pleural fluid, cerebrospinal fluid, stool, tear fluid or cells therefrom of the subject. The biological sample may also include tissue sections taken for histological purposes, i.e., frozen or fixed sections or microdissected cellular or extracellular portions thereof. The biological sample may be obtained by a method that does not cause harm to the subject.
[0055] In addition, the present invention provides a method for providing information on cancer using the composition for detecting nucleic acid.
[0056] Specifically, the method for providing information on cancer of the present invention comprises the following steps:
[0057] (a) a step of performing a reaction with a sample using a template including a converter and a repeater; and a composition for exponential amplification reaction (EXPAR);
[0058] (b) a step in which the target nucleic acid generated through the reaction of step (a) reacts with the Cas12j / CRISPR complex;
[0059] (c) a step in which the Cas12j / CRISPR complex recognizes the target nucleic acid and generates a detectable signal; and
[0060] (d) A step of determining cancer when the above detectable signal is confirmed.
[0061] Descriptions of the Cas12j protein and exponential amplification reaction (EXPAR) described above are omitted to avoid excessive complexity in this specification.
[0062] The cancer may be any one selected from the group consisting of lung cancer, non-small cell lung cancer, small cell lung cancer, lung epithelial cancer, uterine cancer, ovarian cancer, cervical cancer, prostate cancer, and breast cancer, and preferably lung cancer.
[0063] The nucleic acid system according to the present invention can stably detect various target nucleic acids and has excellent nucleic acid detection and analysis capabilities for actual clinical samples, so it can be applied to diagnostic platforms for various diseases.
[0064] Figure 1 is a diagram confirming buffer conditions optimized for the trans-cleavage activity of Cas12j variants.
[0065] (a) Diagram showing the domain organization of three variants of the Cas12j protein family (Cas12j1, Cas12j2, and Cas12j3). Yellow represents the PI domain, green represents the oligonucleotide binding domain (OBD), orange represents the nucleic acid recognition domain (REC), and blue represents the DNase domain (RuvC).
[0066] (b) Fluorescence analysis using an ssDNA reporter containing a fluorophore and a quencher, and an ssDNA target. The orange graph represents Cas12j1, the blue graph represents Cas12j2, and the green graph represents Cas12j3.
[0067] Factors affecting trans-cleavage activity include (c) pH, (d) salt concentration (mM), (e) type of cofactor, (f) optimal concentration of metal ions, (g) DTT concentration, (h) BSA concentration, and (i) & (j) glycerol concentration. The bars in each graph represent the mean fluorescence intensity (RFU), and the dots represent raw fluorescence data. The error bars represent the standard deviation (SD).
[0068] Figure 2 is a diagram confirming the reaction conditions optimized for the trans-cleavage activity of Cas12j variants.
[0069] (a) A diagram evaluating the trans-cleavage activity of Cas12j variants according to various concentrations of crRNA.
[0070] (b) A diagram showing the trans-cleavage activity of Cas12j variants according to various types of target nucleic acids (ssDNA, dsDNA, and RNA).
[0071] (c) Schematic representation of Cas12j / crRNA containing target DNA of various lengths. Regions containing the target sequence are highlighted in red, with additional 20 nt or more added to both the 5' and 3' ends. Target nucleic acids shorter than 20 nt were excised from the 3' end of the crRNA.
[0072] Figure 1 shows the trans-cleavage activity of Cas12j variants on targets (d) ssDNA and (e) dsDNA of various lengths (24 to 80 nt).
[0073] (f) A heatmap showing the change in trans-cleavage activity according to target ssDNA of various lengths (9 to 20 nt).
[0074] (g) A diagram showing changes in the trans-cleavage activity of Cas12j variants toward target ssDNA under various reaction temperature conditions (25 to 65°C).
[0075] (h) A diagram showing changes in the trans-cleavage activity of Cas12j variants for target dsDNA under various reaction temperature conditions (25 to 65°C).
[0076] Figure 3 is a diagram confirming the sequence specificity of the Cas12j protein-mediated trans-cleavage reaction.
[0077] (a) A diagram showing a sequence (M) in which single nucleotide mutations are introduced at 20 different positions within the target sequence. The nucleotides in which mutations are introduced are indicated in red, and PM indicates a perfectly matching sequence in which no mutations are introduced.
[0078] (b) A heatmap showing the trans-cleavage activity of Cas12j variants against mismatched ssDNA targets based on PM.
[0079] (c) A heatmap showing the trans-cleavage activity of Cas12j variants against mismatched dsDNA targets based on PM.
[0080] Figure 4 is a diagram showing the design of the EXP-J reaction system for miRNA detection.
[0081] (a) A schematic diagram of the EXP-J reaction system for miRNA detection.
[0082] (T: Target, X: Trigger, T*- N*-X*: Converter, X*-N*-X*: Repeater, DP: DNA Polymerase, NE: Nicking enzyme) (* indicates complementary sequence)
[0083] (b) PAGE analysis was performed on the EXP-J reaction system. The final concentrations of Converter-21, Repeater, miR-21, DP, and NE were 50 nM, 50 nM, 50 nM, 0.1 U / μL, and 0.25 U / μL, respectively.
[0084] (M: ultra-low range DNA ladder, lane 1: repeater, lane 2: repeater + miR-21, lane 3: converter, lane 4: converter + miR-21, lane 5: converter + miR-21 + DP, lane 6: converter + miR-21 + DP + NE, lane 7: converter + repeater + miR-21 + DP + NE, lane 8: converter + repeater + DP + NE)
[0085] (c) This is a diagram showing fluorescence analysis performed on the EXP-J reaction system.
[0086] (d) A comparison of the EXP-J reaction efficiency when Cas12j1, (e) Cas12j2, and (f) Cas12j3 were used. The EXP-J reaction was performed under various reaction times and miR-21 concentration conditions. The thick-bordered cells represent the threshold (F - F0 + 3SD of blank samples), and F and F0 represent the fluorescence intensities after EXP-J reaction with or without miR-21 for the three Cas12j variants.
[0087] The final concentrations of Converter-21, Repeater, DP, NE, and Cas12j / crRNA are 5 nM, 10 nM, 0.1 U / μL, 0.25 U / μL, 100 nM, and 400 nM, respectively.
