NPTX1 antibodies

NPTX1 antibodies targeting the NPTX1-AMIGO2 interaction in PDAC cells address the high metastatic nature of pancreatic cancer by modulating metabolic pathways and HIF1a nuclear retention, demonstrating efficacy in reducing metastasis and improving survival.

WO2025217258A1PCT designated stage Publication Date: 2025-10-16THE ROCKEFELLER UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/023825
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-09
Filing Date
2025-04-09
Publication Date
2025-10-16

AI Technical Summary

Technical Problem

Pancreatic ductal adenocarcinoma (PDAC) has a high mortality rate due to metastasis, with existing immune and targeted therapies being ineffective, and the mechanisms of PDAC cells adapting to hypoxic tumor microenvironments are poorly understood, necessitating the identification of critical targetable pathways for therapeutic intervention.

Method used

Development of neuronal pentraxin 1 (NPTX1) antibodies and antigen-binding fragments that inhibit the binding of NPTX1 to adhesion molecule with Ig like domain 2 (AMIGO2), targeting key drivers of PDAC metastasis by modulating metabolic pathways and HIF1a nuclear retention.

Benefits of technology

The NPTX1 antibodies effectively reduce PDAC metastasis by inhibiting NPTX1-AMIGO2 interaction, enhancing therapeutic outcomes in preclinical models, including reduced liver metastasis and improved survival rates.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000077_0000
    Figure 00000077_0000
  • Figure 00000077_0001
    Figure 00000077_0001
  • Figure 00000078_0000
    Figure 00000078_0000
Patent Text Reader

Abstract

The current disclosure is directed to antibodies against NPTX1, methods of making such antibodies, and the uses of such antibodies for the treatment of pancreatic ductal adenocarcinoma and prevention of metastasis.
Need to check novelty before this filing date? Find Prior Art

Description

2022-028 NPTX1 ANTIBODIES CROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 631,579, filed April 9, 2024, the contents of which are incorporated herein by reference in its entirety. INCORPORATION BY REFERENCE OF SEQUENCE LISTING

[0002] The Sequence Listing in an XML file, named as 42860WO_SequenceListing.xml of 138,785 bytes, created on April 8, 2025, and submitted to the United States Patent and Trademark Office via Patent Center, is incorporated herein by reference. BACKGROUND

[0003] Pancreatic ductal adenocarcinoma (PDAC) is the third leading cause of cancer death in the United States, with only 20% of patients surviving to one year from diagnosis and a meager 10% surviving to five years (SEER, 2018; Siegel et al., 2021). Furthermore, PDAC incidence has steadily increased on an annual basis over the past 20 years. Metastasis is the driving factor of this mortality as 5-year survival rates decline from 39% in patients with non-metastatic PDAC to 3% in patients with metastases. Unfortunately, clinical trials of immune therapies and other targeted therapies for PDAC have generally been unsuccessful in improving patient outcomes. Thus, there is a major unmet medical need to identify critical targetable pathways that drive PDAC metastatic progression.

[0004] There is growing evidence that PDAC cells rewire metabolic pathways to adapt to nutrient limitations and metabolic stress inherent to the tumor microenvironment (Chung et al., 2020; Perera et al., 2015; Wyant et al., 2017; Yang et al., 2018; Yoo et al., 2020; Zhu et al., 2021). A defining metabolic feature of the pancreatic tumor microenvironment is hypoxia, which results from poor vascularization and excessive fibrosis that can substantially reduce oxygen tension in the pancreatic parenchyma relative to other organs (Jungermann and Kietzmann, 2000). Moreover, the liver, the major target organ of PDAC metastasis, is mainly2022-028 fed by hypoxemic portal vein systems. The mechanisms that enable PDAC tumors to efficiently progress in the face of such hypoxia are poorly defined.

[0005] Hypoxia is sensed by a conserved program involving the hypoxia-inducible factors (HIFs) and the HIF prolyl-hydroxylase (Kaelin et al., 2016). In the presence of oxygen, the prolyl-hydroxylases hydroxylate HIF transcription factors at conserved proline residues, which leads to the binding of hydroxylated HIF by the Von Hippel Lindau E3 ubiquitin ligase and consequently, HIF ubiquitination (Kibel et al., 1995). Ubiquitinated HIFs are then degraded by the proteosome. Because prolyl hydroxylation requires oxygen, this process is inhibited upon hypoxia, leading to stabilization of HIF-1, which transcribes a suite of genes that promote angiogenesis and adaptive metabolic adaptations (Jiang et al., 1997; Maltepe et al., 1997; Maxwell et al., 1997). A key feature of this hypoxic response program is nuclear entry of HIF-1. Moreover, persistent transcription of hypoxic response genes requires HIF1 nuclear retention. A prior study had identified two serine residues in HIF-1α that are required for its nuclear retention (Mylonis et al., 2008; Mylonis et al., 2006). The identity of the upstream extracellular signal(s) that regulate such HIF-1 nuclear retention are largely unknown.

[0006] In vivo selection has been successfully applied to study metastasis by multiple cancer types in order to identify cellular phenotypes and processes that associate with various steps of the metastatic cascade (Fidler, 2003; Fidler and Nicolson, 1976). By deriving highly metastatic sublines from harvested metastases of mice and comparing such cells’ transcriptomic profiles to their parental poorly metastatic cells, key metastasis genes have been identified for mechanistic characterization (Kang et al., 2003; Loo et al., 2015; Minn et al., 2005; Pencheva et al., 2012; Yamaguchi et al., 2019; Yu et al., 2020). Most prior studies performed in vivo selection of human cancer cell populations in immunocompromised mice. Recent advances in genetically engineered mouse models (GEMMs) (Van Dyke and Jacks, 2002) have made it possible to in vivo select highly metastatic murine cancer populations from fully immunocompetent mice as a means of identifying conserved mammalian genes and pathways that drive metastatic progression.

[0007] Over twenty Phase III trials in PDAC have failed, reflecting the aggressive nature of this malignancy and our inadequate understanding of the critical determinants of disease progression. Identifying key drivers of PDAC metastatic progression has the potential to impact future2022-028 clinical outcomes by highlighting the key barriers that cancer cells must overcome, and the genes cancer cells employ to overcome such barriers to progression. One such barrier to progression is the unique PDAC tumor microenvironment , which contains desmoplastic and dense fibrous features that exhibit sparse and compressed vasculature (Feig et al., 2012) (Koong et al., 2000; Olive et al., 2009). Inadequate vascular perfusion causes hypoxia and nutrient limitations that PDAC cells must overcome via metabolic reprogramming events (Ligorio et al., 2019; Schworer et al., 2019; Sullivan et al., 2019; Ying et al., 2012). As the primary target organ of PDAC metastatic progression, the liver is also hypoxic (Jungermann and Kietzmann, 2000). To survive and grow in the hepatic microenvironment, cancer cells harness unique pro-metastatic programs involved in energy homeostasis and anabolism (Loo et al., 2015; Yamaguchi et al., 2019). HIF1a, a master regulator of oxygen homeostasis, has been implicated in promoting cancer progression and metastasis in multiple cancer types including PDAC (Huang et al., 2019; Lu and Kang, 2010; Wang et al., 2021). While genetic inactivation of the Von Hippel-Lindau tumor suppressor gene is a classic mechanism described in renal cancer that enhances HIF1a activity by promoting HIF1a protein stabilization, VHL genetic inactivation does not underlie the enhanced HIF1a transcriptional program observed in PDAC tumors, suggesting alternative mechanisms may be at play. SUMMARY

[0008] In some aspects, the present disclosure provides neuronal pentraxin 1 (NPTX1) antibodies and antigen-binding fragments thereof.

[0009] In one aspect, the present disclosure is directed to an isolated antibody or antigen binding fragment thereof, wherein the antibody or antigen binding fragment thereof: (i) binds to neuronal pentraxin 1 (NPTX1) and inhibits the binding of NPTX1 to adhesion molecule with Ig like domain 2 (AMIGO2); and (ii) comprises: (a) heavy chain variable domain selected from the group consisting of: a heavy chain variable domain comprising a complementarity determining region (CDR) 1-H comprising the amino acid sequence RYWMS (SEQ ID NO: 33) or a functional variant thereof; a CDR2-H comprising the amino acid sequence EINPDGSTINYTPSLKD (SEQ ID NO:2022-028 34) or a functional variant thereof; and a CDR3-H comprising the amino acid sequence GPYPYAMDY (SEQ ID NO: 35) or a functional variant thereof; and (b) a light chain variable domain selected from the group consisting of: a light chain variable domain comprising a CDR1-L comprising the amino acid sequence KASQSVTNDVA (SEQ ID NO: 36) or a functional variant thereof; a CDR2-L comprising the amino acid sequence SASNRFT (SEQ ID NO: 37), GASNRFT (SEQ ID NO: 38), DASNRFT (SEQ ID NO: 39), or a functional variant thereof; and a CDR3-L comprising the amino acid sequence QQDYISPFT (SEQ ID NO: 40) or a functional variant thereof.

[0010] In some embodiments, the current disclosure is directed to an isolated antibody or antigen-binding fragment thereof, comprising: (a) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 3 (VH4 / VK6), and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 4 (VH4 / VK6); (b) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 1 (VH4 / VK8), and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 2 (VH4 / VK8); (c) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 19 (VH0 / VK0), and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 24 (VH0 / VK0); (d) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 23 (VH3 / VK6) and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 30;2022-028 (e) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 23 (VH3 / VK7), and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO:31; (f) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 23 (VH3 / VK8), and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 32; or (g) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 23(VH4 / VK7), and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO:31.

[0011] In some embodiments, the isolated antibody or antigen binding fragment thereof is a humanized antibody. In some embodiments, the isolated antibody or antigen binding fragment thereof comprises a heavy chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 3; and a light chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 4. In some embodiments, the isolated antibody or antigen binding fragment thereof comprises a heavy chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 1; and a light chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 2.

[0012] In some aspects, the current disclosure is directed to an isolated nucleic acid encoding an immunoglobulin chain or variable region thereof of an antibody disclosed herein.

[0013] In some aspects, the current disclosure is directed to a vector comprising an isolated nucleic acid described herein.

[0014] In some aspects, the current disclosure is directed to a host cell comprising an isolated nucleic acid described herein. In some embodiments, the host cell is an Expi 293 cell.2022-028

[0015] In some aspects, the current disclosure is directed to a method for making an antibody or antigen-binding fragment thereof as disclosed herein or an immunoglobulin chain thereof, the method comprising: (a) introducing one or more nucleic acids encoding an immunoglobulin chain of antibody or antigen-binding fragment thereof into a host cell; (b) culturing the host cell in a medium to express the immunoglobulin chain(s); and (c) optionally, isolating the immunoglobulin chain or antibody or antigen-binding fragment thereof from the host cell and / or the medium.

[0016] In some embodiments, the host cell is an Expi 293 cell.

[0017] In some aspects, the current disclosure is directed to a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof as disclosed herein and a pharmaceutically acceptable carrier.

[0018] In some aspects, the current disclosure is directed to an isolated antibody or antigen binding fragment thereof, wherein: (i) the antibody or antigen binding fragment thereof binds to neuronal pentraxin 1 (NPTX1); (ii) the antibody or antigen binding fragment thereof comprises: (a) heavy chain variable domain selected from the group consisting of: a heavy chain variable domain comprising a complementarity determining region (CDR) 1-H comprising the amino acid sequence RYWMS (SEQ ID NO: 33) or a functional variant thereof; a CDR2-H comprising the amino acid sequence EINPDGSTINYTPSLKD (SEQ ID NO: 34) or a functional variant thereof; and a CDR3-H comprising the amino acid sequence GPYPYAMDY (SEQ ID NO: 35) or a functional variant thereof; and (b) a light chain variable domain selected from the group consisting of: a light chain variable domain comprising a CDR1-L comprising the amino acid sequence KASQSVTNDVA (SEQ ID NO: 36) or a functional variant thereof; a CDR2-L comprising the amino acid sequence SASNRFT (SEQ ID NO: 37), GASNRFT (SEQ ID NO: 38), DASNRFT (SEQ ID NO: 39), or a functional variant thereof; and a CDR3-L comprising the amino acid sequence QQDYISPFT (SEQ ID NO: 40) or a functional variant thereof.2022-028

[0019] In some embodiments, the isolated antibody or antigen binding fragment thereof is used to detect biomarker. In some embodiments, the isolated antibody or antigen-binding fragment thereof comprises: a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 55; and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 54. In some embodiments, the isolated antibody or antigen binding fragment thereof comprises a heavy chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 55; and a light chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 54. In some embodiments, the isolated antibody or antigen binding fragment thereof is a humanized antibody.

[0020] Some aspects of the current disclosure are directed to a method of detecting pancreatic ductal adenocarcinoma in a subject, the method comprising: (1) contacting a biological sample from the subject with the antibody or antigen-binding fragment thereof as described herein; (2) comparing the level of the antibody or antigen-binding fragment with a baseline level of the antibody or antigen-binding fragment of a control sample, wherein a difference between the level of the pancreatic cancer biomarker derived from said subject and the pancreatic cancer biomarker in the control sample is an indication that the subject is afflicted with pancreatic cancer.

[0021] Some aspects of the current disclosure are directed to a kit comprising the antibody or antigen-binding fragment thereof as described herein; the isolated nucleic acid as described herein; the vector as described herein, the host cell as described herein, and / or the pharmaceutical composition as described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0023] FIG.1A-1E. NPTX1 is highly expressed in in vivo selected highly metastatic human and murine pancreatic cancer cells. (A) Schematic drawing of in vivo selection of pancreatic cancer cells with high liver metastatic capacity. (B) Liver metastasis assay in NSG mice injected2022-028 intrasplenically with PANC1 parental cells or in vivo selected PANC1 LM3 cells (p=0.001, Student’s t-test, n=5 per group). (C) Liver metastasis assay in B6129SF1 / J mice injected intrasplenically with KPC parental cells or in vivo selected KPC LM2 cells (p=0.002, Student’s t-test, n=4 per group). (D) Spontaneous liver metastasis assay in NSG mice injected intrapancreatically with PANC1 parental cells or in vivo selected PANC1 LM3 cells (p=0.037, Student’s t-test, n=5 per group). (E) Volcano plots revealing ex vivo transcriptomic profiles of PANC1 LM3 / PANC1 and KPC LM2 / KPC (n=3 per group).

[0024] FIG.2A-G. NPTX1 expression in metastatic human and murine pancreatic cancer cells. (A) Liver metastasis assay using parental PANC1 cells and PANC1 LM3 sublines (3a and 3b) (p=0.003 for PANC1 vs PANC1 LM3a on day 19, Student’s t-test. Unable to perform a statistical test for PANC1 LM3b on day 19 due to a multiple mortality in the group, n=5 per group). (B) Liver metastasis assay using PANC1 LM3 cells undergone multiple in vitro passages (p=0.0001 and 0.008 for PANC1 vs PANC1 LM3a and vs PANC1 LM3b respectively, Student’s t-test, Bonferroni correction). (C) Pancreas orthotopic tumor growth- liver spontaneous metastasis assay using KPC and KPC LM2 cells (p=0.046, Student’s t-test). (D) Cell growth assay using PANC1, PANC1 LM3s (a and b), KPC, and KPC LM2 cells (p=0.06, 0.008, 0.0286 for PANC1 vs LM3a, vs LM3b, KPC vs KPC LM2, respectively. Mann-Whitney test). (E) Schematic representation of the transcriptomic analysis in the multiple in vivo selected cell lines. (F) Quantitative PCR for NPTX1 and Nptx1 (p<0.0001 for both comparisons). (G) Quantitative PCR based genomic copy number analysis using HEK293, PANC1, and PANC1 LM3s (a, b, and c) cells.

[0025] FIG.3A-E. NPTX1 involvement in human and murine PDAC liver metastasis. (A) Liver metastasis assay in NSG mice injected intrasplenically with PANC1 LM3 cells expressing either control guide RNA or NPTX1 targeting guide RNAs (_1 and _7). (p=0.003 in sgNPTX1_1, p<0.0001 in sgNPTX1_7, Student’s t-test, n=5 per group). (B) Kaplan-Meier curve comparing the overall survival of mice bearing liver metastasis from PANC1 LM3 cells expressing either control guide or NPTX1 targeting guide (p=0.027, log-rank test, n=5 per group). (C) Relative guide RNA abundance from CRISPR competition liver metastasis assay (p=0.023, Student’s t-test, n=5 per group). (D) Spontaneous liver metastasis assay (p=0.037, Student’s t-test n=5 per group). (E) Liver metastasis assay in NSG mice injected intrasplenically2022-028 with PANC1 LM3 cells expressing either control hairpin or dox-inducible NPTX1 targeted hairpin. Doxycycline at 200mg / kg body weight or control chow were started on day 14 after the injection of cancer cells (p<0.0001, Student’s t-test, n=5 per group).

[0026] FIG.4A-G. NPTX1 drives human and murine PDAC liver metastasis. (A) Western blot for NPTX1 in PANC1 LM3 cells expressing either a control guide or NPTX1 targeting guides (_1 and _7). (B) A representative H&E stain images of livers harboring either control or NPTX1 silenced tumors and the number of liver metastatic foci (p=0.004, Student’s t-test). (C) Relative NPTX1 expression in PANC1 LM3, KPC LM2, and MIA PaCa2 LM3 cells expressing either control or NPTX1 / Nptx1 targeting hairpins (p<0.0001, <0.0001, =0.002, <0.0001, <0.0001, and <0.0001 for shCTRL vs _1, vs _3, vs _D, vs _C, vs_3, and vs _4, respectively, Student’s t- test). (D) Liver metastasis assay using PANC1 LM3 cells expressing either control or NPTX1 targeting hairpins (_3 and _1). (p=0.0007, p=0.006 for shCTRL vs _3 and vs _1, respectively, Student’s t-test, n=5 per group). (E) Liver metastasis assay using KPC LM2 cells expressing either control or Nptx1 targeting hairpins (_C and _D) (p=0.046 and 0.014 for shCTRL vs sh_C and sh_D, respectively, Student’s t-test, n=5 per group). (F) Liver metastasis assay using MIA PaCa2 LM3 cells expressing either control or NPTX1 targeting hairpins (_3 and _4) (p=0.036 and 0.002 for shCTRL vs sh_3 and vs sh_4, respectively, Student’s t-test, n=5 per group). (G) In vitro invasion assay using PANC1 and PANC1 LM3 cells expressing either control or NPTX1 targeting hairpins (sh_1 and _3) (p=0.144, 0.282, and 0.684 for PANC1 vs LM3, shCTRL LM3 vs sh_1, and shCTRL vs sh_3, respectively, Student’s t-test).

[0027] FIG.5A-G. NPTX1 expression in primary PDAC tumors and liver metastases. (A) Relative NPTX1 mRNA abundance in normal pancreas and PDAC samples (p<0.0001, Student’s t-test). (B) NPTX1 ELISA in the serum of PDAC bearing mice (p=0.003, Student’s t-test). (C) NPTX1 ELISA in the serum of PDAC patients (p=0.015, Student’s t-test). (D) Representative images of immunohistochemistry staining of NPTX1 of human liver metastatic foci or primary PDAC tumors (p=0.025, Student’s t-test*). (E) Representative gross liver images and their H&E staining of liver metastasizing PC95 PDAC PDO expressing either control hairpin or NPTX1 targeting hairpins (_4 and _5) and the number of metastatic foci in the livers harboring PC95 PDO expressing either control or NPTX1 targeting hairpins (_4 and _5) (p=0.0031 and 0.0030 for shCTRL vs sh_4 and sh_5, Student’s t-test). (F) In vivo liver metastasis CRISPR competition2022-028 assay in PC95 PDAC PDX / O (p=0.027, Student’s t-test). (G) Kaplan-Meier curve to estimate disease free survival of PDAC patients from TCGA-PAAD dataset with the median cut off for NPTX1 expression (n=185 in total, p=0.023, log-rank test). *single tailed t-test as the hypothesis was whether the liver tumors’s mean IHC score was higher than that of the primary tumors.

[0028] FIG.6A-D. NPTX1 is over-expressed in primary PDAC tumors and liver metastases. (A) Relative NPTX1 expression in primary PDAC and liver metastasis (p=0.009 for primary vs liver metastasis, Student’s t-test). (B) Immunohistochemistry images of representative PDAC tumors corresponding to the each IHC score and the definition of IHC score. (C) Establishment of NPTX1 expressing PC95 PDAC PDO and non NPTX1 expressing PC69 PDAC PDO. (D) Relative NPTX1 expression in PC95 PDO expressing either control hairpin or NPTX1 targeting hairpin.