[0088] (g) This figure shows the results of performing EXP-J reactions for various miRNAs. The heatmap shows the F-F0 values for each EXP-J reaction targeting four different miRNAs (miR-21, miR-92a, miR-222, and miR-155). The final concentrations of converter, repeater, miRNA, DP, NE, Cas12j / crRNA, and reporter DNA are 5 nM, 10 nM, 100 pM, 0.1 U / μL, 0.25 U / μL, 100 nM, and 400 nM.
[0089] Figure 5 shows the results of EXP-J reactions for four types of target miRNAs, namely, (a) miR-21, (b) miR-92a, (c) miR-222, and (d) miR-155, in the presence of miR-21, miR-92a, miR-222, miR-155, miR-141, miR-200c, let-7a, let-7f, miR-122, miR-345, and miR-19a.
[0090] Figure 6 is a diagram confirming that the EXP-J reaction system can be applied to lung cancer diagnosis.
[0091] (a) Heatmap showing the expression patterns of miR-21 and miR-92a in six cell lines (A549, WI-38, DU145, HeLa, PC3, and SK-BR-3).
[0092] (b) Analytical agreement between EXP-J assay and RT-qPCR for miR-21 and (c) miR-92a.
[0093] (d) A schematic diagram showing the EXP-J reaction system applied to lung cancer diagnosis.
[0094] Figure 1. Expression of (e) miR-21 and (g) miR-92a in plasma samples from lung cancer patients (n=20) and healthy controls (n=20) using EXP-J assay.
[0095] Expression of (f) miR-21 and (h) miR-92a in plasma samples from lung cancer patients (n=20) and healthy controls (n=20) was confirmed by RT-qPCR. Statistical analysis was performed by a two-tailed t-test with Welch correction (****p ≤0.0001).
[0096] (i) Analytical agreement between the EXP-J assay and RT-qPCR for miR-21 and (j) miR-92a. Data points represent the average of three measurements, and the linear correlation curve is obtained by linear fitting of the data points. The dotted line represents the 95% confidence interval of the best fit line.
[0097] Figure 1 shows receiver operating characteristic (ROC) curves to distinguish lung cancer patients (n=20) from healthy controls (n=20) based on the results of (k) miR-21 and (l) miR-92a detected using EXP-J assay and RT-qPCR. The area under the curve (AUC) value for each ROC curve is indicated in the lower right corner.
[0098] Hereinafter, preferred examples are presented to aid understanding of the present invention. However, the following examples are provided solely to facilitate understanding of the present invention and are not intended to limit the scope of the present invention.
[0099] Experimental Example 1. Materials
[0100] All oligonucleotides are Bioneer ® (Daejeon, Korea). Custom crRNA was purchased from IDT (Coralville, IA, USA). Luna ® Universal One-Step RT-qPCR Kit, Vent (exo-) DNA polymerase, Nt.BstNB I, and dNTPs were purchased from New England Biolabs (Ipswich, MA, USA). Plasmids used for protein expression were obtained from Addgene (plasmid # 158794-158796), recombinant RNase inhibitor (RRI) was purchased from Takara Korea Biomedical Inc. (Seoul, Korea), Dulbecco's modified Eagle's medium (DMEM) and Fetalgro Bovine Growth Serum (FBS) were purchased from Welgene Inc. (Gyeongsan, Korea) and RMBIO, respectively. ® (Missoula, MT, USA). A549, WI-38, DU145, HeLa, PC3, and SK-BR-3 cell lines were obtained from the Korean Cell Line Bank (Seoul, Korea). Ultrapure DNase / RNase-free distilled water was purchased from Bioneer. ® All chemicals were purchased and used from . All other chemicals were of analytical grade and used without further purification.
[0101] Experimental Example 2. Protein Expression and Purification
[0102] The Cas12j variant tagged with a hexa-histidine sequence at the N-terminus was cloned into the pRSFDuet vector and transformed into E. coliRIL cells. The cells were cultured in Luria-Berani (LB) medium at 37°C, and the optical density at 600 nm (OD600 ) were cultured until the confluence reached 0.5–0.7. Protein overexpression was induced with 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and cultured at 18°C for 18 h. After harvesting, cells were resuspended in lysis buffer (2 M NaCl, 50 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES), 5 mM 2-mercaptoethanol, and 5% glycerol) and sonicated. After centrifugation, the supernatant was diluted 1:1 with salt-free buffer (50 mM HEPES, 5 mM 2-mercaptoethanol, and 5% glycerol). The soluble protein fraction was loaded onto a pre-equilibrated HisTrap HP 5 mL column (Cytiva, Marlborough, MA, USA) using buffer A (500 mM NaCl, 50 mM HEPES, 5 mM 2-mercaptoethanol, 5% glycerol, and 20 mM imidazole).
[0103] The protein was eluted with buffer B (500 mM NaCl, 50 mM HEPES, 5 mM 2-mercaptoethanol, 5% glycerol, and 500 mM imidazole), purified by size exclusion chromatography (SEC) on a Superdex200 26 / 600 column (Cytiva), and equilibrated with SEC buffer (500 mM NaCl, 30 mM HEPES, 3 mM 2-mercaptoethanol, and 5% glycerol). The purified protein fraction was concentrated to 10 mg / mL using a centrifugal filter, flash frozen in liquid nitrogen, and stored at -80°C.
[0104] Experimental Example 3. RNP Production
[0105] To facilitate hairpin formation, crRNA was heated to 80°C for 3 minutes and then cooled to 25°C. Cas12j protein was diluted to a concentration of 40 μM using SEC buffer, and crRNA was diluted to 40 μM using diethyl pyrocarbonate (DEPC)-treated water. These were mixed at a 1:1 ratio and incubated at 25°C for 30 minutes.
[0106] Experimental Example 4. In vitro trans-cleavage activity analysis
[0107] For the in vitro trans-cleavage activity assay, a 10 μL reaction mixture containing 2 μL each of reaction buffer, cofactor solution, RNP, target DNA, and reporter probe was prepared. The final concentrations of RNP, target DNA, and reporter probe were all 250 nM, and the mixture was incubated for 30 min.
[0108] To optimize the assay conditions, the pH of the reaction buffer was set to 7.5-9.0 using Tris-HCl, the concentration of NaCl was set to 0-200 mM, and cofactors including MgCl2, CoSO4, CaCl2, CuSO4, and NiCl2 were evaluated at concentrations of 0-15 mM. The concentration of DTT was adjusted to 0-20 mM, BSA to 0-800 μg / μL, and glycerol to 0-20%. In addition, the effect of the length of the target sequence was investigated using sequences in the range of 9-80 nt, and the heat dependence was evaluated at temperatures in the range of 25-65°C. The specificity was determined by introducing single nucleotide mutations into 20 different target sequences.
[0109] After the reaction, the sample was diluted 10-fold with a buffer containing 50 mM NaCl and 10 mM Tris-HCl under pH 8.5 conditions, and the fluorescence intensity was measured using a Tecan Infinite M200 Pro set to an excitation wavelength of 488 nm and an emission wavelength of 535 nm together with a black 96-well microplate for analysis.
[0110] Experimental Example 5. Reaction Analysis for miRNA Detection
[0111] For EXPAR reaction, a 20 μL reaction solution was prepared with 6.2 μL DEPC-treated water, 1.5 μL MgSO4 (100 mM), 1 μL 10Х Thermopol buffer, 0.4 μL 10Х NEBuffer 3.1, 5 μL dNTP (2 mM), 1 μL converter (100 nM), 1 μL repeater (200 nM), 0.4 μL RRI (40 U / μL), 0.5 μL Nt.BstNB I (10 U / μL), 1 μL Vent (exo-) DNA polymerase (2 U / μL), and 2 μL sample solution, and incubated at 55°C for 30 min.
[0112] Next, the Cas12j reaction solution containing 1 μL 10Х NEBuffer 2.1, 1 μL reporter DNA (10 μM), 1 μL Cas12j / crRNA (2.5 μM), and 2 μL MgCl2 (87.5 mM) was added to the above reaction solution, and the CFX96 was incubated at 37°C. TM Fluorescence signals were measured using a Real-Time System (Bio-Rad, Hercules, CA, USA).
[0113] Experimental Example 6. Gel electrophoresis analysis
[0114] For PAGE analysis, 10 μL EXP-J reaction solution was reacted for 10 minutes, mixed with 2 μL orange loading dye (6x, New England Biolabs), and then dissolved in tris-borate-ethylene-diamine-tetra acetic acid (EDTA, 1x) as a running buffer on a 10% polyacrylamide gel at a constant voltage of 120 V for 60 minutes. After electrophoresis, the gel was stained with GelRed solution and analyzed by ChemiDoc TM Images were captured using an Imaging System (Bio-Rad).
[0115] Experimental Example 7. Cell Culture and miRNA Extraction
[0116] All cell lines were cultured in DMEM supplemented with 10% FBS at 37°C and 5% CO2. Cells were harvested at the exponential growth phase and placed in LUNA-II TM Counting was performed using an automated cell counter (Logos Biosystems Inc., Anyang, Korea). miRNA was isolated from 1X10 cells using the miRNeasy Tissue / Cells Mini Kit (Qiagen, Hilden, Germany). 6 Extracted from cells. The concentration of extracted miRNA was measured using NanoDrop ® The concentration was measured using a spectrophotometer (Thermo Fisher, Wilmington, DE, USA) and diluted to 30 ng / μL. Finally, 2 μL of the extracted miRNA was analyzed using the EXP-J reaction.
[0117] Experimental Example 8. EXP-J Reaction System for Lung Cancer Diagnosis
[0118] Plasma samples from patients aged 19 years or older who had been diagnosed with or suspected of having lung cancer but had not yet started treatment were provided by Samsung Medical Center in Seoul. Less than 20 mL of whole blood was collected in EDTA-treated vacuum tubes and immediately stored at 4°C. Within 8 hours of collection, plasma was centrifuged (1,600 g) for 10 minutes at 4°C, placed in sterile tubes, and stored at -80°C. Total miRNA was extracted from plasma samples from patients or healthy donors (Single Donor Human Plasma (Blood Derived), Innovative Research, Inc., Novi, MI, USA) using the miRNeasy Serum / Plasma Advanced Kit (Qiagen). 1 μL of the extracted miRNA was analyzed using the EXP-J reaction system.
[0119] Experimental Example 9. Polymerase Chain Reaction (PCR)
[0120] Luna ® The conventional stem-loop qPCR method using the Universal One-Step RT-qPCR Kit was used. Specifically, a 12 μL solution containing 0.6 μL sample, 0.48 μL stem-loop primer (10 μM), 0.6 μL forward primer (10 μM), 0.6 μL reverse primer (10 μM), 1Х Luna Universal one-step reaction mix, and 1Х Luna WarmStart® RT enzyme mix was subjected to RT reaction at 55°C for 10 min, followed by initial denaturation at 95°C for 1 min, followed by 45 cycles of 95°C for 10 s and 60°C for 30 s each. The fluorescence signal was measured using CFX96 TM Measurements were taken at each cycle using a real-time system.
[0121] Example 1. Optimal buffer conditions for enhancing Cas12j trans-cleavage activity.
[0122] We investigated the trans-cleavage ability of three variants of the Cas12j protein family (Cas12j1, Cas12j2, and Cas12j3). These variants share structural features such as an N-terminal PAM interacting (PI) domain and a unique C-terminal RuvC nuclease domain (Fig. 1a).
[0123] To measure the trans-cleavage activity of the Cas12j protein family, a reporter molecule (SEQ ID NO: 72) containing a fluorescent dye, a quencher, and a 5'-TTATT-3' sequence was used, and trans-cleavage was initiated by a 24 nt single-stranded DNA (ssDNA) complementary to the crRNA sequence (Fig. 1b). The RNA oligonucleotides used in the experiment are listed in Table 2 below, the dsDNA oligonucleotides in Table 3 below, and the ssDNA oligonucleotides in Table 4 below.