[0029] FIG.7A-I. NPTX1 upregulation promotes cell growth under hypoxia. (A) Cell growth assay using PANC1 LM3 cells expressing either control or NPTX1 targeting guides (_1 and _7) under normoxia (p=0.202 and 0.136 for sgCTRL vs sg_1 and vs sg_7, respectively, Student’s t-test). (B) DEVD luciferin-based apoptosis assay of metastasizing PDAC cells expressing either control hairpin or NPTX1 targeting hairpin (_3) (p=0.521 and 0.364 for shCTRL vs shNPTX1_3 on day 14 and 21 respectively, Student’s t-test, n=5 per group). (C) Ki- 67 immunofluorescence staining of metastasizing PDAC cells expressing either control or NPTX1 hairpin. (p<0.0001, Student’s t-test). (D) Comparing the growth of PANC1 and PANC1 LM3 cells under either normoxia or hypoxia (0.5% oxygen) (Under normoxia, (p=0.06, Student’s t-test), under hypoxia (1.6 fold increase, p=0.004, Student’s t-test)). (E) Western blot of the conditioned media harvested either from PANC1 parental cells or PANC1 LM3 cells. (F) Western blot of PANC1 or PANC1 LM3 whole cell lysates harvested either under normoxia or hypoxia (0.5% oxygen). NPTX1 expression was induced upon the exposure to hypoxia in both PANC1 and PANC1 LM3 cells (5.7 fold increase in LM3 cells and 5.8 fold increase in PANC1 cells, p<0.0001 and p=0.0051 respectively, Student’s t-test). (G) Comparing the growth of LM3 cells derived or PANC1 cells derived conditioned media treated PANC1 cells under hypoxia (0.5% oxygen) (p=0.0013, Student’s t-test). (H) Comparing the growth of PANC1 cells treated with recombinant NPTX1 at the increasing concentrations where 1x rNPTX1 is 1ng / ml*(p=0.0005, Student’s t-test). (I) Comparing the growth of PANC1 LM3 cells expressing either2022-028 control guide or NPTX1 targeting guide with or without rNPTX1 treatment (p=0.002, ctrl vs rNPTX1 in sgCTRL cells and p=0.009, ctrl vs rNPTX1 in sgNPTX1 cells respectively, Student’s t-test). *: 1x concentration was determined by ELISA experiments in PDAC mice and patient samples as performed and shown in FIGs.5B and 5C.

[0030] FIG.8A-F. HIF1a mediated NPTX1 upregulation promotes cell growth under hypoxia. (A) Hypoxia cell growth assay using PANC1 LM3 expressing either control CRISPR guide or NPTX1 targeting guides (_1 and _7) (p=0.0027 and 0.047 for control vs guide1_1 and 1_7, respectively, Student’s t-test). (B) Cell growth assay either under normoxia or hypoxia using PANC1 LM3 cells expressing control or NPTX1 targeting hairpins (_1 and _3) (p=0.937, 0.588, 0.0021, and 0.007 for siCTRL vs siNPTX1_1 and _3 under normoxia and hypoxia, respectively, Mann-Whitney test). (C) Relative NPTX1 protein expression comparing PANC1 parental and PANC1 LM3 cells (p=0.0006, Student’s t-test). (D) Cell growth assay using PANC1 treated by either control or recombinant NPTX1 under normoxia (p=0.128, Student’s t- test). (E) In vivo hypoxia imaging study of liver metastasizing tumors derived either from PANC1 or PANC1 LM3 cells (p<0.0001 and 0.003 for pimonidazole and Ki67 signal, Student’s t-test, respectively). (F) Gene set enrichment analysis (GSEA) with HALLMARK gene sets with the ex vivo mRNAseq data related to FIG.1E comparing PANC1 and LM3 transcriptome.

[0031] FIG.9A-H. AMIGO2 acts as an NPTX1 receptor. (A) Volcano plot comparing the transcriptome of ex vivo PANC1 LM3 liver metastasizing tumors expressing either control hairpin or NPTX1 targeting hairpin. (B) Co-immunoprecipitation under hypoxia (IP) IP: FLAG- AMIGO2 Immunoblot: anti NPTX1 and anti AMIGO2. (C) Proximity ligation assay using PANC1 LM3 cells treated either his-tag control protein or his-tagged rNPTX1. (D) Normalized fluorescence (ΔFnorm) plot from MST assay using rEGFR or rAMIGO2. (E) Hypoxia cell growth assay in PANC1 LM3 cells expressing either control hairpin or AMIGO2 targeting hairpins (_2 and _3) (p=0.002 and p<0.0001 in shCTRL vs sh_2 and shCTRL vs sh_3, Student’s t-test, Bonferroni correction). (F) Hypoxia cell growth assay in PANC1 LM3 cells expressing either control hairpin or AMIGO2 targeting hairpins with / without rNPTX1 treatment (p=0.002, p=0.95, and p=0.41 Ctrl vs rNPTX1 in shCTRL, sh_2, and sh_3 respectively). (G-H) Liver metastasis assay using PANC1 LM3 cells expressing either control hairpin or AMIGO2 targeting2022-028 hairpins (_2 in (G), _3 in (H)) (p<0.0001 for both shAMIGO2_2 and _3, Student’s t-test, n=5 per group).

[0032] FIG.10A-H. AMIGO2 is a cell surface receptor for NPTX1 in PDAC and a driver of PDAC liver metastasis. (A) Top 20 up-regulated genes in the ex vivo NPTX1 silenced liver metastatic tumors. (B) Western blot for AMIGO2 using IP: rNPTX1 sample. (C) Immunofluorescence images from the control conditions in the PLA assay. (D) Relative fluorescence counts plot of NPTX1 with either recombinant AMIGO2 or recombinant EGFR. (E) Relative AMIGO2 expression in PANC1 LM3 cells expressing either control or AMIGO2 targeting hairpins (_2 or _3) (p<0.0001 for both). (F) Cell growth assay using PANC1 LM3 cells expressing either control or AMIGO2 hairpin under normoxia (p=0.09, Student’s t-test). (GH) H&E staining of liver tumors expressing either control hairpin or AMIGO2 targeting hairpins (_2 and _3). The number of metastatic foci was counted from 4 sections per group (p<0.0001 for both comparison, Student’s t-test).

[0033] FIG.11A-G. AMIGO2 mediates HIF1a nuclear retention via specific HIF1a residues. (A) Western blot of HIF1a protein in PANC1 LM3 cells expressing either control hairpin or AMIGO2 hairpin fractionated into the cytoplasmic (cyt) and the nuclear (nuc) fractions. The first column is from control whole cell lysate sample under normoxia. (B) Immunofluorescence staining of HIF1a using in vitro PANC1 LM3 cells expressing either control hairpin or NPTX1 targeting hairpin under hypoxia (0.5% O2). (C) Hypoxia dual luciferase reporter assay using PANC1 LM3 cells expressing either control hairpin or AMIGO2 targeting hairpins (_2 and _3) under hypoxia (0.5% oxygen) (p<0.0001 for both shCTRL vs _2 and _3, Mann-Whitney test). (D) Volcano plot comparing expression level of known HIF1a target genes (84 genes in total) in shCTRL and shAMIGO2 PANC1 LM3 ex vivo tumors (blue dots: negative log2 fold change and p<0.05 and red dots: positive log2 fold change and p<0.05). (E) Hypoxia dual luciferase reporter assay using shCTRL and shAMIGO2 PANC1 LM3 cells over-expressing either empty vector, full-length HIF1a, or the phosphomimetics (S641, S643, or both) (p<0.0001, Mann-Whitney test). (F) Immunofluorescence staining of HIF1a using in vitro cultured shCTRL or shAMIGO2 PANC1 LM3 cells expressing either empty vector or the dual phosphomimetics under hypoxia (0.5% O2). (G) Liver metastasis assay using shAMIGO22022-028 PANC1 LM3 cells expressing either empty vector, full-length HIF1a, or the HIF1a dual phosphomimetics (p=0.026 in EV vs plxS641E / S643E, Student’s t-test, n=4 per group).

[0034] FIG.12A-F. AMIGO2 mediates HIF1a nuclear retention via specific HIF1a residue. (A) Relative HIF1a expression comparing its abundance in cytoplasmic and nuclear fractions (p=0.0004 and 0.005 for shCTRL vs shAMIGO2 in cytoplasmic and nuclear fractions, Student’s t-test, respectively). (B) HIF1a target genes expression level among PDAC patients in the TCGA-PAAD dataset comparing NPTX1 high tumors and NPTX1 low tumors. (C) Western blot for HIF1a using shAMIGO2 PANC1 LM3 cells over-expressing either HIF1a, S641E, S643E, or S641E / S643E constructs. (D) Western blot for CRM1 in shCTRL and shAMIGO2 PANC1 LM3 cells (p=0.710). (E) Relative nuclear HIF1 signal abundance (p<0.0001 for both shCTRL vs shAMIGO2 and plxEmpty vs plxHIF1aS641E / S643E in shAMIGO2 cells, Student’s t-test). (F) The number of liver metastatic foci of plxEmpty, plxHIF1a, or plx641E / S643E expressing shAMIGO2 PANC1 LM3 tumors (p<0.0001, Student’s t-test).

[0035] FIG.13A-G. Targeting NPTX1-AMIGO2 binding in primary and metastatic PDAC. (A) Hypoxia cell viability assay (MTS assay) using PANC1 LM3 cells treated with isotype control antibodies or NPTX1 monoclonal antibodies at 50ug / ml (p<0.0001, Mann- Whitney test) (0.5% O2). (B) Liver metastasis assay using PANC1 LM3 cells treated with either 31B01-NPTX1 antibody (murine IgG1 isotype) at 10mg / kg twice a week I.P., gemcitabine 100mg / kg weekly I.P. or both (p=0.028 in PBS / IgG vs PBS / 31B01, Student’s t-test, n=5 per group. The antibody treatment was started 1 hour after tumor cell injection.). The representative liver sections with H&E staining are shown (p=0.0004 in PBS / IgG vs PBS / 31B01, Student’s t- test). (C) Orthotopic pancreas tumor growth assay using in vivo selected PC69P PDX / O treated either isotype control antibody of NPTX1-31B01 antibody (IgG1 isotype) at 10mg / kg twice a week I.P. (p=0.003, Student’s t-test, n=5 for control group and n=4 for 31B01 group. The antibody treatment was started on day 7 after confirming the establishment of primary pancreatic tumors). (D) Subcutaneous pancreas tumor growth assay using Mia PaCa-2 cells treated with either isotype control antibody of humanized 31B01-NPTX1 antibody (IgG isotype) at 10mg / kg twice a week I.P., humanized 31B01-NPTX1 antibody at 10mg / kg twice a week I.P., or gemcitabine 60 mg / kg and nab-paclitaxel 30mg / kg twice a week I.P. (p=0.9012, Student’s t-test, n=4 for control group, n=4 for humanized 31B01 group, and n=4 for gemcitabine / n-paclitaxel2022-028 group. The antibody treatment was started after tumor volume reached 50 mm3). (E) Livermetastasis assay using BxPC-3 LM3 cells treated with eitherisotype control antibody ofhumanized 31B01-NPTX1 antibody (IgG isotype) at 10mg / kg twice a week I.P., humanized 31B01-NPTX1 antibody at 10mg / kg twice a week I.P. The representative gross liver images are shown (p=0.0095, Student’s t-test, n=5 for control group and n=5 for humanized 31B01 group. The antibody treatment started 1 hour after tumor cell injection). (F) Orthotopic pancreas tumor growth assay using Mia PaCa-2 cells treated with either isotype control antibody of humanized 31B01-NPTX1 antibody (IgG isotype) at 10mg / kg twice a week I.P., humanized 31B01-NPTX1 antibody at 10mg / kg twice a week I.P. (p=0.0151, Student’s t-test, n=4 for control group and n=4 for humanized 31B01 group. The antibody treatment was started on day 7 after confirming the establishment of primary pancreatic tumors). The representative gross liver images are shown (p=0.0158 in PBS / IgG vs PBS / humanized 31B01, Student’s t-test). (G) Schematic representation of the proposing model.

[0036] FIG.14A-F. NPTX1-AMIGO2 is a therapeutic target of primary and metastatic PDAC. (A) Hypoxia cell viability assay using PC95 and PC69 PDO treated either with control or 31B01-NPTX1 antibodies at 50ug / ml (pooled analysis of 2 experiments, p=0.0022 and 0.093 for PC95 and PC69, respectively, Mann-Whitney test). (B) Ultrasonographic image of the liver harboring metastasizing PC69 PDO (annotated with the dashed pink circle). Western blot for NPTX1 using orthotopically growing PC69 (PC69P) and in vivo selected liver metastasizing PC69LM. (C) Hypoxia cell viability assay using PC69P PDO treated either with control or 31B01-NPTX1 antibodies at 50ug / ml (pooled analysis of 2 experiments, p=0.026, Mann- Whitney test). (D) Kaplan-Meier plot to estimate overall survival probability of the mice harboring PC69P PDO comparing control antibody treated group and 31B01-NPTX1 antibody treated group (p=0.002, log-rank test, n=5 per group). (E) Subcutaneous tumor growth assay using BxPC-3 LM3 cells treated with either isotype control antibody of humanized 31B01- NPTX1 antibody (IgG isotype) at 10mg / kg twice a week I.P., humanized 31B01-NPTX1 antibody at 10mg / kg twice a week I.P., or gemcitabine 60mg / kg and nab-paclitaxel 30mg / kg twice a week I.P. (p=0.7983, Student’s t-test, n=4 for control group, n=4 for humanized 31B01 group, and n=4 for gemcitabine / n-paclitaxel group. The antibody treatment was started after tumor volume reached 50 mm3). (F) Subcutaneous tumor growth assay using PC104 PDX2022-028 treated with either isotype control antibody of humanized 31B01-NPTX1 antibody (IgG isotype) at 10mg / kg twice a week I.P. or humanized 31B01-NPTX1 antibody at 10mg / kg twice a week I.P. (p=0.7899, Student’s t-test, n=3 for control group and n=3 for humanized 31B01 group. The antibody treatment was started after tumor volume reached 50 mm3). The representative gross liver images are shown (p=0.8325 in PBS / IgG vs PBS / humanized 31B01, Student’s t-test).

[0037] FIG.15A-B. NPTX1 Antibody of disclosure performs better than commercially available NPTX1 antibody. (A) Western blot comparing commercially available NPTX1 antibody (left) and NPTX1 antibody made as described in the disclosure (right). (B) Immunohistochemistry staining of NPTX1 by commercially available antibody in brain tissue. DETAILED DESCRIPTION

[0038] Although claimed subject matter will be described in terms of certain examples, other examples, including examples that do not provide all of the benefits and features set forth herein, are also within the scope of this disclosure. Various structural, logical, and process step changes may be made without departing from the scope of the disclosure.

[0039] Ranges of values are disclosed herein. The ranges set out a lower limit value and an upper limit value. Unless otherwise stated, the ranges include the lower limit value, the upper limit value, and all values between the lower limit value and the upper limit value, including, but not limited to, all values to the magnitude of the smallest value (either the lower limit value or the upper limit value). General Terminology

[0040] The term “isolated” as used herein in reference to an antibody or an antigen-binding fragment thereof refers to an antibody or an antigen binding fragment thereof that: (1) is not associated with naturally associated components that accompany it in its native state; (2) is free of other proteins from the same species; (3) is expressed by a cell from a different species; and / or (4) does not occur in nature.

[0041] The term “antibody” refers to an immunoglobulin molecule. The general structure of antibodies in vertebrates now is well understood. See Edelman, G. M., Ann. NY Acad Sci., 190:5 (1971). Antibodies consist of two light polypeptide chains of molecular weight2022-028 approximately 23,000 Daltons (the "light chain"), and two heavy chains of molecular weight 53,000-70,000 Daltons (the "heavy chain"). The four chains are joined by disulfide bonds in a "Y" configuration wherein the light chains bracket the heavy chains starting at the mouth of the "Y" configuration. The "branch" portion of the "Y" configuration is designated the Fab region; the stem portion of the "Y" configuration is designated the Fc region. The amino acid sequence orientation runs from the N-terminal end at the top of the "Y" configuration to the C-terminal end at the bottom of each chain. The N-terminal end possesses the variable region having specificity for the antigen that elicited it, and is approximately 100 amino acids in length, there being slight variations between light and heavy chain and from antibody to antibody. The variable region is linked in each chain to a constant region that extends the remaining length of the chain and that within a particular class of antibody does not vary with the specificity of the antibody (i.e., the antigen eliciting it). There are five known major classes of constant regions that determine the class of the immunoglobulin molecule (IgG, IgM, IgA, IgD, and IgE corresponding to γ, μ, α, δ, and ε (gamma, mu, alpha, delta, and epsilon, respectfully) heavy chain constant regions). The constant region or class determines subsequent effector function of the antibody, including activation of complement (see Kabat, E. A, Structural Concepts in Immunology and Immunochemistry, 2nd Ed., p.413-436, New York, NY: Holt, Rinehart, Winston (1976)), and other cellular responses (see Andrews et al., Clinical Immunology, pp.1- 18, W. B. Sanders, Philadelphia, PA (1980); Kohl et al., Immunology, 48: 187 (1983)); while the variable region determines the antigen with which it will react. Light chains are classified as either κ (kappa) or λ (lambda). Each heavy chain class can be prepared with either kappa or lambda light chain. The light and heavy chains are covalently bonded to each other, and the "tail" portions of the two heavy chains are bonded to each other by covalent disulfide linkages when the immunoglobulins are generated either by hybridomas or by B-cells.

[0042] The term “antibody” as used herein encompasses murine, humanized, human and chimeric antibodies, and antibodies in a multimeric form, such as dimers, trimers, or higher- order multimers of monomeric antibodies. The term “antibody” as used herein encompasses monospecific and multispecific (e.g., bispecific) antibodies, and any other modified configuration of the immunoglobulin molecule that comprises an antigen recognition site of the required specificity. Further, the term “antibody” is not limited by any particular method of2022-028 producing the antibody. For example, it includes monoclonal antibodies, recombinant antibodies, and polyclonal antibodies. The term “antibody” includes antibodies of all classes and subclasses, e.g., an IgG, IgA, IgD, IgE or IgM antibody, such as IgG1, IgG2, IgG3 or IgG4 antibody.

[0043] The term “antigen-binding fragment” of an antibody refers to one or more portions of a full-length antibody that are responsible for and involved in binding to the antigen. Examples of antigen-binding fragments include Fab fragments, F(ab’)2fragments, Fd fragments, Fv fragments, single chain Fv (scFv) molecules, a variable domain (VH or VL), a molecule comprising one or more VH and / or VL. An antigen-binding fragment can be synthetic, recombinantly produced, or enzymatically derived.

[0044] Typically, the variable domains of both the heavy and light immunoglobulin chains comprise three hypervariable regions, also called complementarity determining regions (CDRs), located within relatively conserved framework regions (FR). In general, from N-terminal to C- terminal, both light and heavy chains variable domains comprise FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. In an embodiment of the disclosure, the assignment of amino acids to each domain is in accordance with the definitions of Sequences of Proteins of Immunological Interest, Kabat, et al., National Institutes of Health, Bethesda, Md.; 5th ed.; NIH Publ. No.91-3242 (1991); Kabat, Adv. Prot. Chem.32:1-75(1978); Kabat, et al., J. Biol. Chem.252:6609-6616 (1977); Chothia, et al., J Mol. Biol.196:901-917 (1987) or Chothia, et al., Nature 342:878-883 (1989).

[0045] The expression "variable region" or "VR" refers to the domains within each pair of light and heavy chains in an antibody that are involved directly in binding of the antibody to the antigen. Each heavy chain has at one end a variable region (VH) followed by a number of constant domains. Each light chain has a variable region (VL) at one end and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain.

[0046] The expressions "complementarity-determining region," "hypervariable region," and "CDR" refer to one or more of the hyper-variable or complementarity-determining regions ("CDRs") found in the variable regions of light or heavy chains of an antibody (See Kabat et al.,2022-028 Sequences of Proteins of Immunological Interest, 4th ed., Bethesda, MD: U.S. Dept. of Health and Human Services, Public Health Service, National Institutes of Health (1987)). These expressions include the hypervariable regions as defined by Kabat et al. (Sequences of Proteins of Immunological Interest, NIH Publication No.91-3242, Bethesda, MD: U.S. Dept. of Health and Human Services, National Institutes of Health (1983)) or the hypervariable loops in 3- dimensional structures of antibodies (Chothia and Lesk, J Mal. Biol., 196:901-917 (1987)). The CDRs in each chain are held in close proximity by framework regions ("FRs") and, with the CDRs from the other chain, contribute to the formation of the antigen binding site. Within the CDRs there are select amino acids that have been described as the selectivity determining regions ("SDRs") that represent the critical contact residues used by the CDR in the antibody- antigen interaction (see Kashmiri et al., Methods, 36(1):25-34 (2005)).