[0124] Purpose Description Sequence (5'→3') Trans-cleavage analysis crRNA genome Cas12j1 CRISPR sequence containing a 25 nt long 3'-repeat segment (bold) followed by a 20 nt long spacer corresponding to the target sequence AAACGAUUGCUCGAUUAGU CGAGACACAACGGCCCUUCGAUCUCA (SEQ ID NO: 6) Trans-cleavage analysis crRNA genome Cas12j2 CRISPR sequence containing a 25 nt long 3'-repeat segment (bold) followed by a 20 nt long spacer corresponding to the target sequence CAACGAUUGCCCCUCACGA GGGGACACAACGGCCCUUCGAUCUCA (SEQ ID NO: 7) Trans-cleavage analysis crRNA genome Cas12j3 CRISPR sequence containing a 25 nt long 3'-repeat Contains a fragment (bold) followed by a 20 nt long spacer corresponding to the target sequence UAUUGAUUGCCCAGUACGC UGGGACACAACGGCCCUUCGAUCUCA (SEQ ID NO: 8) Trans-cleavage assay target A 24 nt long trans-cleavage RNA substrate (target region is shown in bold) AUGAGAUCGAAGGGCCGUUGUAAA (SEQ ID NO: 9)
[0125] Purpose Description Sequence (5'→3') Trans-cleavage assay target Trans-cleavage dsDNA substrate 24 bp long (target region is indicated in bold) ATGAGATCGAAGGGCCGTTGTAAA (SEQ ID NO: 10) Trans-cleavage assay target length Trans-cleavage dsDNA substrate 39 bp long (target region is indicated in bold) TCATGACAAATGAGATCGAAGGGCCGTTGTAAAGCGCCA (SEQ ID NO: 11) Trans-cleavage assay target length Trans-cleavage dsDNA substrate 49 bp long (target region is indicated in bold) GCTGCCATGACAATGAGATCGAAGGGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 12) Trans-cleavage assay target length Trans-cleavage dsDNA substrate 60 bp long (target Trans-cleavage assay target length 80 bp long trans-cleavage dsDNA substrate (target region is shown in bold) TAATACGACTCACTATAGGGTCTAGGGACCGTGGCTCGAGCTCATGACAAATGAGATCGAAGGGCCGTTGTAAAGCGCCA (SEQ ID NO: 14) Trans-cleavage assay sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 20 (underlined) GCTGCCATGACAAACGAGATCGAAGGGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 15) Trans-cleavage assay sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 19 (Underlined)GCTGCTCATGACAAATAAGATCGAAGGGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 16) Trans-cleavage analysis Sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 18 (Underlined)GCTGCTCATGACAAATGCGATCGAAGGGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 17) Trans-cleavageAnalysis Sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 17 (underlined) GCTGCAATGAAATCGAAGGGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 18) Trans-cleavage analysis Sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 16 (underlined) GCTGCCATGACAAATGAGCTCGAAGGGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 19) Trans-cleavage analysis Sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 15 (underlined) GCTGCCATGACAAATGAGACCGAAGGGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 20) Trans-cleavage analysis Sequence specificity Mismatched dsDNA Substrate (target region is shown in bold) Mutation position 14 (underlined) GCTGCAATGAGATAGAAGGGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 21) Trans-cleavage analysis Sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 13 (underlined) GCTGCAATGAGATCAAAGGGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 22) Trans-cleavage analysis Sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 12 (underlined) GCTGCAATGAGATCGCAGGGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 23) Trans-cleavage analysis Sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 11 (underlined)GCTGCTCATGACAAATGAGATCGACGGGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 24) Trans-cleavage assay sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 10 (underlined)GCTGCTCATGACAAATGAGATCGAAAGGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO:25) Trans-cleavage analysis sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 9 (underlined) GCTGCAATGAGATCGAAGAGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 26) Trans-cleavage analysis sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 8 (underlined) GCTGCCAAATGAGATCGAAGGACCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 27) Trans-cleavage analysis sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 7 (underlined) GCTGCCAAATGAGATCGAAGGGACGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 28) Trans-cleavage analysis sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 6 (underlined) GCTGCAATGAGATCGAAGGGCAGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 29) Trans-cleavage analysis Sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 5 (underlined) GCTGCAATGAGATCGAAGGGCCATTGTAAAGCGCCAGACTTG (SEQ ID NO: 30) Trans-cleavage analysis Sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 4 (underlined) GCTGCAAATGAGATCGAAGGGCCGCTGTAAAGCGCCAGACTTG (SEQ ID NO: 31) Trans-cleavage analysis Sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 3 (Underlined)GCTGCTCATGACAAATGAGATCGAAGGGCCGTCGTAAAGCGCCAGACTTG (SEQ ID NO: 32) Trans-cleavage assay sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 2 (Underlined)GCTGCTCATGACAAATGAGATCGAAGGGCCGTTATAAAGCGCCAGACTTG (SEQ ID NO:33) Trans-cleavage analysis sequence specificity Mismatched dsDNA substrate (target region is shown in bold) Mutation position 1 (underlined) GCTGCCATGACAAATGAGATCGAAGGGCCGTTGCAAAGCGCCAGACTTG (SEQ ID NO: 34)
[0126] Purpose Description Sequence (5'→3') Trans-cleavage assay target 24 nt long trans-cleavage ssDNA substrate (target region is shown in bold) ATGAGATCGAAGGGCCGTTGTAAA (SEQ ID NO: 35) Trans-cleavage assay target 9 nt long trans-cleavage ssDNA substrate (target region is shown in bold) GGCCGTTGT (SEQ ID NO: 36) Trans-cleavage assay target 10 nt long trans-cleavage ssDNA substrate (target region is shown in bold) GGGCCGTTGT (SEQ ID NO: 37) Trans-cleavage assay target 11 nt long trans-cleavage ssDNA substrate (target region is shown in bold) AGGGCCGTTGT (SEQ ID NO: 38) Trans-cleavage assay target 12 nt Trans-cleavage ssDNA substrate of length (target region is shown in bold) AAGGGCCGTTGT (SEQ ID NO: 39) Trans-cleavage assay target length 13 nt trans-cleavage ssDNA substrate of length (target region is shown in bold) GAAGGGCCGTTGT (SEQ ID NO: 40) Trans-cleavage assay target length 14 nt trans-cleavage ssDNA substrate of length (target region is shown in bold) CGAAGGGCCGTTGT (SEQ ID NO: 41) Trans-cleavage assay target length 15 nt trans-cleavage ssDNA substrate of length (target region is shown in bold) TCGAAGGGCCGTTGT (SEQ ID NO: 42) Trans-cleavage assay target length 16 nt trans-cleavage ssDNA substrate of length (target region is shown in bold) ATCGAAGGGCCGTTGT (SEQ ID NO: 43) Trans-cleavage analysis target length 17 nt long trans-cleavage ssDNA substrate (target region is indicated in bold) GATCGAAGGCCGTTGT (SEQ ID NO: 44) Trans-cleavage analysis target length 18 nt long trans-cleavage ssDNA substrate (target region is indicated in bold) AGATCGAAGGGGCCGTTGT (SEQ ID NO: 45) Trans-cleavage analysis target length 19 nt long trans-cleavage ssDNA substrate (target region is indicated in bold) GAGATCGAAGGCCGTTGT (SEQ ID NO:46) Trans-cleavage analysis target length 20 nt long trans-cleavage ssDNA substrate (target region is shown in bold) TGAGATCGAAGGGCCGTTGT (SEQ ID NO: 47) Trans-cleavage analysis target length 39 nt long trans-cleavage ssDNA substrate (target region is shown in bold) TCATGACAAATGAGATCGAAGGGCCGTTGTAAAGCGCCA (SEQ ID NO: 48) Trans-cleavage analysis target length 50 nt long trans-cleavage ssDNA substrate (target region is shown in bold) GCTGCCATGACAAATGAGATCGAAGGGCCGTTGTAAAGCGCCAGACTTG (SEQ ID NO: 49) Trans-cleavage analysis target length 60 nt long trans-cleavage ssDNA substrate (target region is shown in bold) (shown)GCTAGGCTGCTCATGACAAATGAGATCGAAGGGCCGTTGTAAAGCGCCAGACTTGTAAGC (SEQ ID NO: 50)Trans-cleavage assay target lengthTrans-cleavage ssDNA substrate of 78 nt in length (target region is shown in bold)TAATACGACTCACTATAGGGTCTAGGGACCGTGGCTCGAGCTCATGACAAATGAGATCGAAGGGCCGTTGTAAAGCGC (SEQ ID NO: 51)Trans-cleavage assay sequence specificityMismatched ssDNA substrate (target region is shown in bold)Mutation position 20 (underlined)ACGAGATCGAAGGGCCGTTGTAAA (SEQ ID NO: 52)Trans-cleavage assay sequence specificityMismatched ssDNA substrate (target region is shown in bold)Mutation position 19 (underlined (shown) ATAAGATCGAAGGGCCGTTGTAAA (SEQ ID NO: 53) Trans-cleavage analysis sequence specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 18 (underlined) ATGCGATCGAAGGGCCGTTGTAAA (SEQ ID NO: 54) Trans-cleavage analysis sequence specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 17 (underlined) ATGAAATCGAAGGGCCGTTGTAAA (SEQ ID NO: 55) Trans-cleavage analysis sequence specificity Mismatched ssDNASubstrate (target region is shown in bold) Mutation position 16 (underlined) ATGAGTCGAAGGGCCGTTGTAAA (SEQ ID NO: 56) Trans-cleavage analysis Sequence specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 15 (underlined) ATGAGACCGAAGGGCCGTTGTAAA (SEQ ID NO: 57) Trans-cleavage analysis Sequence specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 14 (underlined) ATGAGATAGAAGGGCCGTTGTAAA (SEQ ID NO: 58) Trans-cleavage analysis Sequence specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 13 (underlined) ATGAGATCAAGGGCCGTTGTAAA (SEQ ID NO: 59) Trans-cleavage analysis Sequence specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 12 (underlined) ATGAGATCGCAGGGCCGTTGTAAA (SEQ ID NO: 60) Trans-cleavage analysis Sequence specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 11 (underlined) ATGAGATCGACGGGCCGTTGTAAA (SEQ ID NO: 61) Trans-cleavage analysis Sequence specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 10 (underlined) ATGAGATCGAAAGGCCGTTGTAAA (SEQ ID NO: 62) Trans-cleavage analysis Sequence specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 9 (underlined) (shown)ATGAGATCGAAGAGCCGTTGTAAA (SEQ ID NO: 63)Trans-cleavage assay sequence specificityMismatched ssDNA substrate (target region is shown in bold) Mutation position 8 (underlined)ATGAGATCGAAGGACCGTTGTAAA (SEQ ID NO: 64)mismatch toleranceMismatched ssDNA substrate (target region is shown in bold) Mutation position 7 (underlined)ATGAGATCGAAGGGACGTTGTAAA (SEQ ID NO: 65)Trans-cleavage assay sequence specificityMismatched ssDNASubstrate (target region is shown in bold) Mutation position 6 (underlined) ATGAGATCGAAGGGCAGTTGTAAA (SEQ ID NO: 66) Trans-cleavage analysis Sequence specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 5 (underlined) ATGAGATCGAAGGGCCATTGTAAA (SEQ ID NO: 67) Trans-cleavage analysis Sequence specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 4 (underlined) ATGAGATCGAAGGGCCGCTGTAAA (SEQ ID NO: 68) Trans-cleavage analysis Sequence specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 3 (underlined) ATGAGATCGAAGGGCCGTCGTAAA (SEQ ID NO: 69) Trans-cleavage analysis Sequence Specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 2 (underlined) ATGAGATCGAAGGGCCGTTATAAA (SEQ ID NO: 70) Trans-cleavage assay Sequence specificity Mismatched ssDNA substrate (target region is shown in bold) Mutation position 1 (underlined) ATGAGATCGAAGGGCCGTTGCAAA (SEQ ID NO: 71) Trans-cleavage assay reporter Trans-cleavage assay reporter ssDNA modified with FAM and BHQ1 FAM-TTATT-BHQ1 (SEQ ID NO: 72)
[0127] The optimal pH, salt concentration, and cofactor for the trans-cleavage activity of Cas12j mutants were identified. The highest trans-cleavage activity was observed at pH 8.5 and in the absence of salt (NaCl) (0 mM) (Fig. 1c and 1d). In the case of cofactors, Cas12j1 was Mg 2+ and Co 2+ , Cas12j2 and Cas12j3 are Mg 2+showed the highest preference for (Fig. 1e). To further investigate the effect of the above cofactor, experiments were conducted with divalent metal ions preferred by each mutant. In the presence of target ssDNA, Cas12j1 showed the highest preference for 10 mM Co 2+ , Cas12j2 and Cas12j3 are 10M Mg 2+ It showed optimal activity in (Fig. 1f).