[0047] The term “human antibody” refers to an antibody consisting of amino acid sequences of human immunoglobulin sequences only. A human antibody may contain murine carbohydrate chains if produced in a mouse, in a mouse cell or in a hybridoma derived from a mouse cell. Human antibodies may be prepared in a variety of ways known in the art.

[0048] The term “humanized antibody” includes an antibody that contains some or all of the CDRs from a non-human animal antibody while the framework and constant regions of the antibody contain amino acid residues derived from human antibody sequences. Humanized antibodies can be produced by grafting CDRs from a mouse antibody into human framework sequences, and in some instances followed by back substitution of certain human framework residues for the corresponding mouse residues from the source antibody. The term “humanized antibody” also includes an antibody of non-human origin in which, typically in one or more variable regions, one or more epitopes have been removed, that have a high propensity of constituting a human T-cell and / or B-cell epitope, for purposes of reducing immunogenicity. The amino acid sequence of the epitope can be removed in full or in part. However, typically the amino acid sequence is altered by substituting one or more of the amino acids constituting the epitope for one or more other amino acids, thereby changing the amino acid sequence into a sequence that does not constitute a human T-cell and / or B-cell epitope. The amino acids are substituted by amino acids that are present at the corresponding position(s) in a corresponding human variable heavy or variable light chain as the case may be.2022-028

[0049] The term “chimeric antibody” refers to an antibody that comprises amino acid sequences derived from two different species such as human and mouse, typically a combination of mouse variable (from heavy and light chains) regions and human constant (heavy and light chains) regions.

[0050] A “single-chain antibody” (scFv) consists of a single polypeptide chain comprising a VL domain linked to a VH domain wherein VL domain and VH domain are paired to form a monovalent molecule. Single chain antibody can be prepared according to method known in the art (see, for example, Bird et al., Science 242:423-426 (1988) and Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988)).

[0051] A “diabody” consists of two chains, each chain comprising a heavy chain variable region connected to a light chain variable region on the same polypeptide chain connected by a short peptide linker, wherein the two regions on the same chain do not pair with each other but with complementary domains on the other chain to form a bispecific molecule. Methods of preparing diabodies are known in the art (see, e.g., Holliger P. et al., Proc. Natl. Acad. Sci. USA 90:6444- 6448 (1993), and Poljak R. J. et al., Structure 2:1121-1123 (1994)).

[0052] “Domain antibodies” (dAbs) are small functional binding units of antibodies, corresponding to the variable regions of either the heavy or light chains of antibodies. Domain antibodies are well expressed in bacterial, yeast, and mammalian cell systems. Further details of domain antibodies and methods of production thereof are known in the art (see, for example, U.S. Pat. Nos.6,291,158; 6,582,915; 6,593,081; WO04 / 003019 and WO03 / 002609).

[0053] A “nanobody” typically comprises a single variable domain and two constant domains (CH2 and CH3) and retains antigen-binding capacity of the original antibody. Nanobodies are derived from the heavy chains of an antibody. Nanobodies can be prepared by methods known in the art (see e.g., U.S. Pat. No.6,765,087, U.S. Pat. No.6,838,254, WO 06 / 079372).

[0054] “Unibodies” consist of one light chain and one heavy chain of an IgG4 antibody. Unibodies may be made by the removal of the hinge region of IgG4 antibodies. Further details of unibodies and methods of preparing them may be found in WO2007 / 059782.

[0055] The term “epitope” refers to the area or region of an antigen to which an antigen binding peptide (such as an antibody) specifically binds. “Epitope” is also referred to in the art as the “antigenic determinant”. An epitope generally consists of chemically active surface groupings of2022-028 molecules such as amino acids or carbohydrate or sugar side chains. An epitope may be “linear” or “non-linear / conformational”. A protein epitope may comprise amino acid residues directly involved in the binding (also called immunodominant component of the epitope) and other amino acid residues, which are not directly involved in the binding, such as amino acid residues that are effectively blocked by the specifically antigen binding peptide (in other words, the amino acid residue is within the "footprint" of the specifically antigen binding peptide). Once a desired epitope is determined (e.g., by epitope mapping), antibodies to that epitope can be generated. The generation and characterization of antibodies may also provide information about desirable epitopes. From this information, it is then possible to screen antibodies for those which bind to the same epitope e.g., by conducting cross-competition studies to find antibodies that competitively bind with one another, i.e., the antibodies compete for binding to the antigen.

[0056] In particular, the term "epitope" includes the specific residues in a protein or peptide, e.g., neuronal pentraxin 1 (NPTX1), which are involved in the binding of an antibody to such protein or peptide as determined by known and accepted methods.

[0057] Methods for determining the epitope of an antigen-binding protein, e.g., antibody or fragment or polypeptide, include alanine scanning mutational analysis, peptide blot analysis (Reineke Methods Mol. Biol.248: 443-63(2004)), peptide cleavage analysis, crystallographic studies and NMR analysis. Epitope mapping is a method known which may be used in determining epitopes (DeLisser, Adhesion Protein Protocols. Methods Mol Biol. Vol.96. pp. 11–20 (1999); Davidson and Doranz, Immunology.143 (1): 13–20 (2014); Westwood and Hay eds., Epitope Mapping: A Practical Approach. Oxford, Oxfordshire: Oxford University Press (2001). In addition, methods such as epitope excision, epitope extraction and chemical modification of antigens can be employed (Tomer Prot. Sci.9: 487-496 (2000)). Another method that can be used to identify the amino acids within a polypeptide with which an antigen- binding protein (e.g., antibody or fragment or polypeptide) interacts is hydrogen / deuterium exchange detected by mass spectrometry. See, e.g., Ehring Analytical Biochemistry 267: 252- 259 (1999); Engen and Smith Anal. Chem.73: 256A-265A (2001). An additional method for determining antibody epitopes is predicting protein epitopes through whole proteomes (Paull et al., PLoS ONE 14(9): e0217668 (2019)). Other methods such as yeast display, phage display (Mendonça, et al., PLOS ONE 11 (8): e0160544 (2016)) and limited proteolysis, provide high-2022-028 throughput monitoring of antibody binding but lack resolution, especially for conformational epitopes (Flanagan, Genetic Engineering & Biotechnology News.31 (10) (May 15, 2011).

[0058] The term “antibody derivative” or “derivative” of an antibody refers to a molecule that is capable of binding to the same antigen (i.e., human NPTX1) that the antibody binds to and comprises an amino acid sequence of the antibody linked to an additional molecular entity. The amino acid sequence of the antibody that is contained in the antibody derivative may be the full- length antibody or may be any portion or portions of a full-length antibody. The additional molecular entity may be a biological or chemical molecule. Examples of additional molecular entities include chemical groups, peptides, proteins (such as enzymes, antibodies), amino acids, and chemical compounds. The additional molecular entity may be for use as a detection agent, marker label, therapeutic or pharmaceutical agent. The amino acid sequence of an antibody may be attached or linked to the additional entity by non-covalent association, chemical coupling, genetic fusion, or otherwise.

[0059] The term “host cell” refers to a cell into which an expression vector has been introduced. The term encompasses not only the particular subject cell but also the progeny of such a cell. Because certain modifications may occur in successive generations due to either environmental influences or mutation, such progeny may not be identical to the parent cell, but are still included within the scope of the term “host cell.”

[0060] The term “mammal” refers to any animal species of the Mammalian class. Examples of mammals include humans; laboratory animals such as rats, mice, simians and guinea pigs; domestic animals such as rabbits, cattle, sheep, goats, cats, dogs, horses, and pigs and the like.

[0061] The term “isolated nucleic acid” refers to a nucleic acid molecule of cDNA, or synthetic origin, or a combination thereof, which is separated from other nucleic acid molecules present in the natural source of the nucleic acid.

[0062] The term “Kd” or “KD” refers to the equilibrium dissociation constant of a particular antibody-antigen interaction and is used to describe the binding affinity between a ligand (such as an antibody) and a protein (such as NPTX1). The smaller the equilibrium dissociation constant, the more tightly bound the ligand is, or the higher the affinity between ligand and protein. A Kd can be measured by surface plasmon resonance, for example using the BIACORE 1 or the Octet system.2022-028

[0063] The term “variant”, as used herein in reference to a reference polypeptide (e.g., antibody, heavy chain, light chain, VH, or VL) refers to polypeptides whose amino acid sequences differ insubstantially from the reference polypeptide. In some embodiments, insubstantial differences include substitutions of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids in a reference polypeptide, preferably, the substitutions do not adversely affect the properties of the reference polypeptide. In some embodiments, variants of a reference polypeptide include polypeptides comprising an amino acid sequence substantially identical to the reference polypeptide. In some embodiments, the sequence identity can be about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher. Percent identity can be determined for example by pairwise alignment using the default settings of the AlignX module of Vector NTI v.9.0.0 (Invitrogen, Carlsbad, Calif.). In some embodiments, the differences between a variant and a reference polypeptide involves one or more conservative amino acid substitutions with an amino acid having similar charge, hydrophobic, or stereo chemical characteristics in the antigen-binding site or in the framework without adversely altering the properties of the antibody. Conservative substitutions may also be made to improve antibody properties, for example stability or affinity. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions can be made to a reference VH or VL sequence. In some embodiments, 1, 2, or 3 substitutions are made to a reference VH or VL of an antibody described herein. Furthermore, any native residue in the polypeptide may also be substituted with alanine, as has been previously described for alanine scanning mutagenesis (MacLennan et al., Act Physiol. Scand. Suppl.643:55-67 (1998); Sasaki et al., Adv. Biopsy's. 35:1-24 (1998)).

[0064] The term “functional variant”, as used herein in reference to a reference polypeptide (e.g., antibody, heavy chain, light chain, VH, or VL) refers to polypeptides whose amino acid sequences differ insubstantially from the reference polypeptide and the polypeptides retain the function of the reference polypeptide. For example, an antibody to NPTX1 disclosed herein inhibits binding to adhesion molecule with Ig like domain 2 (AMIGO2). A functional variant of the NPTX1 antibody polypeptide will have an insubstantially different amino acid sequence from the reference polypeptide, but will function in inhibiting the binding of NPTX1 to AMIGO2.2022-028 Neuronal Pentraxin 1 (NPTX1) Antibodies and Antigen-Binding Fragments

[0065] Disclosed herein are NPTX1 antibodies and antigen-binding fragments that inhibit NPTX1 binding to adhesion molecule with Ig like domain 2 (AMIGO2).

[0066] Neuronal Pentraxin 1 (NPTX1) NCBI Accession Number: NC_000017.11, is a member of the neuronal pentraxin gene family. Human NPTX1 has a nucleotide sequence of SEQ ID NO: 48, a nucleotide coding sequence of SEQ ID NO: 49, and an amino acid sequence of SEQ ID NO:47. NPTX1 as an autocrine extracellular factor produced by PDAC cells that drives hypoxic growth and metastatic colonization. Work in the present disclosure identified AMIGO2 as an extracellular receptor for NPTX1 and found that it mediates the hypoxic growth effect of extracellular NPTX1 and phenocopies the cellular and organismal effects of NPTX1 in PDAC progression by promoting HIF1a nuclear retention. The nuclear localization of HIF1a is a dynamic process where the relatively constant nuclear entry of HIF1a under hypoxia via HIF1a interaction with importin 4 / 7 is counterbalanced by its nuclear export via HIF1a interaction with CRM-1 (Chachami et al., 2009; Mylonis et al., 2008; Mylonis et al., 2006). This HIF1a-CRM-1 interaction occurs in a serine 641 / serine 643-dependent manner (Chachami et al., 2009; Mylonis et al., 2008; Mylonis et al., 2006). The identification of a secreted extracellular factor that acts upstream of HIF1a in PDAC provided the opportunity to test the impact of NPTX1 neutralization via a high-affinity therapeutic antibody candidate on cancer progression.

[0067] The antibodies disclosed herein specifically bind to human NPTX1. By “specifically” it means that the antibodies have a binding affinity to human NPTX1 of at least about 10-9M, 10-10M, 10-11M, or 10-12M; e.g., about 0.075 nM to about 0.2 nM (expressed as KD), as measured by an Octet® HTX biosensor, or by surface plasmon resonance, e.g., BIACORE™, or by solution-affinity ELISA.

[0068] In some embodiments, the antibody binds to the extracellular domain of human NPTX1. In some embodiments, the antibody binds to human NPTX1 with a KDof about 10-9M, 10-10M, 10-11M, or 10-12M; e.g., about 0.075 nM to about 0.2 nM.2022-028 Table 1 Ligand Ka (1 / Ms) Kd (1 / s) KD(M) Relative RMAXChi2(RU2) KD VH0 / VK0 3.83E+05 3.40E-05 8.90E-11 1.00 35 2.70E-01 VH3 / VK6 4.02E+05 3.11E-05 7.75E-11 0.87 35.6 2.82E-01 VH3 / VK7 4.07E+05 2.31E-05 5.69E-11 0.64 41.1 4.04E-01 VH3 / VK8 4.80E+05 2.59E-05 5.40E-11 0.61 39.8 6.02E-01 VH4 / VK6 4.34E+05 3.17E-05 7.30E-11 0.82 43.1 5.32E-01 VH4 / VK7 4.27E+05 4.39E-05 1.03E-10 1.16 36.9 3.94E-01 VH4 / VK8 4.93E+05 3.24E-05 6.59E-11 0.74 44.3 9.01E-01

[0069] In some embodiments, the epitope binding site for the disclosed antibody comprises at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or more of the amino acid residues on the antigen that constitute the epitope binding site as laid out in SEQ ID NOs: 50, 51, 52, and / or 53. In some embodiments, the epitope binding site for the disclosed antibody comprises the amino acid residues on the antigen that constitute the epitope binding site as laid out in SEQ ID NOs: 50, 51, 52, and / or 53.

[0070] In some embodiments, the antibody is an IgG, IgA, IgD, IgE or IgM antibody, such as IgG1, IgG2, IgG3 or IgG4 antibody. In some embodiments the antibody is an IgG1 or an IgG4 antibody.

[0071] The class (e.g., IgG, IgM, IgE, IgA, or IgD) and subclass (e.g., IgG1, IgG2, IgG3, or IgG4) of the NPTX1 antibodies may be determined by any suitable method such as by ELISA or Western Blot as well as other techniques. Alternatively, the class and subclass may be determined by sequencing all or a portion of the constant domains of the heavy and / or light chains of the antibodies, comparing their amino acid sequences to the known amino acid sequences of various class and subclasses of immunoglobulins, and determining the class and subclass of the antibodies. The NPTX1 antibodies can be an IgG, an IgM, an IgE, an IgA, or an IgD molecule. For example, the NPTX1 antibodies can be an IgG that is an IgG1, IgG2, IgG3, or an IgG4 subclass. Thus, another embodiment of the disclosure provides a method for converting the class or subclass of an NPTX1 antibody to another class or subclass.2022-028

[0072] In some embodiments, the NPTX1antibody is of the IgG4 isotype.

[0073] In some embodiments, the NPTX1 molecule is an antibody or antigen binding fragment wherein the antibody or antigen binding fragment thereof binds to the extracellular domain of a human NPTX1 protein, wherein binding of the human NPTX1 protein by the antibody or antigen binding fragment thereof binds to the same epitope on the extracellular domain of the human NPTX1 protein as a reference antibody or antigen-binding fragment thereof, or competes for binding to the extracellular domain of the human NPTX1 protein with the reference antibody or antigen-binding fragment thereof.

[0074] In some embodiments, the reference antibody or antigen-binding fragment thereof comprises a heavy chain variable domain comprising a complementarity determining region (CDR)1-H comprising the amino acid sequence RYWMS (SEQ ID NO: 33) or a variant thereof, a CDR2-H comprising the amino acid sequence EINPDGSTINYTPSLKD (SEQ ID NO: 34) or a variant thereof, and a CDR3-H comprising the amino acid sequence GPYPYAMDY (SEQ ID NO: 35) or a variant thereof. In some embodiments, the reference antibody or antigen-binding fragment thereof comprises a light chain variable domain comprising a CDR1-L comprising the amino acid sequence KASQSVTNDVA (SEQ ID NO: 36) or a variant thereof; a CDR2-L comprising the amino acid sequence SASNRFT (SEQ ID NO: 37) or a variant thereof; and a CDR3-L comprising the amino acid sequence QQDYISPFT (SEQ ID NO: 40) or a variant thereof. In some embodiments, the reference antibody or antigen-binding fragment thereof comprises a light chain variable domain comprising a CDR1-L comprising the amino acid sequence KASQSVTNDVA (SEQ ID NO: 36) or a variant thereof; a CDR2-L comprising the amino acid sequence GASNRFT (SEQ ID NO: 38) or a variant thereof; and a CDR3-L comprising the amino acid sequence QQDYISPFT (SEQ ID NO: 40) or a variant thereof. In some embodiments, the reference antibody or antigen-binding fragment thereof comprises a light chain variable domain CDR1-L comprising the amino acid sequence KASQSVTNDVA (SEQ ID NO: 36) or a variant thereof; a CDR2-L comprising the amino acid sequence DASNRFT (SEQ ID NO: 39) or a variant thereof; and a CDR3-L comprising the amino acid sequence QQDYISPFT (SEQ ID NO: 40) or a variant thereof.

[0075] In some embodiments of the disclosure, variants of the NPTX1 antigen-binding proteins, e.g., antibodies and antigen-binding fragments thereof of the present disclosure, include a heavy2022-028 chain immunoglobulin or variable region thereof having at least 80% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) amino acid sequence identity to the amino acids set forth in SEQ ID NOs: 1, 3, or 46; and / or a light chain immunoglobulin or variable region thereof having at least 80% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) amino acid sequence identity to the amino acids set forth in SEQ ID NOs: 2, 4, or 44.

[0076] The present disclosure includes antigen-binding proteins that compete for binding to human NPTX1, with an antibody specifically disclosed herein or an antigen-binding fragment thereof. The term “competes” as used herein, refers to antibody or antigen-binding fragment thereof that binds to an antigen (e.g., human NPTX1) and inhibits or blocks the binding of another antibody or antigen-binding fragment thereof to the antigen. The term also includes competition between two antigen-binding proteins e.g., antibodies, in both orientations, i.e., a first antibody that binds and blocks binding of second antibody and vice versa. In some embodiments, the first antibody and second antibody may bind to the same epitope. Alternatively, the first and second antibodies may bind to epitopes that are not identical but overlap, wherein binding of one inhibits or blocks the binding of the second antibody, e.g., via steric hindrance. Competition between antibodies may be measured by methods known in the art through competitive binding assays.

[0077] In some embodiments, a variant of an antibody or antigen-binding fragment retains the ability to specifically bind to human NPTX1 of the antibody or antigen-binding fragment, e.g., retains at least 50% of its NPTX1 binding activity. In some embodiments, a variant of an antibody or antigen-binding fragment possesses at least 70%, 80%, 90%, 95% or 100% or more of the human NPTX1binding affinity as the antibody antigen-binding fragment. Variants of an antibody or antigen-binding fragment of the disclosure may include conservative or non- conservative amino acid substitutions (referred to as “conservative variants” or “function conserved variants” of the antibody) that do not substantially alter its biologic activity.

[0078] A “variant” of an immunoglobulin chain, e.g., VH, VL, HC or LC, refers to a polypeptide comprising an amino acid sequence that is at least about 70-99.9% (e.g., 70, 72, 74, 75, 76, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.5, 99.9%) identical or similar to a referenced amino acid sequence that is set forth herein (e.g., any of SEQ ID NOs:2022-028 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 42, 44, or 46); when the comparison is performed by a BLAST algorithm wherein the parameters of the algorithm are selected to give the largest match between the respective sequences over the entire length of the respective reference sequences (e.g., expect threshold: 10; word size: 3; max matches in a query range: 0; BLOSUM 62 matrix; gap costs: existence 11, extension 1; conditional compositional score matrix adjustment).

[0079] A “variant” of a polynucleotide refers to a polynucleotide comprising a nucleotide sequence that is at least about 70-99.9% (e.g., 70, 72, 74, 75, 76, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.5, 99.9%) identical to a referenced nucleotide sequence that is set forth herein (e.g., any of SEQ ID NOs: 41, 43, and / or 45); when the comparison is performed by a BLAST algorithm wherein the parameters of the algorithm are selected to give the largest match between the respective sequences over the entire length of the respective reference sequences (e.g., expect threshold: 10; word size: 28; max matches in a query range: 0; match / mismatch scores: 1, −2; gap costs: linear).

[0080] The following references relate to BLAST algorithms often used for sequence analysis: BLAST ALGORITHMS: Altschul et al. FEBS J.272(20): 5101-5109 (2005); Altschul, S. F., et al., J. Mol. Biol.215:403-410 (1990); Gish, W., et al., Nature Genet.3:266-272 (1993); Madden, T. L., et al., Meth. Enzymol.266:131-141 (1996); Altschul, S. F., et al., Nucleic Acids Res. 25:3389-3402 (1997); Zhang, J., et al., Genome Res.7:649-656 (1997); Wootton et al., Comput. Chem.17:149-163 (1993); Hancock et al., Comput. Appl. Biosci.10:67-70 (1994); ALIGNMENT SCORING SYSTEMS: Dayhoff, et al., “A model of evolutionary change in proteins.” in Atlas of Protein Sequence and Structure, vol.5, suppl.3. M. O. Dayhoff (ed.), pp. 345-352, Natl. Biomed. Res. Found., Washington, D.C. (1978); Schwartz, et al., “Matrices for detecting distant relationships.” in Atlas of Protein Sequence and Structure, vol.5, suppl.3.” M. O. Dayhoff (ed.), pp.353-358, Natl. Biomed. Res. Found., Washington, D.C. (1978); Altschul, J. Mol. Biol.219:555-565 (1991); States, et al., Methods 3:66-70 (1991); Henikoff, et al., Proc. Natl. Acad. Sci. USA 89:10915-10919 (1992); Altschul, et al., J. Mol. Evol.36:290-300 (1993); ALIGNMENT STATISTICS: Karlin, et al., Proc. Natl. Acad. Sci. USA 87:2264-2268 (1990); Karlin, et al., Proc. Natl. Acad. Sci. USA 90:5873-5877 (1993); Dembo, A., et al., Ann. Prob. 22:2022-2039 (1994); and Altschul, “Evaluating the statistical significance of multiple distinct2022-028 local alignments.” in Theoretical and Computational Methods in Genome Research (S. Suhai, ed.), pp.1-14, Plenum, N.Y. (1997).

[0081] In addition, an NPTX1 antibody may include a polypeptide comprising an amino acid sequence that is set forth herein except for one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) mutations such as, for example, missense mutations (e.g., conservative substitutions), non-sense mutations, deletions, or insertions. For example, the present disclosure includes NPTX1 antigen- binding proteins which include an immunoglobulin light chain (or VL) variant comprising the amino acid sequence set forth in SEQ ID NOs: 2, 4, 10, 11, 12, 13, 14, 15, 16, 17, 18, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 44 but having one or more of such mutations and / or an immunoglobulin heavy chain (or VH) variant comprising the amino acid sequence set forth in SEQ ID NOs: 1, 2, 5, 6, 7, 8, 9, 19, 20, 21, 22, 23, or 46 but having one or more of such mutations. In an embodiment of the disclosure, an NPTX1 antigen-binding protein includes an immunoglobulin light chain variant comprising CDR-L1, CDR-L2 and CDR-L3 wherein one or more (e.g., 1 or 2 or 3) of such CDRs has one or more of such mutations (e.g., conservative substitutions) and / or an immunoglobulin heavy chain variant comprising CDR-H1, CDR-H2 and CDR-H3 wherein one or more (e.g., 1 or 2 or 3) of such CDRs has one or more of such mutations (e.g., conservative substitutions).

[0082] The phrase that an antibody binds "substantially" the same epitope as a reference antibody means that the epitope binding site for the antibody comprises at least 50%, 60%, 70%, 80%, 90%, or more of the amino acid residues on the antigen that constitute the epitope binding site of the reference antibody. An antibody that binds the same epitope as a reference antibody means that the epitope binding site for the antibody comprises the same amino acid residues on the antigen that constitute the epitope binding site of the reference antibody. An antibody binds the same or substantially the same epitope as a reference antibody competes in binding to the antigen. In some embodiments, the epitope binding site for the disclosed antibody comprises at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or more of the amino acid residues on the antigen that constitute the epitope binding site as laid out in SEQ ID NOs: 50, 51, 52, and / or 53. In some embodiments, the epitope binding site for the disclosed antibody comprises the amino acid residues on the antigen that constitute the epitope binding site as laid out in SEQ ID NOs: 50, 51, 52, and / or 53.2022-028

[0083] The identification of one or more antibodies that bind(s) to substantially the same epitope as the monoclonal antibodies described herein can be readily determined using alanine scanning. Additionally, any one of variety of immunological screening assays in which antibody competition can be assessed. A number of such assays are routinely practiced and well known in the art (see, e.g., U.S. Patent No.5,660,827, issued Aug.26, 1997, which is specifically incorporated herein by reference). It will be understood that actually determining the epitope to which an antibody described herein binds is not in any way required to identify an antibody that binds to the same or substantially the same epitope as the monoclonal antibody described herein.

[0084] Embodiments of the present disclosure also include antigen-binding proteins, e.g., NPTX1 antibodies and antigen-binding fragments thereof, that comprise immunoglobulin VHS and VLS; or HCs and LCs, which comprise a variant amino acid sequence having 80% or more (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) overall amino acid sequence identity or similarity to the amino acid sequences of the corresponding VHS, VLS, HCs or LCs specifically set forth herein, but wherein the CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2 and CDR-H3 of such immunoglobulins are not variants and comprise the amino acid sequences specifically set forth herein. Thus, in such embodiments, the CDRs within variant antigen-binding proteins are not, themselves, variants.

[0085] A “conservatively modified variant” or a “conservative substitution”, e.g., of an immunoglobulin chain set forth herein, refers to a variant wherein there is one or more substitutions of amino acids in a polypeptide with other amino acids having similar characteristics (e.g. charge, side-chain size, hydrophobicity / hydrophilicity, backbone conformation and rigidity, etc.). Such changes can frequently be made without significantly disrupting the biological activity of the antibody or fragment. Those of skill in the art recognize that, in general, single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter biological activity (see, e.g., Watson et al. Molecular Biology of the Gene, The Benjamin / Cummings Pub. Co., p.224 (4th Ed.) (1987)). In addition, substitutions of structurally or functionally similar amino acids are less likely to significantly disrupt biological activity. The present disclosure includes NPTX1 antigen-binding proteins comprising such conservatively modified variant immunoglobulin chains.2022-028

[0086] Examples of groups of amino acids that have side chains with similar chemical properties include 1) aliphatic side chains: glycine, alanine, valine, leucine and isoleucine; 2) aliphatic- hydroxyl side chains: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartate and glutamate, and 7) sulfur- containing side chains: cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamate-aspartate, and asparagine-glutamine. Alternatively, a conservative replacement is any change having a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al. Science 256: 144345 (1992).

[0087] A competitive binding assay can be used to measure the binding of a labeled ligand to a target protein in the presence of a second, competing but unlabeled ligand. Such an assay can be used to assess qualitative binding information as well as relative affinities for two or binding molecules for one target. Such competition assays are known in the art. In some embodiments, the antibodies or antigen binding fragments thereof inhibit coronavirus in substantially the same effectiveness as a reference antibody. Inhibition of coronavirus can be measured as described in this disclosure and in the art. Multispecific antibodies

[0088] Multispecific antibodies are monoclonal antibodies that have binding specificities for at least two different sites (i.e., different antigenic epitopes). In some embodiments, bispecific antibodies may bind to two different epitopes of human NPTX1.

[0089] In some embodiments, the antibodies or antigen-binding fragments disclosed herein are bispecific antibodies that comprise a first variable domain and a second variable domain, wherein the first and second variable domains are different and are selected from the group consisting of a heavy chain variable domain comprising a complementarity determining region (CDR)1-H comprising the amino acid sequence RYWMS (SEQ ID NO: 33) or a variant thereof, a CDR2-H comprising the amino acid sequence EINPDGSTINYTPSLKD (SEQ ID NO: 34) or a variant thereof, and a CDR3-H comprising the amino acid sequence GPYPYAMDY (SEQ ID NO: 35) or a variant thereof. In some embodiments, the reference antibody or antigen-binding2022-028 fragment thereof comprises a light chain variable domain comprising a CDR1-L comprising the amino acid sequence KASQSVTNDVA (SEQ ID NO: 36) or a variant thereof; a CDR2-L comprising the amino acid sequence SASNRFT (SEQ ID NO: 37) or a variant thereof; and a CDR3-L comprising the amino acid sequence QQDYISPFT (SEQ ID NO: 40) or a variant thereof. In some embodiments, the reference antibody or antigen-binding fragment thereof comprises a light chain variable domain comprising a CDR1-L comprising the amino acid sequence KASQSVTNDVA (SEQ ID NO: 36) or a variant thereof; a CDR2-L comprising the amino acid sequence GASNRFT (SEQ ID NO: 38) or a variant thereof; and a CDR3-L comprising the amino acid sequence QQDYISPFT (SEQ ID NO: 40) or a variant thereof. In some embodiments, the reference antibody or antigen-binding fragment thereof comprises a light chain variable domain CDR1-L comprising the amino acid sequence KASQSVTNDVA (SEQ ID NO: 36) or a variant thereof; a CDR2-L comprising the amino acid sequence DASNRFT (SEQ ID NO: 39) or a variant thereof; and a CDR3-L comprising the amino acid sequence QQDYISPFT (SEQ ID NO: 40) or a variant thereof.. VH / VL pairing

[0090] In accordance with the present disclosure, the VH CDR1, CDR2, and CDR3 sequences and VL CDR1, CDR2, and CDR3 sequences can be “mixed and matched”. For example, CDRs from different NPTX1 antibodies originally identified can be mixed and matched. The binding of such “mixed and matched” antibodies to NPTX1 can be tested using the binding assays described in the Examples (e.g., ELISAs, Biacore analysis). In some embodiments, when VH CDR sequences are mixed and matched, the CDR1, CDR2 and / or CDR3 sequence from a particular VH sequence is replaced with structurally similar CDR sequence(s). Likewise, when VL CDR sequences are mixed and matched, the CDR1, CDR2 and / or CDR3 sequence from a particular VL sequence typically is replaced with a structurally similar CDR sequence(s). Compositions and Methods for Making the Antibodies

[0091] The disclosure further provides a nucleic acid molecule encoding an antibody disclosed herein. Further provided is a nucleic acid molecule encoding a heavy chain variable region, a2022-028 heavy chain, a light chain variable region, or a light chain of a humanized antibody of the disclosure.

[0092] One aspect of the disclosure provides an isolated nucleic acid encoding an immunoglobulin chain or variable region thereof of the NPTX1 antibody according to the disclosure. The disclosure also includes an isolated nucleic acid that encodes an NPTX1antibody polypeptide, fragment, homolog, analog, or derivative thereof. In some embodiments, the nucleic acid molecule comprises the nucleotide sequence of a naturally occurring allelic nucleic acid variant. In another embodiment, the nucleic acid encodes a variant polypeptide, wherein the variant polypeptide has the polypeptide sequence of a naturally occurring polypeptide variant. In some embodiments, the nucleic acid molecule differs by a single nucleotide from a nucleotide that encodes an NPTX1antibody polypeptide, fragment, homolog, analog, or derivative thereof. In some embodiments, the nucleic acid molecule differs by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from a nucleic acid sequence that encodes an NPTX1antibody polypeptide, fragment, homolog, analog, or derivative thereof. In some embodiments, an isolated nucleic acid molecule of the disclosure comprises a nucleic acid molecule that is a complement of the nucleotide sequence shown in SEQ ID NOS: 43 or 45. Some embodiments of the disclosure provide a vector comprising an isolated nucleic acid that encodes an NPTX1 antibody, fragment, homolog, analog, or derivative thereof.

[0093] Other embodiments of the disclosure provide a host cell comprising an isolated nucleic acid that encodes an NPTX1 antibody, fragment, homolog, analog, or derivative thereof. Some embodiments of the disclosure provide a host cell comprising a vector comprising an isolated nucleic acid that encodes an NPTX1 antibody, fragment, homolog, analog, or derivative thereof.

[0094] Eukaryotic and prokaryotic host cells, including mammalian cells, may be used as hosts for expression of an NPTX1 antigen-binding protein (e.g., antibody or antigen-binding fragment thereof). Such host cells are well known in the art and many are available from the American Type Culture Collection (ATCC). These host cells include, inter alia, Chinese hamster ovary (CHO) cells, NSO, SP2 cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), A549 cells, 3T3 cells, Expi 293 cells, HEK-293 cells, other transient 293 expression systems known in the art, and a number of other cell lines. Mammalian host cells include human, mouse, rat, dog, monkey, pig, goat,2022-028 bovine, horse and hamster cells. Other cell lines that may be used are insect cell lines (e.g., Spodoptera frugiperda or Trichoplusia ni), amphibian cells, bacterial cells, plant cells and fungal cells. Fungal cells include yeast and filamentous fungus cells including, for example, Pichia, Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta (Ogataea minuta, Pichia lindnen), Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula polymorpha, Kluyveromyces sp., Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Trichoderma reesei, Chrysosporium lucknowense, Fusarium sp., Fusarium gramineum, Fusarium venenatum, Physcomitrella patens and Neurospora crassa. The present disclosure includes an isolated host cell (e.g., a CHO cell or any type of host cell set forth above) comprising an antigen-binding protein, such as VH0 / VH0, VK3 / VK6, VH3 / VK7, VH3 / VK8, VH4 / VH6, VH4 / VK7, and VH4 / VK8 or an antigen-binding fragment thereof; and / or a polynucleotide encoding one or more immunoglobulin chains thereof.

[0095] Some embodiments of the disclosure are directed to methods by which to produce NPTX1 antigen-binding proteins, such as an antibody or antigen-binding fragment thereof, and such methods are known in the art. One example of a method for recombinant production of antibodies is disclosed in U.S. Pat. No.4,816,567.

[0096] Some embodiments of the disclosure include introducing polynucleotides into a host cell. Methods for introduction of heterologous polynucleotides into mammalian cells are well known in the art and include dextran-mediated transfection, calcium phosphate precipitation, polybrene- mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide(s) in liposomes, biolistic injection and direct microinjection of the DNA into nuclei. Additionally, nucleic acid molecules may be introduced into mammalian cells through the use of viral vectors. Methods of transforming cells are well known in the art. See, for example, U.S. Pat. Nos. 4,399,216; 4,912,040; 4,740,461 and 4,959,455. The present disclosure includes recombinant methods for making an NPTX1 antigen-binding protein, such as an antibody or antigen-binding fragment thereof of the present disclosure, or an immunoglobulin chain thereof, comprising (i) introducing one or more nucleic acids encoding an immunoglobulin chain of antibody or antigen-binding fragment thereof (e.g., including the nucleotide sequence in any one or more of2022-028 SEQ ID NOS: 41, 43, and 45; or a variant thereof) encoding light and / or heavy immunoglobulin chains of the antigen-binding protein, e.g., VH0 / VH0, VK3 / VK6, VH3 / VK7, VH3 / VK8, VH4 / VH6, VH4 / VK7, and VH4 / VK8. For example, wherein the polynucleotide is in a vector, and / or integrated into a host cell chromosome and / or is operably linked to a promoter (ii) culturing the host cell (e.g., CHO or Pichia or Pichia pastoris) in a medium under conditions favorable to express the immunoglobulin chain(s) and, (iii) optionally, isolating the immunoglobulin chain or antibody or antigen-binding fragment thereof from the host cell and / or medium in which the host cell is grown. When making an antigen-binding protein (e.g., antibody or antigen-binding fragment) comprising more than one immunoglobulin chain, e.g., an antibody that comprises two heavy immunoglobulin chains and two light immunoglobulin chains, co-expression of the chains in a single host cell leads to association of the chains, e.g., in the cell or on the cell surface or outside the cell if such chains are secreted, so as to form the antigen-binding protein (e.g., antibody or antigen-binding fragment). The methods of the present disclosure include those wherein only a heavy immunoglobulin chain or only a light immunoglobulin chain or both (e.g., any of those discussed herein including mature fragments and / or variable domains thereof) are expressed in a cell. Such single chains can be useful, for example, as intermediates when expressing an antibody or antigen-binding fragment including that chain.

[0097] For example, the present disclosure also includes NPTX1 antigen-binding proteins, such as antibodies and antigen-binding fragments thereof, comprising a heavy chain immunoglobulin (or variable domain thereof or comprising the CDRs thereof) encoded by a polynucleotide comprising the nucleotide sequences set forth in SEQ ID NO: 41 and / or 45; and a light chain immunoglobulin (or variable domain thereof or comprising the CDRs thereof) encoded by the nucleotide sequence set forth in SEQ ID NOS: 41 and / or 43 which are the product of such production methods, and, optionally, the purification methods set forth herein. For example, in an embodiment of the disclosure, the product of the method is an NPTX1 antigen-binding protein which is an antibody or fragment comprising a heavy chain immunoglobulin or VHcomprising the amino acid sequence set forth in SEQ ID NO: 1, 3, 5, 6, 7, 8, 9, 19, 20, 21, 22, 23, 42, or 46; and a light chain immunoglobulin or VLcomprising the amino acid sequence set2022-028 forth in SEQ ID NOS: 2, 4, 10, 11, 12, 13, 14, 15, 16, 17, 18, 24, 25, 26, 27, 28, 29, 30, 31, 32, 42, or 44.

[0098] One embodiment of the disclosure is a method for making an NPTX1 antigen-binding protein, e.g., antibody or antigen-binding fragment thereof, includes a method of purifying the antigen-binding protein, e.g., by column chromatography, precipitation and / or filtration. The current disclosure also includes the product of such a method. Methods of Detecting Pancreatic Ductal Adenocarcinoma

[0099] One aspect of the disclosure is a method of detecting pancreatic ductal adenocarcinoma (PDAC) in a subject, the method comprising: (1) contacting a biological sample from the subject with the antibody or antigen-binding fragment thereof as described herein; and (2) comparing the level of the antibody or antigen-binding fragment with a baseline level of the antibody or antigen-binding fragment of a control sample, wherein a difference between the level of the pancreatic cancer biomarker derived from the subject and the pancreatic cancer biomarker in the control sample is an indication that the subject is afflicted with pancreatic cancer.

[0100] As used herein, “biological sample” is used in its broadest sense. A biological sample is any biological sample suspected of containing NPTX1 polynucleotides or polypeptides or fragments thereof. The biological sample may comprise a cell, chromosomes isolated from a cell (e.g., a spread of metaphase chromosomes), genomic DNA (in solution or bound to a solid support such as for Southern analysis), RNA (in solution or bound to a solid support such as for northern analysis), cDNA (in solution or bound to a solid support), an extract from cells, blood, urine, marrow, or a tissue, and the like. In some embodiments, the biological sample is a blood sample or blood fraction (e.g., serum, plasma, platelets, red blood cells, white blood cells). In some embodiments, the biological sample is a tissue sample (biopsy), e.g., from a suspected tumor site, or from a tissue that is known to be affected, e.g., to determine the boundaries of a known tumor. In some embodiments, the biological sample is obtained to determine metastasis of a cancer. In some embodiments, the biological sample is obtained from a site of inflammation. Biopsies are typically performed to obtain samples from tissues, i.e., non-fluid2022-028 cell types. The biopsy technique applied will depend on the tissue type to be evaluated (e.g., breast, skin, colon, prostate, kidney, lung, bladder, lymph node, liver, bone marrow, airway or lung). In the case of a cancer, the technique will also depend on the size and type of the tumor (e.g., solid, suspended, or blood), among other factors. Biopsy techniques are discussed, for example, in Harrison's Principles of Internal Medicine, Kasper, et al., eds., 16th ed., 2005, Chapter 70, and throughout Part V.

[0101] In some embodiments, the NPTX1 antibodies of the disclosure are used to detect NPTX1 as a biomarker for cancer. In some embodiments, the cancer is either pancreatic ductal adenocarcinoma (PDAC) or metastasized PDAC. In some embodiments, the epitope binding site of the biomarker for the disclosed antibody comprises at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or more of the amino acid residues on the antigen that constitute the epitope binding site as laid out in SEQ ID NOs: 50, 51, 52, and / or 53. In some embodiments, the epitope binding site of the biomarker for the disclosed antibody comprises the amino acid residues on the antigen that constitute the epitope binding site as laid out in SEQ ID NOs: 50, 51, 52, and / or 53.

[0102] In some embodiments, the NPTX1 antibodies of the disclosure are used to contact a biological sample from a subject having or suspected of having cancer. In some embodiments, NPTX1 antibody binding to a cell in the sample is determined when higher or lower than normal antibody binding indicates that the individual has cancer.