[0128] The additive conditions of the reaction buffer were evaluated using 0–20 mM DTT, 0–800 μg / mL BSA, and 0–20% glycerol. In the case of DTT, Cas12j1 reached the highest activity at no DTT addition (0 mM), Cas12j2 at 1 mM, and Cas12j3 at 5 mM concentrations (Fig. 1g). Excellent activity was observed when BSA was added at 200 μg / mL for Cas12j1 and Cas12j3, and at 400 μg / mL for Cas12j2 (Fig. 1h). Finally, Cas12j1 showed high activity at 15% glycerol, Cas12j2 at 7%, and Cas12j3 at 20% glycerol (Figs. 1i and 1j).
[0129] Example 2. Optimal reaction conditions for enhancing Cas12j trans-cleavage activity.
[0130] After optimizing buffer conditions for three Cas12j variants, reaction parameters considered to have a significant impact on the trans-cleavage efficiency of each variant were investigated, namely, concentration of crRNA, type and length of target nucleic acid, and reaction temperature.
[0131] The ratio of Cas12j protein and crRNA to maximize trans-cleavage activity was found to be 1:1 (Fig. 2a).
[0132] For target nucleic acids, ssDNA and dsDNA were suitable as inducers of trans-cleavage (Fig. 2b), and in particular, the trans-cleavage activity of Cas12j variants was highest when 24 nt of ssDNA and 50 bp of dsDNA were used (Figs. 2d and 2e). The minimum partial target length that could activate trans-cleavage of Cas12j variants was confirmed to be 14 nt for Cas12j1 and 17 nt for Cas12j2 and Cas12j3 (Fig. 2f).
[0133] The reaction temperature was (i) when ssDNA activator was used, Cas12j1 and Cas12j2 showed optimal activity at 35°C, and Cas12j3 at 25°C, and (ii) when dsDNA activator was used, Cas12j1 showed optimal activity at 25°C, and Cas12j2 and Cas12j3 showed optimal activity at 35°C (Figs. 2g and 2h).
[0134] By optimizing the buffer and reaction conditions as described above, the Cas12j trans-cleavage activity can be increased, thereby enhancing the efficacy of a Cas12j-based nucleic acid detection composition.
[0135] Example 3. Sequence specificity of Cas12j protein-mediated trans-cleavage reaction.
[0136] To investigate the sequence specificity of the Cas12j-mediated trans-cleavage reaction, single-nucleotide mutations were introduced at 20 different positions within the target sequence (Fig. 3a). Assays were performed using ssDNA or dsDNA activators, and changes in trans-cleavage activity were assessed by comparison with the perfectly matched sequence (PM).
[0137] When ssDNA was used as an activator, Cas12j1 showed reduced trans-cleavage activity in all but M1 to M4, which had mutations introduced at positions far from the PAM site; Cas12j2 showed a marked decrease in activity in M5 to M9 and M11; and Cas12j3 showed low activity in M7 to M9 and M11 to M13, as well as in M19 and M20, which had mutations introduced at positions close to the PAM site (Fig. 3b).
[0138] Meanwhile, when dsDNA was used as an activator, a decrease in activity was observed at M19 and M20 for all Cas12j variants, and in particular, Cas12j1 showed increased sensitivity to point mutations at positions M7 to M15 and M7 to M13, and Cas12j3 showed increased sensitivity to point mutations at positions M7 to M9, M11, and M12, resulting in a significant decrease in trans-cleavage activity (Fig. 3c).
[0139] These results demonstrate the high sequence specificity of Cas12j variants, suggesting that the molecular precision of the Cas12j system can be leveraged to develop diagnostic applications.
[0140] Example 4. Design of a system (EXP-J reaction system) for miRNA detection
[0141] Based on the characteristics of Cas12j mutants, a system for miRNA detection (EXP-J reaction system) was prepared (Fig. 4a). The system was designed to include a combined amplification template of a converter (T*-N*-X*) and a repeater (X*-N*-X*), a composition for exponential amplification reaction (EXPAR) containing DNA polymerase (DP) and nicking enzyme (NE), and a Cas12j / CRISPR complex.
[0142] To test the validity of the system, miR-21 was set as the target model and Cas12j2 as the effector protein, and the reaction was confirmed by PAGE analysis (Fig. 4b). The results showed that there was no interaction between miR-21 and the repeater, whereas a specific binding occurred between miR-21 and the converter (Fig. 4b, lanes 3 and 4). Furthermore, the introduction of DP caused miR-21 to extend along the converter, resulting in a noticeable shift in the band position (Fig. 4b, lane 5). Subsequent addition of NE resulted in the appearance of a trigger band at the bottom of the gel (Fig. 4b, lane 6), and this tendency was further enhanced by the repeater (Fig. 4b, lane 7). On the other hand, no trigger bands were observed in the absence of the target model (Fig. 4b, lane 8).
[0143] Additionally, fluorescence measurements revealed that fluorescence levels increased only when the target and all EXP-J reaction components were present (Fig. 4c).
[0144] That is, through the above experiments, it was confirmed that the EXP-J system of the present invention operates only in the presence of target miRNA.
[0145] After confirming the validity of the system according to the present invention, the conditions were optimized as follows: reaction temperature 55°C, trigger length 19 nt, converter 5 nM, repeater 10 nM, 0.2 X rNEbuffer 3.1, and Cas12j / crRNA 100 nM.
[0146] Next, to compare the detection efficiency of three Cas12j variants in the EXP-J reaction, the EXP-J reaction was performed according to various Cas12j reaction times (5, 10, 20, 30 min) and miR-21 concentrations (1 fM to 1 nM).