[0103] In some embodiments, the NPTX1 antibody, such as VH0 / VH0, VK3 / VK6, VH3 / VK7, VH3 / VK8, VH4 / VH6, VH4 / VK7, and VH4 / VK8 or an antigen-binding fragment thereof; and / or a polynucleotide encoding one or more immunoglobulin chains thereof. In some embodiments, the antibody is an NPTX1 antigen-binding protein which is an antibody or fragment comprising a heavy chain immunoglobulin or VHcomprising the amino acid sequence set forth in SEQ ID NO: 1, 3, 5, 6, 7, 8, 9, 19, 20, 21, 22, 23, 42, or 46; and a light chain immunoglobulin or VLcomprising the amino acid sequence set forth in SEQ ID NOS: 2, 4, 10, 11, 12, 13, 14, 15, 16, 17, 18, 24, 25, 26, 27, 28, 29, 30, 31, 32, 42, or 44. In some embodiments, the NPTX1 antibody In some embodiments, the NPTX1 antibody or antigen-binding fragment thereof comprises a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 55; and a light chain variable domain2022-028 comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 54. In some embodiments, the NPTX1 antibody or antigen binding fragment thereof comprises a heavy chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 55; and a light chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 54. In some embodiments, the NPTX1 antibody or antigen-binding fragment thereof comprises a heavy chain variable domain comprising a complementarity determining region (CDR)1-H comprising the amino acid sequence RYWMS (SEQ ID NO: 33) or a variant thereof, a CDR2-H comprising the amino acid sequence EINPDGSTINYTPSLKD (SEQ ID NO: 34) or a variant thereof, and a CDR3-H comprising the amino acid sequence GPYPYAMDY (SEQ ID NO: 35) or a variant thereof. In some embodiments, the NPTX1 antibody or antigen-binding fragment thereof comprises a light chain variable domain comprising a CDR1-L comprising the amino acid sequence KASQSVTNDVA (SEQ ID NO: 36) or a variant thereof; a CDR2-L comprising the amino acid sequence SASNRFT (SEQ ID NO: 37) or a variant thereof; and a CDR3-L comprising the amino acid sequence QQDYISPFT (SEQ ID NO: 40) or a variant thereof. In some embodiments, the NPTX1 antibody or antigen-binding fragment thereof comprises a light chain variable domain comprising a CDR1-L comprising the amino acid sequence KASQSVTNDVA (SEQ ID NO: 36) or a variant thereof; a CDR2-L comprising the amino acid sequence GASNRFT (SEQ ID NO: 38) or a variant thereof; and a CDR3-L comprising the amino acid sequence QQDYISPFT (SEQ ID NO: 40) or a variant thereof. In some embodiments, the NPTX1 antibody or antigen-binding fragment thereof comprises a light chain variable domain CDR1-L comprising the amino acid sequence KASQSVTNDVA (SEQ ID NO: 36) or a variant thereof; a CDR2-L comprising the amino acid sequence DASNRFT (SEQ ID NO: 39) or a variant thereof; and a CDR3-L comprising the amino acid sequence QQDYISPFT (SEQ ID NO: 40) or a variant thereof.

[0104] In some embodiments, the NPTX1 antibodies of the disclosure comprise markers, labels, or tags to aid in detection or isolation / purification of an NPTX1 epitope. In some embodiments, the antibodies are conjugated to the label. Conjugation methods are known in the art and include, but are not limited to, (succinimidyl) ester method, carbodiimide method, periodate method, isothiocyanate method, and two-tag method. Non-limiting examples of labels include fluorescent dyes, hapten molecules (such as biotin), and enzyme tags. In some embodiments, the2022-028 labeled antibodies are used immuno-based assays, for example, Western blots, ELISAs, flow cytometry, immunohistochemistry (IHC), and immunofluorescence (IF).

[0105] Any method of detecting antibody binding to a cell in a sample can be used for the present diagnostic assays. Methods of detecting antibody binding are well known in the art, e.g., flow cytometry, fluorescent microscopy, ELISAs, histology etc. In some embodiments, the method comprises preparing the biological sample for detection prior to the determining step. For example, a subpopulation of cells (e.g., white blood cells) can be separated from the rest of the sample from the individual (e.g., other blood components) or cells in a tissue can be suspended for easier detection. In some embodiments, the sample is fixed before being contacted with the disclosed antibodies, i.e. the sample is sectioned, and the sections are formalin-fixed and paraffin-embedded. Methods of fixation are known in the art, for example, heat fixation, perfusion fixation, and immersion fixation.

[0106] In some embodiments, the percentage of NPTX1 expressing cells in the sample is determined and compared to a control, e.g., a sample from an individual or group of individuals that are known to have cancer (positive control) or from an individual or group of individuals that are known not to have cancer (normal, non-disease, or negative control). In some embodiments, the control is a standard range NPTX1 expression established for a given tissue. A higher or lower than normal percentage of NPTX1 expressing cells, or higher or lower expression level, indicates that the individual has cancer. In some embodiments, the difference between the level of NPTX1 detected in the biological sample and the level of NPTX1 of the normal / negative control is used to make a diagnostic determination. In some embodiments, this diagnostic determination is made when the sample shows at least a 10% higher level of NPTX1 detection over the level of NPTX1 in the normal / negative control. In some embodiments, this diagnostic determination is made when the sample shows at least a 20% higher level of NPTX1 detection over the level of NPTX1 in the normal / negative control. In some embodiments, this diagnostic determination is made when the sample shows at least a 30% higher level of NPTX1 detection over the level of NPTX1 in the normal / negative control. In some embodiments, this diagnostic determination is made when the sample shows at least a 40% higher level of NPTX1 detection over the level of NPTX1 in the normal / negative control. In some embodiments, this diagnostic determination is made when the sample shows at least a 50% higher level of NPTX12022-028 detection over the level of NPTX1 in the normal / negative control. In some embodiments, this diagnostic determination is made when the sample shows at least a 60% higher level of NPTX1 detection over the level of NPTX1 in the normal / negative control. In some embodiments, this diagnostic determination is made when the sample shows at least a 70% higher level of NPTX1 detection over the level of NPTX1 in the normal / negative control. In some embodiments, this diagnostic determination is made when the sample shows at least a 75% higher level of NPTX1 detection over the level of NPTX1 in the normal / negative control. In some embodiments, this diagnostic determination is made when the sample shows at least a 80% higher level of NPTX1 detection over the level of NPTX1 in the normal / negative control. In some embodiments, this diagnostic determination is made when the sample shows at least a 85% higher level of NPTX1 detection over the level of NPTX1 in the normal / negative control. In some embodiments, this diagnostic determination is made when the sample shows at least a 90% higher level of NPTX1 detection over the level of NPTX1 in the normal / negative control. In some embodiments, this diagnostic determination is made when the sample shows at least a 95% higher level of NPTX1 detection over the level of NPTX1 in the normal / negative control.

[0107] In some embodiments, the disclosure is directed to a combination or mixture comprising a biological sample and an NPTX1 antibody or antigen binding fragment thereof as disclosed herein. Pharmaceutical Compositions and Therapeutic Methods

[0108] This disclosure further provides a pharmaceutical composition or formulation comprising an antibody or antigen-binding fragment thereof disclosed herein and a pharmaceutically acceptable carrier.

[0109] The term “pharmaceutical formulation” refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered.

[0110] A “pharmaceutically acceptable carrier” refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject. A pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.2022-028

[0111] To prepare pharmaceutical compositions of the NPTX1 antigen-binding proteins, e.g., antibodies and antigen-binding fragments thereof (e.g., VH0 / VH0, VK3 / VK6, VH3 / VK7, VH3 / VK8, VH4 / VH6, VH4 / VK7, and VH4 / VK8), antigen-binding protein is admixed with a pharmaceutically acceptable carrier or excipient. See, e.g., Remington's Pharmaceutical Sciences and U.S. Pharmacopeia: National Formulary, Mack Publishing Company, Easton, Pa. (1984); Hardman, et al. (2001) Goodman and Gilman's The Pharmacological Basis of Therapeutics, McGraw-Hill, New York, N.Y.; Gennaro (2000) Remington: The Science and Practice of Pharmacy, Lippincott, Williams, and Wilkins, New York, N.Y.; Avis, et al. (eds.) (1993) Pharmaceutical Dosage Forms: Parenteral Medications, Marcel Dekker, NY; Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage Forms: Tablets, Marcel Dekker, NY: Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage Forms: Disperse Systems, Marcel Dekker, NY; Weiner and Kotkoskie (2000) Excipient Toxicity and Safety, Marcel Dekker, Inc., New York, N.Y. In an embodiment of the disclosure, the pharmaceutical composition is sterile. Such compositions are part of the present disclosure.

[0112] Pharmaceutical compositions of the present disclosure include pharmaceutically acceptable carriers, diluents, excipients and / or stabilizers, such as, for example, water, buffering agents, stabilizing agents, preservatives, isotonifiers, non-ionic detergents, antioxidants and / or other miscellaneous additives.

[0113] The scope of the present disclosure includes desiccated, e.g., freeze-dried, compositions comprising an NPTX1 antigen-binding protein, e.g., antibody or antigen-binding fragment thereof (e.g. VH0 / VH0, VK3 / VK6, VH3 / VK7, VH3 / VK8, VH4 / VH6, VH4 / VK7, and VH4 / VK8), or a pharmaceutical composition thereof that includes a pharmaceutically acceptable carrier but substantially lacks water.

[0114] This disclosure additionally provides a method for treating or preventing infection caused by coronavirus in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an antibody or antigen-binding fragment thereof disclosed herein.

[0115] As used herein, “treatment” (and grammatical variations thereof such as “treat” or “treating”) refers to clinical intervention in an attempt to alter the natural course of the individual being treated, and can be performed either for prophylaxis or during the course of clinical2022-028 pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. In some embodiments, antibodies of the disclosure are used to delay development of a disease or to slow the progression of a disease. For example, by “treating a pancreatic ductal adenocarcinoma” (PDAC), it means that one or more signs and / or symptoms and / or clinical indicia of PDAC regresses or is eliminated and / or the progression thereof is inhibited (e.g., the disease in the subject is stabilized, reduced, or eliminated).

[0116] In some embodiments, the present disclosure provides methods for treating or preventing PDAC by administering a therapeutically effective amount of NPTX1 antigen-binding protein, e.g., antibody or antigen-binding fragment, (e.g., VH0 / VH0, VK3 / VK6, VH3 / VK7, VH3 / VK8, VH4 / VH6, VH4 / VK7, and VH4 / VK8) to a subject (e.g., a human) in need of such treatment or prevention.

[0117] An effective or therapeutically effective dose of NPTX1 antigen-binding protein, e.g., antibody or antigen-binding fragment (e.g., VH0 / VH0, VK3 / VK6, VH3 / VK7, VH3 / VK8, VH4 / VH6, VH4 / VK7, and VH4 / VK8), for treating or preventing PDAC disease and metastasis refers to the amount of the antibody or fragment sufficient to alleviate one or more of the clinical indicia, signs and / or symptoms of the disease in the treated subject, whether by inducing the regression or elimination of such indicia, signs and / or symptoms or by inhibiting the progression of such indicia, signs and / or symptoms. The dose amount may vary depending upon the age and the size of a subject to be administered, target disease, conditions, route of administration, and the like. In an embodiment of the disclosure, an effective or therapeutically effective dose of antibody or antigen-binding fragment thereof of the present disclosure, for treating or preventing metastasis of PDAC, e.g., in an adult human subject, is about 1 mg / kg or more, e.g., about 1 mg / kg to about 25 mg / kg. Depending on the severity of the disease, the frequency and the duration of the treatment can be adjusted. In certain embodiments, the antigen-binding protein of the present disclosure can be administered at an initial dose, followed by one or more secondary doses. In certain embodiments, the initial dose may be followed by administration of a second or a plurality of subsequent doses of antigen-binding protein in an amount that can be2022-028 approximately the same, less than that of the initial dose, or more than that of the initial dose, wherein the subsequent doses are separated by at least 1 day to 3 days; at least one week, at least 2 weeks; at least 3 weeks; at least 4 weeks; at least 5 weeks; at least 6 weeks; at least 7 weeks; at least 8 weeks; at least 9 weeks; at least 10 weeks; at least 12 weeks; at least 14 weeks; at least 16 weeks; at least 18 weeks; at least 20 weeks; at least 22 weeks; at least 24 weeks; at least 26 weeks; at least 28 weeks; at least 30 weeks; at least 32 weeks; at least 34 weeks; at least 36 weeks; at least 38 weeks; at least 40 weeks; at least 42 weeks; at least 44 weeks; at least 46 weeks; at least 48 weeks; at least 50 weeks; or at least 52 weeks.

[0118] The mode of administration of an antigen-binding protein or composition thereof can vary. Routes of administration include oral, rectal, transmucosal, intestinal, parenteral; intramuscular, subcutaneous, intradermal, intramedullary, intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, intraocular, inhalation, insufflation, topical, cutaneous, transdermal or intra-arterial.

[0119] The present disclosure includes combinations including an NPTX1-binding protein, e.g., antibody or antigen-binding fragment thereof of the present disclosure (e.g., VH0 / VH0, VK3 / VK6, VH3 / VK7, VH3 / VK8, VH4 / VH6, VH4 / VK7, and VH4 / VK8), in association with one or more further therapeutic agents. The NPTX1 antigen-binding protein and the further therapeutic agent can be in a single composition or in separate compositions.

[0120] Methods for treating or preventing metastasis of PDAC in a subject in need of treatment or prevention by administering an NPTX1 antigen-binding protein, e.g., VH0 / VH0, VK3 / VK6, VH3 / VK7, VH3 / VK8, VH4 / VH6, VH4 / VK7, and VH4 / VK8, in association with a further therapeutic agent are part of the present disclosure.

[0121] The term “in association with” indicates that components, a NPTX1 antigen-binding protein, e.g., antibody or antigen-binding fragment thereof of the present disclosure, along with another agent such as methotrexate, can be formulated into a single composition, e.g., for simultaneous delivery, or formulated separately into two or more compositions (e.g., a kit including each component). Each component can be administered to a subject at a different time than when the other component is administered; for example, each administration may be given non-simultaneously (e.g., separately or sequentially) at intervals over a given period of time.2022-028 Moreover, the separate components may be administered to a subject by the same or by a different route. EXAMPLES

[0122] The steps of the method described in the various examples disclosed herein are sufficient to carry out the methods of the present disclosure. Thus, in an example, a method consists essentially of a combination of the steps of the methods disclosed herein. In another example, a method consists of such steps.

[0123] In the present disclosure, in vivo selection on human and murine PDAC cell populations were performed and multiple sublines highly efficient at metastatic colonization of the liver were derived. Highly metastatic human and murine PDAC cells over-expressed the secreted protein NPTX1—a poorly characterized non-essential gene product expressed in the developing brain (Boles et al., 2014). NPTX1 was required for efficient PDAC metastatic liver colonization and was found to promote metastasis formation through autocrine binding of the AMIGO2 receptor. NPTX1-AMIGO2 signaling enhanced PDAC hypoxic cell growth by promoting HIF-1α nuclear retention in a HIF-1α ser641 / ser643-dependent manner. Human PDAC tumors and liver metastases over-express NPTX1 and therapeutic antibody-mediated inhibition of NPTX1 substantially reduced PDAC liver metastatic colonization.

[0124] The following examples are presented to illustrate the present disclosure. The examples are not intended to be limiting in any manner. Example 1. NPTX1 is over-expressed in in vivo selected highly metastatic human and murine pancreatic cancer cells

[0125] To identify critical regulators of pancreatic cancer metastasis formation, we performed in vivo selection on the PANC1 (KRAS and P53 mutant) human pancreatic cancer cell line in immunocompromised Nod Scid Gamma (NSG) mice. We also in vivo selected a KRAS / P53 mutant murine pancreatic cancer cell line that had been derived from the murine pancreatic cancer GEMM model K-rasLSL.G12D / +; p53R172H / +; Pdx1Cre in the syngeneic fully immunocompetent background (henceforth referred to as KPC) (FIG.1A). Over 90% of pancreatic cancer patients who undergo surgical resection of their primary tumors ultimately develop metastatic disease (Oettle et al., 2007), thus the presence of micrometastatic disease is a2022-028 fait accompli in the majority of patients. We therefore focused on identifying genes that regulate this critical stage of organ colonization. Because the most common site of pancreatic cancer distal metastasis is the liver (Iacobuzio-Donahue et al., 2009), we performed in vivo selection by directly injecting cancer cells into the liver and selected for subpopulations that were more efficient at colonization (FIG.1A). Such cells were then injected into the liver iteratively. After repeating this procedure two to three times, we isolated several second and third generation liver colonizing murine KPC LM2 and human PANC1 LM3 sublines (FIG.1A). KPC LM2 and PANC1 LM3 sublines were expanded in vitro and introduced into the portal circulation via splenic injection as a means of assessing metastatic colonization capacity of the liver. In both the xenograft and murine syngeneic systems, the in vivo selected PANC1 LM3 and KPC LM2 cells displayed >30 to >100-fold enhancement of metastatic colonization capability, respectively (FIG.1B and C, FIG.2A). The enhanced liver metastatic capacity of PANC1 LM3 cells were retained after more than 25 passages in vitro (FIG.2B), revealing that the selected highly metastatic subpopulation acquired stable and heritable pro-metastatic phenotypes.

[0126] Metastatic colonization is a critical rate-limiting step during metastatic progression (Chambers et al., 2002; Luzzi et al., 1998). Because the derived highly metastatic cells were efficient in overcoming the rate-limiting step of colonization, we hypothesized that they may also be efficient in metastatic progression from the orthotopic site. To test this, we directly implanted PANC1 LM3 cells into the pancreas of NSG mice. Indeed, direct injection of cancer cells into the pancreas of mice revealed that PANC1 LM3 and KPC LM2 cells were >80 and >6-fold more efficient at liver metastatic colonization relative to their respective isogenic parental cell populations (FIG.1D, FIG.2C). Importantly, enhanced metastatic colonization capacity was not simply attributable to increased cellular growth rate as both PANC1 LM3 and KPC LM2 cells grew significantly slower than their isogenic parental cells in vitro (FIG.2D). These findings revealed that highly metastatic PDAC cells attained adaptive trait(s) that enhanced in vivo organ metastatic colonization capacity.

[0127] To identify molecular programs that may underlie such enhanced metastatic activity, we transcriptomically profiled parental PANC1 and KPC cells along with three of their respective independently derived highly metastatic sublines. Integrating these data revealed two genes— neuronal pentraxin-1 (NPTX1) and laminin subunit gamma 2—that were over-expressed in both2022-028 human and murine highly metastatic sublines (FIG.1E, FIG.2E). We focused our attention on the top gene NPTX1, which was over-expressed on average >7-fold higher in highly metastatic PANC1LM3 and KPC LM2 derivatives relative to isogenic parental cells (FIG.2F). We did not observe any copy number variation across in vivo selected and corresponding parental cells by qPCR based gDNA analysis, suggesting that the increased expression of NPTX1 occurs transcriptionally or post-transcriptionally (FIG.2G). NPTX1 is a poorly characterized secreted neuronal glycoprotein originally implicated in synaptic glutamate receptor interaction in neurons. (Omeis et al., 1996; Sia et al., 2007). Example 2. NPTX1 drives human and murine PDAC liver metastatic colonization

[0128] To investigate the functional role of NPTX1 in PDAC, we first transcriptionally repressed NPTX1 via CRISPR-interference (CRISPRi). CRISPRi-mediated depletion of NPTX1 using two independent guide RNAs reduced PANC1 LM3 liver metastatic colonization burden by 15- to 45-fold (FIG.3A, FIG.4A). Histological analysis of ex-vivo livers by haematoxylin and eosin (H&E) revealed that NPTX1 depletion led to a >10-fold reduction in the number of macroscopic metastatic foci (FIG.4B). Moreover, overall survival in mice harboring NPTX1 deleted tumors was significantly longer than that in mice with control tumors (FIG.3B). As an orthogonal approach, shRNA-mediated depletion of NTPX1 using multiple shRNAs led to a >5- to >50-fold reduction in liver metastatic colonization (FIG.4C-D). These findings generalized to additional murine and human PDAC lines (KPC LM2 and MIA PaCa-2 (TP53 and KRAS mutant)). In both systems, NPTX1 depleted cells exhibited significantly reduced metastatic colonization capacity relative to control cells (FIG.4E-F). As an additional orthogonal approach, we performed an in vivo CRISPR / Cas9-mediated competition assay to determine the impact of NPTX1 genetic deletion on PDAC liver metastatic colonization capacity. NPTX1 targeting small RNA guides were significantly under-represented (>4 log2-fold reduction) in liver metastases relative to control guides (FIG.3C). These orthogonal methods reveal NPTX1 to be a critical promoter of PDAC metastatic colonization.

[0129] To characterize the role of NPTX1 in the full metastatic cascade, we performed spontaneous metastasis assays by orthotopically injecting cancer cells into the pancreas. NPTX1-depleted PANC1 LM3 cells exhibited a >100-fold reduction in orthotopic liver2022-028 metastatic colonization capacity (FIG.3D), consistent with the results from intra-splenic injection-based metastatic colonization assays. Because we observed that metastatic tumor growth began diverging most strongly after the third week of observation (FIG.3A-D, FIG.4D- E), we hypothesized that NPTX1 may regulate a late step in the metastatic cascade. Consistent with this, PANC1 LM3 cells did not attain enhanced invasiveness relative to their isogenic parental cells and NPTX1 depletion did not impact invasiveness of PDAC cells as assessed by trans-well Boyden chamber assays (FIG.4G). To directly test whether NPTX1 plays a post- dissemination role, we used a doxycycline inducible shRNA construct to temporally silence NPTX1 after detecting disseminated cancer cells within the liver through bioluminescence imaging (~2 weeks post portal system injection). Metastatic liver burden of doxycycline diet treated animals was substantially reduced compared to control diet treated animals (FIG.3E). Collectively, these data revealed that NPTX1is critically required for the colonization step of PDAC metastatic progression.2022-028 Example 3. NPTX1 is over-expressed in primary PDAC tumors and liver metastases

[0130] We next assessed the expression levels of NPTX1 in normal pancreas and PDAC tumor samples of patients. PDAC tissues exhibited significantly higher NPTX1 expression relative to normal pancreas tissues (>90 fold higher in PDAC samples) (Figure 3A). We performed enzyme-linked immunosorbent assay (ELISA) of serum samples in PDAC harboring mice and PDAC patients. We detected NPTX1 in both samples (~1.1 ng / ml serum in PDAC bearing mice sera and ~1.96ng / ml in metastatic PDAC patient sera), while NPTX1 was detected at low levels in the serum of healthy mice and humans (Figure 3B-C). To validate these findings in an independent dataset, we expanded this analysis to a larger cohort of 125 primary and 47 liver metastatic PDAC tumors obtained through the rapid-autopsy program at MSKCC. NPTX1 mRNA expression was significantly higher in human PDAC liver metastases relative to primary tumors (Figure S3A). To assess NPTX1 protein expression in situ, two independent board- certified pathologists developed an immunohistochemical (IHC) scoring system and blindly scored 14 primary PDAC sections and 12 liver metastatic PDAC sections (Figure S3B). Liver metastatic PDAC samples exhibited significantly higher IHC scores than primary PDAC samples (>2-fold increase) (Figure 3D). These findings revealed that NPTX1 is overexpressed in primary and liver metastatic PDAC samples, consistent with its role in driving PDAC metastatic progression.

[0131] A 3-D patient-derived organoid (PDO) culture system was used to assess the role of NPTX1 in patient-derived cells (Boj et al., 2015; Roe et al., 2017; Tiriac et al., 2018; Tiriac et al., 2019). An NPTX1 expressing PDAC PDO (PC95 PDO) was established and transduced with shRNAs targeting NPTX1 (Figure S3C-D). NPTX1 depletion significantly reduced the number of liver metastatic foci formed by PDO cells (FIG.5E). A CRISPR in vivo competition assay was performed in PC95 PDOs, using NPTX1-targeting and control guides. A significant depletion of NPTX1 targeting guides was observed in PC95 liver metastatic tumors (FIG.5F). Moreover, patients bearing NPTX1 over-expressing tumors in the TCGA PAAD dataset experienced significantly shorter disease-free survival outcomes than patients whose tumors expressed lower levels of NPTX1 (FIG.5G), consistent with our experimental and clinical association findings. These findings reveal that intratumoral and circulating NPTX1 are2022-028 detectable in PDAC patients and that elevated NPTX1 expression associates with reduced disease-free survival in PDAC. Example 4. NPTX1 upregulation promotes cell growth under hypoxia.

[0132] NPTX1 protein is primarily expressed in the brain and previously found to interact and stabilize fast excitatory AMPA glutamate receptors (GluR4) at the synapse (Sia et al., 2007). Moreover, in the setting of ischemia, extracellular NPTX1 was found to localize to the synaptic cleft and enhanced GluR4 activation and neuronal cell death (Hossain et al., 2004). The mechanistic role of NPTX1 in cancer is poorly defined and has been associated with both a pro- tumorigenic role in glioma via increased cell proliferation (Huo et al., 2019) and a tumor suppressive role in colon cancer via reduced cell growth (Peng et al., 2018). The impact of NPTX1 depletion on cell growth was assessed to define how NPTX1 promotes PDAC metastatic colonization. In contrast to these past reports, NPTX1 depletion in pancreatic cancer cells did not significantly impact cancer cell proliferation in vitro (FIG.7A). Moreover, NPTX1 depletion did not impact PDAC apoptosis in vivo as assessed by a DEVD-luciferin caspase 3 / 7 bioluminescence-based activity reporter (FIG.7B). NPTX1 depletion did however significantly reduce PDAC liver metastatic proliferation in vivo, as assessed by Ki-67 staining and quantification (FIG.7C). Given the discordant findings on proliferative advantage conferred by NPTX1 in vitro versus in vivo, it was reasoned that perhaps NPTX1 enables growth in the context of a proliferative barrier inherent to the liver metastatic microenvironment. Hypoxia represents a key hallmark of the liver and pancreatic microenvironments that metastatic cells must overcome during progression (Brown and Wilson, 2004; Jungermann and Kietzmann, 2000). Consistent with this, highly metastatic PDAC cells were significantly more efficient at proliferation under hypoxia relative to isogenic poorly metastatic cells (FIG.7D). Moreover, NPTX1 depletion by CRISPRi or RNAi significantly suppressed growth of PDAC cells under hypoxia but not normoxia (FIG.8A-B). Because NPTX1 can be secreted, the conditioned media of both parental and highly metastatic PDAC cells was analyzed by western blot and detected more NPTX1 in highly metastatic cells relative to isogenic parental cells (FIG.7E), consistent with the enhanced gene expression changes observed at the transcript and intracellular protein levels (FIGS.2F and 8C). Moreover, hypoxia caused a >4-fold increase of NPTX1 expression in2022-028 PDAC cells (FIG.7F). These findings reveal that extracellular NPTX1 increases upon hypoxia and that highly metastatic PDAC cells release more of this protein into the extracellular space.

[0133] It was hypothesized that extracellular NPTX1 may enable cancer cells to overcome the hypoxic barrier that is present in the liver metastatic environment. To test this, PANC1 parental cells were first treated with either the parental cell-derived conditioned media or the highly metastatic cell-derived conditioned media and assessed growth under hypoxia. Cells treated with highly metastatic cell-derived conditioned medium grew significantly better than cells treated with parental cell-derived conditioned medium (FIG.7G). Parental PDAC cells were treated with recombinant NPTX1 (rNPTX1) to determine if NPTX1 is sufficient to promote hypoxic growth. A dose-dependent increase in cell growth was observed under hypoxia but not under normoxia (FIG.7H, FIG.8D). Moreover, treatment of NPTX1 CRISPRi-depleted cells with rNPTX1 nearly fully rescued the hypoxic cell growth reduction caused by NPTX1 depletion (FIG.7I). These results reveal that NPTX1 can act extracellularly to promote hypoxic growth of PDAC cells. PDAC tumors that were stained with pimonidazole were imaged to assess hypoxia and its relationship to growth in vivo. Pimonidazole is a compound that associates with tissues at <10 mmHg oxygen tension. While PANC1 LM3 metastasizing tumors displayed more severe hypoxia than isogenic parental tumors (>30-fold increase in pimonidazole signal intensity) (FIG. 8E), they nonetheless exhibited significantly higher cell-proliferation within such hypoxic regions (>2-fold increase) (FIG.8E). Consistent with these findings, gene set enrichment analysis of ex vivo PDAC tumor mRNAseq data revealed the hypoxia signature to be one of the most upregulated pathways (NES=1.54, adjusted p-value=0.01) in highly metastatic PANC1 LM3 cells relative to parental PANC1 cells (Figure S4F derived from the data in Figure S1F). These results support the notion that NPTX1 upregulation enables metastatic PDAC cells to sustain proliferative growth in vivo despite severe tissue hypoxia in the liver metastatic microenvironment. Example 5. AMIGO2 is a cell surface NPTX1 receptor and drives PDAC liver metastasis.

[0134] The identification of the cell surface receptor that mediates the effects of NPTX1 in PDAC was desired. NPTX1 has been previously shown to interact with neuronal pentraxin receptor (NPTXR) in neurons but NPTXR does not have an intracellular signaling domain and2022-028 the nature of this receptor-ligand interaction remain poorly defined (Dodds et al., 1997). As such, an unbiased search for putative binding partners of NPTX1 on PDAC cells was performed. It was reasoned that a receptor for NPTX1 may become upregulated as a feedback response to depletion of its ligand. MRNA sequencing of ex vivo NPTX1-depleted and control tumors identified AMIGO2 (Fontanals-Cirera et al., 2017; Kuja-Panula et al., 2003; Ma et al., 2019), as a cell surface receptor that became significantly upregulated in NPTX1 depleted tumors, suggesting a potential feedback response (FIG.9A, FIG.10A). Three orthogonal experiments were conducted to determine if AMIGO2 is a binding partner of NPTX1. First, reciprocal co- immunoprecipitations under hypoxia revealed an interaction between FLAG-tagged AMIGO2 and recombinant NPTX1 (FIG.9B, FIG.10B). Next, proximity ligation assays (PLA) revealed an interaction between recombinant NPTX1 and endogenous AMIGO2 under hypoxia (FIG.9C, FIG.10C). Finally, a microscale thermophoresis assay (MST) was conducted. The MST is a cell free biophysical assay to detect direct protein-protein interactions between recombinant extracellular domain of AMIGO2 and NPTX1. Recombinant AMIGO2 induced a robust thermophoresis change in a dose dependent manner at sub-micromolar Kd—consistent with a direct interaction (FIG.9D, FIG.10D). In contrast, an interaction between the control protein EGFR and NPTX1was not detected. Taken together, these results reveal that NPTX1 interacts with the AMIGO2 receptor.

[0135] Next, it was assessed whether AMIGO2 mediates the pro-metastatic effects of NPTX1. Depletion of AMIGO2 by two independent shRNAs reduced the growth of highly metastatic PDAC cells under hypoxia but not normoxia (FIG.9E, FIG.10E and 10F), yielding similar effects as that observed upon NPTX1 depletion (FIG.4A, FIG.8A). Control or AMIGO2- depleted cells were treated with recombinant NPTX1 to determine if AMIGO2 is required for the growth promoting effects of NPTX1 under hypoxia. Recombinant NPTX1 promoted the growth of control PDAC cells upon hypoxia but did not promote the hypoxic growth of AMIGO2 receptor depleted cells (FIG.9F). Consistent with these findings, depletion of AMIGO2 in highly metastatic PANC1 LM3 cells led to >7-fold (shRNA_2) or >50-fold (shRNA_3) reduction in liver metastatic colonization burden and a significant reduction in the number of metastatic foci (FIG.9G, 9H, FIG.10G, 10H). These findings identify AMIGO2 as a receptor2022-028 that mediates the hypoxic pro-growth effects of NPTX1 in PDAC and as a critical promoter of PDAC metastatic colonization. Example 6. AMIGO2 mediates α1a nuclear retention via specific HIF1a residues.

[0136] HIF transcription factors are central drivers of hypoxic responses across organisms. We hypothesized that NPTX1 / AMIGO2 may drive hypoxic growth by promoting the function of HIF1a. To test this, nuclear-cytoplasmic fractionation of PDAC cells was performed under hypoxia conditions (0.5% oxygen) to detect HIF1a localization and abundance by western blot. Remarkably, substantially less nuclear HIF1a abundance (~85% reduction) in AMIGO2 depleted cells was observed (Figure 6A, Figure S6A). Consistent with this, immunofluorescence staining of PDAC cells under hypoxia corroborated these findings and revealed HIF1a to be mostly cytoplasmic in NPTX1 depleted PDAC cells (FIG.11B). To determine if NPTX1 expression associates with HIF1a transcriptomic response in PDAC tumors, we identified human PDAC tumors in the TCGA that exhibited very high as well as tumors that exhibited very low NPTX1 expression. Human PDAC tumors that expressed very low levels of NPTX1 exhibited reduced expression of established HIF1a target genes relative to NPTX1 over-expressing PDAC tumors (FIG.12B), suggesting that NPTX1-AMIGO2 signaling may regulate HIF1a transcriptional response in PDAC. To test if AMIGO2 regulates the HIF1a transcriptional response in PDAC cells, an HIF1a-HRE renilla luciferase hypoxia reporter was transduced into control or AMIGO2 depleted PANC1 LM3 cells expressing firefly luciferase as the reference control. AMIGO2 depleted PDAC cells exhibited a substantial reduction in HIF1a reporter signal under hypoxia relative to control cells (> 300-fold reduction in shRNA_2, and >9-fold reduction in shRNA_3; FIG.11C). Additionally, qPCR array-based quantification of HIF1a target genes in ex vivo liver metastatic PDAC tumors revealed that 80 out of 84 representative HIF1a target genes were downregulated in AMIGO2 depleted samples relative to control samples (FIG.11D). These findings reveal that NPTX1-AMIGO2 enhance HIF1a nuclear localization / retention in PDAC and that AMIGO2 is a promoter of the HIF1a transcriptional response in PDAC.

[0137] Next it was determined whether AMIGO2 regulates the HIF1a transcriptional response by governing HIF1a nuclear localization / retention. HIF1a nuclear retention has been shown to be regulated by HIF1a phosphorylation at serine residues 641 and 643 (S641, S643), which2022-028 interrupts the interaction of HIF1a with the nuclear export factor CRM1 and allows HIF1a to be retained within the nucleus (Mylonis et al., 2008; Mylonis et al., 2006). To determine if driving HIF1a nuclear retention is sufficient to overcome the effects of AMIGO2 depletion, we overexpressed phosphomimetic constructs HIF1a S641E, S643E, and dual S641E / S643E in AMIGO2 depleted PANC1 LM3 cells. It was confirmed that HIF1a overexpression levels were similar across all conditions and that CRM1 levels were not significantly different between AMIGO2 depleted and control cells (FIG.12E-F). While overexpression of full-length HIF1a failed to rescue the HIF1a-HRE reporter signal in AMIGO2 depleted cells, the phosphomimetic constructs partially or fully rescued the HIF1a-HRE signal in AMIGO2 depleted cells (9% increase in S641E, 95% in S643E, and 118% in S641E / 643E samples) (FIG.11E). These findings were confirmed by immunofluorescence analyses, which revealed substantial depletion of HIF1a nuclear signal upon AMIGO2 depletion, which was fully restored by the HIF1a S641E / S643E phosphomimetic variant (FIG.11F, FIG.12E). Finally, while full-length wildtype HIF1a overexpression was unable to enhance high liver metastatic colonization capacity to AMIGO2 depleted cells, HIF1a S641E / S643E mutant overexpression was sufficient to substantially increase the metastatic colonization ability of AMIGO2 depleted cells (>3.5-fold increase in liver photon flux signal and >4-fold increase in the number of liver metastatic foci) (FIG.11G and FIG.12F). These findings reveal that AMIGO2 promotes HIF1a nuclear localization and PDAC liver metastatic colonization in a HIF1a S641 / S643-dependent manner. Example 7. Therapeutic targeting of NPTX1-AMIGO2 axis in primary and metastatic PDAC.

[0138] To determine the therapeutic potential of targeting the NPTX1-AMIGO2 axis, monoclonal antibody targeting NPTX1 was developed. Through phage display and mouse immunization campaigns, 6 human IgG1 and 1 murine IgG1 antibodies were identified that all exhibited high affinity binding to human NPTX1. These antibodies were tested in a hypoxic cell growth assay and anti-NPTX1 murine IgG1 antibody 31B01(31B01) was identified as a lead antibody that significantly reduced PANC1 LM3 cell viability (FIG.13A). Gemcitabine was the first chemotherapy approved for adjuvant treatment of PDAC and despite its poor activity, remains a core component of chemotherapeutic regimens for metastatic PDAC (Burris et al.,2022-028 1997; Conroy et al., 2011; Saung and Zheng, 2017). Thus, the efficacy of 31B01 was compared with gemcitabine in suppressing PDAC liver metastasis colonization. While gemcitabine monotherapy did not significantly suppress liver metastatic colonization by PANC1 LM3 cells (~20% reduction relative to IgG1 / PBS control, p=0.47, Student t-test), 31B01 substantially and significantly suppressed liver metastatic colonization growth by >80% (FIG.13B). Both NPTX1 overexpressing PC95 PDO and NPTX1 non-overexpressing PC69 PDO were treated with 31B01 antibody to determine whether 31B01’s hypoxic cell growth inhibitory effects depend on NPTX1 expression (FIG.14C). While 31B01 inhibited the growth of PC95 PDO under hypoxia, it failed to suppress the growth of PC69 PDO under hypoxia—consistent with “on-target” efficacy (FIG. 14A). To independently validate these findings, the activity of this antibody was tested against an independent PDO PDAC metastatic progression model. Through in vivo selection of the PC69 PDO in the orthotopic pancreas and liver metastatic sites, we generated the NPTX1 highly expressing pancreas orthotopic PC69 (PC69P) and liver metastatic PC69 (PC69LM) PDO derivatives, which induced expression of NPTX1 (FIG.14B). Consistent with our prior findings, 31B01 suppressed hypoxic growth of PC69P PDO (FIG.14C). The impact of 31B01 on orthotopic tumor growth was tested as NPTX1 is upregulated in the primary hypoxic pancreatic microenvironment. 31B01 significantly suppressed primary orthotopic PDAC PDO growth (>70% reduction), caused a regression response (FIG.13C) and dramatically extended the overall survival of treated mice harboring pancreatic orthotopic PDAC PDO tumors (FIG.14D). Next, the efficacy of fully humanized NPTX-1 antibody (h31B01) in two additional human pancreatic cancer cell lines was validated. Parental Mia PaCa-2 and BxPC3 LM3 cells were independently injected to subcutaneous tissue and treated with h31B01 to assess whether h31B01 inhibits cancer cell growth in response to hypoxic stress. 31B01 did not suppress primary tumor growth in subcutaneous tissue where cells undergo relatively less hypoxic exposure (FIG.13D, FIG.14E). Liver metastasis assay was performed by intrasplenic injection with BxPC3 LM3 cells. H31B01 suppressed PDAC metastatic progression (FIG.13E). Therapeutic efficacy was also demonstrated in mice injected with parental Mia PaCa-2 cells to the pancreas (FIG.13F). PDAC PDX tumors which did not express NPTX1 at baseline were implanted to better confirm its effect on primary tumor growth. Consistent with prior results, H31B01 did not significantly affect primary tumor growth in tumors that did not over-express NPTX1 the absence of NPTX12022-028 (FIG.14F). These findings reveal that therapeutic targeting of NPTX1 can suppress PDAC metastatic colonization and orthotopic tumor progression. Example 8. Comparison of generated anti-NPTX1 antibody and commercially available anti-NPTX1 antibody

[0139] To determine the applicability of generated anti-NPTX1 antibody (1B1) and one of most widely cited commercially available NPTX1 antibody, Abcam 191201, Western blotting was performed to detect NPTX1 protein in PANC1 PDAC cell line loaded at 40ug / lane. Abcam antibody failed to detect NPTX1 protein band at the expected molecular weight. Contrastingly, the generated anti-NPTX1 antibody detected NPTX1 protein band at the expected molecular weight (FIG.15A). FIG 15B represents an immunohistochemistry image of human brain cited from Abcam’s website (https: / / www.abcam.com / products / primary-antibodies / np-i-antibody- ab191201.html#lb) as the positive control. The dark cherry color spots were supposed to be NPTX1 protein positive signals, however, the signal to noise ratio is high due to a high background in red color. These images showed the advantage of the generated anti-NPTX1 antibody over the widely used commercially available standard anti-NPTX1 antiobody. Example 9. General Experimental Methods Cell culture

[0140] PANC1 and MIA PaCa-2, (both human, male) were purchased from ATCC (Manassas, VA). KPC cells were gift from the Batra lab at University of Nebraska. All cells were maintained in Dulbecco's Modified Eagle Medium (Gibco) supplemented with 10% v / v fetal bovine serum (Corning), penicillin-streptomycin (100 U / ml; Gibco). All cells were grown at 37°C under 5% CO2and passaged when the monolayer reached 80% confluency. All human cell lines were authenticated by SPR profiling at MSKCC. All cells were regularly checked for mycoplasma contamination and have been negative. Mice