[0147] As a result, Cas12j1 showed low efficiency with only a slight increase in fluorescence even after a reaction time of 30 minutes, and the detectable concentration of miR-21 was confirmed to be up to 10 pM (Fig. 4d). In the case of Cas12j, the detection efficiency reached a peak when the reaction time was approximately 30 minutes, and even very low concentrations of miR-21, such as 1 fM, could be detected (Fig. 4e). Cas12j3 was able to detect 1 fM miR-21 within a reaction time of 10 minutes, showing the fastest fluorescence increase (Fig. 4f).
[0148] In other words, we confirmed that target miRNA detection was most efficient when Cas12j3 was used as an effector protein and reacted for 10 minutes. This laid the foundation for manufacturing a diagnostic system with improved accuracy and speed.
[0149] Finally, when EXP-J was performed on miRNAs other than miR-21, miR-92a, miR-222, and miR-155 showed detection efficiencies almost similar to miR-21 (Fig. 4g). In addition, when EXP-J was performed on four types of target miRNAs in the presence of various miRNAs (miR-21, miR-92a, miR-222, miR-155, miR-141, miR-200c, let-7a, let-7f, miR-122, miR-345, and miR-19a), an increase in fluorescence signal was observed only when the corresponding target miRNA was present (Fig. 5).
[0150] The sequence information of miRNA, crRNA, converter, repeater, and reporter DNA used in the above EXP-J reaction is shown below and in Table 5.
[0151] Classification Description Sequence (5'→3') miRNAmiR-21UAGCUUAUCAGACUGAUGUUGA (SEQ ID NO: 73) miRNAmiR-92aUAUUGCACUUGUCCCGGCCUGU (SEQ ID NO: 74) miRNAmiR-222AGCUACAUCUGGCUACUGGGU (SEQ ID NO: 75) miRNAmiR-155UUAAUGCUAAUCGUGAUAGGGGUU (SEQ ID NO: 76) miRNAmiR-141UAACACUGUCUGGUAAAGAUGG (SEQ ID NO: 77) miRNAmiR-200cUAAUACUGCCGGGUAAUGAUGGA (SEQ ID NO: 78) miRNAlet-7aUGAGGUAGUAGGUUGUAUAGUU (SEQ ID NO: 79) miRNAlet-7fUGAGGUAGUAGAUUGUAUAGUU (SEQ ID NO: 80)miRNAmiR-122UGGAGUGUGACAAUGGUGUUUG (SEQ ID NO: 81)miRNAmiR-345GCUGACUCCUAGUCCAGGGCUC (SEQ ID NO: 82)miRNAmiR-19aUGUGCAAAUCUAUGCAAAACUGA (SEQ ID NO: 83)crRNA genome Cas12j1 CRISPR array comprising a 25 nt long 3'-repeat segment (indicated in bold) followed by a 19 nt long spacer corresponding to the target sequenceAAACGAUUGCUCGAUUAGUCGAGACAUCAACUACUAUACUCUAA (SEQ ID NO: 84)crRNA genome Cas12j2 CRISPR array comprising a 25 nt long 3'-repeat segment (indicated in bold) followed by a 19 nt long spacer corresponding to the target sequence Contains a 25 nt long 3'-repeat segment (indicated in bold) of the crRNA genome Cas12j3 CRISPR array CAACGAUUGCCCCUCACGAGGGGACAUCAACUACUAUACUCUAA (SEQ ID NO: 85),Repeater containing a 19 nt long spacer corresponding to the target sequence UAUUGAUUGCCCAGUACGCUGGGACAUCAACUACUAUACUCUAA (SEQ ID NO: 86) Repeater for 19 nt trigger (in bold) ATCAACTACTATACTCTAAGTGAGACTCTATCAACTACTATACTCTAA-phosphate (SEQ ID NO: 87) Repeater for 18 nt trigger (in bold) ATCAACTACTATACTCTAGTGAGACTCTATCAACTACTATACTCTA-phosphate (SEQ ID NO: 88) Repeater for 17 nt trigger (in bold) ATCAACTACTATACTCTGTGAGACTCTATCAACTACTATACTCT-phosphate (SEQ ID NO: 89) Repeater for 16 nt trigger (in bold) Repeater ATCAAACTACTATACTCGTGAGACTCTATCAACTACTATACTC-phosphate (SEQ ID NO: 90) Repeater ATCAAACTACTATACTGTGAGACTCTATCAACTACTATAC-phosphate (SEQ ID NO: 91) Converter Converter for miR-21; sequence includes the complementary portion to the trigger (bold), the NE recognition sequence (black), and the miR-21-binding portion (underlined) ATCAAACTACTATACTCTAAGTGAGACTCTTCAACATCAGTCTGATAAGCTA-phosphate (SEQ ID NO: 92) Converter Converter for miR-92a; The sequence includes the complementary portion to the trigger (bold), the NE recognition sequence (black), and the miR-92a-binding portion (underlined). ATCAACTACTATACTCTAAGTGAGACTCTACCCAGTAGCCAGATGTAGCT-phosphate (SEQ ID NO: 93). Converter. Converter for miR-222; the sequence includes the complementary portion to the trigger (bold),Contains the NE recognition sequence (black) and miR-222-binding portion (underlined) ATCAACTACTATACTCTAAGTGAGACTCTACAGGCCGGGACAAGTGCAATA-phosphate (SEQ ID NO: 94) Converter Converter for miR-155; sequence contains the portion complementary to the trigger (bold), the NE recognition sequence (black) and the miR-155-binding portion (underlined) ATCAACTACTATACTCTAAGTGAGACTCTAACCCCTATCACGATTAGCATTAA-phosphate (SEQ ID NO: 95) Reporter Trans-cleavage assay reporter modified with DNAROX and BHQ1 ssDNAROX-TTTTTTTT-BHQ1 (SEQ ID NO: 96)
[0152] That is, it was confirmed that the EXP-J reaction can be universally used for the detection of various miRNAs while having high selectivity.