[0141] B6129SF1 / J (JAX stock #101043 RRID: IMSR_JAX:101043) and NOD-SCID-gamma (JAX stock #005557, RRID: IMSR_JAX:005557) were purchased from the Jackson Laboratory. For all tumor growth experiments, cells suspended in PBS were mixed 1:1 with Matrigel and subcutaneously or orthotopically injected to the 6-8 weeks old sex matched mice. Upon2022-028 detection of tumor volumes reaching the size indicated in each figure, mice were randomly assigned to a control or an experimental treatment. Tumor measurements were taken on the days indicated in each figure throughout the course of the experiment with digital calipers. For survival analysis, mice were euthanized when total tumor burden approached IACUC guidelines. For the relevant experiments, anti-NPTX1 monoclonal antibody (clone 31B01) or a control isotype-matched antibody (Tri-I TDI) was administered at 10mg / kg intraperitonially twice a week post-tumor injections. Mice were housed under specific-pathogen-free conditions (SPF) at the Rockefeller University’s comparative bioscience center in New York. All experiments that involved the use of mice were performed in accordance with the guidelines outlined by the Rockefeller’s Institutional Animal Care and Use Committee (IACUC) (approved protocol # 21054-H) in New York. Patient sample details

[0142] All patient samples were obtained from Memorial Sloan Kettering Cancer Center except for the serum from healthy humans, which was purchased from Discovery Life Sciences and Origene. The protocol was approved by all site IRB (MSKCC Institutional Review Board / Privacy Board (protocol 10-018A and 06-107A) and The Rockefeller University’s Institutional Review Board (protocol ERA-0959)) and all patients signed informed consent before sample acquisition. PC95 PDX was established from an 83-year-old male patient with the pathological stage of IIB: T3N1M0. PC69 PDX was established from a 75-year-old female patient with the pathological stage of IIB: T3N1M0. PC104 PDX was established from a 77- year-old female patient with the pathological stage of IIB: T3N1M0. All PDX were primary pancreatic tumors obtained via pancreaticoduodenectomy harboring KRAS and TP53 mutations. The PDAC patient serums were taken from patients with stage IV disease. Patient derived organoid generation

[0143] Patient derived xenograft tumors were freshly resected and minced into a slurry form on ice. The tumor slurry was placed in a 50 ml conical tube with a solution of Dulbecco's Modified Eagle Medium (Gibco) supplemented with 10% v / v fetal bovine serum (Corning), L-glutamine (2 mM; Gibco), penicillin-streptomycin (100 U / ml; Gibco), Amphotericin (1 μg / ml; Lonza), sodium pyruvate (1 mM; Gibco) and Collagenase, Type IV (200 U / ml; Worthington) and placed in a 37°C shaker at 220 rpm for 30 min. After centrifugation and removal of supernatant, the2022-028 sample was subjected to ACK lysis buffer (Lonza) for 3 min at room temperature to remove red blood cells. After centrifugation and removal of ACK lysis buffer, the sample was subjected to a density gradient with Optiprep (Axis-Shield, 1114542) to remove dead cells. The sample was washed in media and subjected to a 100-μm cell strainer and followed by a 70-μm cell strainer. 100,000 PDX cells were suspended in 30ul of Matrigel and were plated in 24 well plate. PDAC PDO growth media (Tiriac et al., 2018) were used to generate the PDOs. In vitro hypoxia cell growth assay

[0144] Cells were grown under normoxia for 24 hours after being seeded at 2x105cells per a well of a 6 well plate followed by incubation for 4 days under 0.5% oxygen in hypoxia chamber (Coy laboratory Products, Grass Lake, MI) and then counted using the Sceptor 2.0 automated Cell Counter (Millipore). Stable cell lines

[0145] Lentiviral particles were created using the ViraSafe lentiviral packaging system (Cell Biolabs). ShRNA oligo sequences were based upon the Sigma-Aldrich MISSION shRNA library and were obtained from Integrated DNA technologies. Table 2 includes the sequence of oligos. Forward and reverse complement oligos were annealed, cloned into pLKO, and transformed into Stbl3 E. coli (Invitrogen, #C737303). For HIF1a overexpression, HIF1a cDNA (plasmid ID OHS6084-202635107) was obtained from the Dharmacon (Lafayette, Colorado) cloned into plx304-puromycin or plx304-blasticidin. For tetracycline-inducible experiments, the seed sequences were cloned into pLKO-Tet-On. Doxycycline formulated chow (200mg / kg body weight) was made from Purina Rodent Chow (#5001, control chow) purchased from Research Diets (New Brunswick, NJ). All plasmids were isolated using the plasmid plus midi kit (Qiagen). Transduction and transfection were performed as described previously (Pencheva et al., 2012).2022-028 TABLE 2: Oligonucleotide Sequences SEQ ID NO: Oligo Sequence 56 sgCTRL (CRISPRi) GCGTGCGTCCCGGGTTACCC 57 sgNPTX1_1 (CRISPRi) TCGGGCTGTGGCTCCGCGAG 58 sgNPTX1_7 (CRISPRi) CTGGGACCCGGCTCGGGCTG CCGGCGACGCGCTTCATCTGCACTTCTCGAGAAGTGCAG 59 shNPTX1_1 ATGAAGCGCGTCGTTTTTG CCGGCCCATGGAGATCCTCATCAATCTCGAGATTGATGA 60 shNPTX1_3 GGATCTCCATGGGTTTTTG CCGGCTGCGGACCAACTATATGTATCTCGAGATACATATA 61 shNPTX1_4 GTTGGTCCGCAGTTTTTG CCGGGAGAAAGGTCAGAAAGACACTCGAGTGTCTTTCTG 62 shNPTX1_5 ACCTTTCTCTTTTTG CCGGGAGACAAGTTTCAGCTGACATCTCGAGATGTCAGC 63 shNptx1_c TGAAACTTGTCTCTTTTTG CCGGTGCGGACCAACTACATGTATGCTCGAGCATACATG 64 shNptx1_d TAGTTGGTCCGCATTTTTG sgNPTX11 (CRISPR 65 comp assay) GGGCCCCAGGAACGACACCG sgNPTX12 (CRISPR 66 comp assay) GAGGTGCAGATGAAGCGCGT sgNPTX13 (CRISPR 67 comp assay) GAGTTGGCTGAGCGTCTCGG sgNPTX14 (CRISPR 68 comp assay) GAACCCGCCTGGAGAACCTCG sgNPTX15 (CRISPR 69 comp assay) GTCCCGGGTGAACACCCTGG sgCTRL1 (CRISPR 70 comp assay) GGCGCTCGATTAAGACTCAG sgCTRL2 (CRISPR 71 comp assay) GTTACGCGTGCTGTCGCTTC2022-028 sgCTRL3 (CRISPR comp assay) GTTCCTTCTGCAGGCACGCT sgCTRL4 (CRISPR comp assay) GCGGATTAGAGGTAATGCGG sgCTRL5 (CRISPR comp assay) GGAGCCATGGTAGAGCGTAT NPTX1 fwd primer (copy number) AAGACAACCGCCCTGGA NPTX1 rev primer (copy number) CACTCAATGAGGACCAGCTC GAPDH fwd primer (copy number) AGCCACA TCGCTCAGACAC GAPDH rev primer (copy number) GCCCAATACGACCAAATCC NPTX1 fwd primer (mRNA quantification) CCTGGAGAACCTCGAGCA NPTX1 rev primer (mRNA quantification) GATCCTTGAGGCTGTTGGTC GAPDH fwd primer (mRNA quantification) AGCCACATCGCTCAGACAC GAPDH rev primer (mRNA quantification) GCCCAATACGACCAAATCC Nptx1 fwd primer (mRNA quantification) CCAAGCTGCCGTTTGTAATC Nptx1 rev primer (mRNA quantification) GATAGGGTGCCAAGTTCTCTC Gapdh fwd primer (mRNA quantification) AGGTCGGTGTGAACGGATTTG Gapdh rev primer (mRNA quantification) GGGGTCGTTGATGGCAACA FLAG-AMIGO2 fwd primer (mutagenesis) GATGATGATAAATCGTTACGTGTACACACTC FLAG-AMIGO2 rev primer (mutagenesis) ATCTTTATAATCCATGCCAACTTTTTTGTACAAAG2022-028 HIF1a S641E fwd primer 89 (mutagenesis) ATTGATTGCAGAGCCATCTCCTACC HIF1a S641E rev primer 90 (mutagenesis) ATTTTAATGTCTTCCATACG HIF1a S643E rev primer 91 (mutagenesis) TGCATCTCCAGAACCTACCCACATAC HIF1a S643E fwd primer 92 (mutagenesis) ATCAATATTTTAATGTCTTCCATAC HIF1a S641E / S643E fwd 93 primer (mutagenesis) AGAACCTACCCACATACATAAAG HIF1a S641E / S643E rev 94 primer (mutagenesis) GGTCTGCAATCAATATTTTAATGTCTTC siNPTX1.1 IDT identification: hs.Ri.NPTX1.13.1 siNPTX1.3 IDT identification: hs.Ri.NPTX1.13.3 Analysis of genomic copy number

[0146] Total genomic DNA was extracted and purified from cell populations using the DNeasy kit (Qiagen). Qpcr assay was performed using Fast SYBR Green Master Mix (Applied Biosystems, #4385612) and an Applied Biosystems 7900HT system (please refer the supplementary table 1 for the primer sequence). For DNA content normalization, GAPDH was used as endogenous control. Ct values from HEK293, PANC1, PANC1-LM3a, b, and c were plotted. In vivo selection

[0147] 1 × 106PANC1, MIA-PaCa2 or KPC cells were suspended in a 20ul volume of 1:1 PBS / Matrigel mixture and injected intra-hepatically into the livers of NOD-SCID gamma (NSG) or B6129 mice. Metastatic nodules were allowed to develop over a period of 3–4 weeks and clinically monitored. Nodules formed were excised and dissociated by collagenase digestion into single cell suspensions as previously described (Pencheva et al., 2012). The cells were allowed to expand in in vitro before re-injection into the spleen of mice. After 2-3 iterations of in vivo selection, highly metastatic derivative cell-lines were established. In vivo metastasis assay2022-028

[0148] 1x106cancer cells that had been stably transduced with a luciferase reporter were subjected to the portal circulation injection in NSG or B6129 mice. After two minutes, a splenectomy was performed. Mice were imaged weekly. Experiments were terminated when the luciferase signal had saturated or the mice were too ill, whichever occurred first. In vivo spontaneous metastasis assay (pancreatic orthotopic injection)

[0149] 1x106cancer cells suspended in 25ul of PBS were mixed with Matrigel at 1:1. The mixed cell suspension was inoculated into the pancreas of NSG mice. Mice were imaged weekly. Experiments were terminated when the luciferase signal had saturated or the mice were too ill, whichever occurred first. In vivo DEVD luciferase apoptosis assay

[0150] 100ul of amino-DEVD-luciferin substrate (15mg / ml, Promega) was injected for bioluminescent imaging. 5 hours after the imaging with DEVD-luciferin, regular D-luciferin substrate (15mg / ml) was injected and images were taken to obtain a normalization signal. All images were taken with the IVIS imaging system. mRNAseq

[0151] RNA was extracted using the Total RNA Purification Kit (Norgen Biotek) and DNAse treated using the RNase-Free DNase I kit (Norgen Biotek). Truseq RNA Library Prep Kit V2 (Illumina, RS-122-2001) was used for generation of RNAseq libraries. RNAseq libraries were quantified using a Bioanalyzer (Agilent) and pooled samples were sequenced on an Illumina NextSeq 500. mRNA reads were aligned to human or mouse reference genome (hg19 or mm39) with STAR 2.7.6a using the default setting (Dobin et al., 2013). To quantify gene expression, we counted sequenced reads mapping to exon regions using featureCounts v2.0.0 (Liao et al., 2014). The sequencing and mapping quality were examined with MultiQC v1.9 (Ewels et al., 2016). Differential expression analysis was performed using DESeq2 v1.24 (Love et al., 2014). Preranked gene set enrichment analysis (GSEA) was performed using fgsea v1.10.1 (Sergushichev, 2016) on the hallmark gene set (Liberzon et al., 2015). FDR was calculated using gene set permutation for 10,000 iterations. CRISPRi knock-down

[0152] Lenti-dCas9-KRAB-blast plasmid (Addgene, #89567) was used to transform Stbl3 competent E. coli (Invitrogen, #C737303). The resulting lentivirus was used to transduce2022-028 PANC1 LM3 cells. Control sgRNA targeting intergenic region and NPTX1 targeting sgRNAs were cloned into linearized lentiGuide-puro plasmid (Addgene, #52963) and used to transform the Stbl3 E. coli. The resulting viral particles were used to transduce dCas9-KRAB expressing PANC1 LM3 cells. In vivo CRISPR competition assay

[0153] Five control sgRNAs targeting intergenic regions, five sgRNAs targeting NPTX1, and were cloned into linearized lentiCRISPR-v2 vector and transformed in NEB competent E. coli. Each plasmid was then pooled at equal concentrations and used for lentivirus production as previously described. PANC1 LM3 cells or patient derived xenograft cells were infected and selected with puromycin for 3 days prior to being in vitro cultured or injected into the spleen, pancreas or flank of NSG mice. Tumors were collected after 2–4 weeks of growth. An initial pool of each sample was taken for normalization. After 14–21 days gDNAs were isolated and amplified by PCR. PCR amplicons were then sequenced on a MiSeq nano (Illumina). Guide scores were calculated as median log2fold change in the abundance between the initial and final population of the sgRNAs similar to standard CRISPR screens. Boyden chamber invasion assay

[0154] 20,000 of the corresponding cells were seeded into 8um pore permeable chamber (Corning, #353097) and have been cultured for 96 hours. The membrane from each well were cut out and was placed on a coverslip. The migrated cells were stained with DAPI formulated mounting media (ThermoFisher, #P36931) and were counted with Fiji. In vivo hypoxia pimonidazole reporter assay

[0155] An intraperitoneal injection of 60mg / kg pimonidazole HCl / Hypoxyprobe (NPI Inc, #HP7-1000kit) was infused into each mouse. 90 min after, the mice were anaesthetized and the livers were extracted. The livers were submerged in 4% paraformaldehyde for 24 hours at 4℃ on a rotator. The livers were then embedded in OCT and frozen on dry ice. 10 um section was cut and stained with pimonidazole antibody conjugated to DylightTM549. The sections were then imaged using a Zeiss laser scanning confocal microscope (LSM 510). Western blot

[0156] Cells were lysed in ice cold RIPA buffer (G-Biosciences, #786-723) supplemented with complete protease inhibitor (Roche, #11836153001). Samples were denatured, separated by2022-028 SDS-PAGE using either 4-12% Bis-tris or 3-8% Tris-acetate gels and transferred to Immobilon- P PVDF membrane (Millipore, #IPVH00010). Membranes were blocked with 5% bovine serum albumin in PBST (1X PBS, 0.1% Tween-20 (Sigma, #P9416)) and probed with primary antibody overnight at 4°C. Membranes were washed with PBST and incubated with secondary antibodies conjugated to horseradish peroxidase (1:10,000) and developed using ECL Western Blotting Substrate (Pierce, #32132) and the SRX-101A (Konica Minolta) developer according to the manufacturer’s instructions. Immunoprecipitation

[0157] PANC1 LM3 cells or PANC1 LM3 cells expressing FLAG-AMIGO2 construct were seeded at 300,000 cells per well of 6 well plate and were cultured under hypoxia (0.5% O2) for 24 hours. 300ng of recombinant NPTX1 (Tri-I TDI) was added to the corresponding wells and were incubated for 1 hour under hypoxia. The plate was washed with ice-cold PBS twice and the cells were scraped off from the plate. RIPA buffer was used to extract the protein. 50ul of FLAG antibody (Sigma-Aldrich, #F7425) or isotype matched control antibody coupled Dynabeads (ThermoFisher, #14311D) at 5ug / mg was added to the protein sample. The protein- beads solution was incubated for 1 hour at 4℃. The beads-bound protein was eluted with low pH elution buffer (ThermoFisher, #88804). The subsequent western blot was performed as described above. Proximity ligation assay

[0158] PANC1 LM3 cells expressing either the control or the AMIGO2 hairpin + / - plxHIF1aS641 / 643E construct were grown on the Nunc Chamber Slide system (ThermoFisher, #154534) under hypoxia (0.5% O2). Recombinant NPTX1 (6x His tagged) and control 6x His tagged protein (6x His maltose binding protein (MBP), a gift from Funabiki’s lab) were added to the corresponding chamber of the coverslip. Anti His tagged antibody (Proteintech, #66005-1- Ig) and anti AMIGO2 antibody (Abcam, #ab179747) were used to probe the target proteins. The manufacture’s instruction has been followed in the rest of procedure (Sigma-Aldrich, #DUO92202-1KT). Microscale thermophoresis

[0159] The MST experiments were performed in a Monolith NT.115 (Nanotemper Technologies) in the red channel. 50 µL of 1 mg / mL of NPTX1 (Novusbio, NBP2-08105) were2022-028 buffer exchanged following Monolith Protein Labeling Kit RED-MALEIMIDE 2nd Generation (MST Grade) cat number (L014) from Nanotemper Technologies kit protocol using labeling buffer provided in the kit. After the buffer exchange the protein was diluted at a half with labeling buffer and labeled in the cysteines using Red-Maleimide 2ndGeneration dye. After that the protein was purified working buffer: 50 mM Tris pH 7.4, 150 mM NaCl, 10 mM MgCl2, 0.05 % tween-20 and 1 mM DTT following Nanotemper kit protocol. The final concentration of labeled protein was 13 µM measured using Bradford Protein Kit (Bio-Rad). The protein was aliquoted, flash frozen and stored at -80 °C. For the interaction NPTX1 was thaw on ice and 200 µL 300 nM were prepared using working buffer. The solution was spun down at 9,400 rcf for 10 min at 4 °C. AMIGO2 (Elabscience, PKSH030569) was buffer exchanged using desalting columns Zeba™ Spin Desalting Columns, 7K MWCO, 0.5 mL (cat number: 89882) into working buffer. Using low binding tubes, 10 µL AMIGO2 were serially diluted in by half for a total of 16 dilutions where the highest final concentration was 2.7 µM. 10 µL of 300 nM NPTX1 were added into each dilution of AMIGO2 making the highest concentration of AMIGO21.35 µM and a final concentration of 150 nM of labeled NPTX1 in the assay. The complex AMIGO2-NPTX1 was incubated for 30 minutes at room temperature. 16 premium coated capillaries (Catalog #: MO-K025, Nanotemper Technologies) were filled with each dilution and measured with 20% LED power at high MST power. Manufacture’s software NT. Analysis was used for analysis and the data was replotted in GraphPad Prism 8.2.1. The change in thermophoresis on the y axis is expressed as the change in the normalized fluorescence (∆Fnorm) of labeled NPTX1 defined as Fhot / Fcold(bound / unbound state) vs. AMIGO2 concentration. For the negative control EGFR, same preparation of NPTX1 was performed. EGFR (Abcam, ab219220) was buffer exchange into the working buffer following the same protocol as for AMIGO2. The highest concentration tested was 0.4 µM. Site directed mutagenesis

[0160] FLAG-AMIGO2, S641E, S643E, and S641E / 643E HIF1a constructs were synthesized with Q5 Site-directed mutagenesis kit (NEB, E0554) per the manufacture’s protocol in pDONR223 backbone (Dharmacon, #OHS6084-202637881(AMIGO2) and OHS6084- 202635107). Subsequently, the synthesized plasmids were treated with LR clonase (Invitrogen, #11791020) to catalyze the recombination from the donor vector to the destination vector,2022-028 plx304 (Addgene, #25890). Lentivirus production and transduction were performed in the way described above (please refer supplementary table for the primer sequence). Hypoxia reporter assay

[0161] Firefly luciferase expressing PANC1 LM3 cells with the corresponding construct were transduced with the hypoxia reporter lentivirus (Gentarget, #LVP972-R-PBS) per the manufacture’s protocol. The transduced cells were sorted by FACS in the previously described manner (Yamaguchi et al., 2019). These cells were seeded at 1000 cells / well of 96 well plate and were incubated for 72 hours under hypoxia. Dual Luc reporter assay was performed per the manufacture’s protocol (Promega, #E2920). Enzyme-linked immunosorbent assay (ELISA)

[0162] ELISA plate (Thermo Scientific, #80040LE 0910) was coated with the capture NPTX1 antibody (Tri-I TDI, 1B1) at 10ug / ml in a coating buffer (Bio-Rad, #buf030a) overnight at 4℃. Following to an iterative wash with PBS, the plate was blocked with a blocking solution (Bio- Rad, #buf033a) overnight at 4℃. Following an iterative wash with PBS, recombinant NPTX1 standards and the samples were added to the corresponding wells in at least triplicate manner. The plate was incubated at 37℃ for 2 hours. Following an iterative wash with PBS, the detection antibody diluted at 1:5000 (Abcam, 191201) was added to each well and the plate was incubated at 37℃ for 2 hours. Following an iterative wash with PBS, the conjugated secondary antibody (Invitrogen, #611620) diluted at 1:5000 and the plate was incubated for 40min at 37℃. Following an iterative wash with PBS, TMB substrate (Abcam, #ab171522) was added to each well and the plate was incubated at 37℃ for 10-30min. The optical density was read at 450nm following the addition of stopping solution (2M H2SO4). TCGA dataset analysis

[0163] Raw counts for pancreas adenocarcinoma transcriptomic profiling from TCGA were downloaded using the TCGAbiolinks package in R (https: / / bioconductor.org / packages / release / bioc / html / TCGAbiolinks.html) (Colaprico et al., 2016; Mounir et al., 2019; Silva et al., 2016). Raw counts were subsequently normalized with the median of ratio method using the estimateSizeFactors function in DESeq2 and the top and bottom 10 samples with regards to NPTX1 expression were selected for final visualization. Prior to filtering, raw count data was transformed with variance stabilizing transformation using the vst2022-028 function in DESeq2 and z-scores for each transcript calculated across all samples relative to the median transformed count across all pancreas cancer samples. Clinical data were downloaded from (https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC6066282 / bin / NIHMS978596-supplement- 1.xlsx) (Liu et al., 2018). A total of 185 PDAC patients data were retrieved and have been analyzed.

[0164] NPTX1 expression levels were extracted and underwent z-score transformation by using the following equation: Z-score = (normalized RSEM value – average of normalized RSEM value in normal tissue) / standard deviation of normalized RSEM value in normal tissue. Patients were stratified along the median. Kaplan-Meier survival curves were drawn with the surminer R package (https: / / CRAN.R-project.org / package=survminer). Significance was evaluated by using the log rank test. Hypoxia qPCR array

[0165] Ex vivo liver tumors were surgically resected and the contaminated mice cells were eliminated from the resulting single cell suspension as per previously documented (Yamaguchi et al., 2019). RNA was extracted using the Total RNA Purification Kit (Norgen Biotek) and DNAse treated using the RNase-Free DNase I kit (Norgen Biotek). The manufacture’s protocol (Qiagen, #330231) has been followed in the rest of procedure. NPTX1 mRNA Expression in End Stage Pancreatic Ductal Adenocarcinoma

[0166] One hundred and twenty-five primary pancreatic ductal adenocarcinoma (PDAC) and forty-six liver metastasis samples from 27 patients are obtained through Last Wish Program (LWP) at Memorial Sloan Kettering Cancer Center (MSKCC). RNA sequencing (RNA-seq) was done as previously described (Hayashi et al., 2020). To explain it briefly, frozen sections were cut from samples for histological review and regions of interest were macro-dissected for extracting total RNA using TRIzol (Life Technologies) followed by Rneasy Plus Mini Kit (Qiagen). Total RNA LT kit (Illumina, RS-122-1202) according to instructions provided by the manufacturer with eight cycles of PCR. Samples were barcoded and run on a HiSeq 4000 using the HiSeq 3000 / 4000 SBS kit (Illumina). Output data (FASTQ files) were mapped to the target genome using the rnaStar aligner and postprocessing of the output SAM files was performed using PICARD tools to add read groups and convert to a compressed BAM format. The expression count matrix from the mapped reads was determined using HTSeq2022-028 (https: / / htseq.readthedocs.io / en / release_0.11.1) and the raw count matrix generated by HTSeq was processed using the R / Bioconductor package DESeq2 (http: / / bioconductor.org / packages / release / bioc / html / DESeq2.html) to normalize the entire dataset between sample groups. Log2-transformated data were used as a normalized expression including NPTX1. Histology

[0167] Tumor or organ samples were freshly surgically resected and have been fixed with 4% paraformaldehyde at 4°C for 24 hours. The samples were washed once with PBS and were soaked in 70% ethanol. The fixed xenografts samples were embedded in paraffin, sectioned, and stained with H and E (Histoserv, Inc., Germantown, MD). NPTX1 Immunohistochemistry

[0168] Representative fourteen primary and twelve liver metastasis sections were obtained from 12 LWP PDAC cases and used for NPTX1 immunohistochemistry. Immunohistochemistry of NPTX1 was performed for 25 number of slides. To perform IHC, we sectioned 5um slides from formalin-fixed paraffin-embedded (FFPE) blocks. Slides were then deparaffinized, hydrated, and stained with Dako IHC products (Agilent Technologies, Inc., Santa Clara, CA). Primary antibody, (NPTX1 mAb, 1B1) was diluted at (1:1000 and 1:2000) that we prepared as recommended by Dako antibody diluent (Agilent, #S0809). The primary antibody staining was tested with positive control tissue (PANC1 LM3 liver metastatic foci) and a negative control (no primary antibody control) was included. Slides were placed on a heat block at 70°C for 15 minutes for deparaffinization and were rehydrated with 5 minute xylene and 2 minute ethanol washes and transferred to deionized water. The slides were placed into a pre-heated Target Retrieval Solution (TRS) (Agilent, #S2369), steamed for 25 minutes and cooled for 20 minutes. Next, the slides were washed with Dako wash buffer (WB) (Agilent, #S3006) and Dako Dual Endogenous Enzyme block (Agilent, #S200389) was applied cover the tissue for 20 minutes at room temperature. The diluted primary antibody (1:1000 and 1:2000) is applied to washed slides for overnight at 4°C incubation. Slides were washed with WB and incubated with Dako Labelled Polymer Horseradish Peroxidase (HRP) containing the proprietary secondary antibody for 20 minutes at room temperature. Slides were rinsed with fresh WB. Dako 3,3'- Diaminobenzidine (DAB) diluted in Dako DAB buffer (Agilent, #GV800) is applied to tissues2022-028 for 5 min. After a quick water rinse, slides were counterstained with hematoxylin. The slides are washed again before dehydrating with 2 minute ethanol and 5 minute xylene washes. The dried slides were then cover slipped and assessed by pathologists.

[0169] IHC scores (range 0-300) for NPTX1 were obtained as a sum of multiplication of positive staining intensity score (0-3) by its 5% increment proportion score (0%, 5%, 10%....100%). IHC scores were assessed by two pathologists who are experts for pancreatic cancer (C.A.I-D. and A.H.). Immunofluorescence

[0170] Liver metastatic tumors were excised and fixed in 4% paraformaldehyde at 4°C for 24 hours. Fixed tumors were embedded in paraffin and sectioned in 5μm thick slices. Sections were dewaxed and rehydrated by incubation with xylene and descending ethanol concentrations. Antigen retrieval was performed by microwaving samples in citrate buffer (C9999, Sigma) for 30 minutes. Samples were blocked by incubation with 5 % goat serum and 0.1% saponin in PBST (PBS with 0.1 % Tween-20) for one hour. Coverslips with growing cancer cells were washed once with PBS, and subsequently the cells were fixed in 4% paraformaldehyde for 15min at room temperature. Coverslips were washed three times with PBS and the cells were blocked by incubation with 5 % goat serum and 0.1% saponin in for one hour. Immunostaining for HIF1a and Ki-67 was carried out with an incubation for 1.5 hours at room temperature using HIF1a antibody (Proteintech, #20960-1-AP) diluted at 1:100 and Ki-67 antibody (Abcam, #ab15580) diluted at 1: 200 in with 1% BSA and 0.1% saponin in PBST. Slides were washed three times with PBS and stained with AF555-conjugated anti-rabbit antibody diluted at 1:200 for 1 hour. Slides were mounted with Prolong Gold with DAPI (ThermoFisher, #P36931)). Three sections per tumor were analyzed and averaged. Samples stained with an isotype control antibody served as negative controls. Images were acquired using an Axioplan 2 imaging upright microscope (Zeiss). The analysis was done with Fiji (Ver.2.00)(Schindelin et al., 2012). MTS cell viability assay

[0171] Cancer cells were seeded at 1000 cells / a well of 96 well plate a day before the exposure to hypoxia for 4 days (0.5% O2). Upon the completion of hypoxia exposure, the MTS reagent was added and the absorbance was measured at OD=490nm by a plate reader (BioTek Instruments, Synergy Neo) per the manufacture’s protocol.2022-028 Quantitative real-time PCR (qPCR)

[0172] Total RNA from cells cultured in triplicates was isolated with the Total RNA Purification Kit (Norgen Biotek, #17200). The Verso cDNA Synthesis Kit (ThermoFisher, #AB1453A) was used to reverse-transcribe 600 ng of total RNA into cDNA according to the manufacturer’s instructions using random hexamers. Subsequently, quantitative real-time PCR was performed using Fast SYBR Green Master Mix (Applied Biosystems, #4385612) and an Applied Biosystems 7900HT system. Expression of target genes was normalized to 18s expression for each sample. Please refer to the supplementary table for primer sequences. Data Analysis

[0173] Significance of tumor growth curve comparisons was carried out using unpaired Student’s t test. The Mantel-Cox log-rank test was used for statistical comparisons in survival analyses. All other statistical comparisons were carried out using Student’s t-test where the assumption of normality is appropriate while the non-parametric Mann-Whitney test was used to test the difference of mean which do not follow normal distribution. Statistical test used and the number of included samples were shown in each figure captions. No samples were omitted throughout the analysis. The sample size was empirically determined to achieve a statistical power. Throughout all figures: *p < 0.05, **p < 0.01, and ***p < 0.001, ****p < 0.0001. Significance was concluded at p < 0.05. TABLE 3 Sequence Descriptions SEQ ID NO: Type Description 1 Amino Acid VH4VK8 HC 2 Amino Acid VH4VK8 LC 3 Amino Acid VH4VK6 HC 4 Amino Acid VH4VK6 LC 5 Amino Acid VH0 humanized 6 Amino Acid VH1 humanized 7 Amino Acid VH2 humanized 8 Amino Acid VH3 humanized 9 Amino Acid VH4 humanized 10 Amino Acid VK0 humanized 11 Amino Acid VK1 humanized2022-028 Amino Acid VK2 humanized Amino Acid VK3 humanized Amino Acid VK4 humanized Amino Acid VK5 humanized Amino Acid VK6 humanized Amino Acid VK7 humanized Amino Acid VK8 humanized Amino Acid ROCK1555_VH0 Amino Acid ROCK1555_VH1 Amino Acid ROCK1555_VH2 Amino Acid ROCK1555_VH3 Amino Acid ROCK1555_VH4 Amino Acid ROCK1555_VK0 Amino Acid ROCK1555_VK1 Amino Acid ROCK1555_VK2 Amino Acid ROCK1555_VK3 Amino Acid ROCK1555_VK4 Amino Acid ROCK1555_VK5 Amino Acid ROCK1555_VK6 Amino Acid ROCK1555_VK7 Amino Acid ROCK1555_VK8 Amino Acid CDRH1 Amino Acid CDRH2 Amino Acid CDRH3 Amino Acid CDRL1 Amino Acid CDRL2 Amino Acid CDRL2 VK7 Amino Acid CDRL2 VK8 Amino Acid CDRL3 Nucleic Acid scFv VL-Linker-VH B002_P1_PH1B1 Nucleotide Amino Acid scFv VL-Linker-VH B002_P1_PH1B1 Protein Nucleic Acid B002_31B01_VK Hybridoma Nucleotide Amino Acid B002_31B01_VK Hybridoma Protein Nucleic Acid B002_31B01_VH Hybridoma Nucleotide2022-028 Amino Acid B002_31B01_VH Hybridoma Amino Acid NPTX1_HUMAN Nucleic Acid NPTX1 Human Nucleic Acid NPTX1 Human mRNA Amino Acid Potential Epitope on NPTX1 of Disclosed Antibodies Amino Acid Potential Epitope on NPTX1 of Disclosed Antibodies Amino Acid Potential Epitope on NPTX1 of Disclosed Antibodies Amino Acid Potential Epitope on NPTX1 of Disclosed Antibodies Amino Acid VH 1B1 Amino Acid VK 1B1 Nucleic Acid sgCTRL (CRISPRi) Nucleic Acid sgNPTX1_1 (CRISPRi) Nucleic Acid sgNPTX1_7 (CRISPRi) Nucleic Acid shNPTX1_1 Nucleic Acid shNPTX1_3 Nucleic Acid shNPTX1_4 Nucleic Acid shNPTX1_5 Nucleic Acid shNptx1_c Nucleic Acid shNptx1_d Nucleic Acid sgNPTX11 (CRISPR comp assay) Nucleic Acid sgNPTX12 (CRISPR comp assay) Nucleic Acid sgNPTX13 (CRISPR comp assay) Nucleic Acid sgNPTX14 (CRISPR comp assay) Nucleic Acid sgNPTX15 (CRISPR comp assay) Nucleic Acid sgCTRL1 (CRISPR comp assay) Nucleic Acid sgCTRL2 (CRISPR comp assay) Nucleic Acid sgCTRL3 (CRISPR comp assay) Nucleic Acid sgCTRL4 (CRISPR comp assay) Nucleic Acid sgCTRL5 (CRISPR comp assay) Nucleic Acid NPTX1 fwd primer (copy number) Nucleic Acid NPTX1 rev primer (copy number) Nucleic Acid GAPDH fwd primer (copy number) Nucleic Acid GAPDH rev primer (copy number) Nucleic Acid NPTX1 fwd primer (mRNA quantification)2022-028 Nucleic Acid NPTX1 rev primer (mRNA quantification) Nucleic Acid GAPDH fwd primer (mRNA quantification) Nucleic Acid GAPDH rev primer (mRNA quantification) Nucleic Acid Nptx1 fwd primer (mRNA quantification) Nucleic Acid Nptx1 rev primer (mRNA quantification) Nucleic Acid Gapdh fwd primer (mRNA quantification) Nucleic Acid Gapdh rev primer (mRNA quantification) Nucleic Acid FLAG-AMIGO2 fwd primer (mutagenesis) Nucleic Acid FLAG-AMIGO2 rev primer (mutagenesis) Nucleic Acid HIF1a S641E fwd primer (mutagenesis) Nucleic Acid HIF1a S641E rev primer (mutagenesis) Nucleic Acid HIF1a S643E rev primer (mutagenesis) Nucleic Acid HIF1a S643E fwd primer (mutagenesis) Nucleic Acid HIF1a S641E / S643E fwd primer (mutagenesis) Nucleic Acid HIF1a S641E / S643E rev primer (mutagenesis)

Claims

2022-028 WHAT IS CLAIMED IS:

1. An isolated antibody or antigen binding fragment thereof, wherein the antibody or antigen binding fragment thereof: (i) binds to neuronal pentraxin 1 (NPTX1) and inhibits the binding of NPTX1 to adhesion molecule with Ig like domain 2 (AMIGO2); (ii) comprises: (a) heavy chain variable domain selected from the group consisting of: a heavy chain variable domain comprising a complementarity determining region (CDR) 1-H comprising the amino acid sequence RYWMS (SEQ ID NO: 33) or a functional variant thereof; a CDR2-H comprising the amino acid sequence EINPDGSTINYTPSLKD (SEQ ID NO: 34) or a functional variant thereof; and a CDR3-H comprising the amino acid sequence GPYPYAMDY (SEQ ID NO: 35) or a functional variant thereof; (b) a light chain variable domain selected from the group consisting of: a light chain variable domain comprising a CDR1-L comprising the amino acid sequence KASQSVTNDVA (SEQ ID NO: 36) or a functional variant thereof; a CDR2-L comprising the amino acid sequence SASNRFT (SEQ ID NO: 37), GASNRFT (SEQ ID NO: 38), DASNRFT (SEQ ID NO: 39), or a functional variant thereof; and a CDR3-L comprising the amino acid sequence QQDYISPFT (SEQ ID NO: 40) or a functional variant thereof.

2. The isolated antibody or antigen-binding fragment thereof according to claim 1, comprising: (a) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 3 (VH4 / VK6), and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 4 (VH4 / VK6); (b) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 1 (VH4 / VK8), and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 2 (VH4 / VK8);2022-028 (c) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 19 (VH0 / VK0), and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 24 (VH0 / VK0); (d) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 23 (VH3 / VK6) and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 30; (e) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 23 (VH3 / VK7), and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO:31; (f) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 23 (VH3 / VK8), and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 32 and / or (g) a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 23(VH4 / VK7), and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO:

31.

3. The isolated antibody or antigen binding fragment thereof of claim 1 or claim 2, wherein the antibody is a humanized antibody.

4. The isolated antibody or antigen binding fragment thereof of any one of the previous claims, comprising a heavy chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 3; and a light chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 4.2022-028 5. The isolated antibody or antigen binding fragment thereof of any one of the previous claims, comprising a heavy chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 1; and a light chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO:

2.

6. An isolated nucleic acid encoding an immunoglobulin chain or variable region thereof of the antibody according to any one of the previous claims.

7. A vector comprising the isolated nucleic acid of claim 6.

8. A host cell comprising the isolated nucleic acid of claim 6 or the vector of claim 7.

9. The host cell of claim 8, wherein the host cell is a Expi 293 cell.

10. A method for making an antibody or antigen-binding fragment thereof according to any one of claims 1-5 or an immunoglobulin chain thereof, comprising: (a) introducing one or more nucleic acids encoding an immunoglobulin chain of antibody or antigen-binding fragment thereof into a host cell; (b) culturing the host cell in a medium to express the immunoglobulin chain(s); and (c) optionally, isolating the immunoglobulin chain or antibody or antigen-binding fragment thereof from the host cell and / or the medium.

11. The method of claim 10, wherein the host cell is a Expi 293 cell.

12. A pharmaceutical composition comprising an antibody or antigen-binding fragment thereof according to any one of claims 1-5 and a pharmaceutically acceptable carrier.

13. An isolated antibody or antigen binding fragment thereof, wherein: (i) the antibody or antigen binding fragment thereof binds to neuronal pentraxin 1 (NPTX1);2022-028 (ii) the antibody or antigen binding fragment thereof comprises: (a) heavy chain variable domain selected from the group consisting of: a heavy chain variable domain comprising a complementarity determining region (CDR) 1-H comprising the amino acid sequence RYWMS (SEQ ID NO: 33) or a functional variant thereof ; a CDR2-H comprising the amino acid sequence EINPDGSTINYTPSLKD (SEQ ID NO: 34) or a functional variant thereof; and a CDR3-H comprising the amino acid sequence GPYPYAMDY (SEQ ID NO: 35) or a functional variant thereof; (b) a light chain variable domain selected from the group consisting of: a light chain variable domain comprising a CDR1-L comprising the amino acid sequence KASQSVTNDVA (SEQ ID NO: 36) or a functional variant thereof; a CDR2-L comprising the amino acid sequence SASNRFT (SEQ ID NO: 37), GASNRFT (SEQ ID NO: 38), DASNRFT (SEQ ID NO: 39), or a functional variant thereof; and a CDR3-L comprising the amino acid sequence QQDYISPFT (SEQ ID NO: 40) or a functional variant thereof.

14. The isolated antibody or antigen-binding fragment thereof according to claim 13, wherein the isolated antibody or antigen binding fragment thereof is a biomarker.

15. The isolated antibody or antigen-binding fragment thereof according to claim 13 or 14, comprising: a heavy chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO: 55; and a light chain variable domain comprising an amino acid sequence having at least 90% identity to the amino acid sequence as set forth in SEQ ID NO:

54.

16. The isolated antibody or antigen binding fragment thereof of any one of claims 13-15, comprising a heavy chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 55; and a light chain variable domain comprising an amino acid sequence as set forth in SEQ ID NO: 54.2022-028 17. The isolated antibody or antigen binding fragment thereof of any one of claims 13-16, wherein the antibody is a humanized antibody.

18. A method of detecting pancreatic ductal adenocarcinoma in a subject, the method comprising: (1) contacting a biological sample from the subject with the antibody or antigen-binding fragment thereof as described in any one of claims 13-17; (2) comparing the level of the antibody or antigen-binding fragment with a baseline level of the antibody or antigen-binding fragment of a control sample, wherein a difference between the level of the pancreatic cancer biomarker derived from said subject and the pancreatic cancer biomarker in the control sample is an indication that the subject is afflicted with pancreatic cancer.

19. A kit comprising the antibody or antigen-binding fragment thereof of any one of claims 1-5 or 13-18; the isolated nucleic acid of claim 6; the vector of claim 7, the host cell of claim 8, and / or the pharmaceutical composition of claim 12.

Citation Information

Patent Citations

  • Biomarkers of cognitive dysfunction

    US20190353668A1

  • Site-specific antibody conjugation methods and compositions

    WO2015031698A1

  • Humanized antibodies against CD269 (BCMA)

    WO2015166073A1