[0153] Example 5. Diagnosis of lung cancer using the EXP-J reaction system
[0154] It was confirmed whether miR-21 and miR-92a, which are involved in the pathogenesis of cancer, could be detected using the EXP-J reaction system designed in Example 4.
[0155] Specifically, the test was performed on six different cell lines: A549 (lung cancer), WI-38 (lung epithelial cancer), DU145 (prostate cancer), HeLa (uterine cancer), PC3 (prostate cancer), and SK-BR-3 (breast cancer). The heatmap showed the expression patterns of miR-21 and miR-92a in each cell line (Fig. 6a), and the analytical agreement between the EXP-J assay and RT-qPCR was confirmed to have Pearson correlation coefficients of 0.8738 and 0.9618, respectively (Figs. 6b and 6c).
[0156] Next, total miRNAs were extracted from plasma samples of lung cancer patients (n=20) and healthy controls (n=20), and the EXP-J reaction system was applied to miR-21 and miR-92a (Fig. 6d). As a result, significant overexpression of miR-21 and miR-92a was observed in the plasma of lung cancer patients (Figs. 6e and 6g), and these results were also confirmed by RT-qPCR (Figs. 6f and 6h). Analytical agreement between the EXP-J assay and RT-qPCR was examined, and the Pearson correlation coefficients were 0.8400 and 0.9215, respectively (Figs. 6i and 6j).
[0157] In addition, the receiver operating characteristic (ROC) curves for the EXP-J assay were analyzed. The area under the curve (AUC) values were measured as 0.9450 (95% CI: 0.8640–1.000) and 0.9350 (95% CI: 0.8523–1.000) for miR-21 and miR-92a, respectively, demonstrating effective discrimination between lung cancer patients and healthy individuals (Figures 6k and 6l, dotted red curves). Furthermore, the AUC values of RT-qPCR were similar to those measured by the EXP-J assay (Figures 6k and 6l, dotted black curves).
[0158] That is, it was confirmed that the nucleic acid detection composition of the present invention has excellent detection and analysis capabilities and can be applied to actual clinical samples.
Claims
1. (a) a template comprising (i) a converter comprising a sequence complementary to a target nucleic acid; and (ii) a repeater comprising a sequence complementary to a trigger; (b) a composition for exponential amplification reaction (EXPAR) comprising DNA polymerase; and a Nicking Enzyme; and (c) A composition for detecting a nucleic acid, comprising a reporter probe and a Cas12j / CRISPR complex.
2. A composition for detecting a nucleic acid, wherein in the first paragraph, the converter is a nucleic acid represented by the general formula T*-N*-X*, where T* is a sequence complementary to a target nucleic acid (T), N* is an arbitrary cleavage sequence on which a nicking enzyme (NE) can act, and X* represents a sequence complementary to a trigger.
3. A composition for detecting a nucleic acid, wherein in the first paragraph, the repeater is a nucleic acid represented by the general formula X*-N*-X*, where X* is a complementary sequence to a trigger, and N* is an arbitrary cleavage sequence on which a nicking enzyme (NE) can act.
4. A composition for detecting nucleic acid, wherein the nicking enzyme in paragraph 1 is any one selected from the group consisting of Nb.BtsI, Nt.BstNBI, Nb.BbvCI, Nt.BbvCI, and Nt.AlwI.
5. A composition for detecting nucleic acid, wherein in paragraph 1, Cas12j is any one selected from the group consisting of Cas12j1, Cas12j2, and Cas12j3.
6. A composition for detecting a nucleic acid, wherein the Cas12j / CRISPR complex comprises Cas12j and crRNA.
7. A composition for detecting a nucleic acid, wherein the crRNA is a nucleic acid sequence having a length of 40 to 50.
8. A composition for detecting a nucleic acid, wherein the reporter probe in paragraph 1 has a reporter conjugated to one end and a quencher conjugated to the other end.
9. In paragraph 8, the reporter is any one selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor®Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, and Quasar 705. A composition for detecting nucleic acids, wherein the quencher is any one selected from the group consisting of DABCYL, BHQ, ECLIPSE and TAMRA. 10.(a) A step of performing a reaction with a sample using a template including a converter and a repeater; and a composition for an exponential amplification reaction (EXPAR); (b) a step in which the target nucleic acid generated through the reaction of step (a) reacts with the Cas12j / CRISPR complex; and (c) a step in which the Cas12j / CRISPR complex recognizes the target nucleic acid and generates a detectable signal; a method for detecting a target nucleic acid.
11. A method for detecting a target nucleic acid in claim 10, wherein the detectable signal is a fluorescent signal that appears by cleavage of a reporter probe.
12. A method for detecting a target nucleic acid in claim 10, wherein the target nucleic acid is any one selected from the group consisting of DNA, RNA, genomic DNA, cDNA, circular RNA, siRNA, mRNA, tRNA, rRNA, miRNA, snoRNA, piRNA, and ncRNA. 13.(a) A step of performing a reaction with a sample using a template including a converter and a repeater; and a composition for an exponential amplification reaction (EXPAR); (b) a step in which the target nucleic acid generated through the reaction of step (a) reacts with the Cas12j / CRISPR complex; (c) a step in which the Cas12j / CRISPR complex recognizes the target nucleic acid and generates a detectable signal; and (d) a step of determining cancer when the detectable signal is confirmed; a method for providing information on cancer.
14. A method for providing information on cancer, wherein the cancer is any one selected from the group consisting of lung cancer, non-small cell lung cancer, small cell lung cancer, lung epithelial cancer, uterine cancer, ovarian cancer, cervical cancer, prostate cancer, and breast cancer.
15. A method for providing information on cancer, wherein the detectable signal in paragraph 13 is a fluorescent signal that appears by cleavage of a reporter probe.
Citation Information
Patent Citations
Method for miRNA detection based on CRISPR / Cas12a driven controlled release homogeneous system
CN115851882A
CRISPR-Cas effector polypeptides and methods of use thereof
JP2022521771A
Compositions and methods of a nuclease chain reaction for nucleic acid detection
WO2021236651A1
Crispr / CAS chain reaction systems and methods for amplifying the detection sensitivity of crispr-based target detection
WO2021243276A1
Methods for nucleic acid detection
WO2023088454A1